COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..64674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1345..2670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(2782..4923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(4935..5735) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(5751..6755) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(7023..7694) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(7806..8576) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(8663..10162) product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(10149..11270) product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(11307..12659) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(12932..13519) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(13534..14553) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051638.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 assembly_gap 14584..14683 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14709..15374) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene grpE CDS complement(15374..17263) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051640.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene dnaK CDS complement(17511..22670) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene pulA CDS 22981..24006 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(24051..24815) product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(24925..25734) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(25727..27733) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene pulA CDS complement(27878..28804) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(28801..30201) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(30224..31468) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 31868..33649 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 33894..36098 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene malQ CDS complement(36413..37372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(37442..38086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(38243..39928) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(40034..44059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(44184..44450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 45154..46179 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051648.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 46450..48264 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(48523..49575) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051650.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene ilvC CDS 50439..51005 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392649.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 51002..51736 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 51733..52326 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(52473..53525) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811512.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene ilvC CDS complement(53862..55229) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582327.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(55755..56798) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068530.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(56862..58499) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068531.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(58696..60033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(60056..61582) product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene gtfA CDS complement(61920..62186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(62183..62350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(62525..62896) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(62896..63669) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 misc_feature complement(63737..>64674) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008783481.1:adenylosuccinate synthase locus_tag LOCUS_00450 sequence002 source 1..55535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 102..176 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 307..597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(1263..1619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 assembly_gap 1593..1602 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1742..3019) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068433.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(3208..4224) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 4628..4822 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene rpmB CDS 4922..7756 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 7883..8089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 7983..8591 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582362.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene rsmD CDS 8596..9528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 assembly_gap 9671..9680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9744..10676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 10995..11891 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(12093..12908) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054789.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene trmD CDS 12982..14628 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582363.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 14707..15687 product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 15767..16642 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068426.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 16652..17329 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 17477..19054 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 19169..20515 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 20773..21906 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 22034..23266 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 23390..24103 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene mtnN CDS 24376..25689 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 25778..27151 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 27350..28054 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 28293..29426 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene pstS CDS 29637..30590 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene pstC CDS 30590..31588 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782854.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene pstA CDS 31641..32420 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051433.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene pstB CDS complement(32520..32762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 32835..33413 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 33477..35747 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068420.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 35907..37739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 assembly_gap 37535..37550 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 37621..39924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 40028..40501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 note possible pseudo, frameshifted CDS 40643..40885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 41200..41370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 41578..42441 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 42539..43594 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(43487..43780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(43908..45260) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(45566..46180) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene rimM CDS complement(46203..46436) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(46457..46918) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054806.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene rpsP CDS complement(47133..48242) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(48319..50067) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527326.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene ffh CDS 50277..51185 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055692.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(51205..52863) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene cysS CDS 53073..53801 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 sequence003 source 1..52152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(919..2733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 note possible pseudo, frameshifted assembly_gap 997..1006 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2730..4808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 note possible pseudo, frameshifted CDS complement(4825..7005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 note possible pseudo, frameshifted assembly_gap 4833..4842 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7133..8554 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057781.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 8721..14705 product tandem-95 repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 14716..16089 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 16114..17337 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 17334..19847 product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 19844..20776 product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 20803..21423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816173.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 21439..22062 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(22255..24021) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226836178.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(24423..25916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 26216..27589 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(27605..28486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(28684..29169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(29175..29576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(30301..33507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 33634..34728 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(34684..35886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(35883..36539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(36619..36933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(37040..37333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(37492..38046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(38043..41078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 note possible pseudo, internal stop codon assembly_gap 40331..40340 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41142..42641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(42960..43844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(43866..49043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 assembly_gap 48855..48864 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(49043..49666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(49663..50514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(50556..50786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 note possible pseudo, frameshifted assembly_gap 50585..50594 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(50848..51360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 note possible pseudo, frameshifted assembly_gap 50909..50918 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(51558..>52152) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051319.1:DNA-directed RNA polymerase subunit beta' locus_tag LOCUS_01260 sequence004 source 1..50861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(436..1530) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 1633..2346 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 2346..3668 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(3670..4662) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068610.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene nrdF CDS complement(4887..7082) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene nrdE CDS complement(7094..7552) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783041.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene nrdI CDS complement(7549..7815) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(8224..8781) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775404.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(8774..11212) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(11548..14505) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 14884..16971 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 17108..18085 product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054647.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 tRNA 18216..18290 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 18609..20066 product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 20099..21022 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rsmA CDS 21019..21969 product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 22016..22645 product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(22730..24145) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 24232..25512 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170114949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 25584..27752 product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 27749..31576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 31696..32715 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(33092..34453) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068597.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(34453..35424) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(35675..36340) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene rsmG CDS complement(36489..37022) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051772.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(37145..38152) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051771.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene yidC CDS complement(38463..38744) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene rnpA CDS complement(38855..38989) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene rpmH CDS 39308..40810 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene dnaA CDS 41545..42669 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene dnaN CDS 42697..43467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 note possible pseudo, frameshifted assembly_gap 43447..43456 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 43499..43954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 note possible pseudo, frameshifted CDS 43951..44421 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783054.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 44602..46692 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361534.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene gyrB CDS 46760..49411 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068593.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene gyrA CDS 49481..50047 product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051760.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 50566..50775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 sequence005 source 1..37649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 373..1113 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene pyrH CDS 1190..1741 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene frr CDS 1764..2330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 note possible pseudo, internal stop codon CDS 2352..2750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 note possible pseudo, internal stop codon CDS 2925..4094 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068098.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene rlmN CDS complement(4095..4643) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 4818..5588 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene hisF CDS 5722..6117 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene hisI CDS 6198..7754 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene trpE CDS complement(7819..8031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(8010..8489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 8642..10243 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 10262..10951 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 11022..11276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 note possible pseudo, frameshifted CDS complement(11445..12116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(12113..12862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(12763..13176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(13176..13823) product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054303.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 14023..15636 product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 15633..16307 product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 assembly_gap 16402..16411 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16446..19868 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 20064..23099 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene uvrA CDS 23245..25611 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene uvrC CDS 25720..26691 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 26691..27677 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene rapZ CDS 27876..28826 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene whiA CDS 28995..30200 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032737730.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 30258..31061 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052784.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene tpiA CDS 31125..31373 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829342.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene secG CDS 31475..31840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 note possible pseudo, frameshifted assembly_gap 31757..31766 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31783..32436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 note possible pseudo, frameshifted CDS 32433..33284 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054292.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 33395..33985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 note possible pseudo, frameshifted assembly_gap 33869..33878 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33895..34941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 note possible pseudo, frameshifted CDS 34945..35400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 assembly_gap 35180..35189 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35582..36691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056804.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(36862..37326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 sequence006 source 1..34430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(323..511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(632..1720) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene fbaA CDS 1954..2814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 tRNA complement(2815..2888) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(3045..5564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(5725..6645) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene htpX CDS complement(6816..8267) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068540.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 8509..9198 product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 note possible pseudo, internal stop codon, frameshifted CDS complement(9326..11629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(11841..13517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(13411..13947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(13955..14650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 note possible pseudo, internal stop codon, frameshifted CDS complement(14716..14892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 note possible pseudo, internal stop codon, frameshifted CDS complement(14983..16305) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(16676..17290) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207760114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(17377..19653) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068542.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(20063..22096) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 22513..23841 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051676.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene tgt assembly_gap 23228..23237 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 24013..24096 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 24170..24391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(24421..24936) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(25018..25350) product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051681.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(25408..27132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(27203..27586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(27849..28442) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(28445..29419) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055903.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene msrB CDS complement(29416..29649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(29795..32479) product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(32476..33714) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(33642..34022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 assembly_gap 33791..33800 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence007 source 1..33574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2242 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068577.1:phosphoenolpyruvate carboxylase locus_tag LOCUS_02300 CDS complement(2466..3464) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(3778..4803) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(4889..6367) product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582926.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(6410..7762) product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(7827..8657) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(8664..9533) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(9633..10970) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(11784..11975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(12379..12759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(12879..14768) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(14891..15457) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene ahpC CDS 15727..16410 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 16501..16926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 17208..18194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 note possible pseudo, internal stop codon, frameshifted CDS 18234..19169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 note possible pseudo, internal stop codon, frameshifted CDS complement(19208..19492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 19382..20725 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 20822..21301 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051742.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 21536..22849 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(22862..23185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(23166..23489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(23857..25404) product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(25602..27845) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(28326..29240) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 29380..30666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 note possible pseudo, frameshifted CDS 30737..31084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 tRNA 31285..31359 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 31401..31474 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 31632..31883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 31977..32567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 32527..32781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(32872..33153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(33150..33512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 sequence008 source 1..30960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(996..1838) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 assembly_gap 1903..2002 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2184..3209) product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054721.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(3206..4744) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056756.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene zwf tRNA 4920..4993 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 5192..6499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(6496..7290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 7436..7684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 7700..8026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 8148..9401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(9403..10671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(11354..12355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(12394..12855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 13449..15083 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(15157..16191) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(16215..17036) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054725.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 17159..18430 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene ftsY CDS 18737..20032 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 20034..20372 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 20516..22306 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058100.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(22340..23773) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 24061..25521 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054729.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene dnaB CDS 25521..26993 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 27094..27846 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 27995..28282 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054731.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 28279..30099 product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 misc_feature complement(30114..>30960) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054733.1:LacI family DNA-binding transcriptional regulator locus_tag LOCUS_02870 sequence009 source 1..28284 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..1644 product PIF1 family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 2156..3463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 note possible pseudo, frameshifted CDS 3698..4486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 note possible pseudo, frameshifted assembly_gap 4403..4412 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4464..4643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 note possible pseudo, frameshifted CDS complement(4668..5294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 5445..7229 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055676.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 7505..8242 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(8325..10499) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 10676..11656 product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 11937..14417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 14616..14849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(14914..15888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 16339..16584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 16994..17197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 17283..18065 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene map CDS 18503..19576 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 note possible pseudo, frameshifted CDS complement(19789..20808) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene dapD CDS complement(21041..22126) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052464.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 22204..26388 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(26597..26902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 27057..27491 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055942.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 misc_feature complement(27522..>28284) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053899.1:Gfo/Idh/MocA family oxidoreductase locus_tag LOCUS_03090 sequence010 source 1..27990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..506 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051809.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC locus_tag LOCUS_03100 CDS 729..2141 product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(2248..3240) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene rlmB CDS 3328..4626 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 4714..5535 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 5718..8705 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(8943..10619) product FIVAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(10682..11263) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051821.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene dcd CDS 11916..12506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 12625..12837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 note possible pseudo, frameshifted CDS 12924..13382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 note possible pseudo, frameshifted CDS complement(13576..15648) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 15788..16219 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056534.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 16339..18645 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 assembly_gap 18712..18721 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18766..19974) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 20148..21437 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 21459..22400 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 22418..23284 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 23488..25308 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 25557..26822 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene ilvA CDS complement(26968..27723) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 sequence011 source 1..27964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 504..701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(742..1449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582922.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(1415..1654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 1678..2745 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene nusA CDS 3015..5942 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene infB CDS 6093..6569 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052308.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene rbfA CDS 6571..7734 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 7833..8957 product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(8972..10510) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 10638..11192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052313.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(11704..12402) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene rpiA CDS complement(12533..13369) product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081966502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 14015..14167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(14326..15960) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(16114..16536) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 16769..17866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(18600..20276) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene pgm CDS complement(20363..21808) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 21696..21947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 assembly_gap 22012..22021 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22420..24774 product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 24792..25631 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(25636..26817) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 sequence012 source 1..26328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..697 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068009.1:aldose 1-epimerase family protein locus_tag LOCUS_03540 CDS complement(964..1284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054435.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(1284..2072) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057260.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 2211..3764 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054433.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 3886..4881 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(5000..8677) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068006.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene smc CDS complement(8738..10357) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 11918..12523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 12827..14422 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 14471..14992 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(15042..16751) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(16755..17924) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(17926..19017) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052566.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(19183..20817) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(21099..22487) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067999.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(22544..23356) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene nagB CDS 23694..24818 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(24958..25200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 sequence013 source 1..24981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..857 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(846..1607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(1709..2065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(2082..4289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 assembly_gap 2941..2950 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4295..6370) product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101626140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(6533..6814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(6818..7204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(7201..7623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(7635..8015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(8012..8344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(8347..9954) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068455.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(9951..11084) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068454.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(11186..12625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072725739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(12615..12926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(13094..13819) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068451.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(13816..14007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(14016..14384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(14384..14692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(15134..15316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(15425..15565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 assembly_gap 15581..15590 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15659..15871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(15858..16040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 16164..16838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(16759..17046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 tRNA complement(17686..17762) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 17978..19012 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene metA CDS 19314..20126 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene atpB CDS 20230..20457 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene atpE CDS 20514..21032 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 21067..21903 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 21979..23607 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene atpA CDS 23611..24534 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 sequence014 source 1..23379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 794..1339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 1225..2265 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015512063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 2342..3274 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053078.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 3368..4621 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(4670..5995) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene murA CDS 6245..7591 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(7797..8924) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068709.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(8964..9968) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225431769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 10549..10740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(10963..11655) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene leuD CDS complement(11740..13143) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene leuC CDS 13461..14237 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(14473..15876) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068707.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 16351..18588 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068706.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 18758..19945 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507753.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 19935..20756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(21216..23195) product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 sequence015 source 1..23193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 assembly_gap 644..653 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 919..1158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 1426..2358 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 2378..3361 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776935.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 3267..4580 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 4577..4810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 assembly_gap 4598..4607 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4786..5481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 5542..6243 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(6287..8560) product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(8704..9786) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055156.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 9991..10653 product DUF4192 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 10856..12184 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 12242..14560 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 14923..16149 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 16223..16729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 note possible pseudo, frameshifted CDS 16629..17186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 note possible pseudo, frameshifted CDS 17202..21935 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(21946..22734) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 sequence016 source 1..23022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(64..261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 180..1109 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 1106..2146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 note possible pseudo, frameshifted assembly_gap 2113..2122 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2152..2505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 note possible pseudo, frameshifted CDS complement(2636..4501) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 4795..5772 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(5841..7169) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813466.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(7291..8340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 8485..8715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 8717..9163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 assembly_gap 9299..9308 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9452..10396) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 10503..11708 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene dapE CDS 12022..15177 product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582944.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 15329..15637 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene rplU CDS 15660..15908 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rpmA CDS 15978..17669 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene obgE CDS 17670..18803 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene proB CDS 18894..20099 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055070.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 tRNA 20230..20305 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 20338..20565 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene secE CDS 20589..21401 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene nusG CDS 21702..22133 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene rplK CDS 22149..22841 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene rplA sequence017 source 1..22408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 670..1161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 tRNA complement(1127..1202) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(1249..1323) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(1548..2561) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068781.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene galE CDS 2890..3750 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene trmB tRNA 3820..3893 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 4444..4695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 4708..4956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 5150..6361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 6358..6807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 6912..7748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 7872..8279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 8414..8671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(10151..10915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068694.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(10908..12338) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 12744..15617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 note possible pseudo, internal stop codon CDS 15633..17039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 note possible pseudo, internal stop codon assembly_gap 17717..17726 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17785..18306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(18260..18907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(18974..19675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 19971..20177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 20197..21042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 21081..21461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 sequence018 source 1..21757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 794..1447 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053234.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 1578..4010 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 4082..4387 product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(4486..4851) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053231.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 4961..5551 product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 5977..6396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(6521..7507) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 7807..9264 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(9592..10971) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(11054..13621) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(13755..14828) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(14894..15136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(15126..15353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(15519..18836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(18903..19442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(19585..20145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 note possible pseudo, frameshifted CDS complement(20045..21127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 note possible pseudo, frameshifted misc_feature complement(21216..>21757) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067917.1:ABC transporter permease subunit locus_tag LOCUS_04970 sequence019 source 1..21724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 870..1451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(1521..1754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 1875..2525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 3604..3780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 4067..4354 product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051627.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 4351..4737 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 4779..5165 product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 5213..6343 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(6541..7140) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051623.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 7336..9954 product DNA polymerase III subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 repeat_region 9736..10022 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatccgtggaatcagccgca CDS 10078..10227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 note possible pseudo, internal stop codon, frameshifted CDS 10253..10855 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene recR CDS complement(10865..11986) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 12702..13466 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 13546..14088 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(14169..15263) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051614.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene asd assembly_gap 15356..15365 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15462..16082 product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 16553..18748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 18839..20305 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170114992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 assembly_gap 20601..20610 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence020 source 1..20775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1052 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065453223.1:2-isopropylmalate synthase locus_tag LOCUS_05170 CDS complement(1120..3543) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 3920..5071 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 5195..8281 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene topA CDS 8517..9218 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene tmk CDS 9215..10444 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068508.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 assembly_gap 10333..10342 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10491..11045 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 11308..12909 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 13028..14545 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068506.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(14942..15289) product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 15490..16026 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051598.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(16072..17523) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054697.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 17763..18422 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 18553..19467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 misc_feature complement(19744..>20775) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068502.1:DUF805 domain-containing protein locus_tag LOCUS_05310 sequence021 source 1..20768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..1197) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057860.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(1324..2163) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(2281..3138) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene lepB CDS complement(3305..3670) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene rplS CDS 4414..6204 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 6223..7632 product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(7939..9636) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene pgi tRNA 9927..10000 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 10087..10169 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 10360..11361 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(11444..12724) product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(12774..13673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 note possible pseudo, frameshifted CDS complement(13673..14041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 note possible pseudo, frameshifted CDS complement(14115..15383) product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 tRNA 15590..15663 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(15829..16488) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 assembly_gap 16525..16534 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16610..17386) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene rph CDS complement(17640..18962) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 19204..19818 product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582373.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(19886..20317) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 sequence022 source 1..20744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(900..1445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(1454..1915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(2014..2307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(2672..4330) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(4327..4761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(4758..5066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(5063..5776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(5796..7253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(7253..8245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(8285..9187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(9240..10691) product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(10682..11086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 11377..11883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 11912..12244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(12362..13921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(14017..14637) product DUF4192 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813775.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 15460..16476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 16490..17233 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 assembly_gap 17209..17223 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17472..18191 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 18333..18461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 18984..20138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 20125..20397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 sequence023 source 1..20379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 594..1076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 1177..2445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 2445..2648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 2653..3078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 3113..3520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 3563..3976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 4999..5202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 5196..5603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 assembly_gap 5479..5488 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5994..6407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 6404..6970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 6972..10319 product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 10502..11887 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene glmM CDS 11910..12563 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 12560..14092 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068339.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 14109..14240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 14475..15599 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene prfB CDS 15608..16777 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene ftsE CDS 16789..17712 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene ftsX CDS 17815..19179 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068336.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 19344..19820 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene smpB sequence024 source 1..19622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..749 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067907.1:ATP-dependent Clp protease ATP-binding subunit locus_tag LOCUS_05910 CDS complement(926..1246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 note possible pseudo, frameshifted CDS complement(1194..1892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 note possible pseudo, internal stop codon, frameshifted assembly_gap 1251..1260 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1914..2219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 note possible pseudo, internal stop codon CDS 2362..3843 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 4054..5367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 assembly_gap 5029..5039 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5337..6095 product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 6220..8007 product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(8213..9673) product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 9773..11173 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene hisS CDS 11209..13008 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene aspS CDS complement(13469..14434) product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046726211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 14969..15520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 15714..16001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 note possible pseudo, frameshifted CDS complement(16058..16429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 16689..17183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 note possible pseudo, frameshifted assembly_gap 17113..17122 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17132..17452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 note possible pseudo, frameshifted CDS 17484..18323 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012471745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 18323..19000 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 sequence025 source 1..19451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..959 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068303.1:aldehyde dehydrogenase family protein locus_tag LOCUS_06100 CDS complement(1192..2463) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene purD CDS complement(2520..3557) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene purM CDS complement(3728..5239) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene purF CDS complement(5444..5653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 5818..7407 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 7404..7622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(7656..8633) product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(8740..9267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 9356..10012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 note possible pseudo, frameshifted CDS 10027..10713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 note possible pseudo, frameshifted CDS 10780..11304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 assembly_gap 10970..10979 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11321..11863) product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 11967..12101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 12368..13180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(13264..13923) product DUF6320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804300.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(13920..15290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(15263..16567) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 misc_feature complement(16705..>19451) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068298.1:phosphoribosylformylglycinamidine synthase locus_tag LOCUS_06280 sequence026 source 1..19283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 516..3587 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 tRNA 3861..3935 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 4401..4955 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 4931..5149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(5125..5775) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052019.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(5779..6204) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(6255..6479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 note possible pseudo, frameshifted CDS complement(6455..8320) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene glgX assembly_gap 6482..6491 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8394..9068) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(9114..10043) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(10204..13071) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068236.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene polA CDS complement(13117..13902) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 14303..15667 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(15693..16775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 16995..17621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 assembly_gap 17640..17649 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17767..18177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 18251..18637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 18722..19093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 sequence027 source 1..18992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(378..1298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 note possible pseudo, internal stop codon, frameshifted CDS complement(1489..1875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 assembly_gap 1511..1520 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1893..2246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 note possible pseudo, frameshifted CDS complement(2243..2890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 note possible pseudo, frameshifted CDS complement(2884..3585) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 3798..4397 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(4475..4810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 assembly_gap 4789..4798 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4944..5096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(5218..5508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 assembly_gap 5543..5651 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5942..6697) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(6700..7827) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390114.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(7970..9646) product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387410.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(9916..10083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(10083..10205) product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(10245..10502) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(10628..10933) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene rpsN CDS complement(11154..11324) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rpmG CDS complement(11496..11615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 11783..12553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390110.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 12923..13846 product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 14105..16180 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 16465..16797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 16755..18293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 18221..18604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 sequence028 source 1..18600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(691..1866) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(1934..3187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 3399..4388 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 4443..5150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 note possible pseudo, frameshifted assembly_gap 5011..5020 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5143..6987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 note possible pseudo, frameshifted CDS 7159..7800 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053093.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene upp CDS 7848..8327 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene rlmH CDS complement(8523..9632) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057441.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(9658..10767) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(10915..13584) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene clpB CDS complement(13798..15357) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene hutH CDS 15604..16479 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 16476..16652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 16850..17878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(17948..18436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 sequence029 source 1..17661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 826..1089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 1222..1866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(2265..2417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(2486..3748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 4412..5215 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 5212..5544 product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052362.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(5491..5712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(5723..6241) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(6375..6992) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(7102..7902) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052359.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 8102..8515 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052358.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(8586..9623) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052357.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(9793..10380) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 10352..10543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(10682..11326) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052354.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 11316..11558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(11641..12597) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 12990..14132 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene serC CDS 14257..14517 product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 assembly_gap 14608..14617 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14645..15166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 note possible pseudo, frameshifted CDS complement(15171..15845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 note possible pseudo, frameshifted assembly_gap 15209..15218 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16036..16710 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068776.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene phoU misc_feature complement(17087..>17661) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052347.1:phosphoglyceromutase locus_tag LOCUS_07070 sequence030 source 1..17225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 430..1392 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783206.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene rsmI CDS complement(1419..1646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(1787..2413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 2841..4628 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene metG CDS complement(5130..6656) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 6881..9109 product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 9137..9307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 note possible pseudo, frameshifted CDS 9340..10257 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050496022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(10429..11586) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 11960..13174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(13691..14761) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 14942..15121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 15138..16097 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068671.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 assembly_gap 15617..15626 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence031 source 1..17009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 note possible pseudo, frameshifted CDS complement(578..2476) product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(2695..4407) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013327.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 4801..5829 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 5981..6736 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 6791..7006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 7228..7794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(7754..8881) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(8881..10977) product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582983.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 11469..12872 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 12869..13990 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 14115..14819 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(14897..15757) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058535.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 misc_feature complement(15851..>17009) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068672.1:KUP/HAK/KT family potassium transporter locus_tag LOCUS_07340 sequence032 source 1..16753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 528..2456 product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 2595..3290 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 3442..4710 product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 4732..6036 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 6070..7293 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 7309..8106 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 assembly_gap 8768..8844 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8857..9453) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(9573..11735) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(11732..13894) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 note possible pseudo, frameshifted CDS complement(13821..14363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 note possible pseudo, frameshifted CDS 14718..16004 product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 sequence033 source 1..16492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..1539) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052999.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 1794..2624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053000.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 2893..3414 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene rplJ CDS 3523..3903 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene rplL CDS 4155..5657 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 5666..9289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 9292..9492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(9587..10066) product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 assembly_gap 10020..10029 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10403..10588) product evolved beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(10788..11483) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 11576..12223 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053783.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 12304..13740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 13913..14206 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene groES CDS complement(14880..15221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 note possible pseudo, frameshifted CDS complement(15106..16113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 note possible pseudo, frameshifted sequence034 source 1..16352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1209 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene gatB CDS 1505..2569 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 2580..2894 product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 3053..4921 product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 5139..6752 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 6958..9054 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056503.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene rho CDS 9362..9751 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 9993..11831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 assembly_gap 11818..11827 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12000..14912) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene valS assembly_gap 12193..12202 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(15056..>16352) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007057703.1:ABC transporter substrate-binding protein locus_tag LOCUS_07700 sequence035 source 1..16294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2326..5889 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 5954..8320 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene ligA note possible pseudo, frameshifted assembly_gap 8213..8222 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8283..8720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 note possible pseudo, frameshifted CDS 8895..9998 product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054010.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(10272..11024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067936.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(11492..12088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 12113..12925 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 13036..15144 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 sequence036 source 1..16153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..893) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782662.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(1022..1816) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene murI CDS 1924..2817 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054039.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene dapF CDS complement(2823..3440) product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 3400..3615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 3698..4591 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(4652..4876) product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(5025..6695) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067952.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 6841..8415 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067953.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(8485..10233) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 assembly_gap 9634..9643 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10454..11335 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 11442..11867 product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 tRNA 12031..12105 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 12336..14039 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053293.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 14036..15226 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene dxr sequence037 source 1..16118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(578..1669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(1806..3455) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(3790..5385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(5342..5533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(5488..6540) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643284.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(6592..7521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 note possible pseudo, frameshifted CDS complement(7469..8191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 note possible pseudo, frameshifted CDS complement(8269..9987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(10040..10975) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 11166..12584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(12665..12811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 12796..13425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 assembly_gap 12843..12852 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13441..15246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 sequence038 source 1..15393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(652..1353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(1358..2215) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(2212..3162) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(3174..4073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(4326..5513) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(5700..6701) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(6795..7712) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(7843..8010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 note possible pseudo, internal stop codon CDS complement(8047..8232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 note possible pseudo, internal stop codon tRNA complement(8561..8636) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 8734..9360 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(9444..10418) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(10704..11711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(11711..12781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 12862..13851 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(13995..14714) product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene nucS CDS complement(14802..15095) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054766.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 sequence039 source 1..14843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 451..1281 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 1386..2675 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 3017..5095 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 5294..5797 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053405.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 assembly_gap 5313..5322 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5825..6559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 note possible pseudo, frameshifted assembly_gap 6546..6555 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6571..6948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 assembly_gap 7062..7071 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7361..7687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 note possible pseudo, internal stop codon CDS 7687..7893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 note possible pseudo, internal stop codon CDS 7903..9162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 note possible pseudo, internal stop codon CDS 9222..9419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 9539..10591 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 assembly_gap 11130..11206 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11491..12030) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052109.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 note possible pseudo, frameshifted assembly_gap 12077..12086 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12140..13492) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 sequence040 source 1..14375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(59..1003) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 1245..2420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 2789..3466 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 3587..5074 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(5147..5425) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(5539..7215) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(7535..8473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 9219..9518 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 9562..12657 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053572.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 12654..13922 product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 note possible pseudo, internal stop codon CDS 14052..14195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 note possible pseudo, internal stop codon sequence041 source 1..14113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1913 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068029.1:aconitate hydratase AcnA locus_tag LOCUS_08460 CDS 2043..2447 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 2444..2935 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(2985..5090) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068031.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(5180..5821) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(5861..6604) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(6615..7835) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 8170..9021 product DUF5067 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 assembly_gap 9584..9672 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9690..10055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 assembly_gap 9970..9979 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10175..11191 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052632.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(11224..11961) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056209.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 12095..13549 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032743317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene miaB sequence042 source 1..13805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1074 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053838.1:MFS transporter locus_tag LOCUS_08580 CDS 1161..3524 product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052343.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 3600..4232 product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053837.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(4381..5982) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068773.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(6085..6774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068772.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(6804..7832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 8624..9907 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068770.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 9904..10599 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068769.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(10647..11669) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068768.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene galE CDS complement(12086..12733) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363467.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(12744..13133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 sequence043 source 1..13391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(914..1633) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051333.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(1872..2651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 assembly_gap 2437..2446 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2993..4024) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051335.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(4089..6605) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051336.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(6666..8006) product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(8115..8528) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051338.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene gcvH CDS complement(8554..9846) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068355.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene nudC CDS complement(9856..10713) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051340.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(10763..11386) product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068356.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 11593..11964 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene trxA assembly_gap 12648..12657 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence044 source 1..13129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..950 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 999..1337 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 1356..2531 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052155.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 2521..3069 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052156.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene ybeY CDS 3145..4578 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 4580..5350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 note possible pseudo, frameshifted CDS 5325..5657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 note possible pseudo, frameshifted assembly_gap 5328..5337 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5709..7820) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 8161..9324 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 9340..9645 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 9645..11069 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(11205..12242) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053364.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 sequence045 source 1..12716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..1695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(1718..3568) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414605.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(3595..4092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(4221..4505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(4557..4868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 5422..6759 product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene eccD CDS 6834..8252 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene eccB CDS 8264..9580 product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene mycP CDS complement(9645..9797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 10040..10216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(10390..12225) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(12251..12424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 12564..12716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 sequence046 source 1..12201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053602.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(934..1707) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(1930..2970) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053603.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(2979..4784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068271.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(4812..6134) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene tyrS CDS complement(6260..7027) product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818363.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(7024..7557) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(7715..8071) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(8128..8856) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene thiF CDS complement(9033..9902) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(9914..10108) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene thiS CDS complement(10457..11929) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051162.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene argH sequence047 source 1..11915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..2876) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068740.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene glgX CDS complement(2873..4057) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 4580..7309 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene adhE CDS complement(7694..8299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 8837..9145 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene rpsJ CDS 9163..9804 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene rplC CDS 9811..10476 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene rplD CDS 10482..10778 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene rplW CDS 10815..11645 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene rplB sequence048 source 1..11741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2350..3561 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(3721..4044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 4062..4751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 note possible pseudo, frameshifted CDS 4902..5537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 note possible pseudo, frameshifted CDS complement(5597..6607) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(6772..6924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 note possible pseudo, frameshifted CDS complement(7137..8105) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(8329..9759) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052501.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene dcuC CDS complement(9861..10457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 assembly_gap 10543..10647 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10905..11366) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 sequence049 source 1..11716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(724..1365) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(1427..2443) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(2517..3860) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 tRNA complement(4246..4334) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(4406..5341) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 5582..6856 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene dinB CDS complement(6883..8118) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene dapC CDS complement(8233..8553) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(8614..10140) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(10291..11514) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 sequence050 source 1..11710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 397..1197 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056838.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1194..2432 product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068569.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 2483..3127 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055904.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(3312..5396) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene pknB CDS complement(5405..6355) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068567.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(6352..7818) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(7815..9374) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(9371..11065) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051709.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(11070..11603) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051708.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 sequence051 source 1..11333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(598..1161) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057761.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene hpt CDS complement(1148..2314) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene tilS CDS complement(2404..3894) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene dacB CDS complement(3917..5590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(5587..6417) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582910.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 6441..6707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(6638..7861) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(7861..9504) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068783.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 9580..10506 product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(10729..11331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 sequence052 source 1..11218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..641 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025221252.1:ABC transporter substrate-binding protein locus_tag LOCUS_09630 assembly_gap 400..409 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 852..1796 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1927..2922 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053710.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 2939..3541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 note possible pseudo, frameshifted assembly_gap 3513..3522 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3528..3776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 note possible pseudo, frameshifted CDS 4072..5910 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene glmS CDS 5987..6688 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410317.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(6724..6927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(6839..7225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 7433..9508 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053701.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(9551..9745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 9717..9944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(9941..10120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 assembly_gap 10360..10369 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence053 source 1..11217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..914 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 904..1842 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 assembly_gap 1792..1801 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1888..2220 product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 2236..3057 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 3064..3507 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052292.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 3608..4240 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052293.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 4372..4776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(4928..5647) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(5779..6126) product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(6240..8831) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(8844..9161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(9192..9515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 note possible pseudo, frameshifted CDS complement(9446..11077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 note possible pseudo, frameshifted assembly_gap 9715..9724 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence054 source 1..10994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(564..1628) product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817017.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1628..3166) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene murC CDS complement(3196..4440) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 assembly_gap 3322..3331 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4456..5673) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067984.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene ftsW CDS complement(5660..7105) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067983.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene murD CDS complement(7161..8267) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene mraY CDS complement(8312..9763) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(9812..10684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 sequence055 source 1..10965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1330 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051332.1:transglycosylase domain-containing protein locus_tag LOCUS_09970 CDS 1552..2925 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(3093..4244) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 assembly_gap 4663..4672 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4693..5406 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658105.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 5411..6661 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene galT CDS 6679..7929 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene galK CDS 8170..9702 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 10131..10550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 sequence056 source 1..10960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 731..740 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1186..1425) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053186.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1655..2338) product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055622.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 2454..3146 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 3263..4351 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 4348..5298 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 5298..5849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021975282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 5849..6904 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 6901..7932 product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 7929..8531 product DUF6466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389711.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 8799..9119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 9116..10720 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782718.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 sequence057 source 1..10625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1291 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068089.1:LPXTG cell wall anchor domain-containing protein locus_tag LOCUS_10160 CDS 1608..2246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 2243..3472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 3486..3968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 4006..4308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 4317..6305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 6339..7826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 7880..9439 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 9454..9798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 sequence058 source 1..10591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(261..707) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene rplI CDS complement(727..975) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rpsR CDS complement(1036..1662) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1719..2009) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene rpsF assembly_gap 2308..2317 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2333..2584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(2538..2873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 2791..5223 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 5345..6358 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(6434..7249) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(7321..9402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(9421..10254) product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(10251..10544) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033512961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 sequence059 source 1..10445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(539..1444) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1757..3436) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene ettA tRNA 3770..3846 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 4269..5219 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052404.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 5479..6012 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 6340..7188 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 7196..7615 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056959.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 8538..9338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056960.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(9357..9665) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(9685..10011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 sequence060 source 1..10409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(364..1551) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055677.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1824..2702) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene prmC CDS complement(2863..3951) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene prfA CDS complement(4105..4317) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003830110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene rpmE tRNA complement(4454..4528) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(4646..5875) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 6095..7615 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 7810..8130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 8221..8565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(8849..9031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 9703..9987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 sequence061 source 1..10393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 assembly_gap 877..886 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1068..1784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 note possible pseudo, frameshifted assembly_gap 1614..1623 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1781..1990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 2016..2252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 assembly_gap 2296..2305 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2365..3330) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(3373..4449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 4930..5091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(5267..6469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(6754..7296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(7322..9046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(9049..9207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 misc_feature complement(9246..>10393) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010773627.1:ATP-binding protein note possible pseudo, frameshifted locus_tag LOCUS_10670 assembly_gap 9249..9258 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence062 source 1..10387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(631..3387) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(3681..4448) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(4631..5008) product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 assembly_gap 5025..5034 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5099..5812 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583014.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 6249..7544 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(7801..8817) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 9200..10054 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 sequence063 source 1..10266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 861..1106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 assembly_gap 868..877 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1115..2494) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067963.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(3000..3377) product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(3428..4237) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene thiD CDS 4367..5560 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 assembly_gap 5448..5457 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5597..8350) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067965.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene thiC CDS complement(8433..9377) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 sequence064 source 1..9971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 467..874 product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(982..1371) product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1505..2596 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene trpS CDS complement(2988..4469) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(5349..6989) product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(7235..9157) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 sequence065 source 1..9813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(243..1208) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene argF CDS complement(1252..2547) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(2537..3493) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene argB CDS complement(3565..4740) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene argJ CDS complement(4737..5831) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene argC CDS complement(5930..6616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(6647..9256) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene pheT misc_feature complement(9264..>9813) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051172.1:phenylalanine--tRNA ligase subunit alpha locus_tag LOCUS_10950 sequence066 source 1..9768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(866..1657) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 tRNA complement(1910..1984) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 2061..3269 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015713385.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(3356..4225) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068311.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 4323..6632 product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(6554..6769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 6813..7082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053674.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(7140..8327) product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 sequence067 source 1..9556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..1076 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866395.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1081..1887) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1992..3491 product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 3522..3797 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 3899..5296 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene hisD CDS 5293..6465 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 assembly_gap 5928..5937 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6551..7150 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene hisB CDS 7150..7935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 7970..8617 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene hisH CDS 8686..9411 product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054385.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene priA sequence068 source 1..9492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2509 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007056239.1:carbamoyl-phosphate synthase large subunit locus_tag LOCUS_11130 CDS 2509..3429 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene pyrF CDS 3609..4199 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene gmk CDS complement(4201..4908) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053268.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 5055..7310 product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(7319..7963) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 8190..8849 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 sequence069 source 1..9469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 228..246 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1183..1632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1639..2718) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene rsmH CDS complement(2718..3239) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene mraZ CDS 3572..4609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 note possible pseudo, frameshifted assembly_gap 4579..4588 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4603..5832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 note possible pseudo, frameshifted CDS 5843..7042 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene serA CDS complement(7177..7653) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene nrdR CDS complement(7670..8020) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 8171..8896 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene lexA sequence070 source 1..9468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 533..1177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1465..1635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(2031..2675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(2700..3026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(3138..3293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(3303..3488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(3677..3871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(3881..4159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(4559..4840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 note possible pseudo, frameshifted CDS complement(4812..5318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(5618..6964) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 7170..7604 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 7924..9270 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051757.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene gdhA sequence071 source 1..9421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(653..1435) product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1519..3009) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051179.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(3158..3781) product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 3873..5240 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 5540..6139 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 6139..7614 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 7611..8438 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 sequence072 source 1..9149 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 719..2683 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 2676..4298 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 sequence073 source 1..8953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 2..75 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 108..183 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 332..2365 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054284.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene thrS CDS 2504..3088 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 3227..3982 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 3988..4572 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052856.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene ruvC CDS 4630..5256 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene ruvA CDS 5256..6320 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene ruvB CDS 6385..6819 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 6883..7437 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 7534..8736 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene sucC sequence074 source 1..8705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 523..1158 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1310..2791) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(3032..3601) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 3745..4446 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 4610..8242 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 sequence075 source 1..8647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1326..1335 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1531..2022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(2183..3307) product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 3435..4655 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 4904..6535 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068096.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 assembly_gap 6012..6026 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6613..7098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 7111..7335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(7647..8033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 tRNA 8226..8299 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence076 source 1..8608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(251..1963) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene pta tRNA complement(2120..2193) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(2282..2355) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(2574..3272) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(3405..3818) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rsfS CDS complement(3822..5204) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782812.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene glmU tRNA complement(5298..5369) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(5486..6436) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052033.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(6594..8468) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 sequence077 source 1..8596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..439 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(655..2706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 note possible pseudo, frameshifted assembly_gap 2289..2298 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2595..3731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 note possible pseudo, frameshifted assembly_gap 2794..2803 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3906..5243) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(5233..5949) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(6094..7551) product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068846.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene pafA CDS complement(7551..7754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 misc_feature complement(7878..>8596) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013582864.1:inositol monophosphatase family protein locus_tag LOCUS_11850 sequence078 source 1..8510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(615..1586) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052228.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1589..2413) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(2431..3384) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene pyrF CDS complement(3402..4898) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(4895..5314) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052224.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(5314..6276) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054218.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene pyrB misc_feature complement(6418..>8510) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068132.1:bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase locus_tag LOCUS_11920 sequence079 source 1..8500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 132..887 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068345.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene dapB CDS 1029..2141 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053723.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene dapA assembly_gap 1912..1921 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2035..3885 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057778.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 3927..6536 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene pepN CDS 6713..7609 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 7808..8140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 sequence080 source 1..8388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3495..4223) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene nrdG CDS complement(4371..6779) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052482.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene nrdD sequence081 source 1..8322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(719..1999) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene nadA CDS complement(2059..2886) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068018.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(3018..3737) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene scpB CDS complement(3747..4661) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(4680..5519) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052597.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(5781..7565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 note possible pseudo, frameshifted CDS complement(7529..8005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 note possible pseudo, frameshifted CDS complement(7993..8322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 note possible pseudo, frameshifted sequence082 source 1..8277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 note possible pseudo, internal stop codon CDS 536..931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 note possible pseudo, internal stop codon CDS 928..1134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 note possible pseudo, internal stop codon CDS 1135..1560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 note possible pseudo, internal stop codon CDS complement(1637..2359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(2418..2726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 2620..3180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(3250..4035) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096594.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene tam CDS complement(4078..4407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(4349..4717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(4920..5894) product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(6142..7209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 note possible pseudo, frameshifted CDS complement(7218..8027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 note possible pseudo, frameshifted assembly_gap 8050..8059 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence083 source 1..8199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 36..1682 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1768..2460 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 2693..4210 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene araA CDS complement(4395..5111) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 5384..6904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 sequence084 source 1..8191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(213..2789) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 assembly_gap 2171..2180 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2898..3593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(3605..5383) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 assembly_gap 4912..4921 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5228..5262 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5461..7233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 7414..8130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 sequence085 source 1..8062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2045..2521) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene dut CDS complement(2521..2814) product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(2814..3146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 3057..4064 product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056777.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene sepH CDS complement(4074..5342) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 sequence086 source 1..8047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1635..2168) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055872.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(2378..4636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 4853..5440 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(5437..6063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(6065..6466) product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052491.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(6453..6740) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 misc_feature complement(7201..>8047) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052488.1:glycoside hydrolase family 3 N-terminal domain-containing protein locus_tag LOCUS_12430 sequence087 source 1..7947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..1557) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1608..2189) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 2306..4999 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 5144..5542 product DUF4418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 5633..6850 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 6852..7817 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052129.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 sequence088 source 1..7878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..1936) product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene dop CDS complement(1959..3524) product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene arc CDS complement(3719..4282) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057155.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 note possible pseudo, internal stop codon CDS 4348..5052 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene serB assembly_gap 4485..4494 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5092..7404 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068842.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 sequence089 source 1..7717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 280..1131 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068117.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1133..1396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1637..1999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 assembly_gap 1951..1960 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2026..4113 product bifunctional indole-3-glycerol phosphate synthase/tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 4137..5027 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene trpA assembly_gap 4685..4694 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5093..6040 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052284.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene lgt CDS 6116..6784 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055745.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene rpe CDS 6847..7110 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054261.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 sequence090 source 1..7675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 554..1828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1835..3385 product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 3734..4558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 note possible pseudo, frameshifted assembly_gap 4538..4547 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4555..5151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 note possible pseudo, frameshifted CDS 5280..5918 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 sequence091 source 1..7666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..521 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007055081.1:Fe-S cluster assembly protein SufB locus_tag LOCUS_12680 CDS 527..1762 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052146.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene sufD CDS 1788..2567 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene sufC CDS 2706..3980 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 3992..4546 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052149.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 4553..5146 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052150.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(5236..6480) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene glgC CDS complement(6683..7186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 note possible pseudo, frameshifted CDS complement(7080..7577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 note possible pseudo, frameshifted assembly_gap 7216..7225 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence092 source 1..7640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 415..1794 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1815..2180) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(2119..2481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(3027..4070) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 4474..5073 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 5073..5441 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(5667..5834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(5952..7016) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 sequence093 source 1..7358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..1567) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051261.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1755..3113 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene alr CDS 3318..4592 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 4792..6855 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene dnaG sequence094 source 1..7273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 242..1660 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1893..2834 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(2880..3545) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052063.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(3639..4604) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052064.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(4700..6583) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 assembly_gap 5532..5541 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6640..7140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 sequence095 source 1..7268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..2065 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114597.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene typA CDS 2165..2611 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 2691..3668 product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 3662..4873 product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068024.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 assembly_gap 4711..4720 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4944..5201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 5236..6309 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 sequence096 source 1..7258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..854 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(884..1681) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081708.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1762..3195) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(3314..4045) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(4136..5542) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051458.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(5863..6357) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057995.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(6689..6856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 tRNA 7085..7158 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence097 source 1..7137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 352..1317 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389876.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1332..1808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1829..2227 product DUF6093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 2227..2595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 2592..2999 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 3013..3555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 3654..4163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 4304..4528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 sequence098 source 1..7076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 264..1439 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene aroC CDS 1523..3145 product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 3309..3755 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052141.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene aroQ CDS 3852..4130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 4137..5798 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052143.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 assembly_gap 6784..6793 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence099 source 1..7037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1299 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010773627.1:ATP-binding protein locus_tag LOCUS_13210 CDS 1296..2885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 assembly_gap 2360..2369 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2908..4176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 4517..5305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 5298..5876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 6035..6214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(6215..7003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 sequence100 source 1..7003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1186..1956) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 2152..3120 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(3019..3321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(3467..5104) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene purH CDS complement(5052..6431) product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 misc_feature complement(6451..>7003) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052862.1:succinate--CoA ligase subunit alpha locus_tag LOCUS_13330 sequence101 source 1..6970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1213..2169 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(2321..4135) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068648.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(4334..6205) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(6392..6913) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 sequence102 source 1..6871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 73..495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 498..1211 product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1287..4061) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(4581..6071) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068263.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene thrC sequence103 source 1..6739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..2183) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene recQ CDS 2432..2779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 note possible pseudo, internal stop codon CDS 2804..4156 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 note possible pseudo, internal stop codon CDS complement(4296..5480) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(5572..6639) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 sequence104 source 1..6624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 146..448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(686..2365) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811470.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(2728..3369) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 3567..3896 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(4220..4708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 tRNA complement(4850..4924) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(4962..5035) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 5477..5671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 misc_feature complement(5854..>6624) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051591.1:glutamate--tRNA ligase locus_tag LOCUS_13530 sequence105 source 1..6600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 98..1462 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1781..2443) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 2464..3426 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 3828..4409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 4652..5878 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 sequence106 source 1..6599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 508..1614 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783085.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1792..2760 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(2776..3480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 note possible pseudo, internal stop codon CDS complement(3535..3888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 note possible pseudo, internal stop codon tRNA 4142..4215 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 4348..4752 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 4920..5348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 5517..6023 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene mscL sequence107 source 1..6585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 557..1453 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067996.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1528..1917 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 2023..3267 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(3364..3843) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928208.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene dtd CDS 3842..4171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 note possible pseudo, internal stop codon CDS 4190..4642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 note possible pseudo, internal stop codon CDS 4675..4968 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 4962..5243 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994045.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 tRNA 5397..5472 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 6114..6410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 sequence108 source 1..6546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(429..836) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(978..2447) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 assembly_gap 1021..1030 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2594..3163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 tRNA complement(3353..3433) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(3592..4593) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(4656..5222) product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068253.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(5219..5830) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582483.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 misc_feature complement(5921..>6546) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051126.1:phosphopyruvate hydratase locus_tag LOCUS_13810 sequence109 source 1..6537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..2805) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 2916..3197 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 3261..4664 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 4661..5290 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 5384..6232 product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051535.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 sequence110 source 1..6515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(157..372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 492..1013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1207..1485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1533..1685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 2232..2609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(2620..2868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(2915..3655) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(3723..3950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(4436..4948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(5662..5955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 sequence111 source 1..6511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(393..3074) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 note possible pseudo, internal stop codon repeat_region 579..785 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcatcggagcgacggcgacgcggacg CDS complement(3393..3662) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene rpsO CDS complement(3853..6105) product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(6102..6470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 sequence112 source 1..6477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1146..2246 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(2326..3756) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783712.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene hemW CDS complement(3756..3965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 note possible pseudo, frameshifted CDS complement(3922..5625) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053360.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene lepA CDS 5772..6032 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene rpsT sequence113 source 1..6417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..850) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783138.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 976..2595 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057799.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 2660..3637 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 3634..4536 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 4533..5618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 5536..6180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 note possible pseudo, frameshifted assembly_gap 6003..6012 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence114 source 1..6328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 186..392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 note possible pseudo, frameshifted CDS complement(560..1516) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene yddG CDS complement(1810..2901) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 3021..5465 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 sequence115 source 1..6257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..914 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082910117.1:sugar ABC transporter ATP-binding protein locus_tag LOCUS_14160 CDS 914..1855 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1894..3990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 4034..4813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 4943..5965 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 sequence116 source 1..6240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3870..4211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 4325..6148 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068394.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 sequence117 source 1..6032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..958) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 1254..3278 product DUF6020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 3278..4099 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(4206..4958) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056694.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(5178..5834) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 note possible pseudo, internal stop codon sequence118 source 1..5970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2004 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390053.1:FtsX-like permease family protein locus_tag LOCUS_14280 CDS complement(2037..2201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(2312..3112) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390051.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 assembly_gap 2387..2396 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3187..5589) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047379863.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 sequence119 source 1..5960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..665 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene ispF CDS complement(717..989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 note possible pseudo, frameshifted assembly_gap 1012..1021 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1088..1588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1630..2520) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(2692..3963) product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 4067..4942 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053562.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 sequence120 source 1..5710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 122..487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(622..1263) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068849.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1396..2832 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene purB CDS 2964..5525 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068847.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 sequence121 source 1..5676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 564..1106 product histone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1731..2870) product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(2949..3827) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(3901..4842) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 sequence122 source 1..5594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(606..1544) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507589.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1693..5277) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068255.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene mfd sequence123 source 1..5427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1088..1402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1780..2145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(2168..2497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 2717..2983 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388479.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 2983..3237 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(3183..4295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(4292..4759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(4770..5288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 sequence124 source 1..5391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 359..2509 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 2553..3608 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068391.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 3668..4537 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068388.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 4541..5284 product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410358.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 sequence125 source 1..5388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(760..894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1004..1135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(1494..2447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068169.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 2975..4021 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 4362..4640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(4697..4912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 note possible pseudo, frameshifted CDS complement(4827..5027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 note possible pseudo, frameshifted assembly_gap 5102..5111 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence126 source 1..5380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 257..266 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(310..660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 922..1140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 note possible pseudo, internal stop codon CDS 1177..1881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 note possible pseudo, internal stop codon, frameshifted assembly_gap 1869..1878 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1905..2681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 note possible pseudo, frameshifted assembly_gap 2614..2623 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2701..4389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 note possible pseudo, frameshifted CDS 4462..4911 product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 sequence127 source 1..5364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(216..938) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 note possible pseudo, frameshifted assembly_gap 263..272 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1225..2163 product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(2252..2653) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052118.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 2812..3141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 note possible pseudo, frameshifted assembly_gap 2953..2962 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3062..3430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 note possible pseudo, frameshifted CDS 3530..4153 product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(4347..4931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 note possible pseudo, internal stop codon CDS complement(4968..5267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 note possible pseudo, internal stop codon sequence128 source 1..5282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(781..1509) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene rnc CDS complement(1657..1851) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene rpmF CDS complement(1940..2569) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(2649..3539) product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057854.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(3547..4047) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051410.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene coaD CDS 4309..4602 product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811884.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 misc_feature complement(4644..>5282) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051408.1:aldo/keto reductase locus_tag LOCUS_14870 sequence129 source 1..5266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(13..375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 618..821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 963..1484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 note possible pseudo, frameshifted CDS 1390..2541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 note possible pseudo, frameshifted CDS complement(2725..3375) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054233.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene lepB CDS complement(3455..3883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(3908..4252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 4340..5218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 sequence130 source 1..5239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..1467 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1454..2866 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(2871..4349) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 4532..4798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 sequence131 source 1..5176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 421..1188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1317..2387) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(2551..2826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(2847..2990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(3237..4541) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 sequence132 source 1..5123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..673 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068393.1:ATP-binding cassette domain-containing protein locus_tag LOCUS_15050 CDS complement(907..1176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 2011..3360 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055690.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 3580..4542 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100494330.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 sequence133 source 1..5115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..812) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032735440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(876..1844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(2054..2758) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(2861..3796) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 4073..4477 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052678.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 misc_feature complement(4505..>5115) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013582782.1:DNA methyltransferase locus_tag LOCUS_15140 sequence134 source 1..5113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 224..282 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(368..1408) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067959.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1452..2849) product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(2924..3940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 4087..4779 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 sequence135 source 1..5092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..654 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene rplR CDS 651..1382 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053804.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene rpsE CDS 1379..1573 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene rpmD CDS 1576..2028 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783622.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene rplO CDS 2303..3640 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene secY CDS 3810..4370 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 4547..4765 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808114.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene infA sequence136 source 1..5082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..971 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029211.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 971..2407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 2421..3794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 3769..4512 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 sequence137 source 1..5051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..1234 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 1334..1867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(1949..2860) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene truA CDS complement(2857..3237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 sequence138 source 1..5032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(108..1085) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1085..2053) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene pdhA CDS complement(2075..2950) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene sucD CDS complement(2947..4098) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene sucC misc_feature complement(4112..>5032) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454646.1:aldehyde dehydrogenase family protein locus_tag LOCUS_15380 sequence139 source 1..4982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(701..3607) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 assembly_gap 1372..1381 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3819..4565 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582798.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 assembly_gap 3928..3937 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence140 source 1..4975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068789.1:ATP-dependent zinc metalloprotease FtsH locus_tag LOCUS_15410 CDS 965..1564 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052379.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene folE CDS 1652..2527 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene folP CDS 2637..4049 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene folK CDS 4224..4751 product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 sequence141 source 1..4865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3260..3469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 3468..3719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(3804..4829) product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 sequence142 source 1..4860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..1139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1143..2036 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene nadC CDS 2039..3286 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 3318..4667 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 sequence143 source 1..4858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1216 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068213.1:chloride channel protein locus_tag LOCUS_15530 CDS 1333..1713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1819..2442 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 2439..3149 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 3271..4650 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021975717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene clpX sequence144 source 1..4854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(476..1855) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene tig CDS complement(1868..3211) product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(3208..3846) product DUF3000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068216.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(3909..4790) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene pflA sequence145 source 1..4842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(233..2290) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(2403..2951) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 3265..3918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 misc_feature complement(4180..>4842) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068722.1:type I polyketide synthase locus_tag LOCUS_15650 sequence146 source 1..4770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..1003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1081..1245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1268..1657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1654..1989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(2002..2256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(2253..2504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(2575..3141) product oligoribonuclease Orn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(3138..3533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813016.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(3526..3726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 sequence147 source 1..4741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..1803) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052234.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1843..3033) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052235.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 assembly_gap 3707..3723 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence148 source 1..4534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1810..2115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(2030..4459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 note possible pseudo, frameshifted assembly_gap 2463..2472 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence149 source 1..4477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 339..430 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1348..1722) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782778.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1964..2611) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056362.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 misc_feature complement(2641..>4477) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068268.1:DNA repair protein RecN locus_tag LOCUS_15810 sequence150 source 1..4474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1204 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1282..2067) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051134.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene nadD CDS complement(2064..2645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053591.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(2642..3946) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051136.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(4128..4472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 sequence151 source 1..4343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 73..285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 note possible pseudo, internal stop codon CDS 325..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 note possible pseudo, internal stop codon CDS complement(558..1031) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033125641.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1160..1594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 1666..1869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 2503..2724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 2890..3246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 3407..4306 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053281.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 sequence152 source 1..4326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(554..1768) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1900..2880) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 3081..3902 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 sequence153 source 1..4291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(717..986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(976..2271) product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(2261..2998) product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783114.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 assembly_gap 2944..2953 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3014..3868) product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 sequence154 source 1..4286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..792 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 792..1496 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1628..2080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 2255..2929 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053883.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 2926..4209 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 sequence155 source 1..4172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(508..2592) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 assembly_gap 2228..2237 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2613..3941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 sequence156 source 1..4172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2161 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053385.1:alanine--tRNA ligase locus_tag LOCUS_16100 assembly_gap 661..670 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2170..2628 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053384.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene ruvX CDS 2639..3820 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene mltG sequence157 source 1..4137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 601..1176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1154..2059 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 2133..2684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 2671..3618 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 3637..3963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 sequence158 source 1..4065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 943..952 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1010..1690) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1768..4020) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene glgB sequence159 source 1..4053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1050..2600) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(2645..3019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 misc_feature complement(3385..>4053) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052069.1:pyridoxamine kinase locus_tag LOCUS_16220 assembly_gap 3805..3814 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence160 source 1..4049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(314..514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 735..1502 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 1792..3057 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 3081..3890 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 sequence161 source 1..4046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(862..1644) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1839..3395) product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 misc_feature complement(3407..>4046) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067958.1:MFS transporter locus_tag LOCUS_16300 sequence162 source 1..4018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1064..2656) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056288.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 misc_feature complement(2659..>4018) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068711.1:arginine--tRNA ligase locus_tag LOCUS_16320 sequence163 source 1..3994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(3330..>3994) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054390.1:methyltransferase locus_tag LOCUS_16330 sequence164 source 1..3954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1696 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068820.1:acyl-CoA dehydratase activase-related protein locus_tag LOCUS_16340 CDS 1861..3138 product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015713811.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 3217..3825 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 sequence165 source 1..3950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..1197 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene tsaB CDS 1214..1768 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783284.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene rimI CDS 1765..2808 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054363.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene tsaD tRNA complement(3000..3075) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 sequence166 source 1..3945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1059..3170) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene uvrB CDS complement(3182..3799) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055464.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene coaE sequence167 source 1..3843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 648..1118 product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051517.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 1227..1931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582356.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 2093..2893 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 2952..3638 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene nth sequence168 source 1..3825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1511 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068832.1:mupirocin-resistant isoleucine--tRNA ligase locus_tag LOCUS_16460 assembly_gap 1528..1537 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1970..3190) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068839.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene metK CDS complement(3468..3752) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene rpoZ sequence169 source 1..3798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 47..892 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068056.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1007..1957 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 2053..2946 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 assembly_gap 2896..2905 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence170 source 1..3796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(473..2170) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052049.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(2519..3670) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 sequence171 source 1..3789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 509..593 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 961..2040 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 2199..3647 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 sequence172 source 1..3778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1892..2857 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 misc_feature complement(3032..>3778) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053194.1:DUF3027 domain-containing protein locus_tag LOCUS_16580 sequence173 source 1..3765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence174 source 1..3721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..507 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068035.1:CinA family protein locus_tag LOCUS_16590 CDS 573..1082 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052641.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1194..1427 product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1728..2921 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene recA CDS 3068..3517 product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 sequence175 source 1..3706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(628..1209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 1273..2256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 2601..3647 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068039.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene trpD sequence176 source 1..3647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 432..1286 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene metF CDS 1420..2373 product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene bsh CDS 2441..3469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 note possible pseudo, frameshifted assembly_gap 3316..3381 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence177 source 1..3585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 107..1342 product IS30-like element ISBlo4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1855..3573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 sequence178 source 1..3566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 104..2158 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055427524.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(2221..3093) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 assembly_gap 3285..3343 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence179 source 1..3524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 701..1627 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1648..2652 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052615.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 sequence180 source 1..3486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(796..1809) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 2028..3308 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033518021.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 sequence181 source 1..3484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 568..577 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1668..2579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(2492..2872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 sequence182 source 1..3478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(609..1328) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene recO CDS complement(1378..3090) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067955.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 sequence183 source 1..3470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..2196) product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 sequence184 source 1..3456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1214..2878) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056415.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 misc_feature complement(2936..>3456) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007056414.1:pyridoxal 5'-phosphate synthase glutaminase subunit PdxT locus_tag LOCUS_16850 sequence185 source 1..3451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..1628) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068714.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1765..2877) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068713.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 sequence186 source 1..3440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..1044) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1335..2327 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014483607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(2520..3029) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene ybaK sequence187 source 1..3376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 57..848 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 914..1816 product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 1946..3178 product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 sequence188 source 1..3376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 295..1467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1650..2987 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582494.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene aroA sequence189 source 1..3340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1566..2318) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 2644..3009 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 sequence190 source 1..3231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1416..1820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1840..2457) product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 sequence191 source 1..3199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(593..1228) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1256..1888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1937..2605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(2598..3104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 sequence192 source 1..3075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068306.1:zinc-binding dehydrogenase locus_tag LOCUS_17040 CDS 1022..1522 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057689.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene purE CDS 1506..2684 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene purK sequence193 source 1..3034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1104..2348) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene dusB misc_feature complement(2493..>3034) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067967.1:glycine--tRNA ligase locus_tag LOCUS_17080 sequence194 source 1..3024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 501..1661 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1809..2834) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056348.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 sequence195 source 1..2974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 138..869 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1040..2890 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 sequence196 source 1..2934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 720..1850 product DUF4854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582958.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1953..2774 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582957.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 sequence197 source 1..2931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..999 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052794.1:molecular chaperone DnaJ locus_tag LOCUS_17160 CDS complement(1047..1682) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 note possible pseudo, internal stop codon CDS complement(1698..1838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 note possible pseudo, internal stop codon CDS 1984..2868 product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene uppP sequence198 source 1..2902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1147..>2902) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068826.1:ABC transporter ATP-binding protein locus_tag LOCUS_17200 sequence199 source 1..2885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1129 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068346.1:ATP-dependent DNA helicase locus_tag LOCUS_17210 CDS 1341..2660 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053725.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 sequence200 source 1..2882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 450..938 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene def CDS 1294..2139 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene rpsB sequence201 source 1..2872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 313..1818 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 assembly_gap 1656..1665 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1914..2870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 sequence202 source 1..2840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 361..1002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054242.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1019..1405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1715..2731) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214358204.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene yidC sequence203 source 1..2780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 496..792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 906..1889 product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 misc_feature complement(2028..>2780) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011167180.1:S8 family peptidase locus_tag LOCUS_17320 sequence204 source 1..2775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(313..732) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051418.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(742..1020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1176..1730) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene ilvN misc_feature complement(1747..>2775) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054814.1:acetolactate synthase large subunit locus_tag LOCUS_17360 sequence205 source 1..2767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(677..1078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1102..1284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1524..2669 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 sequence206 source 1..2759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..1934) product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1951..2241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 sequence207 source 1..2757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..794) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1028..2722) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene ptsP sequence208 source 1..2742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 204..2168 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053388.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 sequence209 source 1..2721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..2251 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053798.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene malQ sequence210 source 1..2720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..2319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 assembly_gap 929..938 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2313..2720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 sequence211 source 1..2667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1261 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068231.1:glycoside-pentoside-hexuronide (GPH):cation symporter locus_tag LOCUS_17490 assembly_gap 1289..1298 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1740..2189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 note possible pseudo, internal stop codon sequence212 source 1..2615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..538 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052070.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase locus_tag LOCUS_17510 CDS 887..1801 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 sequence213 source 1..2602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(279..2519) product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 sequence214 source 1..2596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 2295..2314 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence215 source 1..2593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..930) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068395.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(943..2163) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068396.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 sequence216 source 1..2554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence217 source 1..2549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1464..1539) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 misc_feature complement(1604..>2549) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007055764.1:bifunctional cytidylate kinase/GTPase Der locus_tag LOCUS_17560 sequence218 source 1..2537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 265..864 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1012..2454) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene pyk sequence219 source 1..2527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..1412 product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052709.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1426..1767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1780..2010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 sequence220 source 1..2473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..948) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1101..1949) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053343.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 sequence221 source 1..2463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1453 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032740880.1:AMP-dependent synthetase/ligase locus_tag LOCUS_17640 CDS complement(1594..2118) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(2242..2463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 sequence222 source 1..2434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(804..1835) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 sequence223 source 1..2430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(124..1089) product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068774.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene menA misc_feature complement(1151..>2430) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053839.1:lysine--tRNA ligase locus_tag LOCUS_17690 sequence224 source 1..2354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence225 source 1..2292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(514..1311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 misc_feature complement(1295..>2292) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968626.1:AAA family ATPase locus_tag LOCUS_17710 sequence226 source 1..2282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1376..1849) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 sequence227 source 1..2263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 737..746 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(1147..>2263) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068697.1:UDP-galactopyranose mutase locus_tag LOCUS_17730 sequence228 source 1..2253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 377..1600 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene carA sequence229 source 1..2233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(298..1014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 note possible pseudo, frameshifted assembly_gap 360..369 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence230 source 1..2231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1039 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068840.1:dihydroxy-acid dehydratase locus_tag LOCUS_17760 CDS complement(1195..2181) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene fmt sequence231 source 1..2227 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 410..1249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 sequence232 source 1..2204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(326..1216) product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 misc_feature complement(1413..>2204) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068176.1:branched-chain amino acid aminotransferase locus_tag LOCUS_17800 sequence233 source 1..2172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2094 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965527.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase locus_tag LOCUS_17810 sequence234 source 1..2164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(235..462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 note possible pseudo, frameshifted CDS complement(470..748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 note possible pseudo, frameshifted assembly_gap 486..495 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(845..>2164) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053331.1:oleate hydratase locus_tag LOCUS_17840 sequence235 source 1..2033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(560..>2033) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052449.1:IMP dehydrogenase locus_tag LOCUS_17850 sequence236 source 1..2001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence237 source 1..1996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1056..1994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 sequence238 source 1..1972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..895 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356490.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene cutC CDS 899..1696 product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(1727..1942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 sequence239 source 1..1966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 note possible pseudo, internal stop codon CDS 506..1654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 note possible pseudo, internal stop codon sequence240 source 1..1938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence241 source 1..1923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 715..1005 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 misc_feature complement(1194..>1923) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053188.1:chaperonin GroEL locus_tag LOCUS_17930 sequence242 source 1..1825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(668..>1825) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008783117.1:ABC transporter ATP-binding protein locus_tag LOCUS_17940 sequence243 source 1..1805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..1584) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene gatA sequence244 source 1..1787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(799..1605) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 sequence245 source 1..1779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..994 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390049.1:alpha/beta fold hydrolase locus_tag LOCUS_17980 sequence246 source 1..1727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 assembly_gap 263..272 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(407..1594) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 sequence247 source 1..1693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence248 source 1..1623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..867 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494943.1:MATE family efflux transporter locus_tag LOCUS_18010 CDS complement(857..1048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 misc_feature complement(1045..>1623) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057728.1:SDR family oxidoreductase locus_tag LOCUS_18030 assembly_gap 1051..1070 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence249 source 1..1589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 555..1112 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 sequence250 source 1..1551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(77..361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 assembly_gap 213..222 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(361..675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 note possible pseudo, frameshifted misc_feature complement(936..>1551) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007055085.1:histidine phosphatase family protein locus_tag LOCUS_18070