>Feature sequence001 2670 1345 gene locus_tag LOCUS_00010 2670 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4923 2782 gene locus_tag LOCUS_00020 4923 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5735 4935 gene locus_tag LOCUS_00030 5735 4935 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530243.1 protein_id gnl|my_center|LOCUS_00030 6755 5751 gene locus_tag LOCUS_00040 6755 5751 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_00040 7694 7023 gene locus_tag LOCUS_00050 7694 7023 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051632.1 protein_id gnl|my_center|LOCUS_00050 8576 7806 gene locus_tag LOCUS_00060 8576 7806 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051633.1 protein_id gnl|my_center|LOCUS_00060 10162 8663 gene locus_tag LOCUS_00070 10162 8663 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057589.1 protein_id gnl|my_center|LOCUS_00070 11270 10149 gene locus_tag LOCUS_00080 11270 10149 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_00080 12659 11307 gene locus_tag LOCUS_00090 12659 11307 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054673.1 protein_id gnl|my_center|LOCUS_00090 13519 12932 gene locus_tag LOCUS_00100 13519 12932 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054672.1 protein_id gnl|my_center|LOCUS_00100 14553 13534 gene locus_tag LOCUS_00110 14553 13534 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051638.1 protein_id gnl|my_center|LOCUS_00110 14584 14683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15374 14709 gene locus_tag LOCUS_00120 gene grpE 15374 14709 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055523.1 protein_id gnl|my_center|LOCUS_00120 17263 15374 gene locus_tag LOCUS_00130 gene dnaK 17263 15374 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051640.1 protein_id gnl|my_center|LOCUS_00130 22670 17511 gene locus_tag LOCUS_00140 gene pulA 22670 17511 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947102.1 protein_id gnl|my_center|LOCUS_00140 22981 24006 gene locus_tag LOCUS_00150 22981 24006 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390364.1 protein_id gnl|my_center|LOCUS_00150 24815 24051 gene locus_tag LOCUS_00160 24815 24051 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993522.1 protein_id gnl|my_center|LOCUS_00160 25734 24925 gene locus_tag LOCUS_00170 25734 24925 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_00170 27733 25727 gene locus_tag LOCUS_00180 gene pulA 27733 25727 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 protein_id gnl|my_center|LOCUS_00180 28804 27878 gene locus_tag LOCUS_00190 28804 27878 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 protein_id gnl|my_center|LOCUS_00190 30201 28801 gene locus_tag LOCUS_00200 30201 28801 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_00200 31468 30224 gene locus_tag LOCUS_00210 31468 30224 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_00210 31868 33649 gene locus_tag LOCUS_00220 31868 33649 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_00220 33894 36098 gene locus_tag LOCUS_00230 gene malQ 33894 36098 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068527.1 protein_id gnl|my_center|LOCUS_00230 37372 36413 gene locus_tag LOCUS_00240 37372 36413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 38086 37442 gene locus_tag LOCUS_00250 38086 37442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 39928 38243 gene locus_tag LOCUS_00260 39928 38243 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814213.1 protein_id gnl|my_center|LOCUS_00260 44059 40034 gene locus_tag LOCUS_00270 44059 40034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 44450 44184 gene locus_tag LOCUS_00280 44450 44184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 45154 46179 gene locus_tag LOCUS_00290 45154 46179 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051648.1 protein_id gnl|my_center|LOCUS_00290 46450 48264 gene locus_tag LOCUS_00300 46450 48264 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055555.1 protein_id gnl|my_center|LOCUS_00300 49575 48523 gene locus_tag LOCUS_00310 gene ilvC 49575 48523 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051650.1 protein_id gnl|my_center|LOCUS_00310 50439 51005 gene locus_tag LOCUS_00320 50439 51005 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392649.1 protein_id gnl|my_center|LOCUS_00320 51002 51736 gene locus_tag LOCUS_00330 51002 51736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389086.1 protein_id gnl|my_center|LOCUS_00330 51733 52326 gene locus_tag LOCUS_00340 51733 52326 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 protein_id gnl|my_center|LOCUS_00340 53525 52473 gene locus_tag LOCUS_00350 gene ilvC 53525 52473 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811512.1 protein_id gnl|my_center|LOCUS_00350 55229 53862 gene locus_tag LOCUS_00360 55229 53862 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582327.1 protein_id gnl|my_center|LOCUS_00360 56798 55755 gene locus_tag LOCUS_00370 56798 55755 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068530.1 protein_id gnl|my_center|LOCUS_00370 58499 56862 gene locus_tag LOCUS_00380 58499 56862 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068531.1 protein_id gnl|my_center|LOCUS_00380 60033 58696 gene locus_tag LOCUS_00390 60033 58696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 61582 60056 gene locus_tag LOCUS_00400 gene gtfA 61582 60056 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068532.1 protein_id gnl|my_center|LOCUS_00400 62186 61920 gene locus_tag LOCUS_00410 62186 61920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 62350 62183 gene locus_tag LOCUS_00420 62350 62183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 62896 62525 gene locus_tag LOCUS_00430 62896 62525 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389414.1 protein_id gnl|my_center|LOCUS_00430 63669 62896 gene locus_tag LOCUS_00440 63669 62896 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389413.1 protein_id gnl|my_center|LOCUS_00440 <64674 63737 gene locus_tag LOCUS_00450 <64674 63737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008783481.1:adenylosuccinate synthase >Feature sequence002 102 176 gene locus_tag LOCUS_t00010 102 176 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 307 597 gene locus_tag LOCUS_00460 307 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 1619 1263 gene locus_tag LOCUS_00470 1619 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 1593 1602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3019 1742 gene locus_tag LOCUS_00480 3019 1742 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068433.1 protein_id gnl|my_center|LOCUS_00480 4224 3208 gene locus_tag LOCUS_00490 4224 3208 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068432.1 protein_id gnl|my_center|LOCUS_00490 4628 4822 gene locus_tag LOCUS_00500 gene rpmB 4628 4822 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051452.1 protein_id gnl|my_center|LOCUS_00500 4922 7756 gene locus_tag LOCUS_00510 4922 7756 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068431.1 protein_id gnl|my_center|LOCUS_00510 7883 8089 gene locus_tag LOCUS_00520 7883 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 7983 8591 gene locus_tag LOCUS_00530 gene rsmD 7983 8591 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582362.1 protein_id gnl|my_center|LOCUS_00530 8596 9528 gene locus_tag LOCUS_00540 8596 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 9671 9680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9744 10676 gene locus_tag LOCUS_00550 9744 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 10995 11891 gene locus_tag LOCUS_00560 10995 11891 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068666.1 protein_id gnl|my_center|LOCUS_00560 12908 12093 gene locus_tag LOCUS_00570 gene trmD 12908 12093 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054789.1 protein_id gnl|my_center|LOCUS_00570 12982 14628 gene locus_tag LOCUS_00580 12982 14628 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582363.1 protein_id gnl|my_center|LOCUS_00580 14707 15687 gene locus_tag LOCUS_00590 14707 15687 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068427.1 protein_id gnl|my_center|LOCUS_00590 15767 16642 gene locus_tag LOCUS_00600 15767 16642 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068426.1 protein_id gnl|my_center|LOCUS_00600 16652 17329 gene locus_tag LOCUS_00610 16652 17329 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051445.1 protein_id gnl|my_center|LOCUS_00610 17477 19054 gene locus_tag LOCUS_00620 17477 19054 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 protein_id gnl|my_center|LOCUS_00620 19169 20515 gene locus_tag LOCUS_00630 19169 20515 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055726.1 protein_id gnl|my_center|LOCUS_00630 20773 21906 gene locus_tag LOCUS_00640 20773 21906 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051442.1 protein_id gnl|my_center|LOCUS_00640 22034 23266 gene locus_tag LOCUS_00650 22034 23266 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051440.1 protein_id gnl|my_center|LOCUS_00650 23390 24103 gene locus_tag LOCUS_00660 gene mtnN 23390 24103 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051439.1 protein_id gnl|my_center|LOCUS_00660 24376 25689 gene locus_tag LOCUS_00670 24376 25689 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815310.1 protein_id gnl|my_center|LOCUS_00670 25778 27151 gene locus_tag LOCUS_00680 25778 27151 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055698.1 protein_id gnl|my_center|LOCUS_00680 27350 28054 gene locus_tag LOCUS_00690 27350 28054 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051437.1 protein_id gnl|my_center|LOCUS_00690 28293 29426 gene locus_tag LOCUS_00700 gene pstS 28293 29426 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051436.1 protein_id gnl|my_center|LOCUS_00700 29637 30590 gene locus_tag LOCUS_00710 gene pstC 29637 30590 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 protein_id gnl|my_center|LOCUS_00710 30590 31588 gene locus_tag LOCUS_00720 gene pstA 30590 31588 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782854.1 protein_id gnl|my_center|LOCUS_00720 31641 32420 gene locus_tag LOCUS_00730 gene pstB 31641 32420 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051433.1 protein_id gnl|my_center|LOCUS_00730 32762 32520 gene locus_tag LOCUS_00740 32762 32520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 32835 33413 gene locus_tag LOCUS_00750 32835 33413 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068421.1 protein_id gnl|my_center|LOCUS_00750 33477 35747 gene locus_tag LOCUS_00760 33477 35747 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068420.1 protein_id gnl|my_center|LOCUS_00760 35907 37739 gene locus_tag LOCUS_00770 35907 37739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 37535 37550 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37621 39924 gene locus_tag LOCUS_00780 37621 39924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 40028 40501 gene locus_tag LOCUS_00790 40028 40501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00790 40643 40885 gene locus_tag LOCUS_00800 40643 40885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 41200 41370 gene locus_tag LOCUS_00810 41200 41370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 41578 42441 gene locus_tag LOCUS_00820 41578 42441 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051430.1 protein_id gnl|my_center|LOCUS_00820 42539 43594 gene locus_tag LOCUS_00830 42539 43594 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068419.1 protein_id gnl|my_center|LOCUS_00830 43780 43487 gene locus_tag LOCUS_00840 43780 43487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 45260 43908 gene locus_tag LOCUS_00850 45260 43908 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_00850 46180 45566 gene locus_tag LOCUS_00860 gene rimM 46180 45566 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054805.1 protein_id gnl|my_center|LOCUS_00860 46436 46203 gene locus_tag LOCUS_00870 46436 46203 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051427.1 protein_id gnl|my_center|LOCUS_00870 46918 46457 gene locus_tag LOCUS_00880 gene rpsP 46918 46457 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054806.1 protein_id gnl|my_center|LOCUS_00880 48242 47133 gene locus_tag LOCUS_00890 48242 47133 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068417.1 protein_id gnl|my_center|LOCUS_00890 50067 48319 gene locus_tag LOCUS_00900 gene ffh 50067 48319 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527326.1 protein_id gnl|my_center|LOCUS_00900 50277 51185 gene locus_tag LOCUS_00910 50277 51185 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055692.1 protein_id gnl|my_center|LOCUS_00910 52863 51205 gene locus_tag LOCUS_00920 gene cysS 52863 51205 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068414.1 protein_id gnl|my_center|LOCUS_00920 53073 53801 gene locus_tag LOCUS_00930 53073 53801 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054810.1 protein_id gnl|my_center|LOCUS_00930 >Feature sequence003 2733 919 gene locus_tag LOCUS_00940 2733 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00940 997 1006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4808 2730 gene locus_tag LOCUS_00950 4808 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00950 7005 4825 gene locus_tag LOCUS_00960 7005 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00960 4833 4842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7133 8554 gene locus_tag LOCUS_00970 7133 8554 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057781.1 protein_id gnl|my_center|LOCUS_00970 8721 14705 gene locus_tag LOCUS_00980 8721 14705 CDS product tandem-95 repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051312.1 protein_id gnl|my_center|LOCUS_00980 14716 16089 gene locus_tag LOCUS_00990 14716 16089 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051313.1 protein_id gnl|my_center|LOCUS_00990 16114 17337 gene locus_tag LOCUS_01000 16114 17337 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051314.1 protein_id gnl|my_center|LOCUS_01000 17334 19847 gene locus_tag LOCUS_01010 17334 19847 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068348.1 protein_id gnl|my_center|LOCUS_01010 19844 20776 gene locus_tag LOCUS_01020 19844 20776 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056411.1 protein_id gnl|my_center|LOCUS_01020 20803 21423 gene locus_tag LOCUS_01030 20803 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816173.1 protein_id gnl|my_center|LOCUS_01030 21439 22062 gene locus_tag LOCUS_01040 21439 22062 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820417.1 protein_id gnl|my_center|LOCUS_01040 24021 22255 gene locus_tag LOCUS_01050 24021 22255 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226836178.1 protein_id gnl|my_center|LOCUS_01050 25916 24423 gene locus_tag LOCUS_01060 25916 24423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 26216 27589 gene locus_tag LOCUS_01070 26216 27589 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_01070 28486 27605 gene locus_tag LOCUS_01080 28486 27605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 29169 28684 gene locus_tag LOCUS_01090 29169 28684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 29576 29175 gene locus_tag LOCUS_01100 29576 29175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 33507 30301 gene locus_tag LOCUS_01110 33507 30301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 33634 34728 gene locus_tag LOCUS_01120 33634 34728 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389795.1 protein_id gnl|my_center|LOCUS_01120 35886 34684 gene locus_tag LOCUS_01130 35886 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 36539 35883 gene locus_tag LOCUS_01140 36539 35883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974272.1 protein_id gnl|my_center|LOCUS_01140 36933 36619 gene locus_tag LOCUS_01150 36933 36619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 37333 37040 gene locus_tag LOCUS_01160 37333 37040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 38046 37492 gene locus_tag LOCUS_01170 38046 37492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 41078 38043 gene locus_tag LOCUS_01180 41078 38043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01180 40331 40340 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42641 41142 gene locus_tag LOCUS_01190 42641 41142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 43844 42960 gene locus_tag LOCUS_01200 43844 42960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 49043 43866 gene locus_tag LOCUS_01210 49043 43866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 48855 48864 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49666 49043 gene locus_tag LOCUS_01220 49666 49043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 50514 49663 gene locus_tag LOCUS_01230 50514 49663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 50786 50556 gene locus_tag LOCUS_01240 50786 50556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 50585 50594 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51360 50848 gene locus_tag LOCUS_01250 51360 50848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 50909 50918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <52152 51558 gene locus_tag LOCUS_01260 <52152 51558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051319.1:DNA-directed RNA polymerase subunit beta' >Feature sequence004 1530 436 gene locus_tag LOCUS_01270 1530 436 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583033.1 protein_id gnl|my_center|LOCUS_01270 1633 2346 gene locus_tag LOCUS_01280 1633 2346 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 protein_id gnl|my_center|LOCUS_01280 2346 3668 gene locus_tag LOCUS_01290 2346 3668 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_01290 4662 3670 gene locus_tag LOCUS_01300 gene nrdF 4662 3670 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068610.1 protein_id gnl|my_center|LOCUS_01300 7082 4887 gene locus_tag LOCUS_01310 gene nrdE 7082 4887 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054636.1 protein_id gnl|my_center|LOCUS_01310 7552 7094 gene locus_tag LOCUS_01320 gene nrdI 7552 7094 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783041.1 protein_id gnl|my_center|LOCUS_01320 7815 7549 gene locus_tag LOCUS_01330 7815 7549 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051803.1 protein_id gnl|my_center|LOCUS_01330 8781 8224 gene locus_tag LOCUS_01340 8781 8224 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775404.1 protein_id gnl|my_center|LOCUS_01340 11212 8774 gene locus_tag LOCUS_01350 11212 8774 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 protein_id gnl|my_center|LOCUS_01350 14505 11548 gene locus_tag LOCUS_01360 14505 11548 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_01360 14884 16971 gene locus_tag LOCUS_01370 14884 16971 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783044.1 protein_id gnl|my_center|LOCUS_01370 17108 18085 gene locus_tag LOCUS_01380 17108 18085 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054647.1 protein_id gnl|my_center|LOCUS_01380 18216 18290 gene locus_tag LOCUS_t00020 18216 18290 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18609 20066 gene locus_tag LOCUS_01390 18609 20066 CDS product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068603.1 protein_id gnl|my_center|LOCUS_01390 20099 21022 gene locus_tag LOCUS_01400 gene rsmA 20099 21022 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 protein_id gnl|my_center|LOCUS_01400 21019 21969 gene locus_tag LOCUS_01410 21019 21969 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051793.1 protein_id gnl|my_center|LOCUS_01410 22016 22645 gene locus_tag LOCUS_01420 22016 22645 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051792.1 protein_id gnl|my_center|LOCUS_01420 24145 22730 gene locus_tag LOCUS_01430 24145 22730 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 protein_id gnl|my_center|LOCUS_01430 24232 25512 gene locus_tag LOCUS_01440 24232 25512 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170114949.1 protein_id gnl|my_center|LOCUS_01440 25584 27752 gene locus_tag LOCUS_01450 25584 27752 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361541.1 protein_id gnl|my_center|LOCUS_01450 27749 31576 gene locus_tag LOCUS_01460 27749 31576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 31696 32715 gene locus_tag LOCUS_01470 31696 32715 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051786.1 protein_id gnl|my_center|LOCUS_01470 34453 33092 gene locus_tag LOCUS_01480 34453 33092 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068597.1 protein_id gnl|my_center|LOCUS_01480 35424 34453 gene locus_tag LOCUS_01490 35424 34453 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051774.1 protein_id gnl|my_center|LOCUS_01490 36340 35675 gene locus_tag LOCUS_01500 gene rsmG 36340 35675 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056575.1 protein_id gnl|my_center|LOCUS_01500 37022 36489 gene locus_tag LOCUS_01510 37022 36489 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051772.1 protein_id gnl|my_center|LOCUS_01510 38152 37145 gene locus_tag LOCUS_01520 gene yidC 38152 37145 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051771.1 protein_id gnl|my_center|LOCUS_01520 38744 38463 gene locus_tag LOCUS_01530 gene rnpA 38744 38463 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051769.1 protein_id gnl|my_center|LOCUS_01530 38989 38855 gene locus_tag LOCUS_01540 gene rpmH 38989 38855 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051768.1 protein_id gnl|my_center|LOCUS_01540 39308 40810 gene locus_tag LOCUS_01550 gene dnaA 39308 40810 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051767.1 protein_id gnl|my_center|LOCUS_01550 41545 42669 gene locus_tag LOCUS_01560 gene dnaN 41545 42669 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051765.1 protein_id gnl|my_center|LOCUS_01560 42697 43467 gene locus_tag LOCUS_01570 42697 43467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 43447 43456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43499 43954 gene locus_tag LOCUS_01580 43499 43954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 43951 44421 gene locus_tag LOCUS_01590 43951 44421 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783054.1 protein_id gnl|my_center|LOCUS_01590 44602 46692 gene locus_tag LOCUS_01600 gene gyrB 44602 46692 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361534.1 protein_id gnl|my_center|LOCUS_01600 46760 49411 gene locus_tag LOCUS_01610 gene gyrA 46760 49411 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068593.1 protein_id gnl|my_center|LOCUS_01610 49481 50047 gene locus_tag LOCUS_01620 49481 50047 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051760.1 protein_id gnl|my_center|LOCUS_01620 50566 50775 gene locus_tag LOCUS_01630 50566 50775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence005 373 1113 gene locus_tag LOCUS_01640 gene pyrH 373 1113 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052755.1 protein_id gnl|my_center|LOCUS_01640 1190 1741 gene locus_tag LOCUS_01650 gene frr 1190 1741 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052756.1 protein_id gnl|my_center|LOCUS_01650 1764 2330 gene locus_tag LOCUS_01660 1764 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01660 2352 2750 gene locus_tag LOCUS_01670 2352 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01670 2925 4094 gene locus_tag LOCUS_01680 gene rlmN 2925 4094 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068098.1 protein_id gnl|my_center|LOCUS_01680 4643 4095 gene locus_tag LOCUS_01690 4643 4095 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052759.1 protein_id gnl|my_center|LOCUS_01690 4818 5588 gene locus_tag LOCUS_01700 gene hisF 4818 5588 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068099.1 protein_id gnl|my_center|LOCUS_01700 5722 6117 gene locus_tag LOCUS_01710 gene hisI 5722 6117 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052762.1 protein_id gnl|my_center|LOCUS_01710 6198 7754 gene locus_tag LOCUS_01720 gene trpE 6198 7754 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052763.1 protein_id gnl|my_center|LOCUS_01720 8031 7819 gene locus_tag LOCUS_01730 8031 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8489 8010 gene locus_tag LOCUS_01740 8489 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8642 10243 gene locus_tag LOCUS_01750 8642 10243 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052765.1 protein_id gnl|my_center|LOCUS_01750 10262 10951 gene locus_tag LOCUS_01760 10262 10951 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054307.1 protein_id gnl|my_center|LOCUS_01760 11022 11276 gene locus_tag LOCUS_01770 11022 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01770 12116 11445 gene locus_tag LOCUS_01780 12116 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068101.1 protein_id gnl|my_center|LOCUS_01780 12862 12113 gene locus_tag LOCUS_01790 12862 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 13176 12763 gene locus_tag LOCUS_01800 13176 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 13823 13176 gene locus_tag LOCUS_01810 13823 13176 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054303.1 protein_id gnl|my_center|LOCUS_01810 14023 15636 gene locus_tag LOCUS_01820 14023 15636 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068103.1 protein_id gnl|my_center|LOCUS_01820 15633 16307 gene locus_tag LOCUS_01830 15633 16307 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783544.1 protein_id gnl|my_center|LOCUS_01830 16402 16411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16446 19868 gene locus_tag LOCUS_01840 16446 19868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582773.1 protein_id gnl|my_center|LOCUS_01840 20064 23099 gene locus_tag LOCUS_01850 gene uvrA 20064 23099 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068107.1 protein_id gnl|my_center|LOCUS_01850 23245 25611 gene locus_tag LOCUS_01860 gene uvrC 23245 25611 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582770.1 protein_id gnl|my_center|LOCUS_01860 25720 26691 gene locus_tag LOCUS_01870 25720 26691 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056051.1 protein_id gnl|my_center|LOCUS_01870 26691 27677 gene locus_tag LOCUS_01880 gene rapZ 26691 27677 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068108.1 protein_id gnl|my_center|LOCUS_01880 27876 28826 gene locus_tag LOCUS_01890 gene whiA 27876 28826 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052782.1 protein_id gnl|my_center|LOCUS_01890 28995 30200 gene locus_tag LOCUS_01900 28995 30200 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032737730.1 protein_id gnl|my_center|LOCUS_01900 30258 31061 gene locus_tag LOCUS_01910 gene tpiA 30258 31061 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052784.1 protein_id gnl|my_center|LOCUS_01910 31125 31373 gene locus_tag LOCUS_01920 gene secG 31125 31373 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829342.1 protein_id gnl|my_center|LOCUS_01920 31475 31840 gene locus_tag LOCUS_01930 31475 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01930 31757 31766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31783 32436 gene locus_tag LOCUS_01940 31783 32436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01940 32433 33284 gene locus_tag LOCUS_01950 32433 33284 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054292.1 protein_id gnl|my_center|LOCUS_01950 33395 33985 gene locus_tag LOCUS_01960 33395 33985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01960 33869 33878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33895 34941 gene locus_tag LOCUS_01970 33895 34941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 34945 35400 gene locus_tag LOCUS_01980 34945 35400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 35180 35189 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36691 35582 gene locus_tag LOCUS_01990 36691 35582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056804.1 protein_id gnl|my_center|LOCUS_01990 37326 36862 gene locus_tag LOCUS_02000 37326 36862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 >Feature sequence006 277 53 gene locus_tag LOCUS_02010 277 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 511 323 gene locus_tag LOCUS_02020 511 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1720 632 gene locus_tag LOCUS_02030 gene fbaA 1720 632 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389412.1 protein_id gnl|my_center|LOCUS_02030 1954 2814 gene locus_tag LOCUS_02040 1954 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2888 2815 gene locus_tag LOCUS_t00030 2888 2815 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5564 3045 gene locus_tag LOCUS_02050 5564 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6645 5725 gene locus_tag LOCUS_02060 gene htpX 6645 5725 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055925.1 protein_id gnl|my_center|LOCUS_02060 8267 6816 gene locus_tag LOCUS_02070 8267 6816 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068540.1 protein_id gnl|my_center|LOCUS_02070 8509 9198 gene locus_tag LOCUS_02080 8509 9198 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068541.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02080 11629 9326 gene locus_tag LOCUS_02090 11629 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 13517 11841 gene locus_tag LOCUS_02100 13517 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 13947 13411 gene locus_tag LOCUS_02110 13947 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 14650 13955 gene locus_tag LOCUS_02120 14650 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02120 14892 14716 gene locus_tag LOCUS_02130 14892 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02130 16305 14983 gene locus_tag LOCUS_02140 16305 14983 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803812.1 protein_id gnl|my_center|LOCUS_02140 17290 16676 gene locus_tag LOCUS_02150 17290 16676 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207760114.1 protein_id gnl|my_center|LOCUS_02150 19653 17377 gene locus_tag LOCUS_02160 19653 17377 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068542.1 protein_id gnl|my_center|LOCUS_02160 22096 20063 gene locus_tag LOCUS_02170 22096 20063 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068543.1 protein_id gnl|my_center|LOCUS_02170 22513 23841 gene locus_tag LOCUS_02180 gene tgt 22513 23841 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051676.1 protein_id gnl|my_center|LOCUS_02180 23228 23237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24013 24096 gene locus_tag LOCUS_t00040 24013 24096 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24170 24391 gene locus_tag LOCUS_02190 24170 24391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 24936 24421 gene locus_tag LOCUS_02200 24936 24421 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068547.1 protein_id gnl|my_center|LOCUS_02200 25350 25018 gene locus_tag LOCUS_02210 25350 25018 CDS product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051681.1 protein_id gnl|my_center|LOCUS_02210 27132 25408 gene locus_tag LOCUS_02220 27132 25408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 27586 27203 gene locus_tag LOCUS_02230 27586 27203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 28442 27849 gene locus_tag LOCUS_02240 28442 27849 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068552.1 protein_id gnl|my_center|LOCUS_02240 29419 28445 gene locus_tag LOCUS_02250 gene msrB 29419 28445 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055903.1 protein_id gnl|my_center|LOCUS_02250 29649 29416 gene locus_tag LOCUS_02260 29649 29416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 32479 29795 gene locus_tag LOCUS_02270 32479 29795 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068555.1 protein_id gnl|my_center|LOCUS_02270 33714 32476 gene locus_tag LOCUS_02280 33714 32476 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740565.1 protein_id gnl|my_center|LOCUS_02280 34022 33642 gene locus_tag LOCUS_02290 34022 33642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 33791 33800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence007 <1 2242 gene locus_tag LOCUS_02300 <1 2242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068577.1:phosphoenolpyruvate carboxylase 3464 2466 gene locus_tag LOCUS_02310 3464 2466 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582297.1 protein_id gnl|my_center|LOCUS_02310 4803 3778 gene locus_tag LOCUS_02320 4803 3778 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_02320 6367 4889 gene locus_tag LOCUS_02330 6367 4889 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582926.1 protein_id gnl|my_center|LOCUS_02330 7762 6410 gene locus_tag LOCUS_02340 7762 6410 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_02340 8657 7827 gene locus_tag LOCUS_02350 8657 7827 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_02350 9533 8664 gene locus_tag LOCUS_02360 9533 8664 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_02360 10970 9633 gene locus_tag LOCUS_02370 10970 9633 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_02370 11975 11784 gene locus_tag LOCUS_02380 11975 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 12759 12379 gene locus_tag LOCUS_02390 12759 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 14768 12879 gene locus_tag LOCUS_02400 14768 12879 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056574.1 protein_id gnl|my_center|LOCUS_02400 15457 14891 gene locus_tag LOCUS_02410 gene ahpC 15457 14891 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056578.1 protein_id gnl|my_center|LOCUS_02410 15727 16410 gene locus_tag LOCUS_02420 15727 16410 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068585.1 protein_id gnl|my_center|LOCUS_02420 16501 16926 gene locus_tag LOCUS_02430 16501 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 17208 18194 gene locus_tag LOCUS_02440 17208 18194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02440 18234 19169 gene locus_tag LOCUS_02450 18234 19169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02450 19492 19208 gene locus_tag LOCUS_02460 19492 19208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 19382 20725 gene locus_tag LOCUS_02470 19382 20725 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582296.1 protein_id gnl|my_center|LOCUS_02470 20822 21301 gene locus_tag LOCUS_02480 20822 21301 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051742.1 protein_id gnl|my_center|LOCUS_02480 21536 22849 gene locus_tag LOCUS_02490 21536 22849 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_02490 23185 22862 gene locus_tag LOCUS_02500 23185 22862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 23489 23166 gene locus_tag LOCUS_02510 23489 23166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 25404 23857 gene locus_tag LOCUS_02520 25404 23857 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389504.1 protein_id gnl|my_center|LOCUS_02520 27845 25602 gene locus_tag LOCUS_02530 27845 25602 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068724.1 protein_id gnl|my_center|LOCUS_02530 29240 28326 gene locus_tag LOCUS_02540 29240 28326 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054570.1 protein_id gnl|my_center|LOCUS_02540 29380 30666 gene locus_tag LOCUS_02550 29380 30666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02550 30737 31084 gene locus_tag LOCUS_02560 30737 31084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 31285 31359 gene locus_tag LOCUS_t00050 31285 31359 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 31401 31474 gene locus_tag LOCUS_t00060 31401 31474 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31632 31883 gene locus_tag LOCUS_02570 31632 31883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 31977 32567 gene locus_tag LOCUS_02580 31977 32567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 32527 32781 gene locus_tag LOCUS_02590 32527 32781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 33153 32872 gene locus_tag LOCUS_02600 33153 32872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 33512 33150 gene locus_tag LOCUS_02610 33512 33150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence008 3 866 gene locus_tag LOCUS_02620 3 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1838 996 gene locus_tag LOCUS_02630 1838 996 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056307.1 protein_id gnl|my_center|LOCUS_02630 1903 2002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3209 2184 gene locus_tag LOCUS_02640 3209 2184 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054721.1 protein_id gnl|my_center|LOCUS_02640 4744 3206 gene locus_tag LOCUS_02650 gene zwf 4744 3206 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056756.1 protein_id gnl|my_center|LOCUS_02650 4920 4993 gene locus_tag LOCUS_t00070 4920 4993 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5192 6499 gene locus_tag LOCUS_02660 5192 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7290 6496 gene locus_tag LOCUS_02670 7290 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 7436 7684 gene locus_tag LOCUS_02680 7436 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 7700 8026 gene locus_tag LOCUS_02690 7700 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 8148 9401 gene locus_tag LOCUS_02700 8148 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 10671 9403 gene locus_tag LOCUS_02710 10671 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 12355 11354 gene locus_tag LOCUS_02720 12355 11354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 12855 12394 gene locus_tag LOCUS_02730 12855 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13449 15083 gene locus_tag LOCUS_02740 13449 15083 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054723.1 protein_id gnl|my_center|LOCUS_02740 16191 15157 gene locus_tag LOCUS_02750 16191 15157 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056302.1 protein_id gnl|my_center|LOCUS_02750 17036 16215 gene locus_tag LOCUS_02760 17036 16215 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054725.1 protein_id gnl|my_center|LOCUS_02760 17159 18430 gene locus_tag LOCUS_02770 gene ftsY 17159 18430 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056312.1 protein_id gnl|my_center|LOCUS_02770 18737 20032 gene locus_tag LOCUS_02780 18737 20032 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054727.1 protein_id gnl|my_center|LOCUS_02780 20034 20372 gene locus_tag LOCUS_02790 20034 20372 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_02790 20516 22306 gene locus_tag LOCUS_02800 20516 22306 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058100.1 protein_id gnl|my_center|LOCUS_02800 23773 22340 gene locus_tag LOCUS_02810 23773 22340 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051563.1 protein_id gnl|my_center|LOCUS_02810 24061 25521 gene locus_tag LOCUS_02820 gene dnaB 24061 25521 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054729.1 protein_id gnl|my_center|LOCUS_02820 25521 26993 gene locus_tag LOCUS_02830 25521 26993 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_02830 27094 27846 gene locus_tag LOCUS_02840 27094 27846 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051560.1 protein_id gnl|my_center|LOCUS_02840 27995 28282 gene locus_tag LOCUS_02850 27995 28282 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054731.1 protein_id gnl|my_center|LOCUS_02850 28279 30099 gene locus_tag LOCUS_02860 28279 30099 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051558.1 protein_id gnl|my_center|LOCUS_02860 <30960 30114 gene locus_tag LOCUS_02870 <30960 30114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054733.1:LacI family DNA-binding transcriptional regulator >Feature sequence009 226 1644 gene locus_tag LOCUS_02880 226 1644 CDS product PIF1 family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068808.1 protein_id gnl|my_center|LOCUS_02880 2156 3463 gene locus_tag LOCUS_02890 2156 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02890 3698 4486 gene locus_tag LOCUS_02900 3698 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02900 4403 4412 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4464 4643 gene locus_tag LOCUS_02910 4464 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02910 5294 4668 gene locus_tag LOCUS_02920 5294 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5445 7229 gene locus_tag LOCUS_02930 5445 7229 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055676.1 protein_id gnl|my_center|LOCUS_02930 7505 8242 gene locus_tag LOCUS_02940 7505 8242 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068810.1 protein_id gnl|my_center|LOCUS_02940 10499 8325 gene locus_tag LOCUS_02950 10499 8325 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582898.1 protein_id gnl|my_center|LOCUS_02950 10676 11656 gene locus_tag LOCUS_02960 10676 11656 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052459.1 protein_id gnl|my_center|LOCUS_02960 11937 14417 gene locus_tag LOCUS_02970 11937 14417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 14616 14849 gene locus_tag LOCUS_02980 14616 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 15888 14914 gene locus_tag LOCUS_02990 15888 14914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 16339 16584 gene locus_tag LOCUS_03000 16339 16584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 16994 17197 gene locus_tag LOCUS_03010 16994 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 17283 18065 gene locus_tag LOCUS_03020 gene map 17283 18065 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052460.1 protein_id gnl|my_center|LOCUS_03020 18503 19576 gene locus_tag LOCUS_03030 18503 19576 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053894.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03030 20808 19789 gene locus_tag LOCUS_03040 gene dapD 20808 19789 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052463.1 protein_id gnl|my_center|LOCUS_03040 22126 21041 gene locus_tag LOCUS_03050 22126 21041 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052464.1 protein_id gnl|my_center|LOCUS_03050 22204 26388 gene locus_tag LOCUS_03060 22204 26388 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058870.1 protein_id gnl|my_center|LOCUS_03060 26902 26597 gene locus_tag LOCUS_03070 26902 26597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 27057 27491 gene locus_tag LOCUS_03080 27057 27491 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055942.1 protein_id gnl|my_center|LOCUS_03080 <28284 27522 gene locus_tag LOCUS_03090 <28284 27522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053899.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence010 <1 506 gene locus_tag LOCUS_03100 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051809.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC 729 2141 gene locus_tag LOCUS_03110 729 2141 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068617.1 protein_id gnl|my_center|LOCUS_03110 3240 2248 gene locus_tag LOCUS_03120 gene rlmB 3240 2248 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 protein_id gnl|my_center|LOCUS_03120 3328 4626 gene locus_tag LOCUS_03130 3328 4626 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068619.1 protein_id gnl|my_center|LOCUS_03130 4714 5535 gene locus_tag LOCUS_03140 4714 5535 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_03140 5718 8705 gene locus_tag LOCUS_03150 5718 8705 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_03150 10619 8943 gene locus_tag LOCUS_03160 10619 8943 CDS product FIVAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068621.1 protein_id gnl|my_center|LOCUS_03160 11263 10682 gene locus_tag LOCUS_03170 gene dcd 11263 10682 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051821.1 protein_id gnl|my_center|LOCUS_03170 11916 12506 gene locus_tag LOCUS_03180 11916 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 12625 12837 gene locus_tag LOCUS_03190 12625 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03190 12924 13382 gene locus_tag LOCUS_03200 12924 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03200 15648 13576 gene locus_tag LOCUS_03210 15648 13576 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068624.1 protein_id gnl|my_center|LOCUS_03210 15788 16219 gene locus_tag LOCUS_03220 15788 16219 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056534.1 protein_id gnl|my_center|LOCUS_03220 16339 18645 gene locus_tag LOCUS_03230 16339 18645 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056897.1 protein_id gnl|my_center|LOCUS_03230 18712 18721 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19974 18766 gene locus_tag LOCUS_03240 19974 18766 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054616.1 protein_id gnl|my_center|LOCUS_03240 20148 21437 gene locus_tag LOCUS_03250 20148 21437 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 protein_id gnl|my_center|LOCUS_03250 21459 22400 gene locus_tag LOCUS_03260 21459 22400 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_03260 22418 23284 gene locus_tag LOCUS_03270 22418 23284 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_03270 23488 25308 gene locus_tag LOCUS_03280 23488 25308 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 protein_id gnl|my_center|LOCUS_03280 25557 26822 gene locus_tag LOCUS_03290 gene ilvA 25557 26822 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051833.1 protein_id gnl|my_center|LOCUS_03290 27723 26968 gene locus_tag LOCUS_03300 27723 26968 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051834.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence011 417 28 gene locus_tag LOCUS_03310 417 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 504 701 gene locus_tag LOCUS_03320 504 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 1449 742 gene locus_tag LOCUS_03330 1449 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582922.1 protein_id gnl|my_center|LOCUS_03330 1654 1415 gene locus_tag LOCUS_03340 1654 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1678 2745 gene locus_tag LOCUS_03350 gene nusA 1678 2745 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782965.1 protein_id gnl|my_center|LOCUS_03350 3015 5942 gene locus_tag LOCUS_03360 gene infB 3015 5942 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068747.1 protein_id gnl|my_center|LOCUS_03360 6093 6569 gene locus_tag LOCUS_03370 gene rbfA 6093 6569 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052308.1 protein_id gnl|my_center|LOCUS_03370 6571 7734 gene locus_tag LOCUS_03380 6571 7734 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068748.1 protein_id gnl|my_center|LOCUS_03380 7833 8957 gene locus_tag LOCUS_03390 7833 8957 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055364.1 protein_id gnl|my_center|LOCUS_03390 10510 8972 gene locus_tag LOCUS_03400 10510 8972 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055359.1 protein_id gnl|my_center|LOCUS_03400 10638 11192 gene locus_tag LOCUS_03410 10638 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052313.1 protein_id gnl|my_center|LOCUS_03410 12402 11704 gene locus_tag LOCUS_03420 gene rpiA 12402 11704 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052314.1 protein_id gnl|my_center|LOCUS_03420 13369 12533 gene locus_tag LOCUS_03430 13369 12533 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081966502.1 protein_id gnl|my_center|LOCUS_03430 14015 14167 gene locus_tag LOCUS_03440 14015 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 15960 14326 gene locus_tag LOCUS_03450 15960 14326 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068753.1 protein_id gnl|my_center|LOCUS_03450 16536 16114 gene locus_tag LOCUS_03460 16536 16114 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052318.1 protein_id gnl|my_center|LOCUS_03460 16769 17866 gene locus_tag LOCUS_03470 16769 17866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068754.1 protein_id gnl|my_center|LOCUS_03470 20276 18600 gene locus_tag LOCUS_03480 gene pgm 20276 18600 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068756.1 protein_id gnl|my_center|LOCUS_03480 21808 20363 gene locus_tag LOCUS_03490 21808 20363 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068757.1 protein_id gnl|my_center|LOCUS_03490 21696 21947 gene locus_tag LOCUS_03500 21696 21947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 22012 22021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22420 24774 gene locus_tag LOCUS_03510 22420 24774 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068758.1 protein_id gnl|my_center|LOCUS_03510 24792 25631 gene locus_tag LOCUS_03520 24792 25631 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068759.1 protein_id gnl|my_center|LOCUS_03520 26817 25636 gene locus_tag LOCUS_03530 26817 25636 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053825.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence012 <1 697 gene locus_tag LOCUS_03540 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068009.1:aldose 1-epimerase family protein 1284 964 gene locus_tag LOCUS_03550 1284 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054435.1 protein_id gnl|my_center|LOCUS_03550 2072 1284 gene locus_tag LOCUS_03560 2072 1284 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057260.1 protein_id gnl|my_center|LOCUS_03560 2211 3764 gene locus_tag LOCUS_03570 2211 3764 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054433.1 protein_id gnl|my_center|LOCUS_03570 3886 4881 gene locus_tag LOCUS_03580 3886 4881 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068007.1 protein_id gnl|my_center|LOCUS_03580 8677 5000 gene locus_tag LOCUS_03590 gene smc 8677 5000 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068006.1 protein_id gnl|my_center|LOCUS_03590 10357 8738 gene locus_tag LOCUS_03600 10357 8738 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068005.1 protein_id gnl|my_center|LOCUS_03600 11918 12523 gene locus_tag LOCUS_03610 11918 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 12827 14422 gene locus_tag LOCUS_03620 12827 14422 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068002.1 protein_id gnl|my_center|LOCUS_03620 14471 14992 gene locus_tag LOCUS_03630 14471 14992 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057255.1 protein_id gnl|my_center|LOCUS_03630 16751 15042 gene locus_tag LOCUS_03640 16751 15042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052568.1 protein_id gnl|my_center|LOCUS_03640 17924 16755 gene locus_tag LOCUS_03650 17924 16755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052567.1 protein_id gnl|my_center|LOCUS_03650 19017 17926 gene locus_tag LOCUS_03660 19017 17926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052566.1 protein_id gnl|my_center|LOCUS_03660 20817 19183 gene locus_tag LOCUS_03670 20817 19183 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068000.1 protein_id gnl|my_center|LOCUS_03670 22487 21099 gene locus_tag LOCUS_03680 22487 21099 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067999.1 protein_id gnl|my_center|LOCUS_03680 23356 22544 gene locus_tag LOCUS_03690 gene nagB 23356 22544 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052563.1 protein_id gnl|my_center|LOCUS_03690 23694 24818 gene locus_tag LOCUS_03700 23694 24818 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080889.1 protein_id gnl|my_center|LOCUS_03700 25200 24958 gene locus_tag LOCUS_03710 25200 24958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence013 27 857 gene locus_tag LOCUS_03720 27 857 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 protein_id gnl|my_center|LOCUS_03720 1607 846 gene locus_tag LOCUS_03730 1607 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2065 1709 gene locus_tag LOCUS_03740 2065 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4289 2082 gene locus_tag LOCUS_03750 4289 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2941 2950 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6370 4295 gene locus_tag LOCUS_03760 6370 4295 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101626140.1 protein_id gnl|my_center|LOCUS_03760 6814 6533 gene locus_tag LOCUS_03770 6814 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 7204 6818 gene locus_tag LOCUS_03780 7204 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068459.1 protein_id gnl|my_center|LOCUS_03780 7623 7201 gene locus_tag LOCUS_03790 7623 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068458.1 protein_id gnl|my_center|LOCUS_03790 8015 7635 gene locus_tag LOCUS_03800 8015 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068457.1 protein_id gnl|my_center|LOCUS_03800 8344 8012 gene locus_tag LOCUS_03810 8344 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068456.1 protein_id gnl|my_center|LOCUS_03810 9954 8347 gene locus_tag LOCUS_03820 9954 8347 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068455.1 protein_id gnl|my_center|LOCUS_03820 11084 9951 gene locus_tag LOCUS_03830 11084 9951 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068454.1 protein_id gnl|my_center|LOCUS_03830 12625 11186 gene locus_tag LOCUS_03840 12625 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072725739.1 protein_id gnl|my_center|LOCUS_03840 12926 12615 gene locus_tag LOCUS_03850 12926 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 13819 13094 gene locus_tag LOCUS_03860 13819 13094 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068451.1 protein_id gnl|my_center|LOCUS_03860 14007 13816 gene locus_tag LOCUS_03870 14007 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 14384 14016 gene locus_tag LOCUS_03880 14384 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 14692 14384 gene locus_tag LOCUS_03890 14692 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 15316 15134 gene locus_tag LOCUS_03900 15316 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 15565 15425 gene locus_tag LOCUS_03910 15565 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 15581 15590 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15871 15659 gene locus_tag LOCUS_03920 15871 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 16040 15858 gene locus_tag LOCUS_03930 16040 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 16164 16838 gene locus_tag LOCUS_03940 16164 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 17046 16759 gene locus_tag LOCUS_03950 17046 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 17762 17686 gene locus_tag LOCUS_t00080 17762 17686 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17978 19012 gene locus_tag LOCUS_03960 gene metA 17978 19012 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 protein_id gnl|my_center|LOCUS_03960 19314 20126 gene locus_tag LOCUS_03970 gene atpB 19314 20126 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051483.1 protein_id gnl|my_center|LOCUS_03970 20230 20457 gene locus_tag LOCUS_03980 gene atpE 20230 20457 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 protein_id gnl|my_center|LOCUS_03980 20514 21032 gene locus_tag LOCUS_03990 20514 21032 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051482.1 protein_id gnl|my_center|LOCUS_03990 21067 21903 gene locus_tag LOCUS_04000 21067 21903 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054765.1 protein_id gnl|my_center|LOCUS_04000 21979 23607 gene locus_tag LOCUS_04010 gene atpA 21979 23607 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051480.1 protein_id gnl|my_center|LOCUS_04010 23611 24534 gene locus_tag LOCUS_04020 23611 24534 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051479.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence014 794 1339 gene locus_tag LOCUS_04030 794 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 1225 2265 gene locus_tag LOCUS_04040 1225 2265 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015512063.1 protein_id gnl|my_center|LOCUS_04040 2342 3274 gene locus_tag LOCUS_04050 2342 3274 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053078.1 protein_id gnl|my_center|LOCUS_04050 3368 4621 gene locus_tag LOCUS_04060 3368 4621 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 protein_id gnl|my_center|LOCUS_04060 5995 4670 gene locus_tag LOCUS_04070 gene murA 5995 4670 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056295.1 protein_id gnl|my_center|LOCUS_04070 6245 7591 gene locus_tag LOCUS_04080 6245 7591 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068710.1 protein_id gnl|my_center|LOCUS_04080 8924 7797 gene locus_tag LOCUS_04090 8924 7797 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068709.1 protein_id gnl|my_center|LOCUS_04090 9968 8964 gene locus_tag LOCUS_04100 9968 8964 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225431769.1 protein_id gnl|my_center|LOCUS_04100 10549 10740 gene locus_tag LOCUS_04110 10549 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 11655 10963 gene locus_tag LOCUS_04120 gene leuD 11655 10963 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053083.1 protein_id gnl|my_center|LOCUS_04120 13143 11740 gene locus_tag LOCUS_04130 gene leuC 13143 11740 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053084.1 protein_id gnl|my_center|LOCUS_04130 13461 14237 gene locus_tag LOCUS_04140 13461 14237 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081262.1 protein_id gnl|my_center|LOCUS_04140 15876 14473 gene locus_tag LOCUS_04150 15876 14473 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068707.1 protein_id gnl|my_center|LOCUS_04150 16351 18588 gene locus_tag LOCUS_04160 16351 18588 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068706.1 protein_id gnl|my_center|LOCUS_04160 18758 19945 gene locus_tag LOCUS_04170 18758 19945 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507753.1 protein_id gnl|my_center|LOCUS_04170 19935 20756 gene locus_tag LOCUS_04180 19935 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 protein_id gnl|my_center|LOCUS_04180 23195 21216 gene locus_tag LOCUS_04190 23195 21216 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence015 153 938 gene locus_tag LOCUS_04200 153 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 644 653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 919 1158 gene locus_tag LOCUS_04210 919 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 1426 2358 gene locus_tag LOCUS_04220 1426 2358 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776936.1 protein_id gnl|my_center|LOCUS_04220 2378 3361 gene locus_tag LOCUS_04230 2378 3361 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776935.1 protein_id gnl|my_center|LOCUS_04230 3267 4580 gene locus_tag LOCUS_04240 3267 4580 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776938.1 protein_id gnl|my_center|LOCUS_04240 4577 4810 gene locus_tag LOCUS_04250 4577 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 4598 4607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5481 4786 gene locus_tag LOCUS_04260 5481 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582793.1 protein_id gnl|my_center|LOCUS_04260 5542 6243 gene locus_tag LOCUS_04270 5542 6243 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068041.1 protein_id gnl|my_center|LOCUS_04270 8560 6287 gene locus_tag LOCUS_04280 8560 6287 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068042.1 protein_id gnl|my_center|LOCUS_04280 9786 8704 gene locus_tag LOCUS_04290 9786 8704 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055156.1 protein_id gnl|my_center|LOCUS_04290 9991 10653 gene locus_tag LOCUS_04300 9991 10653 CDS product DUF4192 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068044.1 protein_id gnl|my_center|LOCUS_04300 10856 12184 gene locus_tag LOCUS_04310 10856 12184 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055162.1 protein_id gnl|my_center|LOCUS_04310 12242 14560 gene locus_tag LOCUS_04320 12242 14560 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068045.1 protein_id gnl|my_center|LOCUS_04320 14923 16149 gene locus_tag LOCUS_04330 14923 16149 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_04330 16223 16729 gene locus_tag LOCUS_04340 16223 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04340 16629 17186 gene locus_tag LOCUS_04350 16629 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04350 17202 21935 gene locus_tag LOCUS_04360 17202 21935 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068048.1 protein_id gnl|my_center|LOCUS_04360 22734 21946 gene locus_tag LOCUS_04370 22734 21946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054494.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence016 261 64 gene locus_tag LOCUS_04380 261 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 180 1109 gene locus_tag LOCUS_04390 180 1109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081272.1 protein_id gnl|my_center|LOCUS_04390 1106 2146 gene locus_tag LOCUS_04400 1106 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 2113 2122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2152 2505 gene locus_tag LOCUS_04410 2152 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04410 4501 2636 gene locus_tag LOCUS_04420 4501 2636 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 protein_id gnl|my_center|LOCUS_04420 4795 5772 gene locus_tag LOCUS_04430 4795 5772 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389557.1 protein_id gnl|my_center|LOCUS_04430 7169 5841 gene locus_tag LOCUS_04440 7169 5841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813466.1 protein_id gnl|my_center|LOCUS_04440 8340 7291 gene locus_tag LOCUS_04450 8340 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 8485 8715 gene locus_tag LOCUS_04460 8485 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 8717 9163 gene locus_tag LOCUS_04470 8717 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 9299 9308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10396 9452 gene locus_tag LOCUS_04480 10396 9452 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 protein_id gnl|my_center|LOCUS_04480 10503 11708 gene locus_tag LOCUS_04490 gene dapE 10503 11708 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053064.1 protein_id gnl|my_center|LOCUS_04490 12022 15177 gene locus_tag LOCUS_04500 12022 15177 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582944.1 protein_id gnl|my_center|LOCUS_04500 15329 15637 gene locus_tag LOCUS_04510 gene rplU 15329 15637 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053062.1 protein_id gnl|my_center|LOCUS_04510 15660 15908 gene locus_tag LOCUS_04520 gene rpmA 15660 15908 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053061.1 protein_id gnl|my_center|LOCUS_04520 15978 17669 gene locus_tag LOCUS_04530 gene obgE 15978 17669 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053060.1 protein_id gnl|my_center|LOCUS_04530 17670 18803 gene locus_tag LOCUS_04540 gene proB 17670 18803 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055074.1 protein_id gnl|my_center|LOCUS_04540 18894 20099 gene locus_tag LOCUS_04550 18894 20099 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055070.1 protein_id gnl|my_center|LOCUS_04550 20230 20305 gene locus_tag LOCUS_t00090 20230 20305 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 20338 20565 gene locus_tag LOCUS_04560 gene secE 20338 20565 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053057.1 protein_id gnl|my_center|LOCUS_04560 20589 21401 gene locus_tag LOCUS_04570 gene nusG 20589 21401 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389487.1 protein_id gnl|my_center|LOCUS_04570 21702 22133 gene locus_tag LOCUS_04580 gene rplK 21702 22133 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053055.1 protein_id gnl|my_center|LOCUS_04580 22149 22841 gene locus_tag LOCUS_04590 gene rplA 22149 22841 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829786.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence017 670 1161 gene locus_tag LOCUS_04600 670 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 1202 1127 gene locus_tag LOCUS_t00100 1202 1127 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1323 1249 gene locus_tag LOCUS_t00110 1323 1249 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2561 1548 gene locus_tag LOCUS_04610 gene galE 2561 1548 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068781.1 protein_id gnl|my_center|LOCUS_04610 2890 3750 gene locus_tag LOCUS_04620 gene trmB 2890 3750 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068780.1 protein_id gnl|my_center|LOCUS_04620 3820 3893 gene locus_tag LOCUS_t00120 3820 3893 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4444 4695 gene locus_tag LOCUS_04630 4444 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4708 4956 gene locus_tag LOCUS_04640 4708 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5150 6361 gene locus_tag LOCUS_04650 5150 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6358 6807 gene locus_tag LOCUS_04660 6358 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 6912 7748 gene locus_tag LOCUS_04670 6912 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 7872 8279 gene locus_tag LOCUS_04680 7872 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 8414 8671 gene locus_tag LOCUS_04690 8414 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 10915 10151 gene locus_tag LOCUS_04700 10915 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068694.1 protein_id gnl|my_center|LOCUS_04700 12338 10908 gene locus_tag LOCUS_04710 12338 10908 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_04710 12744 15617 gene locus_tag LOCUS_04720 12744 15617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04720 15633 17039 gene locus_tag LOCUS_04730 15633 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04730 17717 17726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18306 17785 gene locus_tag LOCUS_04740 18306 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 18907 18260 gene locus_tag LOCUS_04750 18907 18260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 19675 18974 gene locus_tag LOCUS_04760 19675 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 19971 20177 gene locus_tag LOCUS_04770 19971 20177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 20197 21042 gene locus_tag LOCUS_04780 20197 21042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 21081 21461 gene locus_tag LOCUS_04790 21081 21461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 >Feature sequence018 794 1447 gene locus_tag LOCUS_04800 794 1447 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053234.1 protein_id gnl|my_center|LOCUS_04800 1578 4010 gene locus_tag LOCUS_04810 1578 4010 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054001.1 protein_id gnl|my_center|LOCUS_04810 4082 4387 gene locus_tag LOCUS_04820 4082 4387 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053232.1 protein_id gnl|my_center|LOCUS_04820 4851 4486 gene locus_tag LOCUS_04830 4851 4486 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053231.1 protein_id gnl|my_center|LOCUS_04830 4961 5551 gene locus_tag LOCUS_04840 4961 5551 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782692.1 protein_id gnl|my_center|LOCUS_04840 5977 6396 gene locus_tag LOCUS_04850 5977 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7507 6521 gene locus_tag LOCUS_04860 7507 6521 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_04860 7807 9264 gene locus_tag LOCUS_04870 7807 9264 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067926.1 protein_id gnl|my_center|LOCUS_04870 10971 9592 gene locus_tag LOCUS_04880 10971 9592 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067922.1 protein_id gnl|my_center|LOCUS_04880 13621 11054 gene locus_tag LOCUS_04890 13621 11054 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067921.1 protein_id gnl|my_center|LOCUS_04890 14828 13755 gene locus_tag LOCUS_04900 14828 13755 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055606.1 protein_id gnl|my_center|LOCUS_04900 15136 14894 gene locus_tag LOCUS_04910 15136 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058714.1 protein_id gnl|my_center|LOCUS_04910 15353 15126 gene locus_tag LOCUS_04920 15353 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 18836 15519 gene locus_tag LOCUS_04930 18836 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 19442 18903 gene locus_tag LOCUS_04940 19442 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 20145 19585 gene locus_tag LOCUS_04950 20145 19585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04950 21127 20045 gene locus_tag LOCUS_04960 21127 20045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 <21757 21216 gene locus_tag LOCUS_04970 <21757 21216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067917.1:ABC transporter permease subunit >Feature sequence019 870 1451 gene locus_tag LOCUS_04980 870 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1754 1521 gene locus_tag LOCUS_04990 1754 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1875 2525 gene locus_tag LOCUS_05000 1875 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 3604 3780 gene locus_tag LOCUS_05010 3604 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 4067 4354 gene locus_tag LOCUS_05020 4067 4354 CDS product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051627.1 protein_id gnl|my_center|LOCUS_05020 4351 4737 gene locus_tag LOCUS_05030 4351 4737 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051626.1 protein_id gnl|my_center|LOCUS_05030 4779 5165 gene locus_tag LOCUS_05040 4779 5165 CDS product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410434.1 protein_id gnl|my_center|LOCUS_05040 5213 6343 gene locus_tag LOCUS_05050 5213 6343 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057587.1 protein_id gnl|my_center|LOCUS_05050 7140 6541 gene locus_tag LOCUS_05060 7140 6541 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051623.1 protein_id gnl|my_center|LOCUS_05060 7336 9954 gene locus_tag LOCUS_05070 7336 9954 CDS product DNA polymerase III subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068519.1 protein_id gnl|my_center|LOCUS_05070 9736 10022 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatccgtggaatcagccgca 10078 10227 gene locus_tag LOCUS_05080 10078 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05080 10253 10855 gene locus_tag LOCUS_05090 gene recR 10253 10855 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051621.1 protein_id gnl|my_center|LOCUS_05090 11986 10865 gene locus_tag LOCUS_05100 11986 10865 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068518.1 protein_id gnl|my_center|LOCUS_05100 12702 13466 gene locus_tag LOCUS_05110 12702 13466 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051616.1 protein_id gnl|my_center|LOCUS_05110 13546 14088 gene locus_tag LOCUS_05120 13546 14088 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051615.1 protein_id gnl|my_center|LOCUS_05120 15263 14169 gene locus_tag LOCUS_05130 gene asd 15263 14169 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051614.1 protein_id gnl|my_center|LOCUS_05130 15356 15365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15462 16082 gene locus_tag LOCUS_05140 15462 16082 CDS product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051613.1 protein_id gnl|my_center|LOCUS_05140 16553 18748 gene locus_tag LOCUS_05150 16553 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 18839 20305 gene locus_tag LOCUS_05160 18839 20305 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170114992.1 protein_id gnl|my_center|LOCUS_05160 20601 20610 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence020 <1 1052 gene locus_tag LOCUS_05170 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065453223.1:2-isopropylmalate synthase 3543 1120 gene locus_tag LOCUS_05180 3543 1120 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582337.1 protein_id gnl|my_center|LOCUS_05180 3920 5071 gene locus_tag LOCUS_05190 3920 5071 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055559.1 protein_id gnl|my_center|LOCUS_05190 5195 8281 gene locus_tag LOCUS_05200 gene topA 5195 8281 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582338.1 protein_id gnl|my_center|LOCUS_05200 8517 9218 gene locus_tag LOCUS_05210 gene tmk 8517 9218 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051604.1 protein_id gnl|my_center|LOCUS_05210 9215 10444 gene locus_tag LOCUS_05220 9215 10444 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068508.1 protein_id gnl|my_center|LOCUS_05220 10333 10342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10491 11045 gene locus_tag LOCUS_05230 10491 11045 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817572.1 protein_id gnl|my_center|LOCUS_05230 11308 12909 gene locus_tag LOCUS_05240 11308 12909 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051601.1 protein_id gnl|my_center|LOCUS_05240 13028 14545 gene locus_tag LOCUS_05250 13028 14545 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068506.1 protein_id gnl|my_center|LOCUS_05250 15289 14942 gene locus_tag LOCUS_05260 15289 14942 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051599.1 protein_id gnl|my_center|LOCUS_05260 15490 16026 gene locus_tag LOCUS_05270 15490 16026 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051598.1 protein_id gnl|my_center|LOCUS_05270 17523 16072 gene locus_tag LOCUS_05280 17523 16072 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054697.1 protein_id gnl|my_center|LOCUS_05280 17763 18422 gene locus_tag LOCUS_05290 17763 18422 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051596.1 protein_id gnl|my_center|LOCUS_05290 18553 19467 gene locus_tag LOCUS_05300 18553 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068504.1 protein_id gnl|my_center|LOCUS_05300 <20775 19744 gene locus_tag LOCUS_05310 <20775 19744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068502.1:DUF805 domain-containing protein >Feature sequence021 1197 82 gene locus_tag LOCUS_05320 1197 82 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057860.1 protein_id gnl|my_center|LOCUS_05320 2163 1324 gene locus_tag LOCUS_05330 2163 1324 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068401.1 protein_id gnl|my_center|LOCUS_05330 3138 2281 gene locus_tag LOCUS_05340 gene lepB 3138 2281 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081174.1 protein_id gnl|my_center|LOCUS_05340 3670 3305 gene locus_tag LOCUS_05350 gene rplS 3670 3305 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811942.1 protein_id gnl|my_center|LOCUS_05350 4414 6204 gene locus_tag LOCUS_05360 4414 6204 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143234.1 protein_id gnl|my_center|LOCUS_05360 6223 7632 gene locus_tag LOCUS_05370 6223 7632 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994361.1 protein_id gnl|my_center|LOCUS_05370 9636 7939 gene locus_tag LOCUS_05380 gene pgi 9636 7939 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 protein_id gnl|my_center|LOCUS_05380 9927 10000 gene locus_tag LOCUS_t00130 9927 10000 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10087 10169 gene locus_tag LOCUS_t00140 10087 10169 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10360 11361 gene locus_tag LOCUS_05390 10360 11361 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068404.1 protein_id gnl|my_center|LOCUS_05390 12724 11444 gene locus_tag LOCUS_05400 12724 11444 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068405.1 protein_id gnl|my_center|LOCUS_05400 13673 12774 gene locus_tag LOCUS_05410 13673 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05410 14041 13673 gene locus_tag LOCUS_05420 14041 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05420 15383 14115 gene locus_tag LOCUS_05430 15383 14115 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068407.1 protein_id gnl|my_center|LOCUS_05430 15590 15663 gene locus_tag LOCUS_t00150 15590 15663 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16488 15829 gene locus_tag LOCUS_05440 16488 15829 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051401.1 protein_id gnl|my_center|LOCUS_05440 16525 16534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17386 16610 gene locus_tag LOCUS_05450 gene rph 17386 16610 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058292.1 protein_id gnl|my_center|LOCUS_05450 18962 17640 gene locus_tag LOCUS_05460 18962 17640 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055715.1 protein_id gnl|my_center|LOCUS_05460 19204 19818 gene locus_tag LOCUS_05470 19204 19818 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582373.1 protein_id gnl|my_center|LOCUS_05470 20317 19886 gene locus_tag LOCUS_05480 20317 19886 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051407.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence022 1445 900 gene locus_tag LOCUS_05490 1445 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 1915 1454 gene locus_tag LOCUS_05500 1915 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2307 2014 gene locus_tag LOCUS_05510 2307 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 4330 2672 gene locus_tag LOCUS_05520 4330 2672 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_05520 4761 4327 gene locus_tag LOCUS_05530 4761 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5066 4758 gene locus_tag LOCUS_05540 5066 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 5776 5063 gene locus_tag LOCUS_05550 5776 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 7253 5796 gene locus_tag LOCUS_05560 7253 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 8245 7253 gene locus_tag LOCUS_05570 8245 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 9187 8285 gene locus_tag LOCUS_05580 9187 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 10691 9240 gene locus_tag LOCUS_05590 10691 9240 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389442.1 protein_id gnl|my_center|LOCUS_05590 11086 10682 gene locus_tag LOCUS_05600 11086 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 11377 11883 gene locus_tag LOCUS_05610 11377 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 11912 12244 gene locus_tag LOCUS_05620 11912 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 13921 12362 gene locus_tag LOCUS_05630 13921 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 14637 14017 gene locus_tag LOCUS_05640 14637 14017 CDS product DUF4192 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813775.1 protein_id gnl|my_center|LOCUS_05640 15460 16476 gene locus_tag LOCUS_05650 15460 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 16490 17233 gene locus_tag LOCUS_05660 16490 17233 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_05660 17209 17223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17472 18191 gene locus_tag LOCUS_05670 17472 18191 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438100.1 protein_id gnl|my_center|LOCUS_05670 18333 18461 gene locus_tag LOCUS_05680 18333 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 18984 20138 gene locus_tag LOCUS_05690 18984 20138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 20125 20397 gene locus_tag LOCUS_05700 20125 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence023 594 1076 gene locus_tag LOCUS_05710 594 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 1177 2445 gene locus_tag LOCUS_05720 1177 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2445 2648 gene locus_tag LOCUS_05730 2445 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2653 3078 gene locus_tag LOCUS_05740 2653 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3113 3520 gene locus_tag LOCUS_05750 3113 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3563 3976 gene locus_tag LOCUS_05760 3563 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4999 5202 gene locus_tag LOCUS_05770 4999 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5196 5603 gene locus_tag LOCUS_05780 5196 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 5479 5488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5994 6407 gene locus_tag LOCUS_05790 5994 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6404 6970 gene locus_tag LOCUS_05800 6404 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6972 10319 gene locus_tag LOCUS_05810 6972 10319 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224114.1 protein_id gnl|my_center|LOCUS_05810 10502 11887 gene locus_tag LOCUS_05820 gene glmM 10502 11887 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051299.1 protein_id gnl|my_center|LOCUS_05820 11910 12563 gene locus_tag LOCUS_05830 11910 12563 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051298.1 protein_id gnl|my_center|LOCUS_05830 12560 14092 gene locus_tag LOCUS_05840 12560 14092 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068339.1 protein_id gnl|my_center|LOCUS_05840 14109 14240 gene locus_tag LOCUS_05850 14109 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 14475 15599 gene locus_tag LOCUS_05860 gene prfB 14475 15599 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051295.1 protein_id gnl|my_center|LOCUS_05860 15608 16777 gene locus_tag LOCUS_05870 gene ftsE 15608 16777 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068338.1 protein_id gnl|my_center|LOCUS_05870 16789 17712 gene locus_tag LOCUS_05880 gene ftsX 16789 17712 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068337.1 protein_id gnl|my_center|LOCUS_05880 17815 19179 gene locus_tag LOCUS_05890 17815 19179 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068336.1 protein_id gnl|my_center|LOCUS_05890 19344 19820 gene locus_tag LOCUS_05900 gene smpB 19344 19820 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051292.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence024 <1 749 gene locus_tag LOCUS_05910 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067907.1:ATP-dependent Clp protease ATP-binding subunit 1246 926 gene locus_tag LOCUS_05920 1246 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05920 1892 1194 gene locus_tag LOCUS_05930 1892 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05930 1251 1260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2219 1914 gene locus_tag LOCUS_05940 2219 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05940 2362 3843 gene locus_tag LOCUS_05950 2362 3843 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067909.1 protein_id gnl|my_center|LOCUS_05950 4054 5367 gene locus_tag LOCUS_05960 4054 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5029 5039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5337 6095 gene locus_tag LOCUS_05970 5337 6095 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_05970 6220 8007 gene locus_tag LOCUS_05980 6220 8007 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067912.1 protein_id gnl|my_center|LOCUS_05980 9673 8213 gene locus_tag LOCUS_05990 9673 8213 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053980.1 protein_id gnl|my_center|LOCUS_05990 9773 11173 gene locus_tag LOCUS_06000 gene hisS 9773 11173 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782706.1 protein_id gnl|my_center|LOCUS_06000 11209 13008 gene locus_tag LOCUS_06010 gene aspS 11209 13008 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067913.1 protein_id gnl|my_center|LOCUS_06010 14434 13469 gene locus_tag LOCUS_06020 14434 13469 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046726211.1 protein_id gnl|my_center|LOCUS_06020 14969 15520 gene locus_tag LOCUS_06030 14969 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 15714 16001 gene locus_tag LOCUS_06040 15714 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06040 16429 16058 gene locus_tag LOCUS_06050 16429 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 16689 17183 gene locus_tag LOCUS_06060 16689 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06060 17113 17122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17132 17452 gene locus_tag LOCUS_06070 17132 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06070 17484 18323 gene locus_tag LOCUS_06080 17484 18323 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012471745.1 protein_id gnl|my_center|LOCUS_06080 18323 19000 gene locus_tag LOCUS_06090 18323 19000 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053211.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence025 <1 959 gene locus_tag LOCUS_06100 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068303.1:aldehyde dehydrogenase family protein 2463 1192 gene locus_tag LOCUS_06110 gene purD 2463 1192 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051230.1 protein_id gnl|my_center|LOCUS_06110 3557 2520 gene locus_tag LOCUS_06120 gene purM 3557 2520 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_06120 5239 3728 gene locus_tag LOCUS_06130 gene purF 5239 3728 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051228.1 protein_id gnl|my_center|LOCUS_06130 5653 5444 gene locus_tag LOCUS_06140 5653 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5818 7407 gene locus_tag LOCUS_06150 5818 7407 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_06150 7404 7622 gene locus_tag LOCUS_06160 7404 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813910.1 protein_id gnl|my_center|LOCUS_06160 8633 7656 gene locus_tag LOCUS_06170 8633 7656 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051219.1 protein_id gnl|my_center|LOCUS_06170 9267 8740 gene locus_tag LOCUS_06180 9267 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 9356 10012 gene locus_tag LOCUS_06190 9356 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06190 10027 10713 gene locus_tag LOCUS_06200 10027 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06200 10780 11304 gene locus_tag LOCUS_06210 10780 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 10970 10979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11863 11321 gene locus_tag LOCUS_06220 11863 11321 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_06220 11967 12101 gene locus_tag LOCUS_06230 11967 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 12368 13180 gene locus_tag LOCUS_06240 12368 13180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 13923 13264 gene locus_tag LOCUS_06250 13923 13264 CDS product DUF6320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804300.1 protein_id gnl|my_center|LOCUS_06250 15290 13920 gene locus_tag LOCUS_06260 15290 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_06260 16567 15263 gene locus_tag LOCUS_06270 16567 15263 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051211.1 protein_id gnl|my_center|LOCUS_06270 <19451 16705 gene locus_tag LOCUS_06280 <19451 16705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068298.1:phosphoribosylformylglycinamidine synthase >Feature sequence026 516 3587 gene locus_tag LOCUS_06290 516 3587 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068233.1 protein_id gnl|my_center|LOCUS_06290 3861 3935 gene locus_tag LOCUS_t00160 3861 3935 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4401 4955 gene locus_tag LOCUS_06300 4401 4955 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_06300 4931 5149 gene locus_tag LOCUS_06310 4931 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 5775 5125 gene locus_tag LOCUS_06320 5775 5125 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052019.1 protein_id gnl|my_center|LOCUS_06320 6204 5779 gene locus_tag LOCUS_06330 6204 5779 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 protein_id gnl|my_center|LOCUS_06330 6479 6255 gene locus_tag LOCUS_06340 6479 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06340 8320 6455 gene locus_tag LOCUS_06350 gene glgX 8320 6455 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055470.1 protein_id gnl|my_center|LOCUS_06350 6482 6491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9068 8394 gene locus_tag LOCUS_06360 9068 8394 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052016.1 protein_id gnl|my_center|LOCUS_06360 10043 9114 gene locus_tag LOCUS_06370 10043 9114 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582492.1 protein_id gnl|my_center|LOCUS_06370 13071 10204 gene locus_tag LOCUS_06380 gene polA 13071 10204 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068236.1 protein_id gnl|my_center|LOCUS_06380 13902 13117 gene locus_tag LOCUS_06390 13902 13117 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068237.1 protein_id gnl|my_center|LOCUS_06390 14303 15667 gene locus_tag LOCUS_06400 14303 15667 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_06400 16775 15693 gene locus_tag LOCUS_06410 16775 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 16995 17621 gene locus_tag LOCUS_06420 16995 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 17640 17649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17767 18177 gene locus_tag LOCUS_06430 17767 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 18251 18637 gene locus_tag LOCUS_06440 18251 18637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 18722 19093 gene locus_tag LOCUS_06450 18722 19093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence027 1298 378 gene locus_tag LOCUS_06460 1298 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06460 1875 1489 gene locus_tag LOCUS_06470 1875 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1511 1520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2246 1893 gene locus_tag LOCUS_06480 2246 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 2890 2243 gene locus_tag LOCUS_06490 2890 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06490 3585 2884 gene locus_tag LOCUS_06500 3585 2884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 protein_id gnl|my_center|LOCUS_06500 3798 4397 gene locus_tag LOCUS_06510 3798 4397 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476510.1 protein_id gnl|my_center|LOCUS_06510 4810 4475 gene locus_tag LOCUS_06520 4810 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4789 4798 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4944 5096 gene locus_tag LOCUS_06530 4944 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 5508 5218 gene locus_tag LOCUS_06540 5508 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 5543 5651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6697 5942 gene locus_tag LOCUS_06550 6697 5942 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813940.1 protein_id gnl|my_center|LOCUS_06550 7827 6700 gene locus_tag LOCUS_06560 7827 6700 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390114.1 protein_id gnl|my_center|LOCUS_06560 9646 7970 gene locus_tag LOCUS_06570 9646 7970 CDS product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387410.1 protein_id gnl|my_center|LOCUS_06570 10083 9916 gene locus_tag LOCUS_06580 10083 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 10205 10083 gene locus_tag LOCUS_06590 10205 10083 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813936.1 protein_id gnl|my_center|LOCUS_06590 10502 10245 gene locus_tag LOCUS_06600 10502 10245 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390112.1 protein_id gnl|my_center|LOCUS_06600 10933 10628 gene locus_tag LOCUS_06610 gene rpsN 10933 10628 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813933.1 protein_id gnl|my_center|LOCUS_06610 11324 11154 gene locus_tag LOCUS_06620 gene rpmG 11324 11154 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 protein_id gnl|my_center|LOCUS_06620 11615 11496 gene locus_tag LOCUS_06630 11615 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11783 12553 gene locus_tag LOCUS_06640 11783 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390110.1 protein_id gnl|my_center|LOCUS_06640 12923 13846 gene locus_tag LOCUS_06650 12923 13846 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783577.1 protein_id gnl|my_center|LOCUS_06650 14105 16180 gene locus_tag LOCUS_06660 14105 16180 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068304.1 protein_id gnl|my_center|LOCUS_06660 16465 16797 gene locus_tag LOCUS_06670 16465 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 16755 18293 gene locus_tag LOCUS_06680 16755 18293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 18221 18604 gene locus_tag LOCUS_06690 18221 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence028 1866 691 gene locus_tag LOCUS_06700 1866 691 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_06700 3187 1934 gene locus_tag LOCUS_06710 3187 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3399 4388 gene locus_tag LOCUS_06720 3399 4388 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_06720 4443 5150 gene locus_tag LOCUS_06730 4443 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 5011 5020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5143 6987 gene locus_tag LOCUS_06740 5143 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06740 7159 7800 gene locus_tag LOCUS_06750 gene upp 7159 7800 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053093.1 protein_id gnl|my_center|LOCUS_06750 7848 8327 gene locus_tag LOCUS_06760 gene rlmH 7848 8327 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_06760 9632 8523 gene locus_tag LOCUS_06770 9632 8523 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057441.1 protein_id gnl|my_center|LOCUS_06770 10767 9658 gene locus_tag LOCUS_06780 10767 9658 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053096.1 protein_id gnl|my_center|LOCUS_06780 13584 10915 gene locus_tag LOCUS_06790 gene clpB 13584 10915 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057489.1 protein_id gnl|my_center|LOCUS_06790 15357 13798 gene locus_tag LOCUS_06800 gene hutH 15357 13798 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068701.1 protein_id gnl|my_center|LOCUS_06800 15604 16479 gene locus_tag LOCUS_06810 15604 16479 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068700.1 protein_id gnl|my_center|LOCUS_06810 16476 16652 gene locus_tag LOCUS_06820 16476 16652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 16850 17878 gene locus_tag LOCUS_06830 16850 17878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 18436 17948 gene locus_tag LOCUS_06840 18436 17948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence029 826 1089 gene locus_tag LOCUS_06850 826 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1222 1866 gene locus_tag LOCUS_06860 1222 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2417 2265 gene locus_tag LOCUS_06870 2417 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3748 2486 gene locus_tag LOCUS_06880 3748 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4412 5215 gene locus_tag LOCUS_06890 4412 5215 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410658.1 protein_id gnl|my_center|LOCUS_06890 5212 5544 gene locus_tag LOCUS_06900 5212 5544 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052362.1 protein_id gnl|my_center|LOCUS_06900 5712 5491 gene locus_tag LOCUS_06910 5712 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6241 5723 gene locus_tag LOCUS_06920 6241 5723 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052361.1 protein_id gnl|my_center|LOCUS_06920 6992 6375 gene locus_tag LOCUS_06930 6992 6375 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052360.1 protein_id gnl|my_center|LOCUS_06930 7902 7102 gene locus_tag LOCUS_06940 7902 7102 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052359.1 protein_id gnl|my_center|LOCUS_06940 8102 8515 gene locus_tag LOCUS_06950 8102 8515 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052358.1 protein_id gnl|my_center|LOCUS_06950 9623 8586 gene locus_tag LOCUS_06960 9623 8586 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052357.1 protein_id gnl|my_center|LOCUS_06960 10380 9793 gene locus_tag LOCUS_06970 10380 9793 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053845.1 protein_id gnl|my_center|LOCUS_06970 10352 10543 gene locus_tag LOCUS_06980 10352 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 11326 10682 gene locus_tag LOCUS_06990 11326 10682 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052354.1 protein_id gnl|my_center|LOCUS_06990 11316 11558 gene locus_tag LOCUS_07000 11316 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 12597 11641 gene locus_tag LOCUS_07010 12597 11641 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052353.1 protein_id gnl|my_center|LOCUS_07010 12990 14132 gene locus_tag LOCUS_07020 gene serC 12990 14132 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052351.1 protein_id gnl|my_center|LOCUS_07020 14257 14517 gene locus_tag LOCUS_07030 14257 14517 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052350.1 protein_id gnl|my_center|LOCUS_07030 14608 14617 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15166 14645 gene locus_tag LOCUS_07040 15166 14645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07040 15845 15171 gene locus_tag LOCUS_07050 15845 15171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07050 15209 15218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16036 16710 gene locus_tag LOCUS_07060 gene phoU 16036 16710 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068776.1 protein_id gnl|my_center|LOCUS_07060 <17661 17087 gene locus_tag LOCUS_07070 <17661 17087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052347.1:phosphoglyceromutase >Feature sequence030 430 1392 gene locus_tag LOCUS_07080 gene rsmI 430 1392 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783206.1 protein_id gnl|my_center|LOCUS_07080 1646 1419 gene locus_tag LOCUS_07090 1646 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054111.1 protein_id gnl|my_center|LOCUS_07090 2413 1787 gene locus_tag LOCUS_07100 2413 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052934.1 protein_id gnl|my_center|LOCUS_07100 2841 4628 gene locus_tag LOCUS_07110 gene metG 2841 4628 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068654.1 protein_id gnl|my_center|LOCUS_07110 6656 5130 gene locus_tag LOCUS_07120 6656 5130 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068657.1 protein_id gnl|my_center|LOCUS_07120 6881 9109 gene locus_tag LOCUS_07130 6881 9109 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068658.1 protein_id gnl|my_center|LOCUS_07130 9137 9307 gene locus_tag LOCUS_07140 9137 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07140 9340 10257 gene locus_tag LOCUS_07150 9340 10257 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050496022.1 protein_id gnl|my_center|LOCUS_07150 11586 10429 gene locus_tag LOCUS_07160 11586 10429 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068660.1 protein_id gnl|my_center|LOCUS_07160 11960 13174 gene locus_tag LOCUS_07170 11960 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 14761 13691 gene locus_tag LOCUS_07180 14761 13691 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_07180 14942 15121 gene locus_tag LOCUS_07190 14942 15121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 15138 16097 gene locus_tag LOCUS_07200 15138 16097 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068671.1 protein_id gnl|my_center|LOCUS_07200 15617 15626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence031 499 179 gene locus_tag LOCUS_07210 499 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07210 2476 578 gene locus_tag LOCUS_07220 2476 578 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994355.1 protein_id gnl|my_center|LOCUS_07220 4407 2695 gene locus_tag LOCUS_07230 4407 2695 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013327.1 protein_id gnl|my_center|LOCUS_07230 4801 5829 gene locus_tag LOCUS_07240 4801 5829 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994687.1 protein_id gnl|my_center|LOCUS_07240 5981 6736 gene locus_tag LOCUS_07250 5981 6736 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_07250 6791 7006 gene locus_tag LOCUS_07260 6791 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7228 7794 gene locus_tag LOCUS_07270 7228 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 8881 7754 gene locus_tag LOCUS_07280 8881 7754 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507759.1 protein_id gnl|my_center|LOCUS_07280 10977 8881 gene locus_tag LOCUS_07290 10977 8881 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582983.1 protein_id gnl|my_center|LOCUS_07290 11469 12872 gene locus_tag LOCUS_07300 11469 12872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068675.1 protein_id gnl|my_center|LOCUS_07300 12869 13990 gene locus_tag LOCUS_07310 12869 13990 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390347.1 protein_id gnl|my_center|LOCUS_07310 14115 14819 gene locus_tag LOCUS_07320 14115 14819 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 protein_id gnl|my_center|LOCUS_07320 15757 14897 gene locus_tag LOCUS_07330 15757 14897 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058535.1 protein_id gnl|my_center|LOCUS_07330 <17009 15851 gene locus_tag LOCUS_07340 <17009 15851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068672.1:KUP/HAK/KT family potassium transporter >Feature sequence032 528 2456 gene locus_tag LOCUS_07350 528 2456 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390320.1 protein_id gnl|my_center|LOCUS_07350 2595 3290 gene locus_tag LOCUS_07360 2595 3290 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051584.1 protein_id gnl|my_center|LOCUS_07360 3442 4710 gene locus_tag LOCUS_07370 3442 4710 CDS product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054710.1 protein_id gnl|my_center|LOCUS_07370 4732 6036 gene locus_tag LOCUS_07380 4732 6036 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051582.1 protein_id gnl|my_center|LOCUS_07380 6070 7293 gene locus_tag LOCUS_07390 6070 7293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068492.1 protein_id gnl|my_center|LOCUS_07390 7309 8106 gene locus_tag LOCUS_07400 7309 8106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 protein_id gnl|my_center|LOCUS_07400 8768 8844 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9453 8857 gene locus_tag LOCUS_07410 9453 8857 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054715.1 protein_id gnl|my_center|LOCUS_07410 11735 9573 gene locus_tag LOCUS_07420 11735 9573 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 protein_id gnl|my_center|LOCUS_07420 13894 11732 gene locus_tag LOCUS_07430 13894 11732 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068489.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07430 14363 13821 gene locus_tag LOCUS_07440 14363 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07440 14718 16004 gene locus_tag LOCUS_07450 14718 16004 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051574.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence033 1539 145 gene locus_tag LOCUS_07460 1539 145 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052999.1 protein_id gnl|my_center|LOCUS_07460 1794 2624 gene locus_tag LOCUS_07470 1794 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053000.1 protein_id gnl|my_center|LOCUS_07470 2893 3414 gene locus_tag LOCUS_07480 gene rplJ 2893 3414 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053001.1 protein_id gnl|my_center|LOCUS_07480 3523 3903 gene locus_tag LOCUS_07490 gene rplL 3523 3903 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053002.1 protein_id gnl|my_center|LOCUS_07490 4155 5657 gene locus_tag LOCUS_07500 4155 5657 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053003.1 protein_id gnl|my_center|LOCUS_07500 5666 9289 gene locus_tag LOCUS_07510 5666 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053004.1 protein_id gnl|my_center|LOCUS_07510 9292 9492 gene locus_tag LOCUS_07520 9292 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10066 9587 gene locus_tag LOCUS_07530 10066 9587 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057269.1 protein_id gnl|my_center|LOCUS_07530 10020 10029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10588 10403 gene locus_tag LOCUS_07540 10588 10403 CDS product evolved beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815625.1 protein_id gnl|my_center|LOCUS_07540 11483 10788 gene locus_tag LOCUS_07550 11483 10788 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472143.1 protein_id gnl|my_center|LOCUS_07550 11576 12223 gene locus_tag LOCUS_07560 11576 12223 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053783.1 protein_id gnl|my_center|LOCUS_07560 12304 13740 gene locus_tag LOCUS_07570 12304 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068733.1 protein_id gnl|my_center|LOCUS_07570 13913 14206 gene locus_tag LOCUS_07580 gene groES 13913 14206 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053011.1 protein_id gnl|my_center|LOCUS_07580 15221 14880 gene locus_tag LOCUS_07590 15221 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07590 16113 15106 gene locus_tag LOCUS_07600 16113 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 >Feature sequence034 1 1209 gene locus_tag LOCUS_07610 gene gatB 1 1209 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051530.1 protein_id gnl|my_center|LOCUS_07610 1505 2569 gene locus_tag LOCUS_07620 1505 2569 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051529.1 protein_id gnl|my_center|LOCUS_07620 2580 2894 gene locus_tag LOCUS_07630 2580 2894 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820018.1 protein_id gnl|my_center|LOCUS_07630 3053 4921 gene locus_tag LOCUS_07640 3053 4921 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054753.1 protein_id gnl|my_center|LOCUS_07640 5139 6752 gene locus_tag LOCUS_07650 5139 6752 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_07650 6958 9054 gene locus_tag LOCUS_07660 gene rho 6958 9054 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056503.1 protein_id gnl|my_center|LOCUS_07660 9362 9751 gene locus_tag LOCUS_07670 9362 9751 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051524.1 protein_id gnl|my_center|LOCUS_07670 9993 11831 gene locus_tag LOCUS_07680 9993 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068469.1 protein_id gnl|my_center|LOCUS_07680 11818 11827 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14912 12000 gene locus_tag LOCUS_07690 gene valS 14912 12000 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 protein_id gnl|my_center|LOCUS_07690 12193 12202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <16352 15056 gene locus_tag LOCUS_07700 <16352 15056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007057703.1:ABC transporter substrate-binding protein >Feature sequence035 2326 5889 gene locus_tag LOCUS_07710 2326 5889 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582850.1 protein_id gnl|my_center|LOCUS_07710 5954 8320 gene locus_tag LOCUS_07720 gene ligA 5954 8320 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067935.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07720 8213 8222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8283 8720 gene locus_tag LOCUS_07730 8283 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07730 8895 9998 gene locus_tag LOCUS_07740 8895 9998 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054010.1 protein_id gnl|my_center|LOCUS_07740 11024 10272 gene locus_tag LOCUS_07750 11024 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067936.1 protein_id gnl|my_center|LOCUS_07750 12088 11492 gene locus_tag LOCUS_07760 12088 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 12113 12925 gene locus_tag LOCUS_07770 12113 12925 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067937.1 protein_id gnl|my_center|LOCUS_07770 13036 15144 gene locus_tag LOCUS_07780 13036 15144 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067938.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence036 893 48 gene locus_tag LOCUS_07790 893 48 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782662.1 protein_id gnl|my_center|LOCUS_07790 1816 1022 gene locus_tag LOCUS_07800 gene murI 1816 1022 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 protein_id gnl|my_center|LOCUS_07800 1924 2817 gene locus_tag LOCUS_07810 gene dapF 1924 2817 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054039.1 protein_id gnl|my_center|LOCUS_07810 3440 2823 gene locus_tag LOCUS_07820 3440 2823 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054040.1 protein_id gnl|my_center|LOCUS_07820 3400 3615 gene locus_tag LOCUS_07830 3400 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3698 4591 gene locus_tag LOCUS_07840 3698 4591 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054041.1 protein_id gnl|my_center|LOCUS_07840 4876 4652 gene locus_tag LOCUS_07850 4876 4652 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821409.1 protein_id gnl|my_center|LOCUS_07850 6695 5025 gene locus_tag LOCUS_07860 6695 5025 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067952.1 protein_id gnl|my_center|LOCUS_07860 6841 8415 gene locus_tag LOCUS_07870 6841 8415 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067953.1 protein_id gnl|my_center|LOCUS_07870 10233 8485 gene locus_tag LOCUS_07880 10233 8485 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054045.1 protein_id gnl|my_center|LOCUS_07880 9634 9643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10454 11335 gene locus_tag LOCUS_07890 10454 11335 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055424.1 protein_id gnl|my_center|LOCUS_07890 11442 11867 gene locus_tag LOCUS_07900 11442 11867 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 protein_id gnl|my_center|LOCUS_07900 12031 12105 gene locus_tag LOCUS_t00170 12031 12105 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12336 14039 gene locus_tag LOCUS_07910 12336 14039 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053293.1 protein_id gnl|my_center|LOCUS_07910 14036 15226 gene locus_tag LOCUS_07920 gene dxr 14036 15226 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053294.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence037 1669 578 gene locus_tag LOCUS_07930 1669 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3455 1806 gene locus_tag LOCUS_07940 3455 1806 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 protein_id gnl|my_center|LOCUS_07940 5385 3790 gene locus_tag LOCUS_07950 5385 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5533 5342 gene locus_tag LOCUS_07960 5533 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6540 5488 gene locus_tag LOCUS_07970 6540 5488 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643284.1 protein_id gnl|my_center|LOCUS_07970 7521 6592 gene locus_tag LOCUS_07980 7521 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07980 8191 7469 gene locus_tag LOCUS_07990 8191 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07990 9987 8269 gene locus_tag LOCUS_08000 9987 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 10975 10040 gene locus_tag LOCUS_08010 10975 10040 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994687.1 protein_id gnl|my_center|LOCUS_08010 11166 12584 gene locus_tag LOCUS_08020 11166 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 12811 12665 gene locus_tag LOCUS_08030 12811 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 12796 13425 gene locus_tag LOCUS_08040 12796 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 12843 12852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15246 13441 gene locus_tag LOCUS_08050 15246 13441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence038 1353 652 gene locus_tag LOCUS_08060 1353 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2215 1358 gene locus_tag LOCUS_08070 2215 1358 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782830.1 protein_id gnl|my_center|LOCUS_08070 3162 2212 gene locus_tag LOCUS_08080 3162 2212 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068438.1 protein_id gnl|my_center|LOCUS_08080 4073 3174 gene locus_tag LOCUS_08090 4073 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5513 4326 gene locus_tag LOCUS_08100 5513 4326 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055652.1 protein_id gnl|my_center|LOCUS_08100 6701 5700 gene locus_tag LOCUS_08110 6701 5700 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051468.1 protein_id gnl|my_center|LOCUS_08110 7712 6795 gene locus_tag LOCUS_08120 7712 6795 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081634.1 protein_id gnl|my_center|LOCUS_08120 8010 7843 gene locus_tag LOCUS_08130 8010 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08130 8232 8047 gene locus_tag LOCUS_08140 8232 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08140 8636 8561 gene locus_tag LOCUS_t00180 8636 8561 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8734 9360 gene locus_tag LOCUS_08150 8734 9360 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081633.1 protein_id gnl|my_center|LOCUS_08150 10418 9444 gene locus_tag LOCUS_08160 10418 9444 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740584.1 protein_id gnl|my_center|LOCUS_08160 11711 10704 gene locus_tag LOCUS_08170 11711 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051473.1 protein_id gnl|my_center|LOCUS_08170 12781 11711 gene locus_tag LOCUS_08180 12781 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051474.1 protein_id gnl|my_center|LOCUS_08180 12862 13851 gene locus_tag LOCUS_08190 12862 13851 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068443.1 protein_id gnl|my_center|LOCUS_08190 14714 13995 gene locus_tag LOCUS_08200 gene nucS 14714 13995 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051476.1 protein_id gnl|my_center|LOCUS_08200 15095 14802 gene locus_tag LOCUS_08210 15095 14802 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054766.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence039 451 1281 gene locus_tag LOCUS_08220 451 1281 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068192.1 protein_id gnl|my_center|LOCUS_08220 1386 2675 gene locus_tag LOCUS_08230 1386 2675 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 protein_id gnl|my_center|LOCUS_08230 3017 5095 gene locus_tag LOCUS_08240 3017 5095 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068191.1 protein_id gnl|my_center|LOCUS_08240 5294 5797 gene locus_tag LOCUS_08250 5294 5797 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053405.1 protein_id gnl|my_center|LOCUS_08250 5313 5322 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6559 5825 gene locus_tag LOCUS_08260 6559 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08260 6546 6555 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6571 6948 gene locus_tag LOCUS_08270 6571 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7062 7071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7361 7687 gene locus_tag LOCUS_08280 7361 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08280 7687 7893 gene locus_tag LOCUS_08290 7687 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08290 7903 9162 gene locus_tag LOCUS_08300 7903 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08300 9222 9419 gene locus_tag LOCUS_08310 9222 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 9539 10591 gene locus_tag LOCUS_08320 9539 10591 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_08320 11130 11206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12030 11491 gene locus_tag LOCUS_08330 12030 11491 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052109.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08330 12077 12086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13492 12140 gene locus_tag LOCUS_08340 13492 12140 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829177.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence040 1003 59 gene locus_tag LOCUS_08350 1003 59 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053578.1 protein_id gnl|my_center|LOCUS_08350 1245 2420 gene locus_tag LOCUS_08360 1245 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2789 3466 gene locus_tag LOCUS_08370 2789 3466 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814452.1 protein_id gnl|my_center|LOCUS_08370 3587 5074 gene locus_tag LOCUS_08380 3587 5074 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051898.1 protein_id gnl|my_center|LOCUS_08380 5425 5147 gene locus_tag LOCUS_08390 5425 5147 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812680.1 protein_id gnl|my_center|LOCUS_08390 7215 5539 gene locus_tag LOCUS_08400 7215 5539 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051899.1 protein_id gnl|my_center|LOCUS_08400 8473 7535 gene locus_tag LOCUS_08410 8473 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 9219 9518 gene locus_tag LOCUS_08420 9219 9518 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051901.1 protein_id gnl|my_center|LOCUS_08420 9562 12657 gene locus_tag LOCUS_08430 9562 12657 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053572.1 protein_id gnl|my_center|LOCUS_08430 12654 13922 gene locus_tag LOCUS_08440 12654 13922 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053571.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08440 14052 14195 gene locus_tag LOCUS_08450 14052 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08450 >Feature sequence041 <1 1913 gene locus_tag LOCUS_08460 <1 1913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068029.1:aconitate hydratase AcnA 2043 2447 gene locus_tag LOCUS_08470 2043 2447 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068030.1 protein_id gnl|my_center|LOCUS_08470 2444 2935 gene locus_tag LOCUS_08480 2444 2935 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054468.1 protein_id gnl|my_center|LOCUS_08480 5090 2985 gene locus_tag LOCUS_08490 5090 2985 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068031.1 protein_id gnl|my_center|LOCUS_08490 5821 5180 gene locus_tag LOCUS_08500 5821 5180 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052627.1 protein_id gnl|my_center|LOCUS_08500 6604 5861 gene locus_tag LOCUS_08510 6604 5861 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056206.1 protein_id gnl|my_center|LOCUS_08510 7835 6615 gene locus_tag LOCUS_08520 7835 6615 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080850.1 protein_id gnl|my_center|LOCUS_08520 8170 9021 gene locus_tag LOCUS_08530 8170 9021 CDS product DUF5067 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057205.1 protein_id gnl|my_center|LOCUS_08530 9584 9672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9690 10055 gene locus_tag LOCUS_08540 9690 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9970 9979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10175 11191 gene locus_tag LOCUS_08550 10175 11191 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052632.1 protein_id gnl|my_center|LOCUS_08550 11961 11224 gene locus_tag LOCUS_08560 11961 11224 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056209.1 protein_id gnl|my_center|LOCUS_08560 12095 13549 gene locus_tag LOCUS_08570 gene miaB 12095 13549 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032743317.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence042 <1 1074 gene locus_tag LOCUS_08580 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053838.1:MFS transporter 1161 3524 gene locus_tag LOCUS_08590 1161 3524 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052343.1 protein_id gnl|my_center|LOCUS_08590 3600 4232 gene locus_tag LOCUS_08600 3600 4232 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053837.1 protein_id gnl|my_center|LOCUS_08600 5982 4381 gene locus_tag LOCUS_08610 5982 4381 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068773.1 protein_id gnl|my_center|LOCUS_08610 6774 6085 gene locus_tag LOCUS_08620 6774 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068772.1 protein_id gnl|my_center|LOCUS_08620 7832 6804 gene locus_tag LOCUS_08630 7832 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 8624 9907 gene locus_tag LOCUS_08640 8624 9907 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068770.1 protein_id gnl|my_center|LOCUS_08640 9904 10599 gene locus_tag LOCUS_08650 9904 10599 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068769.1 protein_id gnl|my_center|LOCUS_08650 11669 10647 gene locus_tag LOCUS_08660 gene galE 11669 10647 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068768.1 protein_id gnl|my_center|LOCUS_08660 12733 12086 gene locus_tag LOCUS_08670 12733 12086 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363467.1 protein_id gnl|my_center|LOCUS_08670 13133 12744 gene locus_tag LOCUS_08680 13133 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence043 1633 914 gene locus_tag LOCUS_08690 1633 914 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051333.1 protein_id gnl|my_center|LOCUS_08690 2651 1872 gene locus_tag LOCUS_08700 2651 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2437 2446 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4024 2993 gene locus_tag LOCUS_08710 4024 2993 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051335.1 protein_id gnl|my_center|LOCUS_08710 6605 4089 gene locus_tag LOCUS_08720 6605 4089 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051336.1 protein_id gnl|my_center|LOCUS_08720 8006 6666 gene locus_tag LOCUS_08730 8006 6666 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057650.1 protein_id gnl|my_center|LOCUS_08730 8528 8115 gene locus_tag LOCUS_08740 gene gcvH 8528 8115 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051338.1 protein_id gnl|my_center|LOCUS_08740 9846 8554 gene locus_tag LOCUS_08750 gene nudC 9846 8554 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068355.1 protein_id gnl|my_center|LOCUS_08750 10713 9856 gene locus_tag LOCUS_08760 10713 9856 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051340.1 protein_id gnl|my_center|LOCUS_08760 11386 10763 gene locus_tag LOCUS_08770 11386 10763 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068356.1 protein_id gnl|my_center|LOCUS_08770 11593 11964 gene locus_tag LOCUS_08780 gene trxA 11593 11964 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068357.1 protein_id gnl|my_center|LOCUS_08780 12648 12657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence044 153 950 gene locus_tag LOCUS_08790 153 950 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052153.1 protein_id gnl|my_center|LOCUS_08790 999 1337 gene locus_tag LOCUS_08800 999 1337 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055091.1 protein_id gnl|my_center|LOCUS_08800 1356 2531 gene locus_tag LOCUS_08810 1356 2531 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052155.1 protein_id gnl|my_center|LOCUS_08810 2521 3069 gene locus_tag LOCUS_08820 gene ybeY 2521 3069 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052156.1 protein_id gnl|my_center|LOCUS_08820 3145 4578 gene locus_tag LOCUS_08830 3145 4578 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052157.1 protein_id gnl|my_center|LOCUS_08830 4580 5350 gene locus_tag LOCUS_08840 4580 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08840 5325 5657 gene locus_tag LOCUS_08850 5325 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08850 5328 5337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7820 5709 gene locus_tag LOCUS_08860 7820 5709 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582533.1 protein_id gnl|my_center|LOCUS_08860 8161 9324 gene locus_tag LOCUS_08870 8161 9324 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052160.1 protein_id gnl|my_center|LOCUS_08870 9340 9645 gene locus_tag LOCUS_08880 9340 9645 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_08880 9645 11069 gene locus_tag LOCUS_08890 9645 11069 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055089.1 protein_id gnl|my_center|LOCUS_08890 12242 11205 gene locus_tag LOCUS_08900 12242 11205 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053364.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence045 1695 175 gene locus_tag LOCUS_08910 1695 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3568 1718 gene locus_tag LOCUS_08920 3568 1718 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414605.1 protein_id gnl|my_center|LOCUS_08920 4092 3595 gene locus_tag LOCUS_08930 4092 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4505 4221 gene locus_tag LOCUS_08940 4505 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4868 4557 gene locus_tag LOCUS_08950 4868 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5422 6759 gene locus_tag LOCUS_08960 gene eccD 5422 6759 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_08960 6834 8252 gene locus_tag LOCUS_08970 gene eccB 6834 8252 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_08970 8264 9580 gene locus_tag LOCUS_08980 gene mycP 8264 9580 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 protein_id gnl|my_center|LOCUS_08980 9797 9645 gene locus_tag LOCUS_08990 9797 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10040 10216 gene locus_tag LOCUS_09000 10040 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 12225 10390 gene locus_tag LOCUS_09010 12225 10390 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414605.1 protein_id gnl|my_center|LOCUS_09010 12424 12251 gene locus_tag LOCUS_09020 12424 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 12564 12716 gene locus_tag LOCUS_09030 12564 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence046 278 952 gene locus_tag LOCUS_09040 278 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053602.1 protein_id gnl|my_center|LOCUS_09040 1707 934 gene locus_tag LOCUS_09050 1707 934 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051151.1 protein_id gnl|my_center|LOCUS_09050 2970 1930 gene locus_tag LOCUS_09060 2970 1930 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053603.1 protein_id gnl|my_center|LOCUS_09060 4784 2979 gene locus_tag LOCUS_09070 4784 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068271.1 protein_id gnl|my_center|LOCUS_09070 6134 4812 gene locus_tag LOCUS_09080 gene tyrS 6134 4812 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068272.1 protein_id gnl|my_center|LOCUS_09080 7027 6260 gene locus_tag LOCUS_09090 7027 6260 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818363.1 protein_id gnl|my_center|LOCUS_09090 7557 7024 gene locus_tag LOCUS_09100 7557 7024 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051157.1 protein_id gnl|my_center|LOCUS_09100 8071 7715 gene locus_tag LOCUS_09110 8071 7715 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051158.1 protein_id gnl|my_center|LOCUS_09110 8856 8128 gene locus_tag LOCUS_09120 gene thiF 8856 8128 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056327.1 protein_id gnl|my_center|LOCUS_09120 9902 9033 gene locus_tag LOCUS_09130 9902 9033 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828815.1 protein_id gnl|my_center|LOCUS_09130 10108 9914 gene locus_tag LOCUS_09140 gene thiS 10108 9914 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051161.1 protein_id gnl|my_center|LOCUS_09140 11929 10457 gene locus_tag LOCUS_09150 gene argH 11929 10457 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051162.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence047 2876 336 gene locus_tag LOCUS_09160 gene glgX 2876 336 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068740.1 protein_id gnl|my_center|LOCUS_09160 4057 2873 gene locus_tag LOCUS_09170 4057 2873 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 protein_id gnl|my_center|LOCUS_09170 4580 7309 gene locus_tag LOCUS_09180 gene adhE 4580 7309 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068742.1 protein_id gnl|my_center|LOCUS_09180 8299 7694 gene locus_tag LOCUS_09190 8299 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 8837 9145 gene locus_tag LOCUS_09200 gene rpsJ 8837 9145 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808013.1 protein_id gnl|my_center|LOCUS_09200 9163 9804 gene locus_tag LOCUS_09210 gene rplC 9163 9804 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053031.1 protein_id gnl|my_center|LOCUS_09210 9811 10476 gene locus_tag LOCUS_09220 gene rplD 9811 10476 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815665.1 protein_id gnl|my_center|LOCUS_09220 10482 10778 gene locus_tag LOCUS_09230 gene rplW 10482 10778 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814498.1 protein_id gnl|my_center|LOCUS_09230 10815 11645 gene locus_tag LOCUS_09240 gene rplB 10815 11645 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053034.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence048 2350 3561 gene locus_tag LOCUS_09250 2350 3561 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_09250 4044 3721 gene locus_tag LOCUS_09260 4044 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 4062 4751 gene locus_tag LOCUS_09270 4062 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09270 4902 5537 gene locus_tag LOCUS_09280 4902 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09280 6607 5597 gene locus_tag LOCUS_09290 6607 5597 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068829.1 protein_id gnl|my_center|LOCUS_09290 6924 6772 gene locus_tag LOCUS_09300 6924 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09300 8105 7137 gene locus_tag LOCUS_09310 8105 7137 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 protein_id gnl|my_center|LOCUS_09310 9759 8329 gene locus_tag LOCUS_09320 gene dcuC 9759 8329 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052501.1 protein_id gnl|my_center|LOCUS_09320 10457 9861 gene locus_tag LOCUS_09330 10457 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 10543 10647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11366 10905 gene locus_tag LOCUS_09340 11366 10905 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052499.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence049 1365 724 gene locus_tag LOCUS_09350 1365 724 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053023.1 protein_id gnl|my_center|LOCUS_09350 2443 1427 gene locus_tag LOCUS_09360 2443 1427 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053022.1 protein_id gnl|my_center|LOCUS_09360 3860 2517 gene locus_tag LOCUS_09370 3860 2517 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053796.1 protein_id gnl|my_center|LOCUS_09370 4334 4246 gene locus_tag LOCUS_t00190 4334 4246 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5341 4406 gene locus_tag LOCUS_09380 5341 4406 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053020.1 protein_id gnl|my_center|LOCUS_09380 5582 6856 gene locus_tag LOCUS_09390 gene dinB 5582 6856 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053794.1 protein_id gnl|my_center|LOCUS_09390 8118 6883 gene locus_tag LOCUS_09400 gene dapC 8118 6883 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068736.1 protein_id gnl|my_center|LOCUS_09400 8553 8233 gene locus_tag LOCUS_09410 8553 8233 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053016.1 protein_id gnl|my_center|LOCUS_09410 10140 8614 gene locus_tag LOCUS_09420 10140 8614 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053015.1 protein_id gnl|my_center|LOCUS_09420 11514 10291 gene locus_tag LOCUS_09430 11514 10291 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053014.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence050 397 1197 gene locus_tag LOCUS_09440 397 1197 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056838.1 protein_id gnl|my_center|LOCUS_09440 1194 2432 gene locus_tag LOCUS_09450 1194 2432 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068569.1 protein_id gnl|my_center|LOCUS_09450 2483 3127 gene locus_tag LOCUS_09460 2483 3127 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055904.1 protein_id gnl|my_center|LOCUS_09460 5396 3312 gene locus_tag LOCUS_09470 gene pknB 5396 3312 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068568.1 protein_id gnl|my_center|LOCUS_09470 6355 5405 gene locus_tag LOCUS_09480 6355 5405 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068567.1 protein_id gnl|my_center|LOCUS_09480 7818 6352 gene locus_tag LOCUS_09490 7818 6352 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056822.1 protein_id gnl|my_center|LOCUS_09490 9374 7815 gene locus_tag LOCUS_09500 9374 7815 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056849.1 protein_id gnl|my_center|LOCUS_09500 11065 9371 gene locus_tag LOCUS_09510 11065 9371 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051709.1 protein_id gnl|my_center|LOCUS_09510 11603 11070 gene locus_tag LOCUS_09520 11603 11070 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051708.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence051 1161 598 gene locus_tag LOCUS_09530 gene hpt 1161 598 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057761.1 protein_id gnl|my_center|LOCUS_09530 2314 1148 gene locus_tag LOCUS_09540 gene tilS 2314 1148 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068788.1 protein_id gnl|my_center|LOCUS_09540 3894 2404 gene locus_tag LOCUS_09550 gene dacB 3894 2404 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068787.1 protein_id gnl|my_center|LOCUS_09550 5590 3917 gene locus_tag LOCUS_09560 5590 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068786.1 protein_id gnl|my_center|LOCUS_09560 6417 5587 gene locus_tag LOCUS_09570 6417 5587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582910.1 protein_id gnl|my_center|LOCUS_09570 6441 6707 gene locus_tag LOCUS_09580 6441 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 7861 6638 gene locus_tag LOCUS_09590 7861 6638 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_09590 9504 7861 gene locus_tag LOCUS_09600 9504 7861 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068783.1 protein_id gnl|my_center|LOCUS_09600 9580 10506 gene locus_tag LOCUS_09610 9580 10506 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068782.1 protein_id gnl|my_center|LOCUS_09610 11331 10729 gene locus_tag LOCUS_09620 11331 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence052 <1 641 gene locus_tag LOCUS_09630 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025221252.1:ABC transporter substrate-binding protein 400 409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 852 1796 gene locus_tag LOCUS_09640 852 1796 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051290.1 protein_id gnl|my_center|LOCUS_09640 1927 2922 gene locus_tag LOCUS_09650 1927 2922 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053710.1 protein_id gnl|my_center|LOCUS_09650 2939 3541 gene locus_tag LOCUS_09660 2939 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09660 3513 3522 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3528 3776 gene locus_tag LOCUS_09670 3528 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09670 4072 5910 gene locus_tag LOCUS_09680 gene glmS 4072 5910 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051287.1 protein_id gnl|my_center|LOCUS_09680 5987 6688 gene locus_tag LOCUS_09690 5987 6688 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410317.1 protein_id gnl|my_center|LOCUS_09690 6927 6724 gene locus_tag LOCUS_09700 6927 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7225 6839 gene locus_tag LOCUS_09710 7225 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 7433 9508 gene locus_tag LOCUS_09720 7433 9508 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053701.1 protein_id gnl|my_center|LOCUS_09720 9745 9551 gene locus_tag LOCUS_09730 9745 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 9717 9944 gene locus_tag LOCUS_09740 9717 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 10120 9941 gene locus_tag LOCUS_09750 10120 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10360 10369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence053 297 914 gene locus_tag LOCUS_09760 297 914 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052288.1 protein_id gnl|my_center|LOCUS_09760 904 1842 gene locus_tag LOCUS_09770 904 1842 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052289.1 protein_id gnl|my_center|LOCUS_09770 1792 1801 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1888 2220 gene locus_tag LOCUS_09780 1888 2220 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052290.1 protein_id gnl|my_center|LOCUS_09780 2236 3057 gene locus_tag LOCUS_09790 2236 3057 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057094.1 protein_id gnl|my_center|LOCUS_09790 3064 3507 gene locus_tag LOCUS_09800 3064 3507 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052292.1 protein_id gnl|my_center|LOCUS_09800 3608 4240 gene locus_tag LOCUS_09810 3608 4240 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052293.1 protein_id gnl|my_center|LOCUS_09810 4372 4776 gene locus_tag LOCUS_09820 4372 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 5647 4928 gene locus_tag LOCUS_09830 5647 4928 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052873.1 protein_id gnl|my_center|LOCUS_09830 6126 5779 gene locus_tag LOCUS_09840 6126 5779 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052872.1 protein_id gnl|my_center|LOCUS_09840 8831 6240 gene locus_tag LOCUS_09850 8831 6240 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068114.1 protein_id gnl|my_center|LOCUS_09850 9161 8844 gene locus_tag LOCUS_09860 9161 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389921.1 protein_id gnl|my_center|LOCUS_09860 9515 9192 gene locus_tag LOCUS_09870 9515 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09870 11077 9446 gene locus_tag LOCUS_09880 11077 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09880 9715 9724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence054 1628 564 gene locus_tag LOCUS_09890 1628 564 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817017.1 protein_id gnl|my_center|LOCUS_09890 3166 1628 gene locus_tag LOCUS_09900 gene murC 3166 1628 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054402.1 protein_id gnl|my_center|LOCUS_09900 4440 3196 gene locus_tag LOCUS_09910 4440 3196 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052550.1 protein_id gnl|my_center|LOCUS_09910 3322 3331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5673 4456 gene locus_tag LOCUS_09920 gene ftsW 5673 4456 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067984.1 protein_id gnl|my_center|LOCUS_09920 7105 5660 gene locus_tag LOCUS_09930 gene murD 7105 5660 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067983.1 protein_id gnl|my_center|LOCUS_09930 8267 7161 gene locus_tag LOCUS_09940 gene mraY 8267 7161 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052547.1 protein_id gnl|my_center|LOCUS_09940 9763 8312 gene locus_tag LOCUS_09950 9763 8312 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054398.1 protein_id gnl|my_center|LOCUS_09950 10684 9812 gene locus_tag LOCUS_09960 10684 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067982.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence055 <1 1330 gene locus_tag LOCUS_09970 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051332.1:transglycosylase domain-containing protein 1552 2925 gene locus_tag LOCUS_09980 1552 2925 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055215.1 protein_id gnl|my_center|LOCUS_09980 4244 3093 gene locus_tag LOCUS_09990 4244 3093 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057648.1 protein_id gnl|my_center|LOCUS_09990 4663 4672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4693 5406 gene locus_tag LOCUS_10000 4693 5406 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658105.1 protein_id gnl|my_center|LOCUS_10000 5411 6661 gene locus_tag LOCUS_10010 gene galT 5411 6661 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055169.1 protein_id gnl|my_center|LOCUS_10010 6679 7929 gene locus_tag LOCUS_10020 gene galK 6679 7929 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057651.1 protein_id gnl|my_center|LOCUS_10020 8170 9702 gene locus_tag LOCUS_10030 8170 9702 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 protein_id gnl|my_center|LOCUS_10030 10131 10550 gene locus_tag LOCUS_10040 10131 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence056 731 740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1425 1186 gene locus_tag LOCUS_10050 1425 1186 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053186.1 protein_id gnl|my_center|LOCUS_10050 2338 1655 gene locus_tag LOCUS_10060 2338 1655 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055622.1 protein_id gnl|my_center|LOCUS_10060 2454 3146 gene locus_tag LOCUS_10070 2454 3146 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053184.1 protein_id gnl|my_center|LOCUS_10070 3263 4351 gene locus_tag LOCUS_10080 3263 4351 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053183.1 protein_id gnl|my_center|LOCUS_10080 4348 5298 gene locus_tag LOCUS_10090 4348 5298 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053182.1 protein_id gnl|my_center|LOCUS_10090 5298 5849 gene locus_tag LOCUS_10100 5298 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021975282.1 protein_id gnl|my_center|LOCUS_10100 5849 6904 gene locus_tag LOCUS_10110 5849 6904 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053180.1 protein_id gnl|my_center|LOCUS_10110 6901 7932 gene locus_tag LOCUS_10120 6901 7932 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782716.1 protein_id gnl|my_center|LOCUS_10120 7929 8531 gene locus_tag LOCUS_10130 7929 8531 CDS product DUF6466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389711.1 protein_id gnl|my_center|LOCUS_10130 8799 9119 gene locus_tag LOCUS_10140 8799 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058571.1 protein_id gnl|my_center|LOCUS_10140 9116 10720 gene locus_tag LOCUS_10150 9116 10720 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782718.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence057 <1 1291 gene locus_tag LOCUS_10160 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068089.1:LPXTG cell wall anchor domain-containing protein 1608 2246 gene locus_tag LOCUS_10170 1608 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2243 3472 gene locus_tag LOCUS_10180 2243 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3486 3968 gene locus_tag LOCUS_10190 3486 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4006 4308 gene locus_tag LOCUS_10200 4006 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068085.1 protein_id gnl|my_center|LOCUS_10200 4317 6305 gene locus_tag LOCUS_10210 4317 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068084.1 protein_id gnl|my_center|LOCUS_10210 6339 7826 gene locus_tag LOCUS_10220 6339 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_10220 7880 9439 gene locus_tag LOCUS_10230 7880 9439 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_10230 9454 9798 gene locus_tag LOCUS_10240 9454 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence058 707 261 gene locus_tag LOCUS_10250 gene rplI 707 261 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051544.1 protein_id gnl|my_center|LOCUS_10250 975 727 gene locus_tag LOCUS_10260 gene rpsR 975 727 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051545.1 protein_id gnl|my_center|LOCUS_10260 1662 1036 gene locus_tag LOCUS_10270 1662 1036 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068475.1 protein_id gnl|my_center|LOCUS_10270 2009 1719 gene locus_tag LOCUS_10280 gene rpsF 2009 1719 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828111.1 protein_id gnl|my_center|LOCUS_10280 2308 2317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2584 2333 gene locus_tag LOCUS_10290 2584 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2873 2538 gene locus_tag LOCUS_10300 2873 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2791 5223 gene locus_tag LOCUS_10310 2791 5223 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811744.1 protein_id gnl|my_center|LOCUS_10310 5345 6358 gene locus_tag LOCUS_10320 5345 6358 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056506.1 protein_id gnl|my_center|LOCUS_10320 7249 6434 gene locus_tag LOCUS_10330 7249 6434 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582354.1 protein_id gnl|my_center|LOCUS_10330 9402 7321 gene locus_tag LOCUS_10340 9402 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 10254 9421 gene locus_tag LOCUS_10350 10254 9421 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389433.1 protein_id gnl|my_center|LOCUS_10350 10544 10251 gene locus_tag LOCUS_10360 10544 10251 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033512961.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence059 1444 539 gene locus_tag LOCUS_10370 1444 539 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068793.1 protein_id gnl|my_center|LOCUS_10370 3436 1757 gene locus_tag LOCUS_10380 gene ettA 3436 1757 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068794.1 protein_id gnl|my_center|LOCUS_10380 3770 3846 gene locus_tag LOCUS_t00200 3770 3846 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4269 5219 gene locus_tag LOCUS_10390 4269 5219 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052404.1 protein_id gnl|my_center|LOCUS_10390 5479 6012 gene locus_tag LOCUS_10400 5479 6012 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052411.1 protein_id gnl|my_center|LOCUS_10400 6340 7188 gene locus_tag LOCUS_10410 6340 7188 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_10410 7196 7615 gene locus_tag LOCUS_10420 7196 7615 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056959.1 protein_id gnl|my_center|LOCUS_10420 8538 9338 gene locus_tag LOCUS_10430 8538 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056960.1 protein_id gnl|my_center|LOCUS_10430 9665 9357 gene locus_tag LOCUS_10440 9665 9357 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068804.1 protein_id gnl|my_center|LOCUS_10440 10011 9685 gene locus_tag LOCUS_10450 10011 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence060 1551 364 gene locus_tag LOCUS_10460 1551 364 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055677.1 protein_id gnl|my_center|LOCUS_10460 2702 1824 gene locus_tag LOCUS_10470 gene prmC 2702 1824 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055663.1 protein_id gnl|my_center|LOCUS_10470 3951 2863 gene locus_tag LOCUS_10480 gene prfA 3951 2863 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052437.1 protein_id gnl|my_center|LOCUS_10480 4317 4105 gene locus_tag LOCUS_10490 gene rpmE 4317 4105 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003830110.1 protein_id gnl|my_center|LOCUS_10490 4528 4454 gene locus_tag LOCUS_t00210 4528 4454 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5875 4646 gene locus_tag LOCUS_10500 5875 4646 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 protein_id gnl|my_center|LOCUS_10500 6095 7615 gene locus_tag LOCUS_10510 6095 7615 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782901.1 protein_id gnl|my_center|LOCUS_10510 7810 8130 gene locus_tag LOCUS_10520 7810 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8221 8565 gene locus_tag LOCUS_10530 8221 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 9031 8849 gene locus_tag LOCUS_10540 9031 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 9703 9987 gene locus_tag LOCUS_10550 9703 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence061 438 211 gene locus_tag LOCUS_10560 438 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 877 886 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1068 1784 gene locus_tag LOCUS_10570 1068 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10570 1614 1623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1781 1990 gene locus_tag LOCUS_10580 1781 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2016 2252 gene locus_tag LOCUS_10590 2016 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2296 2305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3330 2365 gene locus_tag LOCUS_10600 3330 2365 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546167.1 protein_id gnl|my_center|LOCUS_10600 4449 3373 gene locus_tag LOCUS_10610 4449 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4930 5091 gene locus_tag LOCUS_10620 4930 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6469 5267 gene locus_tag LOCUS_10630 6469 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7296 6754 gene locus_tag LOCUS_10640 7296 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 9046 7322 gene locus_tag LOCUS_10650 9046 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 9207 9049 gene locus_tag LOCUS_10660 9207 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 <10393 9246 gene locus_tag LOCUS_10670 <10393 9246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010773627.1:ATP-binding protein note possible pseudo, frameshifted 9249 9258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence062 3387 631 gene locus_tag LOCUS_10680 3387 631 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068632.1 protein_id gnl|my_center|LOCUS_10680 4448 3681 gene locus_tag LOCUS_10690 4448 3681 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390367.1 protein_id gnl|my_center|LOCUS_10690 5008 4631 gene locus_tag LOCUS_10700 5008 4631 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814031.1 protein_id gnl|my_center|LOCUS_10700 5025 5034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5099 5812 gene locus_tag LOCUS_10710 5099 5812 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583014.1 protein_id gnl|my_center|LOCUS_10710 6249 7544 gene locus_tag LOCUS_10720 6249 7544 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_10720 8817 7801 gene locus_tag LOCUS_10730 8817 7801 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054086.1 protein_id gnl|my_center|LOCUS_10730 9200 10054 gene locus_tag LOCUS_10740 9200 10054 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence063 861 1106 gene locus_tag LOCUS_10750 861 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 868 877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2494 1115 gene locus_tag LOCUS_10760 2494 1115 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067963.1 protein_id gnl|my_center|LOCUS_10760 3377 3000 gene locus_tag LOCUS_10770 3377 3000 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053312.1 protein_id gnl|my_center|LOCUS_10770 4237 3428 gene locus_tag LOCUS_10780 gene thiD 4237 3428 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 protein_id gnl|my_center|LOCUS_10780 4367 5560 gene locus_tag LOCUS_10790 4367 5560 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389624.1 protein_id gnl|my_center|LOCUS_10790 5448 5457 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8350 5597 gene locus_tag LOCUS_10800 gene thiC 8350 5597 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067965.1 protein_id gnl|my_center|LOCUS_10800 9377 8433 gene locus_tag LOCUS_10810 9377 8433 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067966.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence064 467 874 gene locus_tag LOCUS_10820 467 874 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527180.1 protein_id gnl|my_center|LOCUS_10820 1371 982 gene locus_tag LOCUS_10830 1371 982 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054547.1 protein_id gnl|my_center|LOCUS_10830 1505 2596 gene locus_tag LOCUS_10840 gene trpS 1505 2596 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827911.1 protein_id gnl|my_center|LOCUS_10840 4469 2988 gene locus_tag LOCUS_10850 4469 2988 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582302.1 protein_id gnl|my_center|LOCUS_10850 6989 5349 gene locus_tag LOCUS_10860 6989 5349 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_10860 9157 7235 gene locus_tag LOCUS_10870 9157 7235 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068576.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence065 1208 243 gene locus_tag LOCUS_10880 gene argF 1208 243 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782770.1 protein_id gnl|my_center|LOCUS_10880 2547 1252 gene locus_tag LOCUS_10890 2547 1252 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056889.1 protein_id gnl|my_center|LOCUS_10890 3493 2537 gene locus_tag LOCUS_10900 gene argB 3493 2537 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068277.1 protein_id gnl|my_center|LOCUS_10900 4740 3565 gene locus_tag LOCUS_10910 gene argJ 4740 3565 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068278.1 protein_id gnl|my_center|LOCUS_10910 5831 4737 gene locus_tag LOCUS_10920 gene argC 5831 4737 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068279.1 protein_id gnl|my_center|LOCUS_10920 6616 5930 gene locus_tag LOCUS_10930 6616 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782767.1 protein_id gnl|my_center|LOCUS_10930 9256 6647 gene locus_tag LOCUS_10940 gene pheT 9256 6647 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053616.1 protein_id gnl|my_center|LOCUS_10940 <9813 9264 gene locus_tag LOCUS_10950 <9813 9264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051172.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence066 1657 866 gene locus_tag LOCUS_10960 1657 866 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 protein_id gnl|my_center|LOCUS_10960 1984 1910 gene locus_tag LOCUS_t00220 1984 1910 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2061 3269 gene locus_tag LOCUS_10970 2061 3269 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015713385.1 protein_id gnl|my_center|LOCUS_10970 4225 3356 gene locus_tag LOCUS_10980 4225 3356 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068311.1 protein_id gnl|my_center|LOCUS_10980 4323 6632 gene locus_tag LOCUS_10990 4323 6632 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507576.1 protein_id gnl|my_center|LOCUS_10990 6769 6554 gene locus_tag LOCUS_11000 6769 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6813 7082 gene locus_tag LOCUS_11010 6813 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053674.1 protein_id gnl|my_center|LOCUS_11010 8327 7140 gene locus_tag LOCUS_11020 8327 7140 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence067 111 1076 gene locus_tag LOCUS_11030 111 1076 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866395.1 protein_id gnl|my_center|LOCUS_11030 1887 1081 gene locus_tag LOCUS_11040 1887 1081 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052514.1 protein_id gnl|my_center|LOCUS_11040 1992 3491 gene locus_tag LOCUS_11050 1992 3491 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067976.1 protein_id gnl|my_center|LOCUS_11050 3522 3797 gene locus_tag LOCUS_11060 3522 3797 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054380.1 protein_id gnl|my_center|LOCUS_11060 3899 5296 gene locus_tag LOCUS_11070 gene hisD 3899 5296 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582830.1 protein_id gnl|my_center|LOCUS_11070 5293 6465 gene locus_tag LOCUS_11080 5293 6465 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067977.1 protein_id gnl|my_center|LOCUS_11080 5928 5937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6551 7150 gene locus_tag LOCUS_11090 gene hisB 6551 7150 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 protein_id gnl|my_center|LOCUS_11090 7150 7935 gene locus_tag LOCUS_11100 7150 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815225.1 protein_id gnl|my_center|LOCUS_11100 7970 8617 gene locus_tag LOCUS_11110 gene hisH 7970 8617 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067978.1 protein_id gnl|my_center|LOCUS_11110 8686 9411 gene locus_tag LOCUS_11120 gene priA 8686 9411 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054385.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence068 <1 2509 gene locus_tag LOCUS_11130 <1 2509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007056239.1:carbamoyl-phosphate synthase large subunit 2509 3429 gene locus_tag LOCUS_11140 gene pyrF 2509 3429 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053266.1 protein_id gnl|my_center|LOCUS_11140 3609 4199 gene locus_tag LOCUS_11150 gene gmk 3609 4199 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053267.1 protein_id gnl|my_center|LOCUS_11150 4908 4201 gene locus_tag LOCUS_11160 4908 4201 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053268.1 protein_id gnl|my_center|LOCUS_11160 5055 7310 gene locus_tag LOCUS_11170 5055 7310 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053269.1 protein_id gnl|my_center|LOCUS_11170 7963 7319 gene locus_tag LOCUS_11180 7963 7319 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053270.1 protein_id gnl|my_center|LOCUS_11180 8190 8849 gene locus_tag LOCUS_11190 8190 8849 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058318.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence069 228 246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1632 1183 gene locus_tag LOCUS_11200 1632 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389658.1 protein_id gnl|my_center|LOCUS_11200 2718 1639 gene locus_tag LOCUS_11210 gene rsmH 2718 1639 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052542.1 protein_id gnl|my_center|LOCUS_11210 3239 2718 gene locus_tag LOCUS_11220 gene mraZ 3239 2718 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052541.1 protein_id gnl|my_center|LOCUS_11220 3572 4609 gene locus_tag LOCUS_11230 3572 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11230 4579 4588 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4603 5832 gene locus_tag LOCUS_11240 4603 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11240 5843 7042 gene locus_tag LOCUS_11250 gene serA 5843 7042 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_11250 7653 7177 gene locus_tag LOCUS_11260 gene nrdR 7653 7177 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056380.1 protein_id gnl|my_center|LOCUS_11260 8020 7670 gene locus_tag LOCUS_11270 8020 7670 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056652.1 protein_id gnl|my_center|LOCUS_11270 8171 8896 gene locus_tag LOCUS_11280 gene lexA 8171 8896 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052535.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence070 533 1177 gene locus_tag LOCUS_11290 533 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1635 1465 gene locus_tag LOCUS_11300 1635 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2675 2031 gene locus_tag LOCUS_11310 2675 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3026 2700 gene locus_tag LOCUS_11320 3026 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3293 3138 gene locus_tag LOCUS_11330 3293 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3488 3303 gene locus_tag LOCUS_11340 3488 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3871 3677 gene locus_tag LOCUS_11350 3871 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4159 3881 gene locus_tag LOCUS_11360 4159 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4840 4559 gene locus_tag LOCUS_11370 4840 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11370 5318 4812 gene locus_tag LOCUS_11380 5318 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 6964 5618 gene locus_tag LOCUS_11390 6964 5618 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056527.1 protein_id gnl|my_center|LOCUS_11390 7170 7604 gene locus_tag LOCUS_11400 7170 7604 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051756.1 protein_id gnl|my_center|LOCUS_11400 7924 9270 gene locus_tag LOCUS_11410 gene gdhA 7924 9270 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051757.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence071 1435 653 gene locus_tag LOCUS_11420 1435 653 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051180.1 protein_id gnl|my_center|LOCUS_11420 3009 1519 gene locus_tag LOCUS_11430 3009 1519 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051179.1 protein_id gnl|my_center|LOCUS_11430 3781 3158 gene locus_tag LOCUS_11440 3781 3158 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582465.1 protein_id gnl|my_center|LOCUS_11440 3873 5240 gene locus_tag LOCUS_11450 3873 5240 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068282.1 protein_id gnl|my_center|LOCUS_11450 5540 6139 gene locus_tag LOCUS_11460 5540 6139 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782764.1 protein_id gnl|my_center|LOCUS_11460 6139 7614 gene locus_tag LOCUS_11470 6139 7614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053620.1 protein_id gnl|my_center|LOCUS_11470 7611 8438 gene locus_tag LOCUS_11480 7611 8438 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053619.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence072 719 2683 gene locus_tag LOCUS_11490 719 2683 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053766.1 protein_id gnl|my_center|LOCUS_11490 2676 4298 gene locus_tag LOCUS_11500 2676 4298 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052982.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence073 2 75 gene locus_tag LOCUS_t00230 2 75 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 108 183 gene locus_tag LOCUS_t00240 108 183 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 332 2365 gene locus_tag LOCUS_11510 gene thrS 332 2365 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054284.1 protein_id gnl|my_center|LOCUS_11510 2504 3088 gene locus_tag LOCUS_11520 2504 3088 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052854.1 protein_id gnl|my_center|LOCUS_11520 3227 3982 gene locus_tag LOCUS_11530 3227 3982 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052855.1 protein_id gnl|my_center|LOCUS_11530 3988 4572 gene locus_tag LOCUS_11540 gene ruvC 3988 4572 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052856.1 protein_id gnl|my_center|LOCUS_11540 4630 5256 gene locus_tag LOCUS_11550 gene ruvA 4630 5256 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052857.1 protein_id gnl|my_center|LOCUS_11550 5256 6320 gene locus_tag LOCUS_11560 gene ruvB 5256 6320 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054282.1 protein_id gnl|my_center|LOCUS_11560 6385 6819 gene locus_tag LOCUS_11570 6385 6819 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052859.1 protein_id gnl|my_center|LOCUS_11570 6883 7437 gene locus_tag LOCUS_11580 6883 7437 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068112.1 protein_id gnl|my_center|LOCUS_11580 7534 8736 gene locus_tag LOCUS_11590 gene sucC 7534 8736 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052861.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence074 523 1158 gene locus_tag LOCUS_11600 523 1158 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068637.1 protein_id gnl|my_center|LOCUS_11600 2791 1310 gene locus_tag LOCUS_11610 2791 1310 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068639.1 protein_id gnl|my_center|LOCUS_11610 3601 3032 gene locus_tag LOCUS_11620 3601 3032 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052949.1 protein_id gnl|my_center|LOCUS_11620 3745 4446 gene locus_tag LOCUS_11630 3745 4446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_11630 4610 8242 gene locus_tag LOCUS_11640 4610 8242 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740909.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence075 1326 1335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2022 1531 gene locus_tag LOCUS_11650 2022 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3307 2183 gene locus_tag LOCUS_11660 3307 2183 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052748.1 protein_id gnl|my_center|LOCUS_11660 3435 4655 gene locus_tag LOCUS_11670 3435 4655 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783318.1 protein_id gnl|my_center|LOCUS_11670 4904 6535 gene locus_tag LOCUS_11680 4904 6535 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068096.1 protein_id gnl|my_center|LOCUS_11680 6012 6026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7098 6613 gene locus_tag LOCUS_11690 7098 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7111 7335 gene locus_tag LOCUS_11700 7111 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 8033 7647 gene locus_tag LOCUS_11710 8033 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 8226 8299 gene locus_tag LOCUS_t00250 8226 8299 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence076 1963 251 gene locus_tag LOCUS_11720 gene pta 1963 251 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582495.1 protein_id gnl|my_center|LOCUS_11720 2193 2120 gene locus_tag LOCUS_t00260 2193 2120 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2355 2282 gene locus_tag LOCUS_t00270 2355 2282 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3272 2574 gene locus_tag LOCUS_11730 3272 2574 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057554.1 protein_id gnl|my_center|LOCUS_11730 3818 3405 gene locus_tag LOCUS_11740 gene rsfS 3818 3405 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052031.1 protein_id gnl|my_center|LOCUS_11740 5204 3822 gene locus_tag LOCUS_11750 gene glmU 5204 3822 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782812.1 protein_id gnl|my_center|LOCUS_11750 5369 5298 gene locus_tag LOCUS_t00280 5369 5298 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6436 5486 gene locus_tag LOCUS_11760 6436 5486 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052033.1 protein_id gnl|my_center|LOCUS_11760 8468 6594 gene locus_tag LOCUS_11770 8468 6594 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068225.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence077 158 439 gene locus_tag LOCUS_11780 158 439 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053170.1 protein_id gnl|my_center|LOCUS_11780 2706 655 gene locus_tag LOCUS_11790 2706 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11790 2289 2298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3731 2595 gene locus_tag LOCUS_11800 3731 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11800 2794 2803 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5243 3906 gene locus_tag LOCUS_11810 5243 3906 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272292.1 protein_id gnl|my_center|LOCUS_11810 5949 5233 gene locus_tag LOCUS_11820 5949 5233 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 protein_id gnl|my_center|LOCUS_11820 7551 6094 gene locus_tag LOCUS_11830 gene pafA 7551 6094 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068846.1 protein_id gnl|my_center|LOCUS_11830 7754 7551 gene locus_tag LOCUS_11840 7754 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 <8596 7878 gene locus_tag LOCUS_11850 <8596 7878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013582864.1:inositol monophosphatase family protein >Feature sequence078 1586 615 gene locus_tag LOCUS_11860 1586 615 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052228.1 protein_id gnl|my_center|LOCUS_11860 2413 1589 gene locus_tag LOCUS_11870 2413 1589 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052227.1 protein_id gnl|my_center|LOCUS_11870 3384 2431 gene locus_tag LOCUS_11880 gene pyrF 3384 2431 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052226.1 protein_id gnl|my_center|LOCUS_11880 4898 3402 gene locus_tag LOCUS_11890 4898 3402 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068131.1 protein_id gnl|my_center|LOCUS_11890 5314 4895 gene locus_tag LOCUS_11900 5314 4895 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052224.1 protein_id gnl|my_center|LOCUS_11900 6276 5314 gene locus_tag LOCUS_11910 gene pyrB 6276 5314 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054218.1 protein_id gnl|my_center|LOCUS_11910 <8510 6418 gene locus_tag LOCUS_11920 <8510 6418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068132.1:bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase >Feature sequence079 132 887 gene locus_tag LOCUS_11930 gene dapB 132 887 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068345.1 protein_id gnl|my_center|LOCUS_11930 1029 2141 gene locus_tag LOCUS_11940 gene dapA 1029 2141 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053723.1 protein_id gnl|my_center|LOCUS_11940 1912 1921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2035 3885 gene locus_tag LOCUS_11950 2035 3885 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057778.1 protein_id gnl|my_center|LOCUS_11950 3927 6536 gene locus_tag LOCUS_11960 gene pepN 3927 6536 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068343.1 protein_id gnl|my_center|LOCUS_11960 6713 7609 gene locus_tag LOCUS_11970 6713 7609 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068342.1 protein_id gnl|my_center|LOCUS_11970 7808 8140 gene locus_tag LOCUS_11980 7808 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051301.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence080 4223 3495 gene locus_tag LOCUS_11990 gene nrdG 4223 3495 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052483.1 protein_id gnl|my_center|LOCUS_11990 6779 4371 gene locus_tag LOCUS_12000 gene nrdD 6779 4371 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052482.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence081 1999 719 gene locus_tag LOCUS_12010 gene nadA 1999 719 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_12010 2886 2059 gene locus_tag LOCUS_12020 2886 2059 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068018.1 protein_id gnl|my_center|LOCUS_12020 3737 3018 gene locus_tag LOCUS_12030 gene scpB 3737 3018 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068017.1 protein_id gnl|my_center|LOCUS_12030 4661 3747 gene locus_tag LOCUS_12040 4661 3747 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068016.1 protein_id gnl|my_center|LOCUS_12040 5519 4680 gene locus_tag LOCUS_12050 5519 4680 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052597.1 protein_id gnl|my_center|LOCUS_12050 7565 5781 gene locus_tag LOCUS_12060 7565 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12060 8005 7529 gene locus_tag LOCUS_12070 8005 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 8322 7993 gene locus_tag LOCUS_12080 8322 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12080 >Feature sequence082 170 496 gene locus_tag LOCUS_12090 170 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12090 536 931 gene locus_tag LOCUS_12100 536 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12100 928 1134 gene locus_tag LOCUS_12110 928 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12110 1135 1560 gene locus_tag LOCUS_12120 1135 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12120 2359 1637 gene locus_tag LOCUS_12130 2359 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2726 2418 gene locus_tag LOCUS_12140 2726 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2620 3180 gene locus_tag LOCUS_12150 2620 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4035 3250 gene locus_tag LOCUS_12160 gene tam 4035 3250 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096594.1 protein_id gnl|my_center|LOCUS_12160 4407 4078 gene locus_tag LOCUS_12170 4407 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 4717 4349 gene locus_tag LOCUS_12180 4717 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5894 4920 gene locus_tag LOCUS_12190 5894 4920 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 protein_id gnl|my_center|LOCUS_12190 7209 6142 gene locus_tag LOCUS_12200 7209 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 8027 7218 gene locus_tag LOCUS_12210 8027 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12210 8050 8059 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence083 36 1682 gene locus_tag LOCUS_12220 36 1682 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051390.1 protein_id gnl|my_center|LOCUS_12220 1768 2460 gene locus_tag LOCUS_12230 1768 2460 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051389.1 protein_id gnl|my_center|LOCUS_12230 2693 4210 gene locus_tag LOCUS_12240 gene araA 2693 4210 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051388.1 protein_id gnl|my_center|LOCUS_12240 5111 4395 gene locus_tag LOCUS_12250 5111 4395 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_12250 5384 6904 gene locus_tag LOCUS_12260 5384 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence084 2789 213 gene locus_tag LOCUS_12270 2789 213 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068028.1 protein_id gnl|my_center|LOCUS_12270 2171 2180 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3593 2898 gene locus_tag LOCUS_12280 3593 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055252.1 protein_id gnl|my_center|LOCUS_12280 5383 3605 gene locus_tag LOCUS_12290 5383 3605 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_12290 4912 4921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5228 5262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7233 5461 gene locus_tag LOCUS_12300 7233 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7414 8130 gene locus_tag LOCUS_12310 7414 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence085 2521 2045 gene locus_tag LOCUS_12320 gene dut 2521 2045 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055963.1 protein_id gnl|my_center|LOCUS_12320 2814 2521 gene locus_tag LOCUS_12330 2814 2521 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052669.1 protein_id gnl|my_center|LOCUS_12330 3146 2814 gene locus_tag LOCUS_12340 3146 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3057 4064 gene locus_tag LOCUS_12350 gene sepH 3057 4064 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056777.1 protein_id gnl|my_center|LOCUS_12350 5342 4074 gene locus_tag LOCUS_12360 5342 4074 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054496.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence086 2168 1635 gene locus_tag LOCUS_12370 2168 1635 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055872.1 protein_id gnl|my_center|LOCUS_12370 4636 2378 gene locus_tag LOCUS_12380 4636 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4853 5440 gene locus_tag LOCUS_12390 4853 5440 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 protein_id gnl|my_center|LOCUS_12390 6063 5437 gene locus_tag LOCUS_12400 6063 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 6466 6065 gene locus_tag LOCUS_12410 6466 6065 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052491.1 protein_id gnl|my_center|LOCUS_12410 6740 6453 gene locus_tag LOCUS_12420 6740 6453 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_12420 <8047 7201 gene locus_tag LOCUS_12430 <8047 7201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052488.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence087 1557 193 gene locus_tag LOCUS_12440 1557 193 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_12440 2189 1608 gene locus_tag LOCUS_12450 2189 1608 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 protein_id gnl|my_center|LOCUS_12450 2306 4999 gene locus_tag LOCUS_12460 2306 4999 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052125.1 protein_id gnl|my_center|LOCUS_12460 5144 5542 gene locus_tag LOCUS_12470 5144 5542 CDS product DUF4418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052126.1 protein_id gnl|my_center|LOCUS_12470 5633 6850 gene locus_tag LOCUS_12480 5633 6850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068184.1 protein_id gnl|my_center|LOCUS_12480 6852 7817 gene locus_tag LOCUS_12490 6852 7817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052129.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence088 1936 269 gene locus_tag LOCUS_12500 gene dop 1936 269 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068844.1 protein_id gnl|my_center|LOCUS_12500 3524 1959 gene locus_tag LOCUS_12510 gene arc 3524 1959 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053165.1 protein_id gnl|my_center|LOCUS_12510 4282 3719 gene locus_tag LOCUS_12520 4282 3719 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057155.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12520 4348 5052 gene locus_tag LOCUS_12530 gene serB 4348 5052 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057164.1 protein_id gnl|my_center|LOCUS_12530 4485 4494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5092 7404 gene locus_tag LOCUS_12540 5092 7404 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068842.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence089 280 1131 gene locus_tag LOCUS_12550 280 1131 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068117.1 protein_id gnl|my_center|LOCUS_12550 1396 1133 gene locus_tag LOCUS_12560 1396 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1999 1637 gene locus_tag LOCUS_12570 1999 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1951 1960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2026 4113 gene locus_tag LOCUS_12580 2026 4113 CDS product bifunctional indole-3-glycerol phosphate synthase/tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068116.1 protein_id gnl|my_center|LOCUS_12580 4137 5027 gene locus_tag LOCUS_12590 gene trpA 4137 5027 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582574.1 protein_id gnl|my_center|LOCUS_12590 4685 4694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5093 6040 gene locus_tag LOCUS_12600 gene lgt 5093 6040 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052284.1 protein_id gnl|my_center|LOCUS_12600 6116 6784 gene locus_tag LOCUS_12610 gene rpe 6116 6784 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055745.1 protein_id gnl|my_center|LOCUS_12610 6847 7110 gene locus_tag LOCUS_12620 6847 7110 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054261.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence090 554 1828 gene locus_tag LOCUS_12630 554 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1835 3385 gene locus_tag LOCUS_12640 1835 3385 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_12640 3734 4558 gene locus_tag LOCUS_12650 3734 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12650 4538 4547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4555 5151 gene locus_tag LOCUS_12660 4555 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12660 5280 5918 gene locus_tag LOCUS_12670 5280 5918 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence091 <1 521 gene locus_tag LOCUS_12680 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007055081.1:Fe-S cluster assembly protein SufB 527 1762 gene locus_tag LOCUS_12690 gene sufD 527 1762 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052146.1 protein_id gnl|my_center|LOCUS_12690 1788 2567 gene locus_tag LOCUS_12700 gene sufC 1788 2567 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053376.1 protein_id gnl|my_center|LOCUS_12700 2706 3980 gene locus_tag LOCUS_12710 2706 3980 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052148.1 protein_id gnl|my_center|LOCUS_12710 3992 4546 gene locus_tag LOCUS_12720 3992 4546 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052149.1 protein_id gnl|my_center|LOCUS_12720 4553 5146 gene locus_tag LOCUS_12730 4553 5146 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052150.1 protein_id gnl|my_center|LOCUS_12730 6480 5236 gene locus_tag LOCUS_12740 gene glgC 6480 5236 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052151.1 protein_id gnl|my_center|LOCUS_12740 7186 6683 gene locus_tag LOCUS_12750 7186 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12750 7577 7080 gene locus_tag LOCUS_12760 7577 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12760 7216 7225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence092 415 1794 gene locus_tag LOCUS_12770 415 1794 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_12770 2180 1815 gene locus_tag LOCUS_12780 2180 1815 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_12780 2481 2119 gene locus_tag LOCUS_12790 2481 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4070 3027 gene locus_tag LOCUS_12800 4070 3027 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053640.1 protein_id gnl|my_center|LOCUS_12800 4474 5073 gene locus_tag LOCUS_12810 4474 5073 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051196.1 protein_id gnl|my_center|LOCUS_12810 5073 5441 gene locus_tag LOCUS_12820 5073 5441 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053642.1 protein_id gnl|my_center|LOCUS_12820 5834 5667 gene locus_tag LOCUS_12830 5834 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7016 5952 gene locus_tag LOCUS_12840 7016 5952 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051199.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence093 1567 107 gene locus_tag LOCUS_12850 1567 107 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051261.1 protein_id gnl|my_center|LOCUS_12850 1755 3113 gene locus_tag LOCUS_12860 gene alr 1755 3113 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068317.1 protein_id gnl|my_center|LOCUS_12860 3318 4592 gene locus_tag LOCUS_12870 3318 4592 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740616.1 protein_id gnl|my_center|LOCUS_12870 4792 6855 gene locus_tag LOCUS_12880 gene dnaG 4792 6855 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068315.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence094 242 1660 gene locus_tag LOCUS_12890 242 1660 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068211.1 protein_id gnl|my_center|LOCUS_12890 1893 2834 gene locus_tag LOCUS_12900 1893 2834 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068210.1 protein_id gnl|my_center|LOCUS_12900 3545 2880 gene locus_tag LOCUS_12910 3545 2880 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052063.1 protein_id gnl|my_center|LOCUS_12910 4604 3639 gene locus_tag LOCUS_12920 4604 3639 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052064.1 protein_id gnl|my_center|LOCUS_12920 6583 4700 gene locus_tag LOCUS_12930 6583 4700 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053431.1 protein_id gnl|my_center|LOCUS_12930 5532 5541 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7140 6640 gene locus_tag LOCUS_12940 7140 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence095 134 2065 gene locus_tag LOCUS_12950 gene typA 134 2065 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114597.1 protein_id gnl|my_center|LOCUS_12950 2165 2611 gene locus_tag LOCUS_12960 2165 2611 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052607.1 protein_id gnl|my_center|LOCUS_12960 2691 3668 gene locus_tag LOCUS_12970 2691 3668 CDS product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783121.1 protein_id gnl|my_center|LOCUS_12970 3662 4873 gene locus_tag LOCUS_12980 3662 4873 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068024.1 protein_id gnl|my_center|LOCUS_12980 4711 4720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4944 5201 gene locus_tag LOCUS_12990 4944 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052610.1 protein_id gnl|my_center|LOCUS_12990 5236 6309 gene locus_tag LOCUS_13000 5236 6309 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058617.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence096 3 854 gene locus_tag LOCUS_13010 3 854 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051462.1 protein_id gnl|my_center|LOCUS_13010 1681 884 gene locus_tag LOCUS_13020 1681 884 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081708.1 protein_id gnl|my_center|LOCUS_13020 3195 1762 gene locus_tag LOCUS_13030 3195 1762 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051460.1 protein_id gnl|my_center|LOCUS_13030 4045 3314 gene locus_tag LOCUS_13040 4045 3314 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051459.1 protein_id gnl|my_center|LOCUS_13040 5542 4136 gene locus_tag LOCUS_13050 5542 4136 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051458.1 protein_id gnl|my_center|LOCUS_13050 6357 5863 gene locus_tag LOCUS_13060 6357 5863 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057995.1 protein_id gnl|my_center|LOCUS_13060 6856 6689 gene locus_tag LOCUS_13070 6856 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 7085 7158 gene locus_tag LOCUS_t00290 7085 7158 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 352 1317 gene locus_tag LOCUS_13080 352 1317 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389876.1 protein_id gnl|my_center|LOCUS_13080 1332 1808 gene locus_tag LOCUS_13090 1332 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816697.1 protein_id gnl|my_center|LOCUS_13090 1829 2227 gene locus_tag LOCUS_13100 1829 2227 CDS product DUF6093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813058.1 protein_id gnl|my_center|LOCUS_13100 2227 2595 gene locus_tag LOCUS_13110 2227 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813060.1 protein_id gnl|my_center|LOCUS_13110 2592 2999 gene locus_tag LOCUS_13120 2592 2999 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813063.1 protein_id gnl|my_center|LOCUS_13120 3013 3555 gene locus_tag LOCUS_13130 3013 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3654 4163 gene locus_tag LOCUS_13140 3654 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4304 4528 gene locus_tag LOCUS_13150 4304 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence098 264 1439 gene locus_tag LOCUS_13160 gene aroC 264 1439 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052139.1 protein_id gnl|my_center|LOCUS_13160 1523 3145 gene locus_tag LOCUS_13170 1523 3145 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_13170 3309 3755 gene locus_tag LOCUS_13180 gene aroQ 3309 3755 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052141.1 protein_id gnl|my_center|LOCUS_13180 3852 4130 gene locus_tag LOCUS_13190 3852 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4137 5798 gene locus_tag LOCUS_13200 4137 5798 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052143.1 protein_id gnl|my_center|LOCUS_13200 6784 6793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence099 <1 1299 gene locus_tag LOCUS_13210 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010773627.1:ATP-binding protein 1296 2885 gene locus_tag LOCUS_13220 1296 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2360 2369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2908 4176 gene locus_tag LOCUS_13230 2908 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4517 5305 gene locus_tag LOCUS_13240 4517 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 5298 5876 gene locus_tag LOCUS_13250 5298 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052776.1 protein_id gnl|my_center|LOCUS_13250 6035 6214 gene locus_tag LOCUS_13260 6035 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 7003 6215 gene locus_tag LOCUS_13270 7003 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence100 1956 1186 gene locus_tag LOCUS_13280 1956 1186 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052866.1 protein_id gnl|my_center|LOCUS_13280 2152 3120 gene locus_tag LOCUS_13290 2152 3120 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052865.1 protein_id gnl|my_center|LOCUS_13290 3321 3019 gene locus_tag LOCUS_13300 3321 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813210.1 protein_id gnl|my_center|LOCUS_13300 5104 3467 gene locus_tag LOCUS_13310 gene purH 5104 3467 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052864.1 protein_id gnl|my_center|LOCUS_13310 6431 5052 gene locus_tag LOCUS_13320 6431 5052 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052863.1 protein_id gnl|my_center|LOCUS_13320 <7003 6451 gene locus_tag LOCUS_13330 <7003 6451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052862.1:succinate--CoA ligase subunit alpha >Feature sequence101 1213 2169 gene locus_tag LOCUS_13340 1213 2169 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740908.1 protein_id gnl|my_center|LOCUS_13340 4135 2321 gene locus_tag LOCUS_13350 4135 2321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068648.1 protein_id gnl|my_center|LOCUS_13350 6205 4334 gene locus_tag LOCUS_13360 6205 4334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068647.1 protein_id gnl|my_center|LOCUS_13360 6913 6392 gene locus_tag LOCUS_13370 6913 6392 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068645.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence102 73 495 gene locus_tag LOCUS_13380 73 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 498 1211 gene locus_tag LOCUS_13390 498 1211 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390009.1 protein_id gnl|my_center|LOCUS_13390 4061 1287 gene locus_tag LOCUS_13400 4061 1287 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068264.1 protein_id gnl|my_center|LOCUS_13400 6071 4581 gene locus_tag LOCUS_13410 gene thrC 6071 4581 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068263.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence103 2183 318 gene locus_tag LOCUS_13420 gene recQ 2183 318 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 protein_id gnl|my_center|LOCUS_13420 2432 2779 gene locus_tag LOCUS_13430 2432 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13430 2804 4156 gene locus_tag LOCUS_13440 2804 4156 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582429.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13440 5480 4296 gene locus_tag LOCUS_13450 5480 4296 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053689.1 protein_id gnl|my_center|LOCUS_13450 6639 5572 gene locus_tag LOCUS_13460 6639 5572 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582428.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence104 146 448 gene locus_tag LOCUS_13470 146 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2365 686 gene locus_tag LOCUS_13480 2365 686 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811470.1 protein_id gnl|my_center|LOCUS_13480 3369 2728 gene locus_tag LOCUS_13490 3369 2728 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 protein_id gnl|my_center|LOCUS_13490 3567 3896 gene locus_tag LOCUS_13500 3567 3896 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_13500 4708 4220 gene locus_tag LOCUS_13510 4708 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4924 4850 gene locus_tag LOCUS_t00300 4924 4850 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5035 4962 gene locus_tag LOCUS_t00310 5035 4962 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5477 5671 gene locus_tag LOCUS_13520 5477 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 <6624 5854 gene locus_tag LOCUS_13530 <6624 5854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051591.1:glutamate--tRNA ligase >Feature sequence105 98 1462 gene locus_tag LOCUS_13540 98 1462 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_13540 2443 1781 gene locus_tag LOCUS_13550 2443 1781 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053738.1 protein_id gnl|my_center|LOCUS_13550 2464 3426 gene locus_tag LOCUS_13560 2464 3426 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053737.1 protein_id gnl|my_center|LOCUS_13560 3828 4409 gene locus_tag LOCUS_13570 3828 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057770.1 protein_id gnl|my_center|LOCUS_13570 4652 5878 gene locus_tag LOCUS_13580 4652 5878 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence106 508 1614 gene locus_tag LOCUS_13590 508 1614 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783085.1 protein_id gnl|my_center|LOCUS_13590 1792 2760 gene locus_tag LOCUS_13600 1792 2760 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052472.1 protein_id gnl|my_center|LOCUS_13600 3480 2776 gene locus_tag LOCUS_13610 3480 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13610 3888 3535 gene locus_tag LOCUS_13620 3888 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13620 4142 4215 gene locus_tag LOCUS_t00320 4142 4215 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4348 4752 gene locus_tag LOCUS_13630 4348 4752 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_13630 4920 5348 gene locus_tag LOCUS_13640 4920 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5517 6023 gene locus_tag LOCUS_13650 gene mscL 5517 6023 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052477.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence107 557 1453 gene locus_tag LOCUS_13660 557 1453 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067996.1 protein_id gnl|my_center|LOCUS_13660 1528 1917 gene locus_tag LOCUS_13670 1528 1917 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_13670 2023 3267 gene locus_tag LOCUS_13680 2023 3267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389667.1 protein_id gnl|my_center|LOCUS_13680 3843 3364 gene locus_tag LOCUS_13690 gene dtd 3843 3364 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928208.1 protein_id gnl|my_center|LOCUS_13690 3842 4171 gene locus_tag LOCUS_13700 3842 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13700 4190 4642 gene locus_tag LOCUS_13710 4190 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13710 4675 4968 gene locus_tag LOCUS_13720 4675 4968 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_13720 4962 5243 gene locus_tag LOCUS_13730 4962 5243 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994045.1 protein_id gnl|my_center|LOCUS_13730 5397 5472 gene locus_tag LOCUS_t00330 5397 5472 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6114 6410 gene locus_tag LOCUS_13740 6114 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence108 836 429 gene locus_tag LOCUS_13750 836 429 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051894.1 protein_id gnl|my_center|LOCUS_13750 2447 978 gene locus_tag LOCUS_13760 2447 978 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055100.1 protein_id gnl|my_center|LOCUS_13760 1021 1030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3163 2594 gene locus_tag LOCUS_13770 3163 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3433 3353 gene locus_tag LOCUS_t00340 3433 3353 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4593 3592 gene locus_tag LOCUS_13780 4593 3592 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068252.1 protein_id gnl|my_center|LOCUS_13780 5222 4656 gene locus_tag LOCUS_13790 5222 4656 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068253.1 protein_id gnl|my_center|LOCUS_13790 5830 5219 gene locus_tag LOCUS_13800 5830 5219 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582483.1 protein_id gnl|my_center|LOCUS_13800 <6546 5921 gene locus_tag LOCUS_13810 <6546 5921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051126.1:phosphopyruvate hydratase >Feature sequence109 2805 139 gene locus_tag LOCUS_13820 2805 139 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068474.1 protein_id gnl|my_center|LOCUS_13820 2916 3197 gene locus_tag LOCUS_13830 2916 3197 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051538.1 protein_id gnl|my_center|LOCUS_13830 3261 4664 gene locus_tag LOCUS_13840 3261 4664 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054746.1 protein_id gnl|my_center|LOCUS_13840 4661 5290 gene locus_tag LOCUS_13850 4661 5290 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051536.1 protein_id gnl|my_center|LOCUS_13850 5384 6232 gene locus_tag LOCUS_13860 5384 6232 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051535.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence110 372 157 gene locus_tag LOCUS_13870 372 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 492 1013 gene locus_tag LOCUS_13880 492 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1207 1485 gene locus_tag LOCUS_13890 1207 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1685 1533 gene locus_tag LOCUS_13900 1685 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2232 2609 gene locus_tag LOCUS_13910 2232 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2868 2620 gene locus_tag LOCUS_13920 2868 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3655 2915 gene locus_tag LOCUS_13930 3655 2915 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_13930 3950 3723 gene locus_tag LOCUS_13940 3950 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4948 4436 gene locus_tag LOCUS_13950 4948 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5955 5662 gene locus_tag LOCUS_13960 5955 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence111 3074 393 gene locus_tag LOCUS_13970 3074 393 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081538.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13970 579 785 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcatcggagcgacggcgacgcggacg 3662 3393 gene locus_tag LOCUS_13980 gene rpsO 3662 3393 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 protein_id gnl|my_center|LOCUS_13980 6105 3853 gene locus_tag LOCUS_13990 6105 3853 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_13990 6470 6102 gene locus_tag LOCUS_14000 6470 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence112 1146 2246 gene locus_tag LOCUS_14010 1146 2246 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068174.1 protein_id gnl|my_center|LOCUS_14010 3756 2326 gene locus_tag LOCUS_14020 gene hemW 3756 2326 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783712.1 protein_id gnl|my_center|LOCUS_14020 3965 3756 gene locus_tag LOCUS_14030 3965 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14030 5625 3922 gene locus_tag LOCUS_14040 gene lepA 5625 3922 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053360.1 protein_id gnl|my_center|LOCUS_14040 5772 6032 gene locus_tag LOCUS_14050 gene rpsT 5772 6032 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052167.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence113 850 80 gene locus_tag LOCUS_14060 850 80 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783138.1 protein_id gnl|my_center|LOCUS_14060 976 2595 gene locus_tag LOCUS_14070 976 2595 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057799.1 protein_id gnl|my_center|LOCUS_14070 2660 3637 gene locus_tag LOCUS_14080 2660 3637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068325.1 protein_id gnl|my_center|LOCUS_14080 3634 4536 gene locus_tag LOCUS_14090 3634 4536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068324.1 protein_id gnl|my_center|LOCUS_14090 4533 5618 gene locus_tag LOCUS_14100 4533 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 5536 6180 gene locus_tag LOCUS_14110 5536 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 6003 6012 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence114 186 392 gene locus_tag LOCUS_14120 186 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14120 1516 560 gene locus_tag LOCUS_14130 gene yddG 1516 560 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068560.1 protein_id gnl|my_center|LOCUS_14130 2901 1810 gene locus_tag LOCUS_14140 2901 1810 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068564.1 protein_id gnl|my_center|LOCUS_14140 3021 5465 gene locus_tag LOCUS_14150 3021 5465 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068565.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence115 <1 914 gene locus_tag LOCUS_14160 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082910117.1:sugar ABC transporter ATP-binding protein 914 1855 gene locus_tag LOCUS_14170 914 1855 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 protein_id gnl|my_center|LOCUS_14170 1894 3990 gene locus_tag LOCUS_14180 1894 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 4034 4813 gene locus_tag LOCUS_14190 4034 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 4943 5965 gene locus_tag LOCUS_14200 4943 5965 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence116 4211 3870 gene locus_tag LOCUS_14210 4211 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4325 6148 gene locus_tag LOCUS_14220 4325 6148 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068394.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence117 958 104 gene locus_tag LOCUS_14230 958 104 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582939.1 protein_id gnl|my_center|LOCUS_14230 1254 3278 gene locus_tag LOCUS_14240 1254 3278 CDS product DUF6020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582940.1 protein_id gnl|my_center|LOCUS_14240 3278 4099 gene locus_tag LOCUS_14250 3278 4099 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053763.1 protein_id gnl|my_center|LOCUS_14250 4958 4206 gene locus_tag LOCUS_14260 4958 4206 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056694.1 protein_id gnl|my_center|LOCUS_14260 5834 5178 gene locus_tag LOCUS_14270 5834 5178 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068719.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14270 >Feature sequence118 <1 2004 gene locus_tag LOCUS_14280 <1 2004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390053.1:FtsX-like permease family protein 2201 2037 gene locus_tag LOCUS_14290 2201 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3112 2312 gene locus_tag LOCUS_14300 3112 2312 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390051.1 protein_id gnl|my_center|LOCUS_14300 2387 2396 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5589 3187 gene locus_tag LOCUS_14310 5589 3187 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047379863.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence119 141 665 gene locus_tag LOCUS_14320 gene ispF 141 665 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068243.1 protein_id gnl|my_center|LOCUS_14320 989 717 gene locus_tag LOCUS_14330 989 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14330 1012 1021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1088 1588 gene locus_tag LOCUS_14340 1088 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2520 1630 gene locus_tag LOCUS_14350 2520 1630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053564.1 protein_id gnl|my_center|LOCUS_14350 3963 2692 gene locus_tag LOCUS_14360 3963 2692 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051915.1 protein_id gnl|my_center|LOCUS_14360 4067 4942 gene locus_tag LOCUS_14370 4067 4942 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053562.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence120 122 487 gene locus_tag LOCUS_14380 122 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053174.1 protein_id gnl|my_center|LOCUS_14380 1263 622 gene locus_tag LOCUS_14390 1263 622 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068849.1 protein_id gnl|my_center|LOCUS_14390 1396 2832 gene locus_tag LOCUS_14400 gene purB 1396 2832 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053172.1 protein_id gnl|my_center|LOCUS_14400 2964 5525 gene locus_tag LOCUS_14410 2964 5525 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068847.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence121 564 1106 gene locus_tag LOCUS_14420 564 1106 CDS product histone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068319.1 protein_id gnl|my_center|LOCUS_14420 2870 1731 gene locus_tag LOCUS_14430 2870 1731 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_14430 3827 2949 gene locus_tag LOCUS_14440 3827 2949 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 protein_id gnl|my_center|LOCUS_14440 4842 3901 gene locus_tag LOCUS_14450 4842 3901 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence122 1544 606 gene locus_tag LOCUS_14460 1544 606 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507589.1 protein_id gnl|my_center|LOCUS_14460 5277 1693 gene locus_tag LOCUS_14470 gene mfd 5277 1693 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068255.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence123 1088 1402 gene locus_tag LOCUS_14480 1088 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2145 1780 gene locus_tag LOCUS_14490 2145 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2497 2168 gene locus_tag LOCUS_14500 2497 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2717 2983 gene locus_tag LOCUS_14510 2717 2983 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388479.1 protein_id gnl|my_center|LOCUS_14510 2983 3237 gene locus_tag LOCUS_14520 2983 3237 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775363.1 protein_id gnl|my_center|LOCUS_14520 4295 3183 gene locus_tag LOCUS_14530 4295 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 4759 4292 gene locus_tag LOCUS_14540 4759 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5288 4770 gene locus_tag LOCUS_14550 5288 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence124 359 2509 gene locus_tag LOCUS_14560 359 2509 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068392.1 protein_id gnl|my_center|LOCUS_14560 2553 3608 gene locus_tag LOCUS_14570 2553 3608 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068391.1 protein_id gnl|my_center|LOCUS_14570 3668 4537 gene locus_tag LOCUS_14580 3668 4537 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068388.1 protein_id gnl|my_center|LOCUS_14580 4541 5284 gene locus_tag LOCUS_14590 4541 5284 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410358.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence125 894 760 gene locus_tag LOCUS_14600 894 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1135 1004 gene locus_tag LOCUS_14610 1135 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2447 1494 gene locus_tag LOCUS_14620 2447 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068169.1 protein_id gnl|my_center|LOCUS_14620 2975 4021 gene locus_tag LOCUS_14630 2975 4021 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053353.1 protein_id gnl|my_center|LOCUS_14630 4362 4640 gene locus_tag LOCUS_14640 4362 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4912 4697 gene locus_tag LOCUS_14650 4912 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 5027 4827 gene locus_tag LOCUS_14660 5027 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 5102 5111 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence126 257 266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 660 310 gene locus_tag LOCUS_14670 660 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 922 1140 gene locus_tag LOCUS_14680 922 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14680 1177 1881 gene locus_tag LOCUS_14690 1177 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14690 1869 1878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1905 2681 gene locus_tag LOCUS_14700 1905 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14700 2614 2623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2701 4389 gene locus_tag LOCUS_14710 2701 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14710 4462 4911 gene locus_tag LOCUS_14720 4462 4911 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053330.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence127 938 216 gene locus_tag LOCUS_14730 938 216 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055490.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14730 263 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1225 2163 gene locus_tag LOCUS_14740 1225 2163 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052119.1 protein_id gnl|my_center|LOCUS_14740 2653 2252 gene locus_tag LOCUS_14750 2653 2252 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052118.1 protein_id gnl|my_center|LOCUS_14750 2812 3141 gene locus_tag LOCUS_14760 2812 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14760 2953 2962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3062 3430 gene locus_tag LOCUS_14770 3062 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14770 3530 4153 gene locus_tag LOCUS_14780 3530 4153 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389783.1 protein_id gnl|my_center|LOCUS_14780 4931 4347 gene locus_tag LOCUS_14790 4931 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14790 5267 4968 gene locus_tag LOCUS_14800 5267 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14800 >Feature sequence128 1509 781 gene locus_tag LOCUS_14810 gene rnc 1509 781 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055729.1 protein_id gnl|my_center|LOCUS_14810 1851 1657 gene locus_tag LOCUS_14820 gene rpmF 1851 1657 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051413.1 protein_id gnl|my_center|LOCUS_14820 2569 1940 gene locus_tag LOCUS_14830 2569 1940 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054816.1 protein_id gnl|my_center|LOCUS_14830 3539 2649 gene locus_tag LOCUS_14840 3539 2649 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057854.1 protein_id gnl|my_center|LOCUS_14840 4047 3547 gene locus_tag LOCUS_14850 gene coaD 4047 3547 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051410.1 protein_id gnl|my_center|LOCUS_14850 4309 4602 gene locus_tag LOCUS_14860 4309 4602 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811884.1 protein_id gnl|my_center|LOCUS_14860 <5282 4644 gene locus_tag LOCUS_14870 <5282 4644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051408.1:aldo/keto reductase >Feature sequence129 375 13 gene locus_tag LOCUS_14880 375 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 618 821 gene locus_tag LOCUS_14890 618 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 963 1484 gene locus_tag LOCUS_14900 963 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 1390 2541 gene locus_tag LOCUS_14910 1390 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14910 3375 2725 gene locus_tag LOCUS_14920 gene lepB 3375 2725 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054233.1 protein_id gnl|my_center|LOCUS_14920 3883 3455 gene locus_tag LOCUS_14930 3883 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 4252 3908 gene locus_tag LOCUS_14940 4252 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4340 5218 gene locus_tag LOCUS_14950 4340 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence130 229 1467 gene locus_tag LOCUS_14960 229 1467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068186.1 protein_id gnl|my_center|LOCUS_14960 1454 2866 gene locus_tag LOCUS_14970 1454 2866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068185.1 protein_id gnl|my_center|LOCUS_14970 4349 2871 gene locus_tag LOCUS_14980 4349 2871 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 protein_id gnl|my_center|LOCUS_14980 4532 4798 gene locus_tag LOCUS_14990 4532 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence131 421 1188 gene locus_tag LOCUS_15000 421 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2387 1317 gene locus_tag LOCUS_15010 2387 1317 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068286.1 protein_id gnl|my_center|LOCUS_15010 2826 2551 gene locus_tag LOCUS_15020 2826 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2990 2847 gene locus_tag LOCUS_15030 2990 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4541 3237 gene locus_tag LOCUS_15040 4541 3237 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence132 <1 673 gene locus_tag LOCUS_15050 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068393.1:ATP-binding cassette domain-containing protein 1176 907 gene locus_tag LOCUS_15060 1176 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2011 3360 gene locus_tag LOCUS_15070 2011 3360 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055690.1 protein_id gnl|my_center|LOCUS_15070 3580 4542 gene locus_tag LOCUS_15080 3580 4542 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100494330.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence133 812 264 gene locus_tag LOCUS_15090 812 264 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032735440.1 protein_id gnl|my_center|LOCUS_15090 1844 876 gene locus_tag LOCUS_15100 1844 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052675.1 protein_id gnl|my_center|LOCUS_15100 2758 2054 gene locus_tag LOCUS_15110 2758 2054 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_15110 3796 2861 gene locus_tag LOCUS_15120 3796 2861 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052677.1 protein_id gnl|my_center|LOCUS_15120 4073 4477 gene locus_tag LOCUS_15130 4073 4477 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052678.1 protein_id gnl|my_center|LOCUS_15130 <5115 4505 gene locus_tag LOCUS_15140 <5115 4505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013582782.1:DNA methyltransferase >Feature sequence134 224 282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1408 368 gene locus_tag LOCUS_15150 1408 368 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067959.1 protein_id gnl|my_center|LOCUS_15150 2849 1452 gene locus_tag LOCUS_15160 2849 1452 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054058.1 protein_id gnl|my_center|LOCUS_15160 3940 2924 gene locus_tag LOCUS_15170 3940 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 4087 4779 gene locus_tag LOCUS_15180 4087 4779 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114259.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence135 283 654 gene locus_tag LOCUS_15190 gene rplR 283 654 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053041.1 protein_id gnl|my_center|LOCUS_15190 651 1382 gene locus_tag LOCUS_15200 gene rpsE 651 1382 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053804.1 protein_id gnl|my_center|LOCUS_15200 1379 1573 gene locus_tag LOCUS_15210 gene rpmD 1379 1573 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053043.1 protein_id gnl|my_center|LOCUS_15210 1576 2028 gene locus_tag LOCUS_15220 gene rplO 1576 2028 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783622.1 protein_id gnl|my_center|LOCUS_15220 2303 3640 gene locus_tag LOCUS_15230 gene secY 2303 3640 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053045.1 protein_id gnl|my_center|LOCUS_15230 3810 4370 gene locus_tag LOCUS_15240 3810 4370 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053046.1 protein_id gnl|my_center|LOCUS_15240 4547 4765 gene locus_tag LOCUS_15250 gene infA 4547 4765 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808114.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence136 219 971 gene locus_tag LOCUS_15260 219 971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029211.1 protein_id gnl|my_center|LOCUS_15260 971 2407 gene locus_tag LOCUS_15270 971 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2421 3794 gene locus_tag LOCUS_15280 2421 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3769 4512 gene locus_tag LOCUS_15290 3769 4512 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence137 239 1234 gene locus_tag LOCUS_15300 239 1234 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053048.1 protein_id gnl|my_center|LOCUS_15300 1334 1867 gene locus_tag LOCUS_15310 1334 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2860 1949 gene locus_tag LOCUS_15320 gene truA 2860 1949 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053050.1 protein_id gnl|my_center|LOCUS_15320 3237 2857 gene locus_tag LOCUS_15330 3237 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence138 1085 108 gene locus_tag LOCUS_15340 1085 108 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_15340 2053 1085 gene locus_tag LOCUS_15350 gene pdhA 2053 1085 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_15350 2950 2075 gene locus_tag LOCUS_15360 gene sucD 2950 2075 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025451.1 protein_id gnl|my_center|LOCUS_15360 4098 2947 gene locus_tag LOCUS_15370 gene sucC 4098 2947 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_15370 <5032 4112 gene locus_tag LOCUS_15380 <5032 4112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454646.1:aldehyde dehydrogenase family protein >Feature sequence139 3607 701 gene locus_tag LOCUS_15390 3607 701 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052638.1 protein_id gnl|my_center|LOCUS_15390 1372 1381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3819 4565 gene locus_tag LOCUS_15400 3819 4565 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582798.1 protein_id gnl|my_center|LOCUS_15400 3928 3937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence140 <1 870 gene locus_tag LOCUS_15410 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068789.1:ATP-dependent zinc metalloprotease FtsH 965 1564 gene locus_tag LOCUS_15420 gene folE 965 1564 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052379.1 protein_id gnl|my_center|LOCUS_15420 1652 2527 gene locus_tag LOCUS_15430 gene folP 1652 2527 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068790.1 protein_id gnl|my_center|LOCUS_15430 2637 4049 gene locus_tag LOCUS_15440 gene folK 2637 4049 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068791.1 protein_id gnl|my_center|LOCUS_15440 4224 4751 gene locus_tag LOCUS_15450 4224 4751 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068792.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence141 3469 3260 gene locus_tag LOCUS_15460 3469 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3468 3719 gene locus_tag LOCUS_15470 3468 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4829 3804 gene locus_tag LOCUS_15480 4829 3804 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence142 51 1139 gene locus_tag LOCUS_15490 51 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1143 2036 gene locus_tag LOCUS_15500 gene nadC 1143 2036 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068020.1 protein_id gnl|my_center|LOCUS_15500 2039 3286 gene locus_tag LOCUS_15510 2039 3286 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068021.1 protein_id gnl|my_center|LOCUS_15510 3318 4667 gene locus_tag LOCUS_15520 3318 4667 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068022.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence143 <1 1216 gene locus_tag LOCUS_15530 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068213.1:chloride channel protein 1333 1713 gene locus_tag LOCUS_15540 1333 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1819 2442 gene locus_tag LOCUS_15550 1819 2442 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052058.1 protein_id gnl|my_center|LOCUS_15550 2439 3149 gene locus_tag LOCUS_15560 2439 3149 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052059.1 protein_id gnl|my_center|LOCUS_15560 3271 4650 gene locus_tag LOCUS_15570 gene clpX 3271 4650 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021975717.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence144 1855 476 gene locus_tag LOCUS_15580 gene tig 1855 476 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068214.1 protein_id gnl|my_center|LOCUS_15580 3211 1868 gene locus_tag LOCUS_15590 3211 1868 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068215.1 protein_id gnl|my_center|LOCUS_15590 3846 3208 gene locus_tag LOCUS_15600 3846 3208 CDS product DUF3000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068216.1 protein_id gnl|my_center|LOCUS_15600 4790 3909 gene locus_tag LOCUS_15610 gene pflA 4790 3909 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence145 2290 233 gene locus_tag LOCUS_15620 2290 233 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_15620 2951 2403 gene locus_tag LOCUS_15630 2951 2403 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052986.1 protein_id gnl|my_center|LOCUS_15630 3265 3918 gene locus_tag LOCUS_15640 3265 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 <4842 4180 gene locus_tag LOCUS_15650 <4842 4180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068722.1:type I polyketide synthase >Feature sequence146 1003 143 gene locus_tag LOCUS_15660 1003 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1245 1081 gene locus_tag LOCUS_15670 1245 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1657 1268 gene locus_tag LOCUS_15680 1657 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1989 1654 gene locus_tag LOCUS_15690 1989 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2256 2002 gene locus_tag LOCUS_15700 2256 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2504 2253 gene locus_tag LOCUS_15710 2504 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3141 2575 gene locus_tag LOCUS_15720 3141 2575 CDS product oligoribonuclease Orn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820462.1 protein_id gnl|my_center|LOCUS_15720 3533 3138 gene locus_tag LOCUS_15730 3533 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813016.1 protein_id gnl|my_center|LOCUS_15730 3726 3526 gene locus_tag LOCUS_15740 3726 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence147 1803 40 gene locus_tag LOCUS_15750 1803 40 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052234.1 protein_id gnl|my_center|LOCUS_15750 3033 1843 gene locus_tag LOCUS_15760 3033 1843 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052235.1 protein_id gnl|my_center|LOCUS_15760 3707 3723 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence148 2115 1810 gene locus_tag LOCUS_15770 2115 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4459 2030 gene locus_tag LOCUS_15780 4459 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15780 2463 2472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence149 339 430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1722 1348 gene locus_tag LOCUS_15790 1722 1348 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782778.1 protein_id gnl|my_center|LOCUS_15790 2611 1964 gene locus_tag LOCUS_15800 2611 1964 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056362.1 protein_id gnl|my_center|LOCUS_15800 <4477 2641 gene locus_tag LOCUS_15810 <4477 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068268.1:DNA repair protein RecN >Feature sequence150 2 1204 gene locus_tag LOCUS_15820 2 1204 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068259.1 protein_id gnl|my_center|LOCUS_15820 2067 1282 gene locus_tag LOCUS_15830 gene nadD 2067 1282 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051134.1 protein_id gnl|my_center|LOCUS_15830 2645 2064 gene locus_tag LOCUS_15840 2645 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053591.1 protein_id gnl|my_center|LOCUS_15840 3946 2642 gene locus_tag LOCUS_15850 3946 2642 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051136.1 protein_id gnl|my_center|LOCUS_15850 4472 4128 gene locus_tag LOCUS_15860 4472 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence151 73 285 gene locus_tag LOCUS_15870 73 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15870 325 447 gene locus_tag LOCUS_15880 325 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15880 1031 558 gene locus_tag LOCUS_15890 1031 558 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033125641.1 protein_id gnl|my_center|LOCUS_15890 1160 1594 gene locus_tag LOCUS_15900 1160 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1666 1869 gene locus_tag LOCUS_15910 1666 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2503 2724 gene locus_tag LOCUS_15920 2503 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2890 3246 gene locus_tag LOCUS_15930 2890 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3407 4306 gene locus_tag LOCUS_15940 3407 4306 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053281.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence152 1768 554 gene locus_tag LOCUS_15950 1768 554 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052046.1 protein_id gnl|my_center|LOCUS_15950 2880 1900 gene locus_tag LOCUS_15960 2880 1900 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068221.1 protein_id gnl|my_center|LOCUS_15960 3081 3902 gene locus_tag LOCUS_15970 3081 3902 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068222.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence153 986 717 gene locus_tag LOCUS_15980 986 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2271 976 gene locus_tag LOCUS_15990 2271 976 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055251.1 protein_id gnl|my_center|LOCUS_15990 2998 2261 gene locus_tag LOCUS_16000 2998 2261 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783114.1 protein_id gnl|my_center|LOCUS_16000 2944 2953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3868 3014 gene locus_tag LOCUS_16010 3868 3014 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068026.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence154 1 792 gene locus_tag LOCUS_16020 1 792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052443.1 protein_id gnl|my_center|LOCUS_16020 792 1496 gene locus_tag LOCUS_16030 792 1496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_16030 2080 1628 gene locus_tag LOCUS_16040 2080 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2255 2929 gene locus_tag LOCUS_16050 2255 2929 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053883.1 protein_id gnl|my_center|LOCUS_16050 2926 4209 gene locus_tag LOCUS_16060 2926 4209 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052448.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence155 3 350 gene locus_tag LOCUS_16070 3 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2592 508 gene locus_tag LOCUS_16080 2592 508 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_16080 2228 2237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3941 2613 gene locus_tag LOCUS_16090 3941 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence156 <1 2161 gene locus_tag LOCUS_16100 <1 2161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053385.1:alanine--tRNA ligase 661 670 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2170 2628 gene locus_tag LOCUS_16110 gene ruvX 2170 2628 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053384.1 protein_id gnl|my_center|LOCUS_16110 2639 3820 gene locus_tag LOCUS_16120 gene mltG 2639 3820 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence157 601 1176 gene locus_tag LOCUS_16130 601 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1154 2059 gene locus_tag LOCUS_16140 1154 2059 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068065.1 protein_id gnl|my_center|LOCUS_16140 2133 2684 gene locus_tag LOCUS_16150 2133 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056124.1 protein_id gnl|my_center|LOCUS_16150 2671 3618 gene locus_tag LOCUS_16160 2671 3618 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 protein_id gnl|my_center|LOCUS_16160 3637 3963 gene locus_tag LOCUS_16170 3637 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052694.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence158 943 952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1690 1010 gene locus_tag LOCUS_16180 1690 1010 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051909.1 protein_id gnl|my_center|LOCUS_16180 4020 1768 gene locus_tag LOCUS_16190 gene glgB 4020 1768 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782797.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence159 2600 1050 gene locus_tag LOCUS_16200 2600 1050 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 protein_id gnl|my_center|LOCUS_16200 3019 2645 gene locus_tag LOCUS_16210 3019 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 <4053 3385 gene locus_tag LOCUS_16220 <4053 3385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052069.1:pyridoxamine kinase 3805 3814 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence160 2 274 gene locus_tag LOCUS_16230 2 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 514 314 gene locus_tag LOCUS_16240 514 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 735 1502 gene locus_tag LOCUS_16250 735 1502 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 protein_id gnl|my_center|LOCUS_16250 1792 3057 gene locus_tag LOCUS_16260 1792 3057 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054004.1 protein_id gnl|my_center|LOCUS_16260 3081 3890 gene locus_tag LOCUS_16270 3081 3890 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582851.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence161 1644 862 gene locus_tag LOCUS_16280 1644 862 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056912.1 protein_id gnl|my_center|LOCUS_16280 3395 1839 gene locus_tag LOCUS_16290 3395 1839 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 protein_id gnl|my_center|LOCUS_16290 <4046 3407 gene locus_tag LOCUS_16300 <4046 3407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067958.1:MFS transporter >Feature sequence162 2656 1064 gene locus_tag LOCUS_16310 2656 1064 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056288.1 protein_id gnl|my_center|LOCUS_16310 <4018 2659 gene locus_tag LOCUS_16320 <4018 2659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068711.1:arginine--tRNA ligase >Feature sequence163 <3994 3330 gene locus_tag LOCUS_16330 <3994 3330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054390.1:methyltransferase >Feature sequence164 <1 1696 gene locus_tag LOCUS_16340 <1 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068820.1:acyl-CoA dehydratase activase-related protein 1861 3138 gene locus_tag LOCUS_16350 1861 3138 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015713811.1 protein_id gnl|my_center|LOCUS_16350 3217 3825 gene locus_tag LOCUS_16360 3217 3825 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053909.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence165 316 1197 gene locus_tag LOCUS_16370 gene tsaB 316 1197 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054365.1 protein_id gnl|my_center|LOCUS_16370 1214 1768 gene locus_tag LOCUS_16380 gene rimI 1214 1768 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783284.1 protein_id gnl|my_center|LOCUS_16380 1765 2808 gene locus_tag LOCUS_16390 gene tsaD 1765 2808 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054363.1 protein_id gnl|my_center|LOCUS_16390 3075 3000 gene locus_tag LOCUS_t00350 3075 3000 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence166 3170 1059 gene locus_tag LOCUS_16400 gene uvrB 3170 1059 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068239.1 protein_id gnl|my_center|LOCUS_16400 3799 3182 gene locus_tag LOCUS_16410 gene coaE 3799 3182 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055464.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence167 648 1118 gene locus_tag LOCUS_16420 648 1118 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051517.1 protein_id gnl|my_center|LOCUS_16420 1227 1931 gene locus_tag LOCUS_16430 1227 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582356.1 protein_id gnl|my_center|LOCUS_16430 2093 2893 gene locus_tag LOCUS_16440 2093 2893 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054758.1 protein_id gnl|my_center|LOCUS_16440 2952 3638 gene locus_tag LOCUS_16450 gene nth 2952 3638 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051520.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence168 <1 1511 gene locus_tag LOCUS_16460 <1 1511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068832.1:mupirocin-resistant isoleucine--tRNA ligase 1528 1537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3190 1970 gene locus_tag LOCUS_16470 gene metK 3190 1970 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068839.1 protein_id gnl|my_center|LOCUS_16470 3752 3468 gene locus_tag LOCUS_16480 gene rpoZ 3752 3468 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053158.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence169 47 892 gene locus_tag LOCUS_16490 47 892 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068056.1 protein_id gnl|my_center|LOCUS_16490 1007 1957 gene locus_tag LOCUS_16500 1007 1957 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 protein_id gnl|my_center|LOCUS_16500 2053 2946 gene locus_tag LOCUS_16510 2053 2946 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080747.1 protein_id gnl|my_center|LOCUS_16510 2896 2905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence170 420 199 gene locus_tag LOCUS_16520 420 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055377.1 protein_id gnl|my_center|LOCUS_16520 2170 473 gene locus_tag LOCUS_16530 2170 473 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052049.1 protein_id gnl|my_center|LOCUS_16530 3670 2519 gene locus_tag LOCUS_16540 3670 2519 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052048.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence171 509 593 gene locus_tag LOCUS_t00360 509 593 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 961 2040 gene locus_tag LOCUS_16550 961 2040 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113365.1 protein_id gnl|my_center|LOCUS_16550 2199 3647 gene locus_tag LOCUS_16560 2199 3647 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence172 1892 2857 gene locus_tag LOCUS_16570 1892 2857 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053195.1 protein_id gnl|my_center|LOCUS_16570 <3778 3032 gene locus_tag LOCUS_16580 <3778 3032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053194.1:DUF3027 domain-containing protein >Feature sequence173 >Feature sequence174 <1 507 gene locus_tag LOCUS_16590 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068035.1:CinA family protein 573 1082 gene locus_tag LOCUS_16600 573 1082 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052641.1 protein_id gnl|my_center|LOCUS_16600 1194 1427 gene locus_tag LOCUS_16610 1194 1427 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113620.1 protein_id gnl|my_center|LOCUS_16610 1728 2921 gene locus_tag LOCUS_16620 gene recA 1728 2921 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052644.1 protein_id gnl|my_center|LOCUS_16620 3068 3517 gene locus_tag LOCUS_16630 3068 3517 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783103.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence175 1209 628 gene locus_tag LOCUS_16640 1209 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1273 2256 gene locus_tag LOCUS_16650 1273 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2601 3647 gene locus_tag LOCUS_16660 gene trpD 2601 3647 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068039.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence176 432 1286 gene locus_tag LOCUS_16670 gene metF 432 1286 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056260.1 protein_id gnl|my_center|LOCUS_16670 1420 2373 gene locus_tag LOCUS_16680 gene bsh 1420 2373 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052221.1 protein_id gnl|my_center|LOCUS_16680 2441 3469 gene locus_tag LOCUS_16690 2441 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 3316 3381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence177 107 1342 gene locus_tag LOCUS_16700 107 1342 CDS product IS30-like element ISBlo4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783747.1 protein_id gnl|my_center|LOCUS_16700 3573 1855 gene locus_tag LOCUS_16710 3573 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence178 104 2158 gene locus_tag LOCUS_16720 104 2158 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055427524.1 protein_id gnl|my_center|LOCUS_16720 3093 2221 gene locus_tag LOCUS_16730 3093 2221 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068065.1 protein_id gnl|my_center|LOCUS_16730 3285 3343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence179 701 1627 gene locus_tag LOCUS_16740 701 1627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052614.1 protein_id gnl|my_center|LOCUS_16740 1648 2652 gene locus_tag LOCUS_16750 1648 2652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052615.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence180 251 772 gene locus_tag LOCUS_16760 251 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1809 796 gene locus_tag LOCUS_16770 1809 796 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582570.1 protein_id gnl|my_center|LOCUS_16770 2028 3308 gene locus_tag LOCUS_16780 2028 3308 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033518021.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence181 568 577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2579 1668 gene locus_tag LOCUS_16790 2579 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2872 2492 gene locus_tag LOCUS_16800 2872 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence182 1328 609 gene locus_tag LOCUS_16810 gene recO 1328 609 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 protein_id gnl|my_center|LOCUS_16810 3090 1378 gene locus_tag LOCUS_16820 3090 1378 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067955.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence183 2196 175 gene locus_tag LOCUS_16830 2196 175 CDS product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582357.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence184 2878 1214 gene locus_tag LOCUS_16840 2878 1214 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056415.1 protein_id gnl|my_center|LOCUS_16840 <3456 2936 gene locus_tag LOCUS_16850 <3456 2936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007056414.1:pyridoxal 5'-phosphate synthase glutaminase subunit PdxT >Feature sequence185 1628 180 gene locus_tag LOCUS_16860 1628 180 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068714.1 protein_id gnl|my_center|LOCUS_16860 2877 1765 gene locus_tag LOCUS_16870 2877 1765 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068713.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence186 1044 34 gene locus_tag LOCUS_16880 1044 34 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054437.1 protein_id gnl|my_center|LOCUS_16880 1335 2327 gene locus_tag LOCUS_16890 1335 2327 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014483607.1 protein_id gnl|my_center|LOCUS_16890 3029 2520 gene locus_tag LOCUS_16900 gene ybaK 3029 2520 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054439.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence187 57 848 gene locus_tag LOCUS_16910 57 848 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056908.1 protein_id gnl|my_center|LOCUS_16910 914 1816 gene locus_tag LOCUS_16920 914 1816 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_16920 1946 3178 gene locus_tag LOCUS_16930 1946 3178 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053275.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence188 295 1467 gene locus_tag LOCUS_16940 295 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052026.1 protein_id gnl|my_center|LOCUS_16940 1650 2987 gene locus_tag LOCUS_16950 gene aroA 1650 2987 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582494.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence189 2318 1566 gene locus_tag LOCUS_16960 2318 1566 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051209.1 protein_id gnl|my_center|LOCUS_16960 2644 3009 gene locus_tag LOCUS_16970 2644 3009 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813907.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence190 1820 1416 gene locus_tag LOCUS_16980 1820 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813042.1 protein_id gnl|my_center|LOCUS_16980 2457 1840 gene locus_tag LOCUS_16990 2457 1840 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389872.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence191 1228 593 gene locus_tag LOCUS_17000 1228 593 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_17000 1888 1256 gene locus_tag LOCUS_17010 1888 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2605 1937 gene locus_tag LOCUS_17020 2605 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3104 2598 gene locus_tag LOCUS_17030 3104 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence192 <1 920 gene locus_tag LOCUS_17040 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068306.1:zinc-binding dehydrogenase 1022 1522 gene locus_tag LOCUS_17050 gene purE 1022 1522 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057689.1 protein_id gnl|my_center|LOCUS_17050 1506 2684 gene locus_tag LOCUS_17060 gene purK 1506 2684 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051237.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence193 2348 1104 gene locus_tag LOCUS_17070 gene dusB 2348 1104 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056907.1 protein_id gnl|my_center|LOCUS_17070 <3034 2493 gene locus_tag LOCUS_17080 <3034 2493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011067967.1:glycine--tRNA ligase >Feature sequence194 501 1661 gene locus_tag LOCUS_17090 501 1661 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051205.1 protein_id gnl|my_center|LOCUS_17090 2834 1809 gene locus_tag LOCUS_17100 2834 1809 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056348.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence195 2 145 gene locus_tag LOCUS_17110 2 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 138 869 gene locus_tag LOCUS_17120 138 869 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053191.1 protein_id gnl|my_center|LOCUS_17120 1040 2890 gene locus_tag LOCUS_17130 1040 2890 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055645.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence196 720 1850 gene locus_tag LOCUS_17140 720 1850 CDS product DUF4854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582958.1 protein_id gnl|my_center|LOCUS_17140 1953 2774 gene locus_tag LOCUS_17150 1953 2774 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582957.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence197 <1 999 gene locus_tag LOCUS_17160 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052794.1:molecular chaperone DnaJ 1682 1047 gene locus_tag LOCUS_17170 1682 1047 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054285.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17170 1838 1698 gene locus_tag LOCUS_17180 1838 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17180 1984 2868 gene locus_tag LOCUS_17190 gene uppP 1984 2868 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052850.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence198 <2902 1147 gene locus_tag LOCUS_17200 <2902 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068826.1:ABC transporter ATP-binding protein >Feature sequence199 <1 1129 gene locus_tag LOCUS_17210 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068346.1:ATP-dependent DNA helicase 1341 2660 gene locus_tag LOCUS_17220 1341 2660 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053725.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence200 450 938 gene locus_tag LOCUS_17230 gene def 450 938 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052751.1 protein_id gnl|my_center|LOCUS_17230 1294 2139 gene locus_tag LOCUS_17240 gene rpsB 1294 2139 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056702.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence201 313 1818 gene locus_tag LOCUS_17250 313 1818 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582382.1 protein_id gnl|my_center|LOCUS_17250 1656 1665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2870 1914 gene locus_tag LOCUS_17260 2870 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence202 361 1002 gene locus_tag LOCUS_17270 361 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054242.1 protein_id gnl|my_center|LOCUS_17270 1405 1019 gene locus_tag LOCUS_17280 1405 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2731 1715 gene locus_tag LOCUS_17290 gene yidC 2731 1715 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214358204.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence203 496 792 gene locus_tag LOCUS_17300 496 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 906 1889 gene locus_tag LOCUS_17310 906 1889 CDS product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068358.1 protein_id gnl|my_center|LOCUS_17310 <2780 2028 gene locus_tag LOCUS_17320 <2780 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011167180.1:S8 family peptidase >Feature sequence204 732 313 gene locus_tag LOCUS_17330 732 313 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051418.1 protein_id gnl|my_center|LOCUS_17330 1020 742 gene locus_tag LOCUS_17340 1020 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1730 1176 gene locus_tag LOCUS_17350 gene ilvN 1730 1176 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 protein_id gnl|my_center|LOCUS_17350 <2775 1747 gene locus_tag LOCUS_17360 <2775 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054814.1:acetolactate synthase large subunit >Feature sequence205 458 258 gene locus_tag LOCUS_17370 458 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1078 677 gene locus_tag LOCUS_17380 1078 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1284 1102 gene locus_tag LOCUS_17390 1284 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1524 2669 gene locus_tag LOCUS_17400 1524 2669 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence206 1934 177 gene locus_tag LOCUS_17410 1934 177 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_17410 2241 1951 gene locus_tag LOCUS_17420 2241 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence207 794 60 gene locus_tag LOCUS_17430 794 60 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051540.1 protein_id gnl|my_center|LOCUS_17430 2722 1028 gene locus_tag LOCUS_17440 gene ptsP 2722 1028 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence208 204 2168 gene locus_tag LOCUS_17450 204 2168 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053388.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence209 86 2251 gene locus_tag LOCUS_17460 gene malQ 86 2251 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053798.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence210 2319 76 gene locus_tag LOCUS_17470 2319 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 929 938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2720 2313 gene locus_tag LOCUS_17480 2720 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence211 <1 1261 gene locus_tag LOCUS_17490 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068231.1:glycoside-pentoside-hexuronide (GPH):cation symporter 1289 1298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1740 2189 gene locus_tag LOCUS_17500 1740 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17500 >Feature sequence212 <1 538 gene locus_tag LOCUS_17510 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052070.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase 887 1801 gene locus_tag LOCUS_17520 887 1801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068208.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence213 2519 279 gene locus_tag LOCUS_17530 2519 279 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054760.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence214 2295 2314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence215 930 295 gene locus_tag LOCUS_17540 930 295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068395.1 protein_id gnl|my_center|LOCUS_17540 2163 943 gene locus_tag LOCUS_17550 2163 943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068396.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence216 >Feature sequence217 1539 1464 gene locus_tag LOCUS_t00370 1539 1464 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <2549 1604 gene locus_tag LOCUS_17560 <2549 1604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007055764.1:bifunctional cytidylate kinase/GTPase Der >Feature sequence218 265 864 gene locus_tag LOCUS_17570 265 864 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051922.1 protein_id gnl|my_center|LOCUS_17570 2454 1012 gene locus_tag LOCUS_17580 gene pyk 2454 1012 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055467.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence219 144 1412 gene locus_tag LOCUS_17590 144 1412 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052709.1 protein_id gnl|my_center|LOCUS_17590 1767 1426 gene locus_tag LOCUS_17600 1767 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2010 1780 gene locus_tag LOCUS_17610 2010 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence220 948 91 gene locus_tag LOCUS_17620 948 91 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582540.1 protein_id gnl|my_center|LOCUS_17620 1949 1101 gene locus_tag LOCUS_17630 1949 1101 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053343.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence221 <1 1453 gene locus_tag LOCUS_17640 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032740880.1:AMP-dependent synthetase/ligase 2118 1594 gene locus_tag LOCUS_17650 2118 1594 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068818.1 protein_id gnl|my_center|LOCUS_17650 2463 2242 gene locus_tag LOCUS_17660 2463 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence222 1835 804 gene locus_tag LOCUS_17670 1835 804 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803835.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence223 1089 124 gene locus_tag LOCUS_17680 gene menA 1089 124 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068774.1 protein_id gnl|my_center|LOCUS_17680 <2430 1151 gene locus_tag LOCUS_17690 <2430 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053839.1:lysine--tRNA ligase >Feature sequence224 >Feature sequence225 1311 514 gene locus_tag LOCUS_17700 1311 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 <2292 1295 gene locus_tag LOCUS_17710 <2292 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968626.1:AAA family ATPase >Feature sequence226 1849 1376 gene locus_tag LOCUS_17720 1849 1376 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054369.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence227 737 746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2263 1147 gene locus_tag LOCUS_17730 <2263 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068697.1:UDP-galactopyranose mutase >Feature sequence228 377 1600 gene locus_tag LOCUS_17740 gene carA 377 1600 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782674.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence229 1014 298 gene locus_tag LOCUS_17750 1014 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17750 360 369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence230 <1 1039 gene locus_tag LOCUS_17760 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068840.1:dihydroxy-acid dehydratase 2181 1195 gene locus_tag LOCUS_17770 gene fmt 2181 1195 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053160.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence231 410 1249 gene locus_tag LOCUS_17780 410 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence232 1216 326 gene locus_tag LOCUS_17790 1216 326 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053362.1 protein_id gnl|my_center|LOCUS_17790 <2204 1413 gene locus_tag LOCUS_17800 <2204 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068176.1:branched-chain amino acid aminotransferase >Feature sequence233 <1 2094 gene locus_tag LOCUS_17810 <1 2094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965527.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence234 462 235 gene locus_tag LOCUS_17820 462 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17820 748 470 gene locus_tag LOCUS_17830 748 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17830 486 495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2164 845 gene locus_tag LOCUS_17840 <2164 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053331.1:oleate hydratase >Feature sequence235 <2033 560 gene locus_tag LOCUS_17850 <2033 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052449.1:IMP dehydrogenase >Feature sequence236 >Feature sequence237 1994 1056 gene locus_tag LOCUS_17860 1994 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence238 218 895 gene locus_tag LOCUS_17870 gene cutC 218 895 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356490.1 protein_id gnl|my_center|LOCUS_17870 899 1696 gene locus_tag LOCUS_17880 899 1696 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703308.1 protein_id gnl|my_center|LOCUS_17880 1942 1727 gene locus_tag LOCUS_17890 1942 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence239 236 490 gene locus_tag LOCUS_17900 236 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17900 506 1654 gene locus_tag LOCUS_17910 506 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17910 >Feature sequence240 >Feature sequence241 715 1005 gene locus_tag LOCUS_17920 715 1005 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053189.1 protein_id gnl|my_center|LOCUS_17920 <1923 1194 gene locus_tag LOCUS_17930 <1923 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053188.1:chaperonin GroEL >Feature sequence242 <1825 668 gene locus_tag LOCUS_17940 <1825 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008783117.1:ABC transporter ATP-binding protein >Feature sequence243 1584 43 gene locus_tag LOCUS_17950 gene gatA 1584 43 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054751.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence244 366 67 gene locus_tag LOCUS_17960 366 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1605 799 gene locus_tag LOCUS_17970 1605 799 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence245 <1 994 gene locus_tag LOCUS_17980 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390049.1:alpha/beta fold hydrolase >Feature sequence246 242 102 gene locus_tag LOCUS_17990 242 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 263 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1594 407 gene locus_tag LOCUS_18000 1594 407 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372834.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence247 >Feature sequence248 <1 867 gene locus_tag LOCUS_18010 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494943.1:MATE family efflux transporter 1048 857 gene locus_tag LOCUS_18020 1048 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 <1623 1045 gene locus_tag LOCUS_18030 <1623 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057728.1:SDR family oxidoreductase 1051 1070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence249 555 1112 gene locus_tag LOCUS_18040 555 1112 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068133.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence250 361 77 gene locus_tag LOCUS_18050 361 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 213 222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 675 361 gene locus_tag LOCUS_18060 675 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18060 <1551 936 gene locus_tag LOCUS_18070 <1551 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007055085.1:histidine phosphatase family protein