>Feature sequence01 767 240 gene locus_tag LOCUS_00010 767 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1464 889 gene locus_tag LOCUS_00020 gene tmk 1464 889 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852526.1 protein_id gnl|my_center|LOCUS_00020 1940 1449 gene locus_tag LOCUS_00030 gene coaD 1940 1449 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169234.1 protein_id gnl|my_center|LOCUS_00030 2467 1937 gene locus_tag LOCUS_00040 2467 1937 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780126.1 protein_id gnl|my_center|LOCUS_00040 3333 2464 gene locus_tag LOCUS_00050 3333 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3497 3414 gene locus_tag LOCUS_t00010 3497 3414 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3649 5745 gene locus_tag LOCUS_00060 gene flgL 3649 5745 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852538.1 protein_id gnl|my_center|LOCUS_00060 5817 8012 gene locus_tag LOCUS_00070 5817 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8012 8404 gene locus_tag LOCUS_00080 8012 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8526 11075 gene locus_tag LOCUS_00090 gene acnB 8526 11075 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932230.1 protein_id gnl|my_center|LOCUS_00090 11200 13575 gene locus_tag LOCUS_00100 11200 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14080 13565 gene locus_tag LOCUS_00110 gene lolA 14080 13565 CDS product LolA-like outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853302.1 protein_id gnl|my_center|LOCUS_00110 14255 16828 gene locus_tag LOCUS_00120 gene secA 14255 16828 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858134.1 protein_id gnl|my_center|LOCUS_00120 16825 18027 gene locus_tag LOCUS_00130 16825 18027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 protein_id gnl|my_center|LOCUS_00130 21191 18030 gene locus_tag LOCUS_00140 21191 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 21121 22065 gene locus_tag LOCUS_00150 gene mltG 21121 22065 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859067.1 protein_id gnl|my_center|LOCUS_00150 22206 24401 gene locus_tag LOCUS_00160 22206 24401 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_00160 24483 25439 gene locus_tag LOCUS_00170 gene mdh 24483 25439 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_00170 25443 26834 gene locus_tag LOCUS_00180 gene fumC 25443 26834 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160526.1 protein_id gnl|my_center|LOCUS_00180 26991 28166 gene locus_tag LOCUS_00190 gene sucC 26991 28166 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858590.1 protein_id gnl|my_center|LOCUS_00190 28184 29059 gene locus_tag LOCUS_00200 gene sucD 28184 29059 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002872006.1 protein_id gnl|my_center|LOCUS_00200 29250 29585 gene locus_tag LOCUS_00210 29250 29585 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096894.1 protein_id gnl|my_center|LOCUS_00210 29585 30739 gene locus_tag LOCUS_00220 29585 30739 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_00220 30739 31596 gene locus_tag LOCUS_00230 30739 31596 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_00230 31606 32160 gene locus_tag LOCUS_00240 31606 32160 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_00240 32780 32265 gene locus_tag LOCUS_00250 32780 32265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33740 33546 gene locus_tag LOCUS_00260 33740 33546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 34010 34333 gene locus_tag LOCUS_00270 34010 34333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34333 35253 gene locus_tag LOCUS_00280 gene xerD 34333 35253 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583825.1 protein_id gnl|my_center|LOCUS_00280 35695 35207 gene locus_tag LOCUS_00290 35695 35207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37180 35735 gene locus_tag LOCUS_00300 37180 35735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39145 37190 gene locus_tag LOCUS_00310 39145 37190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39341 39135 gene locus_tag LOCUS_00320 39341 39135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40980 39352 gene locus_tag LOCUS_00330 40980 39352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 42346 41447 gene locus_tag LOCUS_00340 42346 41447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 42608 42339 gene locus_tag LOCUS_00350 42608 42339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42967 42632 gene locus_tag LOCUS_00360 42967 42632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43139 44023 gene locus_tag LOCUS_00370 43139 44023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44025 44942 gene locus_tag LOCUS_00380 gene noc 44025 44942 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_00380 44991 45329 gene locus_tag LOCUS_00390 44991 45329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45788 45967 gene locus_tag LOCUS_00400 45788 45967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 45970 47856 gene locus_tag LOCUS_00410 45970 47856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47849 48607 gene locus_tag LOCUS_00420 47849 48607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 49629 50528 gene locus_tag LOCUS_00430 49629 50528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 51350 51880 gene locus_tag LOCUS_00440 51350 51880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51943 52260 gene locus_tag LOCUS_00450 51943 52260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52662 53822 gene locus_tag LOCUS_00460 52662 53822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54632 54766 gene locus_tag LOCUS_00470 54632 54766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 54771 55004 gene locus_tag LOCUS_00480 54771 55004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55270 56202 gene locus_tag LOCUS_00490 55270 56202 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942799.1 protein_id gnl|my_center|LOCUS_00490 56298 56582 gene locus_tag LOCUS_00500 56298 56582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56668 56811 gene locus_tag LOCUS_00510 56668 56811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 56827 57177 gene locus_tag LOCUS_00520 56827 57177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 57591 60041 gene locus_tag LOCUS_00530 57591 60041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60123 60359 gene locus_tag LOCUS_00540 60123 60359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60666 60989 gene locus_tag LOCUS_00550 60666 60989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60986 61468 gene locus_tag LOCUS_00560 60986 61468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 61465 61704 gene locus_tag LOCUS_00570 61465 61704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 61706 62110 gene locus_tag LOCUS_00580 61706 62110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 62107 62325 gene locus_tag LOCUS_00590 62107 62325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 62482 64071 gene locus_tag LOCUS_00600 62482 64071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 64068 64463 gene locus_tag LOCUS_00610 64068 64463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 64456 64722 gene locus_tag LOCUS_00620 64456 64722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 64812 65117 gene locus_tag LOCUS_00630 64812 65117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 65225 65392 gene locus_tag LOCUS_00640 65225 65392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 65389 66372 gene locus_tag LOCUS_00650 65389 66372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 66546 66800 gene locus_tag LOCUS_00660 66546 66800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 67085 67798 gene locus_tag LOCUS_00670 67085 67798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 68116 69132 gene locus_tag LOCUS_00680 68116 69132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 69208 69507 gene locus_tag LOCUS_00690 69208 69507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 69504 69677 gene locus_tag LOCUS_00700 69504 69677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 69674 69928 gene locus_tag LOCUS_00710 69674 69928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 69921 70478 gene locus_tag LOCUS_00720 69921 70478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202392502.1 protein_id gnl|my_center|LOCUS_00720 70475 71833 gene locus_tag LOCUS_00730 70475 71833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 71843 72043 gene locus_tag LOCUS_00740 71843 72043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 72081 72413 gene locus_tag LOCUS_00750 72081 72413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 72812 73912 gene locus_tag LOCUS_00760 gene dnaN 72812 73912 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_00760 73922 74191 gene locus_tag LOCUS_00770 73922 74191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 74202 75137 gene locus_tag LOCUS_00780 74202 75137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 75386 75517 gene locus_tag LOCUS_00790 75386 75517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 75510 75704 gene locus_tag LOCUS_00800 75510 75704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 75661 77676 gene locus_tag LOCUS_00810 75661 77676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 77686 77928 gene locus_tag LOCUS_00820 77686 77928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 77947 78207 gene locus_tag LOCUS_00830 77947 78207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 78249 78728 gene locus_tag LOCUS_00840 78249 78728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 78909 79040 gene locus_tag LOCUS_00850 78909 79040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 79055 79252 gene locus_tag LOCUS_00860 79055 79252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 79245 79406 gene locus_tag LOCUS_00870 79245 79406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 80866 79535 gene locus_tag LOCUS_00880 80866 79535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 81143 80919 gene locus_tag LOCUS_00890 81143 80919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 81512 81228 gene locus_tag LOCUS_00900 81512 81228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 81813 81616 gene locus_tag LOCUS_00910 81813 81616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 82223 81810 gene locus_tag LOCUS_00920 82223 81810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 82508 82314 gene locus_tag LOCUS_00930 82508 82314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 83235 82561 gene locus_tag LOCUS_00940 83235 82561 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852117.1 protein_id gnl|my_center|LOCUS_00940 83939 83262 gene locus_tag LOCUS_00950 gene dut 83939 83262 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_00950 84195 83950 gene locus_tag LOCUS_00960 84195 83950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 84527 84796 gene locus_tag LOCUS_00970 84527 84796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 84771 84977 gene locus_tag LOCUS_00980 84771 84977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 84974 85327 gene locus_tag LOCUS_00990 84974 85327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 85343 85879 gene locus_tag LOCUS_01000 85343 85879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 86023 87183 gene locus_tag LOCUS_01010 86023 87183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 87180 88127 gene locus_tag LOCUS_01020 gene xerD 87180 88127 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546237.1 protein_id gnl|my_center|LOCUS_01020 88136 88429 gene locus_tag LOCUS_01030 88136 88429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 88558 88989 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attataccgtatctaagtgtggcaggtcaatacagt 89860 89003 gene locus_tag LOCUS_01040 gene cas1 89860 89003 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797819.1 protein_id gnl|my_center|LOCUS_01040 92936 89907 gene locus_tag LOCUS_01050 gene cas9 92936 89907 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_01050 93981 92986 gene locus_tag LOCUS_01060 93981 92986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 95222 94044 gene locus_tag LOCUS_01070 95222 94044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 95973 95215 gene locus_tag LOCUS_01080 95973 95215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 96497 96126 gene locus_tag LOCUS_01090 96497 96126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 98638 96503 gene locus_tag LOCUS_01100 98638 96503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 100716 98653 gene locus_tag LOCUS_01110 100716 98653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 101309 100713 gene locus_tag LOCUS_01120 101309 100713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 102702 101299 gene locus_tag LOCUS_01130 102702 101299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 105164 102714 gene locus_tag LOCUS_01140 105164 102714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 105932 105168 gene locus_tag LOCUS_01150 105932 105168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 106912 105932 gene locus_tag LOCUS_01160 gene trhU 106912 105932 CDS product IncHI-type conjugal transfer protein TrhU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011070.1 protein_id gnl|my_center|LOCUS_01160 107598 106909 gene locus_tag LOCUS_01170 107598 106909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 108145 107540 gene locus_tag LOCUS_01180 108145 107540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 108968 108234 gene locus_tag LOCUS_01190 108968 108234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 110179 109016 gene locus_tag LOCUS_01200 110179 109016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 110711 110220 gene locus_tag LOCUS_01210 110711 110220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 111166 110708 gene locus_tag LOCUS_01220 111166 110708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 111696 111163 gene locus_tag LOCUS_01230 111696 111163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 112375 111671 gene locus_tag LOCUS_01240 112375 111671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 114147 112372 gene locus_tag LOCUS_01250 114147 112372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 115219 114149 gene locus_tag LOCUS_01260 115219 114149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 118944 115252 gene locus_tag LOCUS_01270 118944 115252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 122689 119009 gene locus_tag LOCUS_01280 122689 119009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 123068 122775 gene locus_tag LOCUS_01290 123068 122775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 123300 123052 gene locus_tag LOCUS_01300 123300 123052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 123902 123357 gene locus_tag LOCUS_01310 123902 123357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 124131 123895 gene locus_tag LOCUS_01320 124131 123895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 125690 124128 gene locus_tag LOCUS_01330 125690 124128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 126505 125693 gene locus_tag LOCUS_01340 126505 125693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 127070 126474 gene locus_tag LOCUS_01350 127070 126474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 127423 127073 gene locus_tag LOCUS_01360 127423 127073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 127738 127433 gene locus_tag LOCUS_01370 127738 127433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 128786 127905 gene locus_tag LOCUS_01380 128786 127905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 129000 128779 gene locus_tag LOCUS_01390 129000 128779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 129530 128997 gene locus_tag LOCUS_01400 129530 128997 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701365.1 protein_id gnl|my_center|LOCUS_01400 130187 129531 gene locus_tag LOCUS_01410 130187 129531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 130562 130188 gene locus_tag LOCUS_01420 130562 130188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 130963 130559 gene locus_tag LOCUS_01430 130963 130559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 131718 130960 gene locus_tag LOCUS_01440 131718 130960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 131938 132144 gene locus_tag LOCUS_01450 131938 132144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 132232 132777 gene locus_tag LOCUS_01460 132232 132777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 132866 132940 gene locus_tag LOCUS_t00020 132866 132940 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 133027 134325 gene locus_tag LOCUS_01470 gene gltX 133027 134325 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_01470 134322 134606 gene locus_tag LOCUS_01480 134322 134606 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 protein_id gnl|my_center|LOCUS_01480 135100 134612 gene locus_tag LOCUS_01490 135100 134612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 135197 135700 gene locus_tag LOCUS_01500 gene mobB 135197 135700 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 protein_id gnl|my_center|LOCUS_01500 135705 136547 gene locus_tag LOCUS_01510 135705 136547 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_01510 136531 136737 gene locus_tag LOCUS_01520 136531 136737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797008.1 protein_id gnl|my_center|LOCUS_01520 136855 138792 gene locus_tag LOCUS_01530 gene metG 136855 138792 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852639.1 protein_id gnl|my_center|LOCUS_01530 138789 139787 gene locus_tag LOCUS_01540 138789 139787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 139804 140937 gene locus_tag LOCUS_01550 139804 140937 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_01550 140986 142215 gene locus_tag LOCUS_01560 140986 142215 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009982187.1 protein_id gnl|my_center|LOCUS_01560 142861 142199 gene locus_tag LOCUS_01570 142861 142199 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_01570 143489 142848 gene locus_tag LOCUS_01580 gene queC 143489 142848 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779268.1 protein_id gnl|my_center|LOCUS_01580 143605 143784 gene locus_tag LOCUS_01590 143605 143784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 143860 144279 gene locus_tag LOCUS_01600 gene ybeY 143860 144279 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851664.1 protein_id gnl|my_center|LOCUS_01600 144286 145212 gene locus_tag LOCUS_01610 144286 145212 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_01610 146975 145254 gene locus_tag LOCUS_01620 gene mrdA 146975 145254 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 protein_id gnl|my_center|LOCUS_01620 147918 147457 gene locus_tag LOCUS_01630 147918 147457 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583314.1 protein_id gnl|my_center|LOCUS_01630 148526 147915 gene locus_tag LOCUS_01640 gene yihA 148526 147915 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852258.1 protein_id gnl|my_center|LOCUS_01640 149016 148519 gene locus_tag LOCUS_01650 149016 148519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 149441 149013 gene locus_tag LOCUS_01660 149441 149013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 150032 149538 gene locus_tag LOCUS_01670 150032 149538 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858506.1 protein_id gnl|my_center|LOCUS_01670 150601 150029 gene locus_tag LOCUS_01680 gene hisB 150601 150029 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528350.1 protein_id gnl|my_center|LOCUS_01680 151403 150609 gene locus_tag LOCUS_01690 151403 150609 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852227.1 protein_id gnl|my_center|LOCUS_01690 152622 151396 gene locus_tag LOCUS_01700 152622 151396 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852087.1 protein_id gnl|my_center|LOCUS_01700 153476 152700 gene locus_tag LOCUS_01710 153476 152700 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858473.1 protein_id gnl|my_center|LOCUS_01710 155020 153473 gene locus_tag LOCUS_01720 155020 153473 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871805.1 protein_id gnl|my_center|LOCUS_01720 155624 155103 gene locus_tag LOCUS_01730 155624 155103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 156494 155640 gene locus_tag LOCUS_01740 156494 155640 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 protein_id gnl|my_center|LOCUS_01740 156640 158394 gene locus_tag LOCUS_01750 gene aspS 156640 158394 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871806.1 protein_id gnl|my_center|LOCUS_01750 158431 159009 gene locus_tag LOCUS_01760 158431 159009 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 protein_id gnl|my_center|LOCUS_01760 159678 159031 gene locus_tag LOCUS_01770 gene adk 159678 159031 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706319.1 protein_id gnl|my_center|LOCUS_01770 159799 161043 gene locus_tag LOCUS_01780 159799 161043 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_01780 161372 161085 gene locus_tag LOCUS_01790 161372 161085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 161471 162202 gene locus_tag LOCUS_01800 161471 162202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 162387 163046 gene locus_tag LOCUS_01810 162387 163046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 163554 163051 gene locus_tag LOCUS_01820 163554 163051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 163631 164827 gene locus_tag LOCUS_01830 163631 164827 CDS product 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851311.1 protein_id gnl|my_center|LOCUS_01830 164901 165206 gene locus_tag LOCUS_01840 164901 165206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 166529 165216 gene locus_tag LOCUS_01850 166529 165216 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080877.1 protein_id gnl|my_center|LOCUS_01850 167283 166624 gene locus_tag LOCUS_01860 167283 166624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 167644 167507 gene locus_tag LOCUS_01870 167644 167507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 168111 167641 gene locus_tag LOCUS_01880 168111 167641 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_01880 168956 168120 gene locus_tag LOCUS_01890 gene purU 168956 168120 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852510.1 protein_id gnl|my_center|LOCUS_01890 169318 168953 gene locus_tag LOCUS_01900 169318 168953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852635.1 protein_id gnl|my_center|LOCUS_01900 169542 169294 gene locus_tag LOCUS_01910 169542 169294 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891888.1 protein_id gnl|my_center|LOCUS_01910 170606 169539 gene locus_tag LOCUS_01920 gene leuB 170606 169539 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_01920 171109 170606 gene locus_tag LOCUS_01930 gene leuD 171109 170606 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_01930 172041 171253 gene locus_tag LOCUS_01940 gene flgG 172041 171253 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852142.1 protein_id gnl|my_center|LOCUS_01940 172875 172054 gene locus_tag LOCUS_01950 172875 172054 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858501.1 protein_id gnl|my_center|LOCUS_01950 173011 174882 gene locus_tag LOCUS_01960 gene rpoD 173011 174882 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 protein_id gnl|my_center|LOCUS_01960 174893 175576 gene locus_tag LOCUS_01970 174893 175576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 176086 175586 gene locus_tag LOCUS_01980 176086 175586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 176399 176070 gene locus_tag LOCUS_01990 176399 176070 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852414.1 protein_id gnl|my_center|LOCUS_01990 177687 176392 gene locus_tag LOCUS_02000 gene hemL 177687 176392 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421462.1 protein_id gnl|my_center|LOCUS_02000 177783 178643 gene locus_tag LOCUS_02010 177783 178643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 179591 178659 gene locus_tag LOCUS_02020 gene citE 179591 178659 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878102.1 protein_id gnl|my_center|LOCUS_02020 179931 179581 gene locus_tag LOCUS_02030 179931 179581 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235932.1 protein_id gnl|my_center|LOCUS_02030 179991 180848 gene locus_tag LOCUS_02040 gene folD 179991 180848 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_02040 180849 181658 gene locus_tag LOCUS_02050 gene lepB 180849 181658 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_02050 181645 182322 gene locus_tag LOCUS_02060 181645 182322 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159394.1 protein_id gnl|my_center|LOCUS_02060 182336 182773 gene locus_tag LOCUS_02070 gene rpiB 182336 182773 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_02070 182793 183125 gene locus_tag LOCUS_02080 182793 183125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495094.1 protein_id gnl|my_center|LOCUS_02080 183140 183688 gene locus_tag LOCUS_02090 gene apt 183140 183688 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853297.1 protein_id gnl|my_center|LOCUS_02090 183688 184890 gene locus_tag LOCUS_02100 gene trpB 183688 184890 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_02100 184899 186314 gene locus_tag LOCUS_02110 184899 186314 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853317.1 protein_id gnl|my_center|LOCUS_02110 186391 187236 gene locus_tag LOCUS_02120 gene zupT 186391 187236 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851840.1 protein_id gnl|my_center|LOCUS_02120 187276 187779 gene locus_tag LOCUS_02130 187276 187779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 187846 188946 gene locus_tag LOCUS_02140 gene ychF 187846 188946 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 protein_id gnl|my_center|LOCUS_02140 190068 188950 gene locus_tag LOCUS_02150 190068 188950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301659.1 protein_id gnl|my_center|LOCUS_02150 192773 190071 gene locus_tag LOCUS_02160 gene rbbA 192773 190071 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974059.1 protein_id gnl|my_center|LOCUS_02160 193785 192775 gene locus_tag LOCUS_02170 193785 192775 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312415.1 protein_id gnl|my_center|LOCUS_02170 194659 193841 gene locus_tag LOCUS_02180 194659 193841 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226149.1 protein_id gnl|my_center|LOCUS_02180 195728 194652 gene locus_tag LOCUS_02190 gene truD 195728 194652 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052415.1 protein_id gnl|my_center|LOCUS_02190 196561 195743 gene locus_tag LOCUS_02200 196561 195743 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130232873.1 protein_id gnl|my_center|LOCUS_02200 196650 197849 gene locus_tag LOCUS_02210 196650 197849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 197975 199687 gene locus_tag LOCUS_02220 gene sdhA 197975 199687 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_02220 199697 200674 gene locus_tag LOCUS_02230 199697 200674 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_02230 200685 201566 gene locus_tag LOCUS_02240 200685 201566 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933695.1 protein_id gnl|my_center|LOCUS_02240 201592 201849 gene locus_tag LOCUS_02250 201592 201849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 201850 201978 gene locus_tag LOCUS_02260 201850 201978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 202066 202212 gene locus_tag LOCUS_02270 202066 202212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 202381 202545 gene locus_tag LOCUS_02280 202381 202545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 203395 202577 gene locus_tag LOCUS_02290 203395 202577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 204554 203388 gene locus_tag LOCUS_02300 204554 203388 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 protein_id gnl|my_center|LOCUS_02300 204824 206077 gene locus_tag LOCUS_02310 204824 206077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 206180 206395 gene locus_tag LOCUS_02320 206180 206395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 206966 206433 gene locus_tag LOCUS_02330 gene mog 206966 206433 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_02330 207647 207126 gene locus_tag LOCUS_02340 207647 207126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 209277 207634 gene locus_tag LOCUS_02350 209277 207634 CDS product ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852990.1 protein_id gnl|my_center|LOCUS_02350 210511 209264 gene locus_tag LOCUS_02360 gene mtaB 210511 209264 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_02360 212158 210512 gene locus_tag LOCUS_02370 212158 210512 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218141.1 protein_id gnl|my_center|LOCUS_02370 213207 212155 gene locus_tag LOCUS_02380 gene aroB 213207 212155 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156090.1 protein_id gnl|my_center|LOCUS_02380 214692 213286 gene locus_tag LOCUS_02390 214692 213286 CDS product COG3400 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857878.1 protein_id gnl|my_center|LOCUS_02390 215233 214742 gene locus_tag LOCUS_02400 215233 214742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 216348 215230 gene locus_tag LOCUS_02410 gene trmA 216348 215230 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113457.1 protein_id gnl|my_center|LOCUS_02410 217106 216366 gene locus_tag LOCUS_02420 gene fliP 217106 216366 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_02420 217765 217106 gene locus_tag LOCUS_02430 217765 217106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 218649 217885 gene locus_tag LOCUS_02440 218649 217885 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556880.1 protein_id gnl|my_center|LOCUS_02440 218917 220218 gene locus_tag LOCUS_02450 gene glmU 218917 220218 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862579.1 protein_id gnl|my_center|LOCUS_02450 >Feature sequence02 500 994 gene locus_tag LOCUS_02460 500 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 1733 984 gene locus_tag LOCUS_02470 1733 984 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_02470 1952 4336 gene locus_tag LOCUS_02480 1952 4336 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_02480 5078 4350 gene locus_tag LOCUS_02490 5078 4350 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 protein_id gnl|my_center|LOCUS_02490 5229 5305 gene locus_tag LOCUS_t00030 5229 5305 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5363 5447 gene locus_tag LOCUS_t00040 5363 5447 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5462 5538 gene locus_tag LOCUS_t00050 5462 5538 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5709 5783 gene locus_tag LOCUS_t00060 5709 5783 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5874 7073 gene locus_tag LOCUS_02500 gene tuf 5874 7073 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040579.1 protein_id gnl|my_center|LOCUS_02500 7118 7270 gene locus_tag LOCUS_02510 gene rpmG 7118 7270 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_02510 7325 7401 gene locus_tag LOCUS_t00070 7325 7401 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7463 7642 gene locus_tag LOCUS_02520 7463 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 7646 8194 gene locus_tag LOCUS_02530 gene nusG 7646 8194 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851098.1 protein_id gnl|my_center|LOCUS_02530 8362 8787 gene locus_tag LOCUS_02540 gene rplK 8362 8787 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779452.1 protein_id gnl|my_center|LOCUS_02540 8854 9546 gene locus_tag LOCUS_02550 gene rplA 8854 9546 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854928.1 protein_id gnl|my_center|LOCUS_02550 9700 10185 gene locus_tag LOCUS_02560 gene rplJ 9700 10185 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858610.1 protein_id gnl|my_center|LOCUS_02560 10365 10736 gene locus_tag LOCUS_02570 gene rplL 10365 10736 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858569.1 protein_id gnl|my_center|LOCUS_02570 11082 15110 gene locus_tag LOCUS_02580 gene rpoB 11082 15110 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891860.1 protein_id gnl|my_center|LOCUS_02580 15103 19620 gene locus_tag LOCUS_02590 gene rpoC 15103 19620 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858508.1 protein_id gnl|my_center|LOCUS_02590 19838 20212 gene locus_tag LOCUS_02600 gene rpsL 19838 20212 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782934.1 protein_id gnl|my_center|LOCUS_02600 20436 20903 gene locus_tag LOCUS_02610 gene rpsG 20436 20903 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779471.1 protein_id gnl|my_center|LOCUS_02610 20916 23006 gene locus_tag LOCUS_02620 gene fusA 20916 23006 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779472.1 protein_id gnl|my_center|LOCUS_02620 23337 23098 gene locus_tag LOCUS_02630 23337 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 24095 23382 gene locus_tag LOCUS_02640 24095 23382 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853863.1 protein_id gnl|my_center|LOCUS_02640 24683 24171 gene locus_tag LOCUS_02650 24683 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 26709 24745 gene locus_tag LOCUS_02660 26709 24745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 27238 26699 gene locus_tag LOCUS_02670 27238 26699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 27949 27725 gene locus_tag LOCUS_02680 27949 27725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 28323 28081 gene locus_tag LOCUS_02690 28323 28081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 29428 28403 gene locus_tag LOCUS_02700 29428 28403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 31392 30085 gene locus_tag LOCUS_02710 31392 30085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 31657 32022 gene locus_tag LOCUS_02720 31657 32022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 33097 32000 gene locus_tag LOCUS_02730 gene prfB 33097 32000 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851475.1 protein_id gnl|my_center|LOCUS_02730 33150 33995 gene locus_tag LOCUS_02740 gene panC 33150 33995 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881396.1 protein_id gnl|my_center|LOCUS_02740 35732 33972 gene locus_tag LOCUS_02750 35732 33972 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370329.1 protein_id gnl|my_center|LOCUS_02750 36124 35825 gene locus_tag LOCUS_02760 gene fliE 36124 35825 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147918.1 protein_id gnl|my_center|LOCUS_02760 36631 36137 gene locus_tag LOCUS_02770 gene flgC 36631 36137 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480097.1 protein_id gnl|my_center|LOCUS_02770 37073 36642 gene locus_tag LOCUS_02780 gene flgB 37073 36642 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347783.1 protein_id gnl|my_center|LOCUS_02780 37220 37642 gene locus_tag LOCUS_02790 37220 37642 CDS product type IV pilin-like G/H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056853.1 protein_id gnl|my_center|LOCUS_02790 37753 38214 gene locus_tag LOCUS_02800 37753 38214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 38257 40191 gene locus_tag LOCUS_02810 38257 40191 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852169.1 protein_id gnl|my_center|LOCUS_02810 40754 40188 gene locus_tag LOCUS_02820 40754 40188 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119978.1 protein_id gnl|my_center|LOCUS_02820 41931 40723 gene locus_tag LOCUS_02830 41931 40723 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 protein_id gnl|my_center|LOCUS_02830 42045 42953 gene locus_tag LOCUS_02840 42045 42953 CDS product plasminogen-binding N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852692.1 protein_id gnl|my_center|LOCUS_02840 42922 44307 gene locus_tag LOCUS_02850 42922 44307 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852810.1 protein_id gnl|my_center|LOCUS_02850 44408 45304 gene locus_tag LOCUS_02860 44408 45304 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_02860 45787 46068 gene locus_tag LOCUS_02870 45787 46068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 47893 46442 gene locus_tag LOCUS_02880 47893 46442 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858532.1 protein_id gnl|my_center|LOCUS_02880 48954 47893 gene locus_tag LOCUS_02890 gene ispG 48954 47893 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852250.1 protein_id gnl|my_center|LOCUS_02890 49091 49987 gene locus_tag LOCUS_02900 49091 49987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 50047 53709 gene locus_tag LOCUS_02910 50047 53709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 53711 54265 gene locus_tag LOCUS_02920 53711 54265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 54262 55233 gene locus_tag LOCUS_02930 54262 55233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 55230 55505 gene locus_tag LOCUS_02940 55230 55505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 55622 61693 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctaaagataccaccaaatttctactgttgtagat 61949 62197 gene locus_tag LOCUS_02950 61949 62197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 64247 62241 gene locus_tag LOCUS_02960 64247 62241 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_02960 65428 64433 gene locus_tag LOCUS_02970 65428 64433 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_02970 65444 66469 gene locus_tag LOCUS_02980 65444 66469 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852617.1 protein_id gnl|my_center|LOCUS_02980 66892 66500 gene locus_tag LOCUS_02990 66892 66500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 67122 66889 gene locus_tag LOCUS_03000 67122 66889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 67700 67119 gene locus_tag LOCUS_03010 gene rsmG 67700 67119 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068828.1 protein_id gnl|my_center|LOCUS_03010 68280 67717 gene locus_tag LOCUS_03020 gene ribA 68280 67717 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_03020 68351 69322 gene locus_tag LOCUS_03030 gene hemB 68351 69322 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 protein_id gnl|my_center|LOCUS_03030 69410 70345 gene locus_tag LOCUS_03040 gene argF 69410 70345 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858026.1 protein_id gnl|my_center|LOCUS_03040 70346 71536 gene locus_tag LOCUS_03050 70346 71536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 72498 71533 gene locus_tag LOCUS_03060 gene trpS 72498 71533 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_03060 72614 72943 gene locus_tag LOCUS_03070 72614 72943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 72947 73369 gene locus_tag LOCUS_03080 gene hemJ 72947 73369 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854237.1 protein_id gnl|my_center|LOCUS_03080 74998 73511 gene locus_tag LOCUS_03090 gene der 74998 73511 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858744.1 protein_id gnl|my_center|LOCUS_03090 75700 75122 gene locus_tag LOCUS_03100 75700 75122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 76767 75787 gene locus_tag LOCUS_03110 76767 75787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 76814 77272 gene locus_tag LOCUS_03120 76814 77272 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 protein_id gnl|my_center|LOCUS_03120 78043 77291 gene locus_tag LOCUS_03130 78043 77291 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853334.1 protein_id gnl|my_center|LOCUS_03130 78873 78082 gene locus_tag LOCUS_03140 78873 78082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 80000 78948 gene locus_tag LOCUS_03150 80000 78948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 80052 80957 gene locus_tag LOCUS_03160 80052 80957 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 protein_id gnl|my_center|LOCUS_03160 81155 81946 gene locus_tag LOCUS_03170 gene kdsA 81155 81946 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858652.1 protein_id gnl|my_center|LOCUS_03170 81948 82412 gene locus_tag LOCUS_03180 gene ribE 81948 82412 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 protein_id gnl|my_center|LOCUS_03180 82545 82943 gene locus_tag LOCUS_03190 gene nusB 82545 82943 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_03190 83316 83167 gene locus_tag LOCUS_03200 83316 83167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 84811 83300 gene locus_tag LOCUS_03210 84811 83300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 85460 84804 gene locus_tag LOCUS_03220 gene dccR 85460 84804 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_03220 85540 87546 gene locus_tag LOCUS_03230 85540 87546 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948731.1 protein_id gnl|my_center|LOCUS_03230 87610 90720 gene locus_tag LOCUS_03240 87610 90720 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117787.1 protein_id gnl|my_center|LOCUS_03240 90722 91813 gene locus_tag LOCUS_03250 90722 91813 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_03250 91810 93114 gene locus_tag LOCUS_03260 91810 93114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 93339 95270 gene locus_tag LOCUS_03270 93339 95270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 95355 96410 gene locus_tag LOCUS_03280 95355 96410 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_03280 96456 97694 gene locus_tag LOCUS_03290 96456 97694 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714010.1 protein_id gnl|my_center|LOCUS_03290 97766 99565 gene locus_tag LOCUS_03300 gene recG 97766 99565 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158370.1 protein_id gnl|my_center|LOCUS_03300 100126 99584 gene locus_tag LOCUS_03310 gene raiA 100126 99584 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887725.1 protein_id gnl|my_center|LOCUS_03310 100653 100192 gene locus_tag LOCUS_03320 100653 100192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 101543 100629 gene locus_tag LOCUS_03330 101543 100629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 102184 101543 gene locus_tag LOCUS_03340 102184 101543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 105579 102178 gene locus_tag LOCUS_03350 105579 102178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 106102 105722 gene locus_tag LOCUS_03360 gene fliW 106102 105722 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862609.1 protein_id gnl|my_center|LOCUS_03360 106225 106986 gene locus_tag LOCUS_03370 106225 106986 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852961.1 protein_id gnl|my_center|LOCUS_03370 106973 109384 gene locus_tag LOCUS_03380 gene lon 106973 109384 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868636.1 protein_id gnl|my_center|LOCUS_03380 109773 109399 gene locus_tag LOCUS_03390 109773 109399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 112995 109789 gene locus_tag LOCUS_03400 112995 109789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 114584 112995 gene locus_tag LOCUS_03410 114584 112995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 115004 114597 gene locus_tag LOCUS_03420 115004 114597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 116879 115077 gene locus_tag LOCUS_03430 gene uvrC 116879 115077 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864614.1 protein_id gnl|my_center|LOCUS_03430 117234 116869 gene locus_tag LOCUS_03440 117234 116869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 117310 117486 gene locus_tag LOCUS_03450 117310 117486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 117483 118934 gene locus_tag LOCUS_03460 gene nadB 117483 118934 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_03460 118927 120309 gene locus_tag LOCUS_03470 gene nhaD 118927 120309 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 protein_id gnl|my_center|LOCUS_03470 120399 121949 gene locus_tag LOCUS_03480 gene guaA 120399 121949 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853189.1 protein_id gnl|my_center|LOCUS_03480 121959 122597 gene locus_tag LOCUS_03490 121959 122597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 122963 124228 gene locus_tag LOCUS_03500 gene purD 122963 124228 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853212.1 protein_id gnl|my_center|LOCUS_03500 124240 124689 gene locus_tag LOCUS_03510 124240 124689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 124682 126856 gene locus_tag LOCUS_03520 124682 126856 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 protein_id gnl|my_center|LOCUS_03520 126861 127523 gene locus_tag LOCUS_03530 126861 127523 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090667.1 protein_id gnl|my_center|LOCUS_03530 127513 129678 gene locus_tag LOCUS_03540 127513 129678 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853182.1 protein_id gnl|my_center|LOCUS_03540 129983 130309 gene locus_tag LOCUS_03550 129983 130309 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853292.1 protein_id gnl|my_center|LOCUS_03550 130351 130435 gene locus_tag LOCUS_t00080 130351 130435 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 131421 130480 gene locus_tag LOCUS_03560 131421 130480 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 protein_id gnl|my_center|LOCUS_03560 131761 131405 gene locus_tag LOCUS_03570 131761 131405 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_03570 131842 132765 gene locus_tag LOCUS_03580 gene cysK 131842 132765 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_03580 132758 133360 gene locus_tag LOCUS_03590 132758 133360 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_03590 133350 133808 gene locus_tag LOCUS_03600 133350 133808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 134724 133822 gene locus_tag LOCUS_03610 134724 133822 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_03610 134852 136900 gene locus_tag LOCUS_03620 134852 136900 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_03620 136897 137718 gene locus_tag LOCUS_03630 gene truB 136897 137718 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 protein_id gnl|my_center|LOCUS_03630 137712 137942 gene locus_tag LOCUS_03640 137712 137942 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906447.1 protein_id gnl|my_center|LOCUS_03640 137954 138745 gene locus_tag LOCUS_03650 137954 138745 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 protein_id gnl|my_center|LOCUS_03650 138749 139201 gene locus_tag LOCUS_03660 gene smpB 138749 139201 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_03660 139201 140064 gene locus_tag LOCUS_03670 139201 140064 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857898.1 protein_id gnl|my_center|LOCUS_03670 140064 140660 gene locus_tag LOCUS_03680 140064 140660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 140669 141391 gene locus_tag LOCUS_03690 140669 141391 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_03690 141429 142142 gene locus_tag LOCUS_03700 141429 142142 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_03700 142184 143308 gene locus_tag LOCUS_03710 gene waaA 142184 143308 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852277.1 protein_id gnl|my_center|LOCUS_03710 143322 144056 gene locus_tag LOCUS_03720 143322 144056 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852134.1 protein_id gnl|my_center|LOCUS_03720 144049 144306 gene locus_tag LOCUS_03730 144049 144306 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_03730 144306 144758 gene locus_tag LOCUS_03740 144306 144758 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704544.1 protein_id gnl|my_center|LOCUS_03740 144956 146302 gene locus_tag LOCUS_03750 gene ffh 144956 146302 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852163.1 protein_id gnl|my_center|LOCUS_03750 146426 146656 gene locus_tag LOCUS_03760 gene rpsP 146426 146656 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852274.1 protein_id gnl|my_center|LOCUS_03760 146658 146897 gene locus_tag LOCUS_03770 146658 146897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 146878 147417 gene locus_tag LOCUS_03780 gene rimM 146878 147417 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852323.1 protein_id gnl|my_center|LOCUS_03780 147417 148121 gene locus_tag LOCUS_03790 gene trmD 147417 148121 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868040.1 protein_id gnl|my_center|LOCUS_03790 148111 148470 gene locus_tag LOCUS_03800 gene rplS 148111 148470 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852307.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence03 2015 201 gene locus_tag LOCUS_03810 2015 201 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_03810 3359 2025 gene locus_tag LOCUS_03820 3359 2025 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_03820 4640 3447 gene locus_tag LOCUS_03830 4640 3447 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_03830 5206 4637 gene locus_tag LOCUS_03840 5206 4637 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_03840 6079 5285 gene locus_tag LOCUS_03850 6079 5285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_03850 7970 6087 gene locus_tag LOCUS_03860 gene flgK 7970 6087 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851396.1 protein_id gnl|my_center|LOCUS_03860 8400 7972 gene locus_tag LOCUS_03870 8400 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 8638 8429 gene locus_tag LOCUS_03880 8638 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 9011 8709 gene locus_tag LOCUS_03890 9011 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609401.1 protein_id gnl|my_center|LOCUS_03890 10054 9011 gene locus_tag LOCUS_03900 10054 9011 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858049.1 protein_id gnl|my_center|LOCUS_03900 10690 10100 gene locus_tag LOCUS_03910 10690 10100 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 protein_id gnl|my_center|LOCUS_03910 11075 10680 gene locus_tag LOCUS_03920 11075 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 11844 11113 gene locus_tag LOCUS_03930 11844 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 12257 11838 gene locus_tag LOCUS_03940 12257 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 12798 12370 gene locus_tag LOCUS_03950 12798 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 12911 14800 gene locus_tag LOCUS_03960 12911 14800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 14857 16119 gene locus_tag LOCUS_03970 gene murA 14857 16119 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857102.1 protein_id gnl|my_center|LOCUS_03970 16497 16120 gene locus_tag LOCUS_03980 gene hspR 16497 16120 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_03980 17385 16501 gene locus_tag LOCUS_03990 17385 16501 CDS product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045822.1 protein_id gnl|my_center|LOCUS_03990 17988 17461 gene locus_tag LOCUS_04000 17988 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 18145 18933 gene locus_tag LOCUS_04010 18145 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 18923 20020 gene locus_tag LOCUS_04020 18923 20020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 21599 20076 gene locus_tag LOCUS_04030 gene purH 21599 20076 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853339.1 protein_id gnl|my_center|LOCUS_04030 21812 22771 gene locus_tag LOCUS_04040 gene pfkA 21812 22771 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082880.1 protein_id gnl|my_center|LOCUS_04040 22794 23084 gene locus_tag LOCUS_04050 22794 23084 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_04050 24691 23081 gene locus_tag LOCUS_04060 24691 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 25041 24670 gene locus_tag LOCUS_04070 25041 24670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 27496 25283 gene locus_tag LOCUS_04080 gene purL 27496 25283 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858406.1 protein_id gnl|my_center|LOCUS_04080 28079 27567 gene locus_tag LOCUS_04090 gene greA 28079 27567 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031337.1 protein_id gnl|my_center|LOCUS_04090 28430 28104 gene locus_tag LOCUS_04100 28430 28104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 28552 29349 gene locus_tag LOCUS_04110 gene cheP 28552 29349 CDS product cheVAW transcriptional regulator CheP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851703.1 protein_id gnl|my_center|LOCUS_04110 29358 31304 gene locus_tag LOCUS_04120 29358 31304 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 protein_id gnl|my_center|LOCUS_04120 31307 32269 gene locus_tag LOCUS_04130 31307 32269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 33434 32412 gene locus_tag LOCUS_04140 gene ilvC 33434 32412 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_04140 33542 34162 gene locus_tag LOCUS_04150 33542 34162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 37382 34284 gene locus_tag LOCUS_04160 37382 34284 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_04160 38484 37384 gene locus_tag LOCUS_04170 38484 37384 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257457.1 protein_id gnl|my_center|LOCUS_04170 39714 38485 gene locus_tag LOCUS_04180 39714 38485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 39807 40304 gene locus_tag LOCUS_04190 39807 40304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 40529 40410 gene locus_tag LOCUS_04200 40529 40410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 40705 41808 gene locus_tag LOCUS_04210 40705 41808 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545648.1 protein_id gnl|my_center|LOCUS_04210 41805 42188 gene locus_tag LOCUS_04220 41805 42188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 42195 43325 gene locus_tag LOCUS_04230 42195 43325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 43310 45661 gene locus_tag LOCUS_04240 43310 45661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 46195 45797 gene locus_tag LOCUS_04250 gene ruvX 46195 45797 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852281.1 protein_id gnl|my_center|LOCUS_04250 47648 46308 gene locus_tag LOCUS_04260 gene mnmE 47648 46308 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853397.1 protein_id gnl|my_center|LOCUS_04260 48587 47652 gene locus_tag LOCUS_04270 48587 47652 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 protein_id gnl|my_center|LOCUS_04270 50199 48580 gene locus_tag LOCUS_04280 gene yidC 50199 48580 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853384.1 protein_id gnl|my_center|LOCUS_04280 50746 50525 gene locus_tag LOCUS_04290 50746 50525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 50997 50863 gene locus_tag LOCUS_04300 gene rpmH 50997 50863 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776864.1 protein_id gnl|my_center|LOCUS_04300 51361 51071 gene locus_tag LOCUS_04310 51361 51071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 54026 51432 gene locus_tag LOCUS_04320 54026 51432 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858618.1 protein_id gnl|my_center|LOCUS_04320 54169 54846 gene locus_tag LOCUS_04330 54169 54846 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 protein_id gnl|my_center|LOCUS_04330 55690 54839 gene locus_tag LOCUS_04340 55690 54839 CDS product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450949.1 protein_id gnl|my_center|LOCUS_04340 56525 55695 gene locus_tag LOCUS_04350 gene peb4 56525 55695 CDS product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 protein_id gnl|my_center|LOCUS_04350 56611 57252 gene locus_tag LOCUS_04360 gene nth 56611 57252 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852225.1 protein_id gnl|my_center|LOCUS_04360 57288 57530 gene locus_tag LOCUS_04370 57288 57530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 57520 57738 gene locus_tag LOCUS_04380 57520 57738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 58672 57965 gene locus_tag LOCUS_04390 gene cmoA 58672 57965 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_04390 58752 59096 gene locus_tag LOCUS_04400 58752 59096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 60198 59125 gene locus_tag LOCUS_04410 gene fbaA 60198 59125 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_04410 60312 60983 gene locus_tag LOCUS_04420 60312 60983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 60973 62637 gene locus_tag LOCUS_04430 60973 62637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 62961 63095 gene locus_tag LOCUS_04440 62961 63095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 63100 63333 gene locus_tag LOCUS_04450 63100 63333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 63430 63714 gene locus_tag LOCUS_04460 63430 63714 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_04460 63873 64418 gene locus_tag LOCUS_04470 63873 64418 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566814.1 protein_id gnl|my_center|LOCUS_04470 64497 66146 gene locus_tag LOCUS_04480 64497 66146 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_04480 66673 66176 gene locus_tag LOCUS_04490 66673 66176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 66751 67248 gene locus_tag LOCUS_04500 66751 67248 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421462.1 protein_id gnl|my_center|LOCUS_04500 70711 67319 gene locus_tag LOCUS_04510 70711 67319 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_04510 71623 70724 gene locus_tag LOCUS_04520 71623 70724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 72261 71623 gene locus_tag LOCUS_04530 72261 71623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 72941 72468 gene locus_tag LOCUS_04540 72941 72468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 74311 73019 gene locus_tag LOCUS_04550 gene hisD 74311 73019 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_04550 74730 74311 gene locus_tag LOCUS_04560 74730 74311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 75211 74723 gene locus_tag LOCUS_04570 75211 74723 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904001.1 protein_id gnl|my_center|LOCUS_04570 76539 75241 gene locus_tag LOCUS_04580 76539 75241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880562.1 protein_id gnl|my_center|LOCUS_04580 76995 76555 gene locus_tag LOCUS_04590 76995 76555 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_04590 77148 78464 gene locus_tag LOCUS_04600 77148 78464 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856815.1 protein_id gnl|my_center|LOCUS_04600 78469 79182 gene locus_tag LOCUS_04610 78469 79182 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858572.1 protein_id gnl|my_center|LOCUS_04610 79327 79569 gene locus_tag LOCUS_04620 gene purS 79327 79569 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858611.1 protein_id gnl|my_center|LOCUS_04620 79566 80240 gene locus_tag LOCUS_04630 gene purQ 79566 80240 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858528.1 protein_id gnl|my_center|LOCUS_04630 80237 81382 gene locus_tag LOCUS_04640 80237 81382 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858517.1 protein_id gnl|my_center|LOCUS_04640 81360 82058 gene locus_tag LOCUS_04650 81360 82058 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858620.1 protein_id gnl|my_center|LOCUS_04650 82027 82416 gene locus_tag LOCUS_04660 gene crcB 82027 82416 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858490.1 protein_id gnl|my_center|LOCUS_04660 82975 82406 gene locus_tag LOCUS_04670 82975 82406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 83671 82979 gene locus_tag LOCUS_04680 gene dut 83671 82979 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_04680 84319 83894 gene locus_tag LOCUS_04690 84319 83894 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098903.1 protein_id gnl|my_center|LOCUS_04690 84545 84309 gene locus_tag LOCUS_04700 84545 84309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 85738 84548 gene locus_tag LOCUS_04710 85738 84548 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_04710 86528 85785 gene locus_tag LOCUS_04720 86528 85785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04720 86955 86494 gene locus_tag LOCUS_04730 86955 86494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04730 87342 86959 gene locus_tag LOCUS_04740 87342 86959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 89868 87382 gene locus_tag LOCUS_04750 89868 87382 CDS product adenine/cytosine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895775.1 protein_id gnl|my_center|LOCUS_04750 92195 90096 gene locus_tag LOCUS_04760 gene ovoA 92195 90096 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_04760 92224 92949 gene locus_tag LOCUS_04770 gene pgeF 92224 92949 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804706.1 protein_id gnl|my_center|LOCUS_04770 94753 92930 gene locus_tag LOCUS_04780 gene dxs 94753 92930 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858717.1 protein_id gnl|my_center|LOCUS_04780 95557 94763 gene locus_tag LOCUS_04790 gene fliH 95557 94763 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858748.1 protein_id gnl|my_center|LOCUS_04790 96587 95559 gene locus_tag LOCUS_04800 gene fliG 96587 95559 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_04800 98299 96584 gene locus_tag LOCUS_04810 gene fliF 98299 96584 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364750.1 protein_id gnl|my_center|LOCUS_04810 99527 98433 gene locus_tag LOCUS_04820 gene hisC 99527 98433 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 protein_id gnl|my_center|LOCUS_04820 100608 99514 gene locus_tag LOCUS_04830 gene pheA 100608 99514 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_04830 101396 100605 gene locus_tag LOCUS_04840 101396 100605 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858702.1 protein_id gnl|my_center|LOCUS_04840 102609 101398 gene locus_tag LOCUS_04850 gene lysA 102609 101398 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858733.1 protein_id gnl|my_center|LOCUS_04850 103744 102674 gene locus_tag LOCUS_04860 103744 102674 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858697.1 protein_id gnl|my_center|LOCUS_04860 104395 103838 gene locus_tag LOCUS_04870 gene pth 104395 103838 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858659.1 protein_id gnl|my_center|LOCUS_04870 104934 104398 gene locus_tag LOCUS_04880 104934 104398 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002791314.1 protein_id gnl|my_center|LOCUS_04880 106197 105001 gene locus_tag LOCUS_04890 106197 105001 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_04890 107174 106194 gene locus_tag LOCUS_04900 107174 106194 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851728.1 protein_id gnl|my_center|LOCUS_04900 108661 107261 gene locus_tag LOCUS_04910 108661 107261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 109613 108675 gene locus_tag LOCUS_04920 109613 108675 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_04920 110496 109603 gene locus_tag LOCUS_04930 110496 109603 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852714.1 protein_id gnl|my_center|LOCUS_04930 111192 110536 gene locus_tag LOCUS_04940 gene bioD 111192 110536 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897490.1 protein_id gnl|my_center|LOCUS_04940 111253 111552 gene locus_tag LOCUS_04950 111253 111552 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_04950 111552 113729 gene locus_tag LOCUS_04960 gene clpA 111552 113729 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_04960 113841 114530 gene locus_tag LOCUS_04970 gene aat 113841 114530 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence04 941 237 gene locus_tag LOCUS_04980 941 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1180 1254 gene locus_tag LOCUS_t00090 1180 1254 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1505 3598 gene locus_tag LOCUS_04990 1505 3598 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211632.1 protein_id gnl|my_center|LOCUS_04990 3607 5043 gene locus_tag LOCUS_05000 3607 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5620 5072 gene locus_tag LOCUS_05010 5620 5072 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_05010 6043 5642 gene locus_tag LOCUS_05020 6043 5642 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_05020 6504 6133 gene locus_tag LOCUS_05030 6504 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 6852 6517 gene locus_tag LOCUS_05040 6852 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7598 7104 gene locus_tag LOCUS_05050 7598 7104 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 protein_id gnl|my_center|LOCUS_05050 9002 7719 gene locus_tag LOCUS_05060 9002 7719 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_05060 9484 8999 gene locus_tag LOCUS_05070 9484 8999 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_05070 10939 9494 gene locus_tag LOCUS_05080 10939 9494 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852462.1 protein_id gnl|my_center|LOCUS_05080 11676 10939 gene locus_tag LOCUS_05090 11676 10939 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852645.1 protein_id gnl|my_center|LOCUS_05090 12713 11676 gene locus_tag LOCUS_05100 12713 11676 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852516.1 protein_id gnl|my_center|LOCUS_05100 13298 12729 gene locus_tag LOCUS_05110 gene ruvA 13298 12729 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635172.1 protein_id gnl|my_center|LOCUS_05110 15208 13295 gene locus_tag LOCUS_05120 15208 13295 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051272.1 protein_id gnl|my_center|LOCUS_05120 15382 16719 gene locus_tag LOCUS_05130 gene murJ 15382 16719 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611242.1 protein_id gnl|my_center|LOCUS_05130 17181 17495 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaattacaccccagtgaatgaatctccacttttt 17733 17966 gene locus_tag LOCUS_05140 17733 17966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 17967 18155 gene locus_tag LOCUS_05150 17967 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 18064 18258 gene locus_tag LOCUS_05160 18064 18258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 18290 18472 gene locus_tag LOCUS_05170 18290 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 18487 19887 gene locus_tag LOCUS_05180 gene cysS 18487 19887 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471359.1 protein_id gnl|my_center|LOCUS_05180 19887 20801 gene locus_tag LOCUS_05190 19887 20801 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 protein_id gnl|my_center|LOCUS_05190 21345 20788 gene locus_tag LOCUS_05200 21345 20788 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241407.1 protein_id gnl|my_center|LOCUS_05200 21443 22309 gene locus_tag LOCUS_05210 21443 22309 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_05210 22306 22695 gene locus_tag LOCUS_05220 22306 22695 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931865.1 protein_id gnl|my_center|LOCUS_05220 22698 23990 gene locus_tag LOCUS_05230 22698 23990 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_05230 23987 24718 gene locus_tag LOCUS_05240 23987 24718 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 protein_id gnl|my_center|LOCUS_05240 24715 26190 gene locus_tag LOCUS_05250 24715 26190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 26187 26765 gene locus_tag LOCUS_05260 26187 26765 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207732.1 protein_id gnl|my_center|LOCUS_05260 26825 27409 gene locus_tag LOCUS_05270 26825 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 27480 28538 gene locus_tag LOCUS_05280 27480 28538 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_05280 28582 29838 gene locus_tag LOCUS_05290 28582 29838 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 protein_id gnl|my_center|LOCUS_05290 29839 30732 gene locus_tag LOCUS_05300 gene dapA 29839 30732 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852574.1 protein_id gnl|my_center|LOCUS_05300 30734 31501 gene locus_tag LOCUS_05310 30734 31501 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891889.1 protein_id gnl|my_center|LOCUS_05310 31545 32447 gene locus_tag LOCUS_05320 31545 32447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 32540 33073 gene locus_tag LOCUS_05330 32540 33073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 33606 33178 gene locus_tag LOCUS_05340 33606 33178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 34438 33677 gene locus_tag LOCUS_05350 34438 33677 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_05350 35826 34525 gene locus_tag LOCUS_05360 35826 34525 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958257.1 protein_id gnl|my_center|LOCUS_05360 36933 35908 gene locus_tag LOCUS_05370 gene amrS 36933 35908 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_05370 38412 36979 gene locus_tag LOCUS_05380 38412 36979 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869048.1 protein_id gnl|my_center|LOCUS_05380 42351 38431 gene locus_tag LOCUS_05390 gene otsB 42351 38431 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084493241.1 protein_id gnl|my_center|LOCUS_05390 43068 42436 gene locus_tag LOCUS_05400 43068 42436 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147186.1 protein_id gnl|my_center|LOCUS_05400 44168 43050 gene locus_tag LOCUS_05410 gene ald 44168 43050 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869878.1 protein_id gnl|my_center|LOCUS_05410 44452 44180 gene locus_tag LOCUS_05420 44452 44180 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942407.1 protein_id gnl|my_center|LOCUS_05420 45249 44449 gene locus_tag LOCUS_05430 45249 44449 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937487.1 protein_id gnl|my_center|LOCUS_05430 45312 46583 gene locus_tag LOCUS_05440 45312 46583 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968391.1 protein_id gnl|my_center|LOCUS_05440 47816 46575 gene locus_tag LOCUS_05450 47816 46575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 48043 48594 gene locus_tag LOCUS_05460 gene pgsA 48043 48594 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_05460 48594 49646 gene locus_tag LOCUS_05470 gene rseP 48594 49646 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_05470 49650 50336 gene locus_tag LOCUS_05480 49650 50336 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888213.1 protein_id gnl|my_center|LOCUS_05480 50392 50982 gene locus_tag LOCUS_05490 50392 50982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903164.1 protein_id gnl|my_center|LOCUS_05490 51441 51091 gene locus_tag LOCUS_05500 51441 51091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 51742 51434 gene locus_tag LOCUS_05510 51742 51434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 52582 51824 gene locus_tag LOCUS_05520 52582 51824 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688976.1 protein_id gnl|my_center|LOCUS_05520 52731 53981 gene locus_tag LOCUS_05530 52731 53981 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_05530 54528 53965 gene locus_tag LOCUS_05540 gene thiE 54528 53965 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880880.1 protein_id gnl|my_center|LOCUS_05540 54685 56781 gene locus_tag LOCUS_05550 54685 56781 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_05550 56797 56949 gene locus_tag LOCUS_05560 gene nrdD 56797 56949 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389030.1 protein_id gnl|my_center|LOCUS_05560 56912 57613 gene locus_tag LOCUS_05570 56912 57613 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_05570 60185 57732 gene locus_tag LOCUS_05580 60185 57732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 60308 62011 gene locus_tag LOCUS_05590 60308 62011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 62675 61998 gene locus_tag LOCUS_05600 62675 61998 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_05600 63876 62665 gene locus_tag LOCUS_05610 63876 62665 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 protein_id gnl|my_center|LOCUS_05610 66222 63907 gene locus_tag LOCUS_05620 gene opgB 66222 63907 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292715.1 protein_id gnl|my_center|LOCUS_05620 69035 66315 gene locus_tag LOCUS_05630 gene polA 69035 66315 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858644.1 protein_id gnl|my_center|LOCUS_05630 69847 69038 gene locus_tag LOCUS_05640 69847 69038 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_05640 70608 69895 gene locus_tag LOCUS_05650 70608 69895 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851528.1 protein_id gnl|my_center|LOCUS_05650 71129 70617 gene locus_tag LOCUS_05660 71129 70617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 71789 71310 gene locus_tag LOCUS_05670 71789 71310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 72613 71786 gene locus_tag LOCUS_05680 gene xerD 72613 71786 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_05680 73620 72616 gene locus_tag LOCUS_05690 73620 72616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 74204 73617 gene locus_tag LOCUS_05700 74204 73617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851102.1 protein_id gnl|my_center|LOCUS_05700 74332 74622 gene locus_tag LOCUS_05710 gene gatC 74332 74622 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858734.1 protein_id gnl|my_center|LOCUS_05710 74691 75773 gene locus_tag LOCUS_05720 74691 75773 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_05720 76793 75804 gene locus_tag LOCUS_05730 76793 75804 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256047.1 protein_id gnl|my_center|LOCUS_05730 77985 76783 gene locus_tag LOCUS_05740 77985 76783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 79126 77942 gene locus_tag LOCUS_05750 79126 77942 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_05750 80856 79123 gene locus_tag LOCUS_05760 80856 79123 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877176.1 protein_id gnl|my_center|LOCUS_05760 81646 80849 gene locus_tag LOCUS_05770 81646 80849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 81772 82719 gene locus_tag LOCUS_05780 gene cheV1 81772 82719 CDS product chemotaxis protein CheV1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785454.1 protein_id gnl|my_center|LOCUS_05780 84107 82776 gene locus_tag LOCUS_05790 84107 82776 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417780.1 protein_id gnl|my_center|LOCUS_05790 85911 84112 gene locus_tag LOCUS_05800 85911 84112 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_05800 86150 85920 gene locus_tag LOCUS_05810 86150 85920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 86295 86600 gene locus_tag LOCUS_05820 86295 86600 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 protein_id gnl|my_center|LOCUS_05820 86635 86943 gene locus_tag LOCUS_05830 86635 86943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 86950 87117 gene locus_tag LOCUS_05840 86950 87117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 87629 87123 gene locus_tag LOCUS_05850 87629 87123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 89620 87728 gene locus_tag LOCUS_05860 gene htpG 89620 87728 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070607.1 protein_id gnl|my_center|LOCUS_05860 89869 90696 gene locus_tag LOCUS_05870 89869 90696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 92194 90803 gene locus_tag LOCUS_05880 92194 90803 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_05880 92310 94250 gene locus_tag LOCUS_05890 92310 94250 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 protein_id gnl|my_center|LOCUS_05890 95745 94396 gene locus_tag LOCUS_05900 95745 94396 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268550.1 protein_id gnl|my_center|LOCUS_05900 95909 96823 gene locus_tag LOCUS_05910 95909 96823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 96823 97473 gene locus_tag LOCUS_05920 96823 97473 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858643.1 protein_id gnl|my_center|LOCUS_05920 97476 97949 gene locus_tag LOCUS_05930 97476 97949 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_05930 98002 99516 gene locus_tag LOCUS_05940 gene lysS 98002 99516 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858694.1 protein_id gnl|my_center|LOCUS_05940 99574 100821 gene locus_tag LOCUS_05950 99574 100821 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_05950 100835 101377 gene locus_tag LOCUS_05960 100835 101377 CDS product DUF1882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859481.1 protein_id gnl|my_center|LOCUS_05960 101515 102177 gene locus_tag LOCUS_05970 101515 102177 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864776.1 protein_id gnl|my_center|LOCUS_05970 102197 103600 gene locus_tag LOCUS_05980 gene trpE 102197 103600 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_05980 103601 104392 gene locus_tag LOCUS_05990 103601 104392 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 protein_id gnl|my_center|LOCUS_05990 106600 104372 gene locus_tag LOCUS_06000 gene hypF 106600 104372 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_06000 106941 106600 gene locus_tag LOCUS_06010 gene hypA 106941 106600 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 protein_id gnl|my_center|LOCUS_06010 107934 106942 gene locus_tag LOCUS_06020 gene hypE 107934 106942 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072154.1 protein_id gnl|my_center|LOCUS_06020 108827 108027 gene locus_tag LOCUS_06030 108827 108027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 109219 108932 gene locus_tag LOCUS_06040 109219 108932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 109466 109212 gene locus_tag LOCUS_06050 109466 109212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 110193 109516 gene locus_tag LOCUS_06060 110193 109516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 110688 110197 gene locus_tag LOCUS_06070 gene sixA 110688 110197 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_06070 111711 110692 gene locus_tag LOCUS_06080 111711 110692 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_06080 112242 111727 gene locus_tag LOCUS_06090 112242 111727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 113037 112360 gene locus_tag LOCUS_06100 113037 112360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence05 114 533 gene locus_tag LOCUS_06110 114 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 543 1718 gene locus_tag LOCUS_06120 543 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 1718 2680 gene locus_tag LOCUS_06130 1718 2680 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822204.1 protein_id gnl|my_center|LOCUS_06130 2685 5735 gene locus_tag LOCUS_06140 2685 5735 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570460.1 protein_id gnl|my_center|LOCUS_06140 5823 6404 gene locus_tag LOCUS_06150 gene crdR 5823 6404 CDS product copper response regulator transcription factor CrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_06150 6529 7527 gene locus_tag LOCUS_06160 gene dccS 6529 7527 CDS product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 protein_id gnl|my_center|LOCUS_06160 7609 7534 gene locus_tag LOCUS_t00100 7609 7534 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7706 7631 gene locus_tag LOCUS_t00110 7706 7631 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8420 7857 gene locus_tag LOCUS_06170 gene purN 8420 7857 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_06170 9619 8420 gene locus_tag LOCUS_06180 gene murD 9619 8420 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_06180 10680 9619 gene locus_tag LOCUS_06190 gene mraY 10680 9619 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 protein_id gnl|my_center|LOCUS_06190 10907 12382 gene locus_tag LOCUS_06200 gene gpmI 10907 12382 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057737.1 protein_id gnl|my_center|LOCUS_06200 12520 13266 gene locus_tag LOCUS_06210 gene fabG 12520 13266 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_06210 13286 14233 gene locus_tag LOCUS_06220 13286 14233 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943863.1 protein_id gnl|my_center|LOCUS_06220 14230 15567 gene locus_tag LOCUS_06230 14230 15567 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_06230 15675 15902 gene locus_tag LOCUS_06240 gene acpP 15675 15902 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854831.1 protein_id gnl|my_center|LOCUS_06240 16005 17222 gene locus_tag LOCUS_06250 16005 17222 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 protein_id gnl|my_center|LOCUS_06250 17239 18174 gene locus_tag LOCUS_06260 gene accA 17239 18174 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_06260 18975 18175 gene locus_tag LOCUS_06270 18975 18175 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858535.1 protein_id gnl|my_center|LOCUS_06270 19566 18979 gene locus_tag LOCUS_06280 19566 18979 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545776.1 protein_id gnl|my_center|LOCUS_06280 20297 19656 gene locus_tag LOCUS_06290 gene rpe 20297 19656 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861474.1 protein_id gnl|my_center|LOCUS_06290 21773 20379 gene locus_tag LOCUS_06300 21773 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 22567 21770 gene locus_tag LOCUS_06310 22567 21770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 22718 22906 gene locus_tag LOCUS_06320 gene rpmB 22718 22906 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_06320 22925 24061 gene locus_tag LOCUS_06330 22925 24061 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461981.1 protein_id gnl|my_center|LOCUS_06330 24054 25232 gene locus_tag LOCUS_06340 gene argJ 24054 25232 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932788.1 protein_id gnl|my_center|LOCUS_06340 25517 25254 gene locus_tag LOCUS_06350 25517 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 25672 25499 gene locus_tag LOCUS_06360 25672 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 26310 25867 gene locus_tag LOCUS_06370 26310 25867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06370 26632 26468 gene locus_tag LOCUS_06380 26632 26468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 26850 26638 gene locus_tag LOCUS_06390 26850 26638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 27263 28453 gene locus_tag LOCUS_06400 27263 28453 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719549.1 protein_id gnl|my_center|LOCUS_06400 28450 30258 gene locus_tag LOCUS_06410 28450 30258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 30255 30635 gene locus_tag LOCUS_06420 30255 30635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 31275 30664 gene locus_tag LOCUS_06430 31275 30664 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979664.1 protein_id gnl|my_center|LOCUS_06430 31803 31276 gene locus_tag LOCUS_06440 31803 31276 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851622.1 protein_id gnl|my_center|LOCUS_06440 33904 31805 gene locus_tag LOCUS_06450 33904 31805 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860421.1 protein_id gnl|my_center|LOCUS_06450 35302 34064 gene locus_tag LOCUS_06460 35302 34064 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237964.1 protein_id gnl|my_center|LOCUS_06460 35407 35673 gene locus_tag LOCUS_06470 gene yajC 35407 35673 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 protein_id gnl|my_center|LOCUS_06470 35768 37228 gene locus_tag LOCUS_06480 gene secD 35768 37228 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_06480 37320 38291 gene locus_tag LOCUS_06490 gene secF 37320 38291 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_06490 38903 39979 gene locus_tag LOCUS_06500 38903 39979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 40101 40439 gene locus_tag LOCUS_06510 40101 40439 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383778.1 protein_id gnl|my_center|LOCUS_06510 40589 43045 gene locus_tag LOCUS_06520 gene leuS 40589 43045 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_06520 43048 43581 gene locus_tag LOCUS_06530 43048 43581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 43606 45150 gene locus_tag LOCUS_06540 43606 45150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 45147 46295 gene locus_tag LOCUS_06550 45147 46295 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891906.1 protein_id gnl|my_center|LOCUS_06550 46288 47232 gene locus_tag LOCUS_06560 46288 47232 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852904.1 protein_id gnl|my_center|LOCUS_06560 47145 47600 gene locus_tag LOCUS_06570 47145 47600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 47617 50598 gene locus_tag LOCUS_06580 47617 50598 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858240.1 protein_id gnl|my_center|LOCUS_06580 50595 51407 gene locus_tag LOCUS_06590 50595 51407 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 protein_id gnl|my_center|LOCUS_06590 51866 51408 gene locus_tag LOCUS_06600 51866 51408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 51989 52663 gene locus_tag LOCUS_06610 51989 52663 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860529.1 protein_id gnl|my_center|LOCUS_06610 52657 54051 gene locus_tag LOCUS_06620 52657 54051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 55688 54048 gene locus_tag LOCUS_06630 55688 54048 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891914.1 protein_id gnl|my_center|LOCUS_06630 55958 55734 gene locus_tag LOCUS_06640 55958 55734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 57785 56070 gene locus_tag LOCUS_06650 57785 56070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 58108 57803 gene locus_tag LOCUS_06660 58108 57803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 59123 58101 gene locus_tag LOCUS_06670 59123 58101 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_06670 59339 59154 gene locus_tag LOCUS_06680 59339 59154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 59566 59345 gene locus_tag LOCUS_06690 59566 59345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 60555 59566 gene locus_tag LOCUS_06700 60555 59566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 61322 60579 gene locus_tag LOCUS_06710 gene murI 61322 60579 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851499.1 protein_id gnl|my_center|LOCUS_06710 62754 61411 gene locus_tag LOCUS_06720 gene rho 62754 61411 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004715.1 protein_id gnl|my_center|LOCUS_06720 63939 62881 gene locus_tag LOCUS_06730 63939 62881 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205617032.1 protein_id gnl|my_center|LOCUS_06730 64065 64865 gene locus_tag LOCUS_06740 gene surE 64065 64865 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854555.1 protein_id gnl|my_center|LOCUS_06740 64862 65500 gene locus_tag LOCUS_06750 64862 65500 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612425.1 protein_id gnl|my_center|LOCUS_06750 65512 65763 gene locus_tag LOCUS_06760 65512 65763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 65811 66308 gene locus_tag LOCUS_06770 gene greA 65811 66308 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031337.1 protein_id gnl|my_center|LOCUS_06770 66295 67299 gene locus_tag LOCUS_06780 gene argC 66295 67299 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870608.1 protein_id gnl|my_center|LOCUS_06780 67303 68040 gene locus_tag LOCUS_06790 67303 68040 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894935.1 protein_id gnl|my_center|LOCUS_06790 68044 68985 gene locus_tag LOCUS_06800 68044 68985 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851778.1 protein_id gnl|my_center|LOCUS_06800 68996 71398 gene locus_tag LOCUS_06810 68996 71398 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_06810 71395 71889 gene locus_tag LOCUS_06820 gene cheW 71395 71889 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070768.1 protein_id gnl|my_center|LOCUS_06820 71899 73023 gene locus_tag LOCUS_06830 71899 73023 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 protein_id gnl|my_center|LOCUS_06830 73023 73766 gene locus_tag LOCUS_06840 73023 73766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328527.1 protein_id gnl|my_center|LOCUS_06840 73763 74725 gene locus_tag LOCUS_06850 73763 74725 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771786.1 protein_id gnl|my_center|LOCUS_06850 74727 75320 gene locus_tag LOCUS_06860 74727 75320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 75317 76600 gene locus_tag LOCUS_06870 gene pepP 75317 76600 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693180.1 protein_id gnl|my_center|LOCUS_06870 77328 76597 gene locus_tag LOCUS_06880 77328 76597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 77721 77332 gene locus_tag LOCUS_06890 77721 77332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 78686 77736 gene locus_tag LOCUS_06900 78686 77736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 79168 78686 gene locus_tag LOCUS_06910 79168 78686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 79875 79168 gene locus_tag LOCUS_06920 79875 79168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 80596 79877 gene locus_tag LOCUS_06930 gene napH 80596 79877 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_06930 81516 80704 gene locus_tag LOCUS_06940 gene napG 81516 80704 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852504.1 protein_id gnl|my_center|LOCUS_06940 84372 81550 gene locus_tag LOCUS_06950 gene napA 84372 81550 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_06950 85617 84607 gene locus_tag LOCUS_06960 85617 84607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 86282 85614 gene locus_tag LOCUS_06970 gene nssR 86282 85614 CDS product nitrosative stress-sensitive transcriptional regulator NssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851096.1 protein_id gnl|my_center|LOCUS_06970 86437 87693 gene locus_tag LOCUS_06980 86437 87693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 89047 87695 gene locus_tag LOCUS_06990 gene gdhA 89047 87695 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 protein_id gnl|my_center|LOCUS_06990 89257 92820 gene locus_tag LOCUS_07000 89257 92820 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891940.1 protein_id gnl|my_center|LOCUS_07000 93148 92804 gene locus_tag LOCUS_07010 93148 92804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 93984 93145 gene locus_tag LOCUS_07020 93984 93145 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 protein_id gnl|my_center|LOCUS_07020 95575 93971 gene locus_tag LOCUS_07030 95575 93971 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942070.1 protein_id gnl|my_center|LOCUS_07030 97160 95664 gene locus_tag LOCUS_07040 97160 95664 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854402.1 protein_id gnl|my_center|LOCUS_07040 97244 97660 gene locus_tag LOCUS_07050 97244 97660 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021908.1 protein_id gnl|my_center|LOCUS_07050 97994 97776 gene locus_tag LOCUS_07060 97994 97776 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_07060 98216 98758 gene locus_tag LOCUS_07070 98216 98758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 99396 98773 gene locus_tag LOCUS_07080 99396 98773 CDS product putative metalloprotease CJM1_0395 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858642.1 protein_id gnl|my_center|LOCUS_07080 99588 99791 gene locus_tag LOCUS_07090 99588 99791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 100649 99933 gene locus_tag LOCUS_07100 100649 99933 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_07100 100826 101299 gene locus_tag LOCUS_07110 100826 101299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 101309 104401 gene locus_tag LOCUS_07120 101309 104401 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_07120 104796 104398 gene locus_tag LOCUS_07130 104796 104398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 104862 105227 gene locus_tag LOCUS_07140 104862 105227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 107135 105243 gene locus_tag LOCUS_07150 107135 105243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 107553 107224 gene locus_tag LOCUS_07160 107553 107224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 107779 108396 gene locus_tag LOCUS_07170 107779 108396 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814882.1 protein_id gnl|my_center|LOCUS_07170 108397 109503 gene locus_tag LOCUS_07180 108397 109503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 109505 110302 gene locus_tag LOCUS_07190 109505 110302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence06 153 1028 gene locus_tag LOCUS_07200 153 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1022 1348 gene locus_tag LOCUS_07210 1022 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2927 1719 gene locus_tag LOCUS_07220 2927 1719 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858477.1 protein_id gnl|my_center|LOCUS_07220 3048 3431 gene locus_tag LOCUS_07230 3048 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3570 4805 gene locus_tag LOCUS_07240 3570 4805 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 protein_id gnl|my_center|LOCUS_07240 4824 5561 gene locus_tag LOCUS_07250 4824 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 5571 6017 gene locus_tag LOCUS_07260 gene rplI 5571 6017 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781628.1 protein_id gnl|my_center|LOCUS_07260 6110 6655 gene locus_tag LOCUS_07270 gene hslV 6110 6655 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 protein_id gnl|my_center|LOCUS_07270 6652 7980 gene locus_tag LOCUS_07280 gene hslU 6652 7980 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 protein_id gnl|my_center|LOCUS_07280 7989 8891 gene locus_tag LOCUS_07290 gene era 7989 8891 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862438.1 protein_id gnl|my_center|LOCUS_07290 8993 9853 gene locus_tag LOCUS_07300 gene csd6 8993 9853 CDS product cell shape-determining L,D-carboxypeptidase Csd6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757130.1 protein_id gnl|my_center|LOCUS_07300 9867 11180 gene locus_tag LOCUS_07310 9867 11180 CDS product M99 family carboxypeptidase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869556.1 protein_id gnl|my_center|LOCUS_07310 11177 12730 gene locus_tag LOCUS_07320 11177 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 12727 13368 gene locus_tag LOCUS_07330 12727 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 13365 13829 gene locus_tag LOCUS_07340 13365 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 13839 15431 gene locus_tag LOCUS_07350 gene mshL 13839 15431 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_07350 15428 16243 gene locus_tag LOCUS_07360 15428 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 16236 17093 gene locus_tag LOCUS_07370 16236 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 17090 17632 gene locus_tag LOCUS_07380 17090 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 17641 19374 gene locus_tag LOCUS_07390 17641 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 19374 20621 gene locus_tag LOCUS_07400 gene mshG 19374 20621 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_07400 21366 20656 gene locus_tag LOCUS_07410 21366 20656 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_07410 21464 21955 gene locus_tag LOCUS_07420 21464 21955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 22703 21945 gene locus_tag LOCUS_07430 22703 21945 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 protein_id gnl|my_center|LOCUS_07430 23385 22693 gene locus_tag LOCUS_07440 gene pfs 23385 22693 CDS product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859787.1 protein_id gnl|my_center|LOCUS_07440 24111 23395 gene locus_tag LOCUS_07450 24111 23395 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_07450 25051 24113 gene locus_tag LOCUS_07460 gene fabD 25051 24113 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 protein_id gnl|my_center|LOCUS_07460 25847 25062 gene locus_tag LOCUS_07470 25847 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 26313 25801 gene locus_tag LOCUS_07480 26313 25801 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851661.1 protein_id gnl|my_center|LOCUS_07480 27292 26381 gene locus_tag LOCUS_07490 27292 26381 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851738.1 protein_id gnl|my_center|LOCUS_07490 27835 27296 gene locus_tag LOCUS_07500 gene pal 27835 27296 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851617.1 protein_id gnl|my_center|LOCUS_07500 29164 27914 gene locus_tag LOCUS_07510 gene tolB 29164 27914 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_07510 29935 29168 gene locus_tag LOCUS_07520 29935 29168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 30320 29928 gene locus_tag LOCUS_07530 30320 29928 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105106.1 protein_id gnl|my_center|LOCUS_07530 30890 30324 gene locus_tag LOCUS_07540 30890 30324 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854361.1 protein_id gnl|my_center|LOCUS_07540 31286 30894 gene locus_tag LOCUS_07550 gene atpC 31286 30894 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851752.1 protein_id gnl|my_center|LOCUS_07550 32697 31303 gene locus_tag LOCUS_07560 gene atpD 32697 31303 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 protein_id gnl|my_center|LOCUS_07560 33596 32709 gene locus_tag LOCUS_07570 gene atpG 33596 32709 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 protein_id gnl|my_center|LOCUS_07570 35123 33606 gene locus_tag LOCUS_07580 gene atpA 35123 33606 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_07580 35678 35145 gene locus_tag LOCUS_07590 35678 35145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 36188 35679 gene locus_tag LOCUS_07600 36188 35679 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 protein_id gnl|my_center|LOCUS_07600 36620 36198 gene locus_tag LOCUS_07610 36620 36198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 37589 36747 gene locus_tag LOCUS_07620 37589 36747 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034353519.1 protein_id gnl|my_center|LOCUS_07620 38371 37586 gene locus_tag LOCUS_07630 38371 37586 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_07630 39003 38368 gene locus_tag LOCUS_07640 39003 38368 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 protein_id gnl|my_center|LOCUS_07640 39892 38984 gene locus_tag LOCUS_07650 gene fmt 39892 38984 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851657.1 protein_id gnl|my_center|LOCUS_07650 40656 39892 gene locus_tag LOCUS_07660 gene proB 40656 39892 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851769.1 protein_id gnl|my_center|LOCUS_07660 41773 40667 gene locus_tag LOCUS_07670 gene obgE 41773 40667 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851611.1 protein_id gnl|my_center|LOCUS_07670 42212 41955 gene locus_tag LOCUS_07680 gene rpmA 42212 41955 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_07680 42555 42247 gene locus_tag LOCUS_07690 gene rplU 42555 42247 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119318.1 protein_id gnl|my_center|LOCUS_07690 45733 42689 gene locus_tag LOCUS_07700 gene hefC 45733 42689 CDS product efflux RND transporter permease subunit HefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278421.1 protein_id gnl|my_center|LOCUS_07700 46490 45738 gene locus_tag LOCUS_07710 gene hefB 46490 45738 CDS product efflux RND transporter periplasmic adaptor subunit HefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619658.1 protein_id gnl|my_center|LOCUS_07710 47650 46487 gene locus_tag LOCUS_07720 47650 46487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 48084 47710 gene locus_tag LOCUS_07730 48084 47710 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869808.1 protein_id gnl|my_center|LOCUS_07730 48488 48096 gene locus_tag LOCUS_07740 48488 48096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 49595 48498 gene locus_tag LOCUS_07750 gene dapE 49595 48498 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854067.1 protein_id gnl|my_center|LOCUS_07750 49925 51268 gene locus_tag LOCUS_07760 49925 51268 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423893.1 protein_id gnl|my_center|LOCUS_07760 51295 51789 gene locus_tag LOCUS_07770 51295 51789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 51804 53477 gene locus_tag LOCUS_07780 51804 53477 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07780 53464 54804 gene locus_tag LOCUS_07790 53464 54804 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_07790 54805 55410 gene locus_tag LOCUS_07800 54805 55410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 56753 55458 gene locus_tag LOCUS_07810 56753 55458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 57149 56901 gene locus_tag LOCUS_07820 57149 56901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 57369 57280 gene locus_tag LOCUS_t00120 57369 57280 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58286 57603 gene locus_tag LOCUS_07830 gene pyrF 58286 57603 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_07830 60325 58373 gene locus_tag LOCUS_07840 gene acs 60325 58373 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851288.1 protein_id gnl|my_center|LOCUS_07840 60940 60326 gene locus_tag LOCUS_07850 60940 60326 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086891.1 protein_id gnl|my_center|LOCUS_07850 62757 60943 gene locus_tag LOCUS_07860 62757 60943 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112968.1 protein_id gnl|my_center|LOCUS_07860 64681 63017 gene locus_tag LOCUS_07870 gene actP 64681 63017 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175651.1 protein_id gnl|my_center|LOCUS_07870 64996 64682 gene locus_tag LOCUS_07880 64996 64682 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_07880 66362 65007 gene locus_tag LOCUS_07890 66362 65007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 67880 67224 gene locus_tag LOCUS_07900 gene crdR 67880 67224 CDS product copper response regulator transcription factor CrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_07900 69097 67880 gene locus_tag LOCUS_07910 69097 67880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 69193 69693 gene locus_tag LOCUS_07920 69193 69693 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001873572.1 protein_id gnl|my_center|LOCUS_07920 69814 70896 gene locus_tag LOCUS_07930 69814 70896 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 protein_id gnl|my_center|LOCUS_07930 70948 71397 gene locus_tag LOCUS_07940 gene fabZ 70948 71397 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 protein_id gnl|my_center|LOCUS_07940 71394 72215 gene locus_tag LOCUS_07950 gene lpxA 71394 72215 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851756.1 protein_id gnl|my_center|LOCUS_07950 72190 72321 gene locus_tag LOCUS_07960 72190 72321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 72318 73562 gene locus_tag LOCUS_07970 gene clpX 72318 73562 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_07970 73572 74609 gene locus_tag LOCUS_07980 73572 74609 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_07980 74602 75363 gene locus_tag LOCUS_07990 gene mreC 74602 75363 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864583.1 protein_id gnl|my_center|LOCUS_07990 75435 78710 gene locus_tag LOCUS_08000 gene carB 75435 78710 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858661.1 protein_id gnl|my_center|LOCUS_08000 78713 79144 gene locus_tag LOCUS_08010 78713 79144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851686.1 protein_id gnl|my_center|LOCUS_08010 79141 79584 gene locus_tag LOCUS_08020 79141 79584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 79581 80153 gene locus_tag LOCUS_08030 79581 80153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 80159 81334 gene locus_tag LOCUS_08040 80159 81334 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_08040 83080 81347 gene locus_tag LOCUS_08050 83080 81347 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022302.1 protein_id gnl|my_center|LOCUS_08050 84317 83106 gene locus_tag LOCUS_08060 84317 83106 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855462.1 protein_id gnl|my_center|LOCUS_08060 85158 84319 gene locus_tag LOCUS_08070 gene galU 85158 84319 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088639.1 protein_id gnl|my_center|LOCUS_08070 87348 85219 gene locus_tag LOCUS_08080 gene pglB 87348 85219 CDS product undecaprenyl-diphosphooligosaccharide--protein glycotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852780.1 protein_id gnl|my_center|LOCUS_08080 88414 87362 gene locus_tag LOCUS_08090 gene mqnE 88414 87362 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858079.1 protein_id gnl|my_center|LOCUS_08090 89617 88418 gene locus_tag LOCUS_08100 gene metK 89617 88418 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852836.1 protein_id gnl|my_center|LOCUS_08100 91279 89711 gene locus_tag LOCUS_08110 gene lsrK 91279 89711 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098852.1 protein_id gnl|my_center|LOCUS_08110 91493 91311 gene locus_tag LOCUS_08120 91493 91311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 91785 91534 gene locus_tag LOCUS_08130 91785 91534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 93350 92289 gene locus_tag LOCUS_08140 93350 92289 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510777.1 protein_id gnl|my_center|LOCUS_08140 94226 93366 gene locus_tag LOCUS_08150 gene cysW 94226 93366 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_08150 95077 94223 gene locus_tag LOCUS_08160 gene cysT 95077 94223 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_08160 96773 95313 gene locus_tag LOCUS_08170 96773 95313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 97853 96798 gene locus_tag LOCUS_08180 97853 96798 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928929.1 protein_id gnl|my_center|LOCUS_08180 98490 98029 gene locus_tag LOCUS_08190 98490 98029 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868963.1 protein_id gnl|my_center|LOCUS_08190 98700 98539 gene locus_tag LOCUS_08200 98700 98539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence07 1252 1168 gene locus_tag LOCUS_t00130 1252 1168 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1362 1286 gene locus_tag LOCUS_t00140 1362 1286 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1454 1378 gene locus_tag LOCUS_t00150 1454 1378 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1577 1501 gene locus_tag LOCUS_t00160 1577 1501 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1678 1601 gene locus_tag LOCUS_t00170 1678 1601 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1852 3297 gene locus_tag LOCUS_08210 1852 3297 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_08210 3294 3569 gene locus_tag LOCUS_08220 3294 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 4444 3665 gene locus_tag LOCUS_08230 4444 3665 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881431.1 protein_id gnl|my_center|LOCUS_08230 5818 4454 gene locus_tag LOCUS_08240 5818 4454 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954017.1 protein_id gnl|my_center|LOCUS_08240 6555 5821 gene locus_tag LOCUS_08250 6555 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6705 7724 gene locus_tag LOCUS_08260 6705 7724 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857587.1 protein_id gnl|my_center|LOCUS_08260 7767 8729 gene locus_tag LOCUS_08270 7767 8729 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121932.1 protein_id gnl|my_center|LOCUS_08270 8726 9682 gene locus_tag LOCUS_08280 8726 9682 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398405.1 protein_id gnl|my_center|LOCUS_08280 9683 10867 gene locus_tag LOCUS_08290 9683 10867 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060246.1 protein_id gnl|my_center|LOCUS_08290 10933 11220 gene locus_tag LOCUS_08300 10933 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11223 13199 gene locus_tag LOCUS_08310 11223 13199 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_08310 13199 14884 gene locus_tag LOCUS_08320 13199 14884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 15276 14917 gene locus_tag LOCUS_08330 gene rplT 15276 14917 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_08330 15571 15380 gene locus_tag LOCUS_08340 gene rpmI 15571 15380 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_08340 15665 15892 gene locus_tag LOCUS_08350 15665 15892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 16525 16187 gene locus_tag LOCUS_08360 16525 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 16881 16627 gene locus_tag LOCUS_08370 16881 16627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 17242 16868 gene locus_tag LOCUS_08380 gene fliS 17242 16868 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776169.1 protein_id gnl|my_center|LOCUS_08380 18717 17329 gene locus_tag LOCUS_08390 gene fliD 18717 17329 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146799.1 protein_id gnl|my_center|LOCUS_08390 19758 18931 gene locus_tag LOCUS_08400 19758 18931 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_08400 19980 22205 gene locus_tag LOCUS_08410 gene topA 19980 22205 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681408.1 protein_id gnl|my_center|LOCUS_08410 22215 22739 gene locus_tag LOCUS_08420 22215 22739 CDS product MJ0936 family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 protein_id gnl|my_center|LOCUS_08420 22732 23577 gene locus_tag LOCUS_08430 22732 23577 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851400.1 protein_id gnl|my_center|LOCUS_08430 23634 23984 gene locus_tag LOCUS_08440 23634 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 24948 23995 gene locus_tag LOCUS_08450 24948 23995 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856867.1 protein_id gnl|my_center|LOCUS_08450 25113 25703 gene locus_tag LOCUS_08460 25113 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 25703 27508 gene locus_tag LOCUS_08470 gene asnB 25703 27508 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398625.1 protein_id gnl|my_center|LOCUS_08470 28161 27505 gene locus_tag LOCUS_08480 28161 27505 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851887.1 protein_id gnl|my_center|LOCUS_08480 29105 28212 gene locus_tag LOCUS_08490 29105 28212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 29732 29106 gene locus_tag LOCUS_08500 gene upp 29732 29106 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881419.1 protein_id gnl|my_center|LOCUS_08500 31102 29786 gene locus_tag LOCUS_08510 31102 29786 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864147.1 protein_id gnl|my_center|LOCUS_08510 32654 31095 gene locus_tag LOCUS_08520 gene sirA 32654 31095 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_08520 34076 32664 gene locus_tag LOCUS_08530 34076 32664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 34989 34078 gene locus_tag LOCUS_08540 gene cysD 34989 34078 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 protein_id gnl|my_center|LOCUS_08540 35696 34986 gene locus_tag LOCUS_08550 35696 34986 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816178.1 protein_id gnl|my_center|LOCUS_08550 35939 35709 gene locus_tag LOCUS_08560 35939 35709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 36431 35985 gene locus_tag LOCUS_08570 36431 35985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 36666 37070 gene locus_tag LOCUS_08580 36666 37070 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_08580 37083 37517 gene locus_tag LOCUS_08590 37083 37517 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908759.1 protein_id gnl|my_center|LOCUS_08590 38175 37720 gene locus_tag LOCUS_08600 38175 37720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 38359 38712 gene locus_tag LOCUS_08610 gene arsC 38359 38712 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705568.1 protein_id gnl|my_center|LOCUS_08610 39251 38709 gene locus_tag LOCUS_08620 gene nifU 39251 38709 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_08620 39698 39255 gene locus_tag LOCUS_08630 39698 39255 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_08630 40534 39698 gene locus_tag LOCUS_08640 40534 39698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 40623 42011 gene locus_tag LOCUS_08650 gene gltX 40623 42011 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 protein_id gnl|my_center|LOCUS_08650 42015 42551 gene locus_tag LOCUS_08660 42015 42551 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973031.1 protein_id gnl|my_center|LOCUS_08660 42650 44482 gene locus_tag LOCUS_08670 42650 44482 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_08670 44554 46506 gene locus_tag LOCUS_08680 44554 46506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 47269 46508 gene locus_tag LOCUS_08690 47269 46508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 47799 47287 gene locus_tag LOCUS_08700 47799 47287 CDS product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940855.1 protein_id gnl|my_center|LOCUS_08700 49157 47787 gene locus_tag LOCUS_08710 gene dbpA 49157 47787 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_08710 49348 49157 gene locus_tag LOCUS_08720 49348 49157 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_08720 49434 50657 gene locus_tag LOCUS_08730 49434 50657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 50696 50926 gene locus_tag LOCUS_08740 50696 50926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 51174 50923 gene locus_tag LOCUS_08750 51174 50923 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 protein_id gnl|my_center|LOCUS_08750 52490 51171 gene locus_tag LOCUS_08760 52490 51171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 52611 52536 gene locus_tag LOCUS_t00180 52611 52536 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52729 53643 gene locus_tag LOCUS_08770 52729 53643 CDS product DUF234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852402.1 protein_id gnl|my_center|LOCUS_08770 53762 55378 gene locus_tag LOCUS_08780 53762 55378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08780 55391 55738 gene locus_tag LOCUS_08790 55391 55738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08790 56495 55743 gene locus_tag LOCUS_08800 56495 55743 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707376.1 protein_id gnl|my_center|LOCUS_08800 57093 56590 gene locus_tag LOCUS_08810 gene tpx 57093 56590 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_08810 58260 57283 gene locus_tag LOCUS_08820 gene tsaD 58260 57283 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864246.1 protein_id gnl|my_center|LOCUS_08820 59267 58263 gene locus_tag LOCUS_08830 59267 58263 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106543.1 protein_id gnl|my_center|LOCUS_08830 59476 59264 gene locus_tag LOCUS_08840 59476 59264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 60189 59530 gene locus_tag LOCUS_08850 60189 59530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 60809 60186 gene locus_tag LOCUS_08860 60809 60186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111525078.1 protein_id gnl|my_center|LOCUS_08860 61606 60809 gene locus_tag LOCUS_08870 61606 60809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 62666 61596 gene locus_tag LOCUS_08880 gene dxr 62666 61596 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260724.1 protein_id gnl|my_center|LOCUS_08880 63569 62787 gene locus_tag LOCUS_08890 63569 62787 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656886.1 protein_id gnl|my_center|LOCUS_08890 63891 63580 gene locus_tag LOCUS_08900 63891 63580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 65224 63896 gene locus_tag LOCUS_08910 65224 63896 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864240.1 protein_id gnl|my_center|LOCUS_08910 65891 67693 gene locus_tag LOCUS_08920 gene btuB 65891 67693 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703958.1 protein_id gnl|my_center|LOCUS_08920 67693 68520 gene locus_tag LOCUS_08930 67693 68520 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851399.1 protein_id gnl|my_center|LOCUS_08930 68521 69213 gene locus_tag LOCUS_08940 68521 69213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865069.1 protein_id gnl|my_center|LOCUS_08940 69210 70154 gene locus_tag LOCUS_08950 69210 70154 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_08950 70249 71811 gene locus_tag LOCUS_08960 70249 71811 CDS product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816035.1 protein_id gnl|my_center|LOCUS_08960 71808 72233 gene locus_tag LOCUS_08970 71808 72233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 72526 72236 gene locus_tag LOCUS_08980 72526 72236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence08 144 401 gene locus_tag LOCUS_08990 144 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 402 596 gene locus_tag LOCUS_09000 402 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 679 1746 gene locus_tag LOCUS_09010 679 1746 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052727998.1 protein_id gnl|my_center|LOCUS_09010 1928 3313 gene locus_tag LOCUS_09020 1928 3313 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989707.1 protein_id gnl|my_center|LOCUS_09020 3306 3806 gene locus_tag LOCUS_09030 gene cobU 3306 3806 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546718.1 protein_id gnl|my_center|LOCUS_09030 3803 4531 gene locus_tag LOCUS_09040 gene cobS 3803 4531 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_09040 4528 5067 gene locus_tag LOCUS_09050 gene cobC 4528 5067 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_09050 5101 6312 gene locus_tag LOCUS_09060 5101 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6327 7205 gene locus_tag LOCUS_09070 6327 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 7205 8260 gene locus_tag LOCUS_09080 7205 8260 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980223.1 protein_id gnl|my_center|LOCUS_09080 8302 11313 gene locus_tag LOCUS_09090 8302 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 11526 11320 gene locus_tag LOCUS_09100 11526 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 13277 11523 gene locus_tag LOCUS_09110 13277 11523 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_09110 14431 13430 gene locus_tag LOCUS_09120 gene rhuM 14431 13430 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_09120 14638 14447 gene locus_tag LOCUS_09130 14638 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 15994 14768 gene locus_tag LOCUS_09140 15994 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 16501 16043 gene locus_tag LOCUS_09150 16501 16043 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_09150 17522 16623 gene locus_tag LOCUS_09160 17522 16623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 20361 17554 gene locus_tag LOCUS_09170 20361 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 20742 20545 gene locus_tag LOCUS_09180 20742 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 21076 20786 gene locus_tag LOCUS_09190 21076 20786 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_09190 22426 21368 gene locus_tag LOCUS_09200 22426 21368 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817148.1 protein_id gnl|my_center|LOCUS_09200 23608 22439 gene locus_tag LOCUS_09210 gene ugd 23608 22439 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 protein_id gnl|my_center|LOCUS_09210 23754 26141 gene locus_tag LOCUS_09220 gene ppsA 23754 26141 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269108.1 protein_id gnl|my_center|LOCUS_09220 26199 26426 gene locus_tag LOCUS_09230 26199 26426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 26413 26754 gene locus_tag LOCUS_09240 26413 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 29319 26749 gene locus_tag LOCUS_09250 29319 26749 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169981.1 protein_id gnl|my_center|LOCUS_09250 29415 29681 gene locus_tag LOCUS_09260 29415 29681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 29830 31098 gene locus_tag LOCUS_09270 29830 31098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_09270 31258 32136 gene locus_tag LOCUS_09280 31258 32136 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_09280 32133 32882 gene locus_tag LOCUS_09290 32133 32882 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881421.1 protein_id gnl|my_center|LOCUS_09290 32884 33195 gene locus_tag LOCUS_09300 32884 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 33188 33499 gene locus_tag LOCUS_09310 33188 33499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 33556 34377 gene locus_tag LOCUS_09320 gene mscS 33556 34377 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_09320 34370 35242 gene locus_tag LOCUS_09330 34370 35242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 36365 35340 gene locus_tag LOCUS_09340 36365 35340 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267283.1 protein_id gnl|my_center|LOCUS_09340 36590 37078 gene locus_tag LOCUS_09350 36590 37078 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_09350 37113 38366 gene locus_tag LOCUS_09360 37113 38366 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012661737.1 protein_id gnl|my_center|LOCUS_09360 38526 39011 gene locus_tag LOCUS_09370 38526 39011 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_09370 38980 40407 gene locus_tag LOCUS_09380 gene cetA 38980 40407 CDS product bipartate energy taxis response protein CetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002790076.1 protein_id gnl|my_center|LOCUS_09380 40564 40833 gene locus_tag LOCUS_09390 40564 40833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09390 40761 42065 gene locus_tag LOCUS_09400 40761 42065 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09400 42065 42718 gene locus_tag LOCUS_09410 42065 42718 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 protein_id gnl|my_center|LOCUS_09410 42715 44637 gene locus_tag LOCUS_09420 42715 44637 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073982.1 protein_id gnl|my_center|LOCUS_09420 44704 45822 gene locus_tag LOCUS_09430 44704 45822 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012661737.1 protein_id gnl|my_center|LOCUS_09430 46302 45826 gene locus_tag LOCUS_09440 46302 45826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 46475 46387 gene locus_tag LOCUS_t00190 46475 46387 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 47193 46531 gene locus_tag LOCUS_09450 47193 46531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 47702 47205 gene locus_tag LOCUS_09460 47702 47205 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 protein_id gnl|my_center|LOCUS_09460 48459 47758 gene locus_tag LOCUS_09470 48459 47758 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880390.1 protein_id gnl|my_center|LOCUS_09470 50053 48449 gene locus_tag LOCUS_09480 gene sdhA 50053 48449 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_09480 52628 50043 gene locus_tag LOCUS_09490 52628 50043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 52966 52658 gene locus_tag LOCUS_09500 52966 52658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 53994 53050 gene locus_tag LOCUS_09510 53994 53050 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_09510 55159 53996 gene locus_tag LOCUS_09520 gene purT 55159 53996 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496844.1 protein_id gnl|my_center|LOCUS_09520 57441 55264 gene locus_tag LOCUS_09530 gene flgE 57441 55264 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946389.1 protein_id gnl|my_center|LOCUS_09530 58971 57679 gene locus_tag LOCUS_09540 58971 57679 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_09540 59647 58982 gene locus_tag LOCUS_09550 59647 58982 CDS product flagellar basal body rod modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805290.1 protein_id gnl|my_center|LOCUS_09550 61322 59670 gene locus_tag LOCUS_09560 61322 59670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 61405 61656 gene locus_tag LOCUS_09570 61405 61656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 62059 61643 gene locus_tag LOCUS_09580 62059 61643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 63098 62118 gene locus_tag LOCUS_09590 63098 62118 CDS product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851386.1 protein_id gnl|my_center|LOCUS_09590 64547 63261 gene locus_tag LOCUS_09600 gene rhlE 64547 63261 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007135.1 protein_id gnl|my_center|LOCUS_09600 64646 65446 gene locus_tag LOCUS_09610 64646 65446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 67091 65436 gene locus_tag LOCUS_09620 gene dnaG 67091 65436 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601638.1 protein_id gnl|my_center|LOCUS_09620 67334 67203 gene locus_tag LOCUS_09630 67334 67203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 67528 67740 gene locus_tag LOCUS_09640 gene rpsU 67528 67740 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117778.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence09 47 122 gene locus_tag LOCUS_t00200 47 122 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 136 210 gene locus_tag LOCUS_t00210 136 210 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2215 227 gene locus_tag LOCUS_09650 2215 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3050 2316 gene locus_tag LOCUS_09660 3050 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3512 3174 gene locus_tag LOCUS_09670 gene glnB 3512 3174 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_09670 3770 3570 gene locus_tag LOCUS_09680 3770 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09680 4822 3821 gene locus_tag LOCUS_09690 4822 3821 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 5034 6329 gene locus_tag LOCUS_09700 5034 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 6536 6396 gene locus_tag LOCUS_09710 6536 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 6811 6972 gene locus_tag LOCUS_09720 6811 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7171 7416 gene locus_tag LOCUS_09730 7171 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 7833 8063 gene locus_tag LOCUS_09740 7833 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 8056 8307 gene locus_tag LOCUS_09750 8056 8307 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_09750 8921 8310 gene locus_tag LOCUS_09760 8921 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 9162 8935 gene locus_tag LOCUS_09770 9162 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 9378 11861 gene locus_tag LOCUS_09780 gene gyrA 9378 11861 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857904.1 protein_id gnl|my_center|LOCUS_09780 11909 12484 gene locus_tag LOCUS_09790 11909 12484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 12433 12846 gene locus_tag LOCUS_09800 12433 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 12880 14031 gene locus_tag LOCUS_09810 gene flgR 12880 14031 CDS product fla regulon two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853038.1 protein_id gnl|my_center|LOCUS_09810 14050 15084 gene locus_tag LOCUS_09820 14050 15084 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 protein_id gnl|my_center|LOCUS_09820 15087 15605 gene locus_tag LOCUS_09830 15087 15605 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_09830 15692 16723 gene locus_tag LOCUS_09840 gene hemE 15692 16723 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 protein_id gnl|my_center|LOCUS_09840 16772 17656 gene locus_tag LOCUS_09850 16772 17656 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853222.1 protein_id gnl|my_center|LOCUS_09850 17713 17787 gene locus_tag LOCUS_t00220 17713 17787 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 18163 18912 gene locus_tag LOCUS_09860 18163 18912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 21567 18913 gene locus_tag LOCUS_09870 21567 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 22392 21583 gene locus_tag LOCUS_09880 22392 21583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 22652 22488 gene locus_tag LOCUS_09890 22652 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 24148 22679 gene locus_tag LOCUS_09900 24148 22679 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_09900 26804 24243 gene locus_tag LOCUS_09910 gene pepN 26804 24243 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443934.1 protein_id gnl|my_center|LOCUS_09910 26931 27152 gene locus_tag LOCUS_09920 26931 27152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 27154 27357 gene locus_tag LOCUS_09930 27154 27357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 27507 28094 gene locus_tag LOCUS_09940 27507 28094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 28072 28653 gene locus_tag LOCUS_09950 28072 28653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 28949 29131 gene locus_tag LOCUS_09960 28949 29131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 29323 30681 gene locus_tag LOCUS_09970 29323 30681 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355104.1 protein_id gnl|my_center|LOCUS_09970 30678 31685 gene locus_tag LOCUS_09980 gene pyrC 30678 31685 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852008.1 protein_id gnl|my_center|LOCUS_09980 31693 32331 gene locus_tag LOCUS_09990 gene dccR 31693 32331 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_09990 32321 33151 gene locus_tag LOCUS_10000 32321 33151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 33151 33603 gene locus_tag LOCUS_10010 gene exbB 33151 33603 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661840.1 protein_id gnl|my_center|LOCUS_10010 33606 33998 gene locus_tag LOCUS_10020 gene exbD 33606 33998 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836350.1 protein_id gnl|my_center|LOCUS_10020 34238 33999 gene locus_tag LOCUS_10030 34238 33999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 34343 34555 gene locus_tag LOCUS_10040 34343 34555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 34625 36682 gene locus_tag LOCUS_10050 34625 36682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10050 37363 36779 gene locus_tag LOCUS_10060 37363 36779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927105.1 protein_id gnl|my_center|LOCUS_10060 39142 37505 gene locus_tag LOCUS_10070 gene groL 39142 37505 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858047.1 protein_id gnl|my_center|LOCUS_10070 39419 39159 gene locus_tag LOCUS_10080 gene groES 39419 39159 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 protein_id gnl|my_center|LOCUS_10080 39643 39719 gene locus_tag LOCUS_t00230 39643 39719 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 39767 41233 gene locus_tag LOCUS_10090 39767 41233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 43380 41230 gene locus_tag LOCUS_10100 43380 41230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 43738 43373 gene locus_tag LOCUS_10110 43738 43373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 43912 43772 gene locus_tag LOCUS_10120 43912 43772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 44436 44278 gene locus_tag LOCUS_10130 44436 44278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 44902 44456 gene locus_tag LOCUS_10140 44902 44456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 45113 44904 gene locus_tag LOCUS_10150 45113 44904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 45576 45244 gene locus_tag LOCUS_10160 45576 45244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 45799 45578 gene locus_tag LOCUS_10170 45799 45578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 46521 45832 gene locus_tag LOCUS_10180 46521 45832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 48263 46665 gene locus_tag LOCUS_10190 48263 46665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 48900 48974 gene locus_tag LOCUS_t00240 48900 48974 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 49141 50157 gene locus_tag LOCUS_10200 49141 50157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 50154 50579 gene locus_tag LOCUS_10210 50154 50579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 51206 50592 gene locus_tag LOCUS_10220 51206 50592 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_10220 51667 51224 gene locus_tag LOCUS_10230 51667 51224 CDS product CopD family copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338876.1 protein_id gnl|my_center|LOCUS_10230 52415 51699 gene locus_tag LOCUS_10240 gene truC 52415 51699 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 protein_id gnl|my_center|LOCUS_10240 53717 52422 gene locus_tag LOCUS_10250 53717 52422 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063821.1 protein_id gnl|my_center|LOCUS_10250 53779 54339 gene locus_tag LOCUS_10260 53779 54339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 55157 54336 gene locus_tag LOCUS_10270 gene lgt 55157 54336 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854600.1 protein_id gnl|my_center|LOCUS_10270 56448 55165 gene locus_tag LOCUS_10280 56448 55165 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 protein_id gnl|my_center|LOCUS_10280 57818 56451 gene locus_tag LOCUS_10290 gene hemN 57818 56451 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 protein_id gnl|my_center|LOCUS_10290 58884 57913 gene locus_tag LOCUS_10300 58884 57913 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 protein_id gnl|my_center|LOCUS_10300 59960 58980 gene locus_tag LOCUS_10310 59960 58980 CDS product polysialyltransferase family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466247.1 protein_id gnl|my_center|LOCUS_10310 60997 59957 gene locus_tag LOCUS_10320 60997 59957 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_10320 61670 60987 gene locus_tag LOCUS_10330 61670 60987 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_10330 62734 61673 gene locus_tag LOCUS_10340 62734 61673 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044860.1 protein_id gnl|my_center|LOCUS_10340 63546 62746 gene locus_tag LOCUS_10350 63546 62746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 64136 63543 gene locus_tag LOCUS_10360 64136 63543 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516588.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence10 612 764 gene locus_tag LOCUS_10370 612 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 863 1414 gene locus_tag LOCUS_10380 863 1414 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851269.1 protein_id gnl|my_center|LOCUS_10380 1415 2557 gene locus_tag LOCUS_10390 gene carA 1415 2557 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851156.1 protein_id gnl|my_center|LOCUS_10390 2782 4275 gene locus_tag LOCUS_10400 gene ccoN 2782 4275 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_10400 4291 4983 gene locus_tag LOCUS_10410 gene ccoO 4291 4983 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 protein_id gnl|my_center|LOCUS_10410 4990 5196 gene locus_tag LOCUS_10420 4990 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5206 6129 gene locus_tag LOCUS_10430 5206 6129 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851306.1 protein_id gnl|my_center|LOCUS_10430 6140 6349 gene locus_tag LOCUS_10440 6140 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 6480 7163 gene locus_tag LOCUS_10450 6480 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851454.1 protein_id gnl|my_center|LOCUS_10450 7150 7656 gene locus_tag LOCUS_10460 7150 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7671 10016 gene locus_tag LOCUS_10470 7671 10016 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891938.1 protein_id gnl|my_center|LOCUS_10470 10097 11296 gene locus_tag LOCUS_10480 10097 11296 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109411.1 protein_id gnl|my_center|LOCUS_10480 11297 13867 gene locus_tag LOCUS_10490 11297 13867 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109412.1 protein_id gnl|my_center|LOCUS_10490 13851 14771 gene locus_tag LOCUS_10500 13851 14771 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816114.1 protein_id gnl|my_center|LOCUS_10500 14764 15444 gene locus_tag LOCUS_10510 gene prpE 14764 15444 CDS product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244765.1 protein_id gnl|my_center|LOCUS_10510 15535 15768 gene locus_tag LOCUS_10520 15535 15768 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_10520 15897 18611 gene locus_tag LOCUS_10530 15897 18611 CDS product RecB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864468.1 protein_id gnl|my_center|LOCUS_10530 18808 19230 gene locus_tag LOCUS_10540 gene rplM 18808 19230 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 protein_id gnl|my_center|LOCUS_10540 19241 19630 gene locus_tag LOCUS_10550 gene rpsI 19241 19630 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851459.1 protein_id gnl|my_center|LOCUS_10550 19775 21271 gene locus_tag LOCUS_10560 19775 21271 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_10560 21273 21932 gene locus_tag LOCUS_10570 21273 21932 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851542.1 protein_id gnl|my_center|LOCUS_10570 22084 22641 gene locus_tag LOCUS_10580 22084 22641 CDS product pyruvate flavodoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486467.1 protein_id gnl|my_center|LOCUS_10580 22652 23047 gene locus_tag LOCUS_10590 22652 23047 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656174.1 protein_id gnl|my_center|LOCUS_10590 23047 24270 gene locus_tag LOCUS_10600 23047 24270 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129867.1 protein_id gnl|my_center|LOCUS_10600 24281 25237 gene locus_tag LOCUS_10610 24281 25237 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238135.1 protein_id gnl|my_center|LOCUS_10610 26299 25520 gene locus_tag LOCUS_10620 26299 25520 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853285.1 protein_id gnl|my_center|LOCUS_10620 26877 26299 gene locus_tag LOCUS_10630 26877 26299 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853263.1 protein_id gnl|my_center|LOCUS_10630 28816 26858 gene locus_tag LOCUS_10640 28816 26858 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_10640 28984 29490 gene locus_tag LOCUS_10650 gene luxS 28984 29490 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693682.1 protein_id gnl|my_center|LOCUS_10650 29492 29794 gene locus_tag LOCUS_10660 29492 29794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 29791 30273 gene locus_tag LOCUS_10670 29791 30273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 30255 31022 gene locus_tag LOCUS_10680 30255 31022 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881294.1 protein_id gnl|my_center|LOCUS_10680 31654 31043 gene locus_tag LOCUS_10690 31654 31043 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 protein_id gnl|my_center|LOCUS_10690 32432 31746 gene locus_tag LOCUS_10700 32432 31746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 32515 34389 gene locus_tag LOCUS_10710 gene mnmG 32515 34389 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864546.1 protein_id gnl|my_center|LOCUS_10710 34405 35271 gene locus_tag LOCUS_10720 34405 35271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 35331 35855 gene locus_tag LOCUS_10730 gene petA 35331 35855 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852880.1 protein_id gnl|my_center|LOCUS_10730 35868 37082 gene locus_tag LOCUS_10740 35868 37082 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807891.1 protein_id gnl|my_center|LOCUS_10740 37093 38040 gene locus_tag LOCUS_10750 37093 38040 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657605.1 protein_id gnl|my_center|LOCUS_10750 38723 38259 gene locus_tag LOCUS_10760 38723 38259 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201774.1 protein_id gnl|my_center|LOCUS_10760 38952 40220 gene locus_tag LOCUS_10770 38952 40220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 40380 41345 gene locus_tag LOCUS_10780 gene moaA 40380 41345 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868437.1 protein_id gnl|my_center|LOCUS_10780 41345 42103 gene locus_tag LOCUS_10790 41345 42103 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851883.1 protein_id gnl|my_center|LOCUS_10790 42103 42684 gene locus_tag LOCUS_10800 42103 42684 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858675.1 protein_id gnl|my_center|LOCUS_10800 43890 42664 gene locus_tag LOCUS_10810 43890 42664 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622860.1 protein_id gnl|my_center|LOCUS_10810 43928 44335 gene locus_tag LOCUS_10820 43928 44335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 44332 45003 gene locus_tag LOCUS_10830 44332 45003 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851903.1 protein_id gnl|my_center|LOCUS_10830 45160 45360 gene locus_tag LOCUS_10840 gene rpmE 45160 45360 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_10840 45373 46188 gene locus_tag LOCUS_10850 gene rsmI 45373 46188 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_10850 46227 46907 gene locus_tag LOCUS_10860 gene rlmB 46227 46907 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851944.1 protein_id gnl|my_center|LOCUS_10860 46904 47701 gene locus_tag LOCUS_10870 46904 47701 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851924.1 protein_id gnl|my_center|LOCUS_10870 47695 48534 gene locus_tag LOCUS_10880 47695 48534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 48592 49818 gene locus_tag LOCUS_10890 48592 49818 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932911.1 protein_id gnl|my_center|LOCUS_10890 49815 51077 gene locus_tag LOCUS_10900 49815 51077 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851705.1 protein_id gnl|my_center|LOCUS_10900 51922 51092 gene locus_tag LOCUS_10910 51922 51092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 52014 52364 gene locus_tag LOCUS_10920 52014 52364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 52467 52853 gene locus_tag LOCUS_10930 52467 52853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 52853 54349 gene locus_tag LOCUS_10940 52853 54349 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_10940 54346 55080 gene locus_tag LOCUS_10950 54346 55080 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800040.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence11 693 310 gene locus_tag LOCUS_10960 693 310 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170794.1 protein_id gnl|my_center|LOCUS_10960 902 690 gene locus_tag LOCUS_10970 902 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1164 2738 gene locus_tag LOCUS_10980 1164 2738 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 protein_id gnl|my_center|LOCUS_10980 2908 3306 gene locus_tag LOCUS_10990 2908 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3632 3333 gene locus_tag LOCUS_11000 3632 3333 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323755.1 protein_id gnl|my_center|LOCUS_11000 3738 4103 gene locus_tag LOCUS_11010 3738 4103 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_11010 5381 4380 gene locus_tag LOCUS_11020 5381 4380 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_11020 6379 5381 gene locus_tag LOCUS_11030 gene plsX 6379 5381 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 protein_id gnl|my_center|LOCUS_11030 6532 6383 gene locus_tag LOCUS_11040 gene rpmF 6532 6383 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858674.1 protein_id gnl|my_center|LOCUS_11040 7024 6644 gene locus_tag LOCUS_11050 7024 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 7447 7034 gene locus_tag LOCUS_11060 gene ndk 7447 7034 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_11060 7874 7590 gene locus_tag LOCUS_11070 7874 7590 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_11070 9200 8025 gene locus_tag LOCUS_11080 gene metK 9200 8025 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655178.1 protein_id gnl|my_center|LOCUS_11080 9322 9918 gene locus_tag LOCUS_11090 9322 9918 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_11090 10078 11988 gene locus_tag LOCUS_11100 10078 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 13242 11983 gene locus_tag LOCUS_11110 gene pif1 13242 11983 CDS product ATP-dependent DNA helicase Pif1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853306.1 protein_id gnl|my_center|LOCUS_11110 13292 14536 gene locus_tag LOCUS_11120 13292 14536 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971367.1 protein_id gnl|my_center|LOCUS_11120 15627 14533 gene locus_tag LOCUS_11130 15627 14533 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_11130 16626 15631 gene locus_tag LOCUS_11140 16626 15631 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_11140 17825 16623 gene locus_tag LOCUS_11150 17825 16623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 17862 19202 gene locus_tag LOCUS_11160 gene nhaA 17862 19202 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_11160 19239 20348 gene locus_tag LOCUS_11170 19239 20348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 21375 20338 gene locus_tag LOCUS_11180 21375 20338 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038463.1 protein_id gnl|my_center|LOCUS_11180 21572 21396 gene locus_tag LOCUS_11190 21572 21396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 22546 22064 gene locus_tag LOCUS_11200 22546 22064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 22991 22593 gene locus_tag LOCUS_11210 22991 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 24259 23243 gene locus_tag LOCUS_11220 24259 23243 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_11220 24600 24256 gene locus_tag LOCUS_11230 24600 24256 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_11230 24835 24593 gene locus_tag LOCUS_11240 24835 24593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 26023 24890 gene locus_tag LOCUS_11250 26023 24890 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804043.1 protein_id gnl|my_center|LOCUS_11250 26681 26016 gene locus_tag LOCUS_11260 26681 26016 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356718.1 protein_id gnl|my_center|LOCUS_11260 26768 27145 gene locus_tag LOCUS_11270 26768 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 27222 28004 gene locus_tag LOCUS_11280 gene exoX 27222 28004 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816172.1 protein_id gnl|my_center|LOCUS_11280 29135 27993 gene locus_tag LOCUS_11290 29135 27993 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_11290 29137 29394 gene locus_tag LOCUS_11300 29137 29394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 30000 29377 gene locus_tag LOCUS_11310 30000 29377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 30131 30745 gene locus_tag LOCUS_11320 30131 30745 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_11320 32318 30747 gene locus_tag LOCUS_11330 gene argS 32318 30747 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891916.1 protein_id gnl|my_center|LOCUS_11330 32591 32346 gene locus_tag LOCUS_11340 gene tatA 32591 32346 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508588.1 protein_id gnl|my_center|LOCUS_11340 33275 32655 gene locus_tag LOCUS_11350 gene gmk 33275 32655 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860253.1 protein_id gnl|my_center|LOCUS_11350 34720 33275 gene locus_tag LOCUS_11360 34720 33275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 35533 34769 gene locus_tag LOCUS_11370 gene fliR 35533 34769 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852712.1 protein_id gnl|my_center|LOCUS_11370 36199 35555 gene locus_tag LOCUS_11380 36199 35555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588225.1 protein_id gnl|my_center|LOCUS_11380 37414 36218 gene locus_tag LOCUS_11390 37414 36218 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197317646.1 protein_id gnl|my_center|LOCUS_11390 38556 37504 gene locus_tag LOCUS_11400 gene tsf 38556 37504 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864836.1 protein_id gnl|my_center|LOCUS_11400 39338 38559 gene locus_tag LOCUS_11410 gene rpsB 39338 38559 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002892710.1 protein_id gnl|my_center|LOCUS_11410 40143 39673 gene locus_tag LOCUS_11420 gene bcp 40143 39673 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_11420 40738 40160 gene locus_tag LOCUS_11430 40738 40160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 41245 40778 gene locus_tag LOCUS_11440 41245 40778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 41850 41242 gene locus_tag LOCUS_11450 41850 41242 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_11450 42865 41843 gene locus_tag LOCUS_11460 gene murG 42865 41843 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_11460 44050 42887 gene locus_tag LOCUS_11470 44050 42887 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611797.1 protein_id gnl|my_center|LOCUS_11470 44579 44055 gene locus_tag LOCUS_11480 44579 44055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 45097 44576 gene locus_tag LOCUS_11490 45097 44576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 45909 45094 gene locus_tag LOCUS_11500 45909 45094 CDS product 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851905.1 protein_id gnl|my_center|LOCUS_11500 46022 46915 gene locus_tag LOCUS_11510 gene miaA 46022 46915 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080343057.1 protein_id gnl|my_center|LOCUS_11510 46912 48147 gene locus_tag LOCUS_11520 46912 48147 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_11520 48377 48144 gene locus_tag LOCUS_11530 48377 48144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 49487 48477 gene locus_tag LOCUS_11540 49487 48477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 49642 49917 gene locus_tag LOCUS_11550 49642 49917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 50624 49914 gene locus_tag LOCUS_11560 50624 49914 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864286.1 protein_id gnl|my_center|LOCUS_11560 51642 50638 gene locus_tag LOCUS_11570 51642 50638 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_11570 52504 51632 gene locus_tag LOCUS_11580 gene rhuM 52504 51632 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence12 1207 1872 gene locus_tag LOCUS_11590 gene ung 1207 1872 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_11590 2869 1865 gene locus_tag LOCUS_11600 2869 1865 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_11600 4818 2869 gene locus_tag LOCUS_11610 4818 2869 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483790.1 protein_id gnl|my_center|LOCUS_11610 5922 4834 gene locus_tag LOCUS_11620 5922 4834 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_11620 7238 5925 gene locus_tag LOCUS_11630 7238 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 7880 7374 gene locus_tag LOCUS_11640 7880 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 8243 8064 gene locus_tag LOCUS_11650 8243 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 8441 9976 gene locus_tag LOCUS_11660 8441 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 10805 9990 gene locus_tag LOCUS_11670 gene modD 10805 9990 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932141.1 protein_id gnl|my_center|LOCUS_11670 11582 10809 gene locus_tag LOCUS_11680 11582 10809 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927097.1 protein_id gnl|my_center|LOCUS_11680 12436 11582 gene locus_tag LOCUS_11690 12436 11582 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_11690 13126 12437 gene locus_tag LOCUS_11700 gene modB 13126 12437 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_11700 13520 13119 gene locus_tag LOCUS_11710 13520 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 14263 13517 gene locus_tag LOCUS_11720 gene modA 14263 13517 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_11720 15727 14273 gene locus_tag LOCUS_11730 15727 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 16679 15888 gene locus_tag LOCUS_11740 16679 15888 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933208.1 protein_id gnl|my_center|LOCUS_11740 16873 17586 gene locus_tag LOCUS_11750 gene pyrH 16873 17586 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148056.1 protein_id gnl|my_center|LOCUS_11750 17721 17936 gene locus_tag LOCUS_11760 17721 17936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 17942 20095 gene locus_tag LOCUS_11770 17942 20095 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 protein_id gnl|my_center|LOCUS_11770 20121 21320 gene locus_tag LOCUS_11780 gene tyrS 20121 21320 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_11780 21320 22411 gene locus_tag LOCUS_11790 21320 22411 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857924.1 protein_id gnl|my_center|LOCUS_11790 22510 23808 gene locus_tag LOCUS_11800 22510 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 24884 23805 gene locus_tag LOCUS_11810 24884 23805 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852576.1 protein_id gnl|my_center|LOCUS_11810 27069 24886 gene locus_tag LOCUS_11820 gene flhA 27069 24886 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262893.1 protein_id gnl|my_center|LOCUS_11820 27475 27074 gene locus_tag LOCUS_11830 27475 27074 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852609.1 protein_id gnl|my_center|LOCUS_11830 27613 27888 gene locus_tag LOCUS_11840 gene rpsO 27613 27888 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852579.1 protein_id gnl|my_center|LOCUS_11840 28653 27937 gene locus_tag LOCUS_11850 gene kdsB 28653 27937 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852502.1 protein_id gnl|my_center|LOCUS_11850 28758 29453 gene locus_tag LOCUS_11860 28758 29453 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864161.1 protein_id gnl|my_center|LOCUS_11860 29441 29821 gene locus_tag LOCUS_11870 29441 29821 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864630.1 protein_id gnl|my_center|LOCUS_11870 29814 31088 gene locus_tag LOCUS_11880 29814 31088 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855132.1 protein_id gnl|my_center|LOCUS_11880 31107 31907 gene locus_tag LOCUS_11890 gene trpC 31107 31907 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854779.1 protein_id gnl|my_center|LOCUS_11890 32426 31983 gene locus_tag LOCUS_11900 32426 31983 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858625.1 protein_id gnl|my_center|LOCUS_11900 32505 33227 gene locus_tag LOCUS_11910 gene flgH 32505 33227 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864738.1 protein_id gnl|my_center|LOCUS_11910 33172 34656 gene locus_tag LOCUS_11920 33172 34656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_11920 34658 35878 gene locus_tag LOCUS_11930 34658 35878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 37517 35883 gene locus_tag LOCUS_11940 gene sulP 37517 35883 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_11940 40164 37534 gene locus_tag LOCUS_11950 40164 37534 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864150.1 protein_id gnl|my_center|LOCUS_11950 40349 40780 gene locus_tag LOCUS_11960 40349 40780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 40796 41134 gene locus_tag LOCUS_11970 40796 41134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 42018 41194 gene locus_tag LOCUS_11980 42018 41194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 42188 44263 gene locus_tag LOCUS_11990 42188 44263 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852419.1 protein_id gnl|my_center|LOCUS_11990 44317 44862 gene locus_tag LOCUS_12000 44317 44862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 45651 44857 gene locus_tag LOCUS_12010 45651 44857 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002819467.1 protein_id gnl|my_center|LOCUS_12010 46589 45648 gene locus_tag LOCUS_12020 46589 45648 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_12020 47155 46601 gene locus_tag LOCUS_12030 47155 46601 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence13 559 44 gene locus_tag LOCUS_12040 559 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 930 811 gene locus_tag LOCUS_12050 930 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1209 958 gene locus_tag LOCUS_12060 1209 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1625 1284 gene locus_tag LOCUS_12070 1625 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4004 1647 gene locus_tag LOCUS_12080 4004 1647 CDS product paralyzed flagella protein PflA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851328.1 protein_id gnl|my_center|LOCUS_12080 5537 4029 gene locus_tag LOCUS_12090 gene nuoN 5537 4029 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904307.1 protein_id gnl|my_center|LOCUS_12090 7090 5537 gene locus_tag LOCUS_12100 7090 5537 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 protein_id gnl|my_center|LOCUS_12100 9016 7094 gene locus_tag LOCUS_12110 gene nuoL 9016 7094 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200192.1 protein_id gnl|my_center|LOCUS_12110 9328 9020 gene locus_tag LOCUS_12120 gene nuoK 9328 9020 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_12120 9903 9325 gene locus_tag LOCUS_12130 9903 9325 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464208.1 protein_id gnl|my_center|LOCUS_12130 10550 9915 gene locus_tag LOCUS_12140 gene nuoI 10550 9915 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851456.1 protein_id gnl|my_center|LOCUS_12140 11546 10560 gene locus_tag LOCUS_12150 gene nuoH 11546 10560 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277308.1 protein_id gnl|my_center|LOCUS_12150 14036 11550 gene locus_tag LOCUS_12160 14036 11550 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 protein_id gnl|my_center|LOCUS_12160 16288 14033 gene locus_tag LOCUS_12170 16288 14033 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 protein_id gnl|my_center|LOCUS_12170 18325 16292 gene locus_tag LOCUS_12180 18325 16292 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941178.1 protein_id gnl|my_center|LOCUS_12180 18561 18340 gene locus_tag LOCUS_12190 18561 18340 CDS product NADH-ubiquinone oxidoreductase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824979.1 protein_id gnl|my_center|LOCUS_12190 19894 18656 gene locus_tag LOCUS_12200 gene nuoD 19894 18656 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864417.1 protein_id gnl|my_center|LOCUS_12200 20709 19903 gene locus_tag LOCUS_12210 20709 19903 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864416.1 protein_id gnl|my_center|LOCUS_12210 21219 20710 gene locus_tag LOCUS_12220 21219 20710 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851253.1 protein_id gnl|my_center|LOCUS_12220 21629 21201 gene locus_tag LOCUS_12230 21629 21201 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183543.1 protein_id gnl|my_center|LOCUS_12230 22527 21919 gene locus_tag LOCUS_12240 22527 21919 CDS product DUF6448 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943772.1 protein_id gnl|my_center|LOCUS_12240 23150 22737 gene locus_tag LOCUS_12250 23150 22737 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569926.1 protein_id gnl|my_center|LOCUS_12250 23922 23173 gene locus_tag LOCUS_12260 23922 23173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 24241 24714 gene locus_tag LOCUS_12270 24241 24714 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814552.1 protein_id gnl|my_center|LOCUS_12270 25566 24814 gene locus_tag LOCUS_12280 25566 24814 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_12280 26855 25593 gene locus_tag LOCUS_12290 26855 25593 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_12290 27447 27004 gene locus_tag LOCUS_12300 27447 27004 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_12300 27802 27449 gene locus_tag LOCUS_12310 27802 27449 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978347.1 protein_id gnl|my_center|LOCUS_12310 29617 27881 gene locus_tag LOCUS_12320 29617 27881 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858720.1 protein_id gnl|my_center|LOCUS_12320 30774 29626 gene locus_tag LOCUS_12330 30774 29626 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_12330 31635 30790 gene locus_tag LOCUS_12340 gene nfo 31635 30790 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873890.1 protein_id gnl|my_center|LOCUS_12340 32101 31628 gene locus_tag LOCUS_12350 32101 31628 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858715.1 protein_id gnl|my_center|LOCUS_12350 32184 32987 gene locus_tag LOCUS_12360 32184 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 33410 33102 gene locus_tag LOCUS_12370 33410 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 33646 34917 gene locus_tag LOCUS_12380 33646 34917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 34930 35871 gene locus_tag LOCUS_12390 34930 35871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 36514 35864 gene locus_tag LOCUS_12400 36514 35864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 37706 36864 gene locus_tag LOCUS_12410 gene aguB 37706 36864 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464341.1 protein_id gnl|my_center|LOCUS_12410 38796 37720 gene locus_tag LOCUS_12420 38796 37720 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_12420 39282 38965 gene locus_tag LOCUS_12430 39282 38965 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 protein_id gnl|my_center|LOCUS_12430 40064 39279 gene locus_tag LOCUS_12440 gene amrB 40064 39279 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_12440 40670 40083 gene locus_tag LOCUS_12450 40670 40083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 41617 40745 gene locus_tag LOCUS_12460 41617 40745 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690042.1 protein_id gnl|my_center|LOCUS_12460 44063 41826 gene locus_tag LOCUS_12470 44063 41826 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966138.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence14 540 265 gene locus_tag LOCUS_12480 540 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 679 831 gene locus_tag LOCUS_12490 679 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1604 852 gene locus_tag LOCUS_12500 1604 852 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062678.1 protein_id gnl|my_center|LOCUS_12500 1700 1900 gene locus_tag LOCUS_12510 gene thiS 1700 1900 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831588.1 protein_id gnl|my_center|LOCUS_12510 2197 1868 gene locus_tag LOCUS_12520 gene acpS 2197 1868 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857939.1 protein_id gnl|my_center|LOCUS_12520 2800 2243 gene locus_tag LOCUS_12530 gene fliL 2800 2243 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797017.1 protein_id gnl|my_center|LOCUS_12530 3125 2868 gene locus_tag LOCUS_12540 3125 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4551 3205 gene locus_tag LOCUS_12550 gene radA 4551 3205 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858434.1 protein_id gnl|my_center|LOCUS_12550 5551 4673 gene locus_tag LOCUS_12560 gene ftsY 5551 4673 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864556.1 protein_id gnl|my_center|LOCUS_12560 6106 5552 gene locus_tag LOCUS_12570 6106 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 6161 6733 gene locus_tag LOCUS_12580 6161 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 6735 8303 gene locus_tag LOCUS_12590 gene rny 6735 8303 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 protein_id gnl|my_center|LOCUS_12590 9260 8367 gene locus_tag LOCUS_12600 9260 8367 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853697.1 protein_id gnl|my_center|LOCUS_12600 9361 10212 gene locus_tag LOCUS_12610 gene cmoB 9361 10212 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_12610 10209 10700 gene locus_tag LOCUS_12620 10209 10700 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868197.1 protein_id gnl|my_center|LOCUS_12620 11302 10709 gene locus_tag LOCUS_12630 11302 10709 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404680.1 protein_id gnl|my_center|LOCUS_12630 11431 12237 gene locus_tag LOCUS_12640 11431 12237 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932247.1 protein_id gnl|my_center|LOCUS_12640 12248 13369 gene locus_tag LOCUS_12650 gene pseC 12248 13369 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_12650 13474 14397 gene locus_tag LOCUS_12660 13474 14397 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833936.1 protein_id gnl|my_center|LOCUS_12660 14381 15232 gene locus_tag LOCUS_12670 gene argB 14381 15232 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_12670 16385 15243 gene locus_tag LOCUS_12680 16385 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 16483 16764 gene locus_tag LOCUS_12690 16483 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 16765 17178 gene locus_tag LOCUS_12700 16765 17178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 17192 18079 gene locus_tag LOCUS_12710 17192 18079 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_12710 18079 19377 gene locus_tag LOCUS_12720 gene hemA 18079 19377 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878972.1 protein_id gnl|my_center|LOCUS_12720 19378 20682 gene locus_tag LOCUS_12730 19378 20682 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389451.1 protein_id gnl|my_center|LOCUS_12730 20684 21112 gene locus_tag LOCUS_12740 20684 21112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 21066 21896 gene locus_tag LOCUS_12750 21066 21896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 21897 22838 gene locus_tag LOCUS_12760 gene hemC 21897 22838 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856753.1 protein_id gnl|my_center|LOCUS_12760 22841 24655 gene locus_tag LOCUS_12770 22841 24655 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204347.1 protein_id gnl|my_center|LOCUS_12770 24985 26364 gene locus_tag LOCUS_12780 gene argH 24985 26364 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891895.1 protein_id gnl|my_center|LOCUS_12780 26367 26831 gene locus_tag LOCUS_12790 26367 26831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 28016 26826 gene locus_tag LOCUS_12800 gene mltC 28016 26826 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 protein_id gnl|my_center|LOCUS_12800 28404 28048 gene locus_tag LOCUS_12810 28404 28048 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100349.1 protein_id gnl|my_center|LOCUS_12810 28528 29520 gene locus_tag LOCUS_12820 gene pheS 28528 29520 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 protein_id gnl|my_center|LOCUS_12820 29517 31853 gene locus_tag LOCUS_12830 gene pheT 29517 31853 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915726.1 protein_id gnl|my_center|LOCUS_12830 31850 33121 gene locus_tag LOCUS_12840 gene aroA 31850 33121 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852577.1 protein_id gnl|my_center|LOCUS_12840 33221 34048 gene locus_tag LOCUS_12850 33221 34048 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_12850 34199 35860 gene locus_tag LOCUS_12860 34199 35860 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852520.1 protein_id gnl|my_center|LOCUS_12860 35860 36339 gene locus_tag LOCUS_12870 35860 36339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 36339 37928 gene locus_tag LOCUS_12880 gene serA 36339 37928 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 protein_id gnl|my_center|LOCUS_12880 39735 38047 gene locus_tag LOCUS_12890 39735 38047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 41318 39735 gene locus_tag LOCUS_12900 41318 39735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 42006 41329 gene locus_tag LOCUS_12910 42006 41329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence15 1205 93 gene locus_tag LOCUS_12920 1205 93 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266687.1 protein_id gnl|my_center|LOCUS_12920 1319 2440 gene locus_tag LOCUS_12930 gene dnaJ 1319 2440 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853203.1 protein_id gnl|my_center|LOCUS_12930 2481 3071 gene locus_tag LOCUS_12940 2481 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4366 3068 gene locus_tag LOCUS_12950 4366 3068 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_12950 4710 4363 gene locus_tag LOCUS_12960 4710 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 4898 6361 gene locus_tag LOCUS_12970 4898 6361 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574070.1 protein_id gnl|my_center|LOCUS_12970 6363 7718 gene locus_tag LOCUS_12980 gene ftsA 6363 7718 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_12980 7730 8848 gene locus_tag LOCUS_12990 gene ftsZ 7730 8848 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 protein_id gnl|my_center|LOCUS_12990 9620 8991 gene locus_tag LOCUS_13000 gene nssR 9620 8991 CDS product nitrosative stress-sensitive transcriptional regulator NssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851096.1 protein_id gnl|my_center|LOCUS_13000 10618 9671 gene locus_tag LOCUS_13010 10618 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_13010 11287 10619 gene locus_tag LOCUS_13020 11287 10619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_13020 12459 11284 gene locus_tag LOCUS_13030 12459 11284 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_13030 12760 12449 gene locus_tag LOCUS_13040 12760 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 13844 12753 gene locus_tag LOCUS_13050 13844 12753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 14602 14123 gene locus_tag LOCUS_13060 14602 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 15436 14606 gene locus_tag LOCUS_13070 15436 14606 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176078.1 protein_id gnl|my_center|LOCUS_13070 16674 15418 gene locus_tag LOCUS_13080 16674 15418 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884428.1 protein_id gnl|my_center|LOCUS_13080 16747 17334 gene locus_tag LOCUS_13090 16747 17334 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071870.1 protein_id gnl|my_center|LOCUS_13090 17331 18092 gene locus_tag LOCUS_13100 17331 18092 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933543.1 protein_id gnl|my_center|LOCUS_13100 18145 18462 gene locus_tag LOCUS_13110 18145 18462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 18796 18506 gene locus_tag LOCUS_13120 18796 18506 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_13120 18987 19184 gene locus_tag LOCUS_13130 18987 19184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 20536 19181 gene locus_tag LOCUS_13140 20536 19181 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_13140 21922 20537 gene locus_tag LOCUS_13150 21922 20537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 22183 21923 gene locus_tag LOCUS_13160 22183 21923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 22415 22188 gene locus_tag LOCUS_13170 22415 22188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 23376 22486 gene locus_tag LOCUS_13180 23376 22486 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 protein_id gnl|my_center|LOCUS_13180 24067 23369 gene locus_tag LOCUS_13190 24067 23369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 25620 24067 gene locus_tag LOCUS_13200 25620 24067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 27050 25626 gene locus_tag LOCUS_13210 gene gatB 27050 25626 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 protein_id gnl|my_center|LOCUS_13210 27401 27138 gene locus_tag LOCUS_13220 27401 27138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 28088 27414 gene locus_tag LOCUS_13230 28088 27414 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858390.1 protein_id gnl|my_center|LOCUS_13230 29072 28167 gene locus_tag LOCUS_13240 gene truD 29072 28167 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052415.1 protein_id gnl|my_center|LOCUS_13240 30028 29207 gene locus_tag LOCUS_13250 30028 29207 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852206.1 protein_id gnl|my_center|LOCUS_13250 30362 30090 gene locus_tag LOCUS_13260 30362 30090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 31321 30509 gene locus_tag LOCUS_13270 31321 30509 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_13270 32124 31414 gene locus_tag LOCUS_13280 32124 31414 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852328.1 protein_id gnl|my_center|LOCUS_13280 34069 32111 gene locus_tag LOCUS_13290 gene ligA 34069 32111 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852062.1 protein_id gnl|my_center|LOCUS_13290 34314 35105 gene locus_tag LOCUS_13300 34314 35105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence16 2157 256 gene locus_tag LOCUS_13310 2157 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5391 2266 gene locus_tag LOCUS_13320 gene ccsA 5391 2266 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_13320 5744 5460 gene locus_tag LOCUS_13330 5744 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 6781 5798 gene locus_tag LOCUS_13340 gene flgS 6781 5798 CDS product acid survival sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748581.1 protein_id gnl|my_center|LOCUS_13340 8040 6781 gene locus_tag LOCUS_13350 8040 6781 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267127.1 protein_id gnl|my_center|LOCUS_13350 8409 8104 gene locus_tag LOCUS_13360 8409 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 9495 8455 gene locus_tag LOCUS_13370 9495 8455 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_13370 10535 9492 gene locus_tag LOCUS_13380 10535 9492 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_13380 12649 10610 gene locus_tag LOCUS_13390 12649 10610 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013856.1 protein_id gnl|my_center|LOCUS_13390 12950 12651 gene locus_tag LOCUS_13400 12950 12651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 13257 12940 gene locus_tag LOCUS_13410 13257 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 16919 13293 gene locus_tag LOCUS_13420 gene dnaE 16919 13293 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_13420 19584 17023 gene locus_tag LOCUS_13430 19584 17023 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 protein_id gnl|my_center|LOCUS_13430 20288 19722 gene locus_tag LOCUS_13440 gene efp 20288 19722 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974265.1 protein_id gnl|my_center|LOCUS_13440 20384 21508 gene locus_tag LOCUS_13450 gene tgt 20384 21508 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853029.1 protein_id gnl|my_center|LOCUS_13450 21885 21535 gene locus_tag LOCUS_13460 21885 21535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 22286 21930 gene locus_tag LOCUS_13470 22286 21930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 23070 22297 gene locus_tag LOCUS_13480 23070 22297 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_13480 23445 23137 gene locus_tag LOCUS_13490 23445 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 24693 23500 gene locus_tag LOCUS_13500 24693 23500 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864549.1 protein_id gnl|my_center|LOCUS_13500 24829 27042 gene locus_tag LOCUS_13510 24829 27042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 27190 27435 gene locus_tag LOCUS_13520 27190 27435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 27432 28487 gene locus_tag LOCUS_13530 gene lpxB 27432 28487 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142178.1 protein_id gnl|my_center|LOCUS_13530 28477 29568 gene locus_tag LOCUS_13540 gene wlbC 28477 29568 CDS product O-antigen biosynthesis protein WlbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807112.1 protein_id gnl|my_center|LOCUS_13540 29572 30480 gene locus_tag LOCUS_13550 29572 30480 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088659.1 protein_id gnl|my_center|LOCUS_13550 30480 31229 gene locus_tag LOCUS_13560 gene lpxA 30480 31229 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 protein_id gnl|my_center|LOCUS_13560 32389 31226 gene locus_tag LOCUS_13570 32389 31226 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966754.1 protein_id gnl|my_center|LOCUS_13570 33503 32382 gene locus_tag LOCUS_13580 33503 32382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence17 765 277 gene locus_tag LOCUS_13590 765 277 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964040.1 protein_id gnl|my_center|LOCUS_13590 1312 782 gene locus_tag LOCUS_13600 1312 782 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_13600 1441 1740 gene locus_tag LOCUS_13610 1441 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1776 2219 gene locus_tag LOCUS_13620 1776 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4216 2222 gene locus_tag LOCUS_13630 4216 2222 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_13630 5301 4216 gene locus_tag LOCUS_13640 gene mtnA 5301 4216 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083782.1 protein_id gnl|my_center|LOCUS_13640 6517 5291 gene locus_tag LOCUS_13650 gene mtnK 6517 5291 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087665.1 protein_id gnl|my_center|LOCUS_13650 6666 6914 gene locus_tag LOCUS_13660 6666 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7600 6911 gene locus_tag LOCUS_13670 7600 6911 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_13670 7896 7603 gene locus_tag LOCUS_13680 7896 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 8054 7893 gene locus_tag LOCUS_13690 8054 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8456 8055 gene locus_tag LOCUS_13700 8456 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 9464 8466 gene locus_tag LOCUS_13710 9464 8466 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_13710 9606 10175 gene locus_tag LOCUS_13720 9606 10175 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_13720 10172 10549 gene locus_tag LOCUS_13730 10172 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 11817 10591 gene locus_tag LOCUS_13740 11817 10591 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256133.1 protein_id gnl|my_center|LOCUS_13740 12725 11820 gene locus_tag LOCUS_13750 12725 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 13387 13004 gene locus_tag LOCUS_13760 13387 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 13508 13702 gene locus_tag LOCUS_13770 13508 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13900 14226 gene locus_tag LOCUS_13780 13900 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14265 14951 gene locus_tag LOCUS_13790 14265 14951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 14941 16365 gene locus_tag LOCUS_13800 gene norB 14941 16365 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_13800 16377 16538 gene locus_tag LOCUS_13810 16377 16538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 16603 18246 gene locus_tag LOCUS_13820 gene nirN 16603 18246 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_13820 18446 18751 gene locus_tag LOCUS_13830 18446 18751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 18752 19891 gene locus_tag LOCUS_13840 gene nirJ 18752 19891 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113242.1 protein_id gnl|my_center|LOCUS_13840 19960 21099 gene locus_tag LOCUS_13850 19960 21099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 21096 21836 gene locus_tag LOCUS_13860 21096 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 21829 23355 gene locus_tag LOCUS_13870 21829 23355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 23345 24034 gene locus_tag LOCUS_13880 23345 24034 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_13880 24739 24038 gene locus_tag LOCUS_13890 24739 24038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 26149 24821 gene locus_tag LOCUS_13900 gene mgtE 26149 24821 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_13900 26715 26191 gene locus_tag LOCUS_13910 26715 26191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 27673 26765 gene locus_tag LOCUS_13920 27673 26765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 29211 27670 gene locus_tag LOCUS_13930 29211 27670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 29818 29195 gene locus_tag LOCUS_13940 29818 29195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_13940 30888 29815 gene locus_tag LOCUS_13950 30888 29815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_13950 31355 30885 gene locus_tag LOCUS_13960 31355 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 32145 31399 gene locus_tag LOCUS_13970 32145 31399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 32811 32158 gene locus_tag LOCUS_13980 32811 32158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence18 185 1348 gene locus_tag LOCUS_13990 185 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1348 1728 gene locus_tag LOCUS_14000 1348 1728 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_14000 2922 1711 gene locus_tag LOCUS_14010 2922 1711 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145994.1 protein_id gnl|my_center|LOCUS_14010 3575 2919 gene locus_tag LOCUS_14020 3575 2919 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931900.1 protein_id gnl|my_center|LOCUS_14020 3686 5263 gene locus_tag LOCUS_14030 3686 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5721 5335 gene locus_tag LOCUS_14040 5721 5335 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870246.1 protein_id gnl|my_center|LOCUS_14040 5902 7923 gene locus_tag LOCUS_14050 gene glyS 5902 7923 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858294.1 protein_id gnl|my_center|LOCUS_14050 9440 7920 gene locus_tag LOCUS_14060 9440 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 10768 9704 gene locus_tag LOCUS_14070 10768 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 11522 10785 gene locus_tag LOCUS_14080 11522 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 11581 12327 gene locus_tag LOCUS_14090 gene elyC 11581 12327 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422543.1 protein_id gnl|my_center|LOCUS_14090 12419 14236 gene locus_tag LOCUS_14100 12419 14236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 14707 14246 gene locus_tag LOCUS_14110 14707 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 15386 14754 gene locus_tag LOCUS_14120 gene truA 15386 14754 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852636.1 protein_id gnl|my_center|LOCUS_14120 16484 15465 gene locus_tag LOCUS_14130 16484 15465 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589921.1 protein_id gnl|my_center|LOCUS_14130 17299 16484 gene locus_tag LOCUS_14140 17299 16484 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_14140 17886 17299 gene locus_tag LOCUS_14150 17886 17299 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_14150 19241 17973 gene locus_tag LOCUS_14160 gene coaBC 19241 17973 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009984.1 protein_id gnl|my_center|LOCUS_14160 19410 22106 gene locus_tag LOCUS_14170 19410 22106 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331957.1 protein_id gnl|my_center|LOCUS_14170 22371 22096 gene locus_tag LOCUS_14180 22371 22096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 22493 23056 gene locus_tag LOCUS_14190 gene yqiA 22493 23056 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457154.1 protein_id gnl|my_center|LOCUS_14190 23058 23975 gene locus_tag LOCUS_14200 23058 23975 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_14200 24114 24674 gene locus_tag LOCUS_14210 24114 24674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 25024 24806 gene locus_tag LOCUS_14220 25024 24806 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558414.1 protein_id gnl|my_center|LOCUS_14220 25330 26361 gene locus_tag LOCUS_14230 gene selD 25330 26361 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169286.1 protein_id gnl|my_center|LOCUS_14230 26362 27450 gene locus_tag LOCUS_14240 gene mnmH 26362 27450 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266576.1 protein_id gnl|my_center|LOCUS_14240 28627 27443 gene locus_tag LOCUS_14250 28627 27443 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_14250 29123 28671 gene locus_tag LOCUS_14260 29123 28671 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_14260 29333 29962 gene locus_tag LOCUS_14270 29333 29962 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243096.1 protein_id gnl|my_center|LOCUS_14270 30690 29959 gene locus_tag LOCUS_14280 30690 29959 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022781.1 protein_id gnl|my_center|LOCUS_14280 32043 30706 gene locus_tag LOCUS_14290 gene cls 32043 30706 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016286.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence19 427 1185 gene locus_tag LOCUS_14300 427 1185 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_14300 2345 1161 gene locus_tag LOCUS_14310 2345 1161 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_14310 2455 2892 gene locus_tag LOCUS_14320 2455 2892 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_14320 2893 4095 gene locus_tag LOCUS_14330 gene ilvA 2893 4095 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_14330 4103 6229 gene locus_tag LOCUS_14340 4103 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 6309 8006 gene locus_tag LOCUS_14350 6309 8006 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852093.1 protein_id gnl|my_center|LOCUS_14350 8006 8482 gene locus_tag LOCUS_14360 gene ilvN 8006 8482 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852211.1 protein_id gnl|my_center|LOCUS_14360 8486 9436 gene locus_tag LOCUS_14370 gene lpxD 8486 9436 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852180.1 protein_id gnl|my_center|LOCUS_14370 9445 10398 gene locus_tag LOCUS_14380 gene lpxD 9445 10398 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852180.1 protein_id gnl|my_center|LOCUS_14380 10418 10621 gene locus_tag LOCUS_14390 10418 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 10646 12340 gene locus_tag LOCUS_14400 10646 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 12442 14982 gene locus_tag LOCUS_14410 12442 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 15131 15724 gene locus_tag LOCUS_14420 15131 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 15714 17795 gene locus_tag LOCUS_14430 15714 17795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 17792 18337 gene locus_tag LOCUS_14440 17792 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 18396 20384 gene locus_tag LOCUS_14450 18396 20384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 21246 20371 gene locus_tag LOCUS_14460 21246 20371 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_14460 22745 21249 gene locus_tag LOCUS_14470 22745 21249 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_14470 24075 22906 gene locus_tag LOCUS_14480 24075 22906 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967300.1 protein_id gnl|my_center|LOCUS_14480 24954 24253 gene locus_tag LOCUS_14490 gene cysE 24954 24253 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852612.1 protein_id gnl|my_center|LOCUS_14490 26793 24964 gene locus_tag LOCUS_14500 gene speA 26793 24964 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891885.1 protein_id gnl|my_center|LOCUS_14500 28530 26803 gene locus_tag LOCUS_14510 28530 26803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 29741 28530 gene locus_tag LOCUS_14520 gene hisS 29741 28530 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 protein_id gnl|my_center|LOCUS_14520 29855 30784 gene locus_tag LOCUS_14530 29855 30784 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943923.1 protein_id gnl|my_center|LOCUS_14530 30924 31118 gene locus_tag LOCUS_14540 30924 31118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14540 31115 31366 gene locus_tag LOCUS_14550 31115 31366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14550 >Feature sequence20 1295 141 gene locus_tag LOCUS_14560 gene wecB 1295 141 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767232.1 protein_id gnl|my_center|LOCUS_14560 2355 1297 gene locus_tag LOCUS_14570 2355 1297 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_14570 3576 2368 gene locus_tag LOCUS_14580 3576 2368 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_14580 3914 3573 gene locus_tag LOCUS_14590 3914 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4349 4065 gene locus_tag LOCUS_14600 4349 4065 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948599.1 protein_id gnl|my_center|LOCUS_14600 4579 4352 gene locus_tag LOCUS_14610 4579 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14610 4900 4824 gene locus_tag LOCUS_t00250 4900 4824 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7956 4945 gene locus_tag LOCUS_14620 7956 4945 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_14620 8367 8089 gene locus_tag LOCUS_14630 8367 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9293 8367 gene locus_tag LOCUS_14640 gene rsmH 9293 8367 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155571.1 protein_id gnl|my_center|LOCUS_14640 9384 10436 gene locus_tag LOCUS_14650 9384 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 10815 10513 gene locus_tag LOCUS_14660 10815 10513 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990295.1 protein_id gnl|my_center|LOCUS_14660 11994 10960 gene locus_tag LOCUS_14670 11994 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 12545 12204 gene locus_tag LOCUS_14680 12545 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 13865 12633 gene locus_tag LOCUS_14690 13865 12633 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_14690 13942 14703 gene locus_tag LOCUS_14700 gene proC 13942 14703 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228245.1 protein_id gnl|my_center|LOCUS_14700 15629 14745 gene locus_tag LOCUS_14710 15629 14745 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881171.1 protein_id gnl|my_center|LOCUS_14710 17265 15793 gene locus_tag LOCUS_14720 gene thrC 17265 15793 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117321.1 protein_id gnl|my_center|LOCUS_14720 18546 17323 gene locus_tag LOCUS_14730 18546 17323 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 protein_id gnl|my_center|LOCUS_14730 19355 18543 gene locus_tag LOCUS_14740 19355 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 20013 19342 gene locus_tag LOCUS_14750 20013 19342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 protein_id gnl|my_center|LOCUS_14750 21178 20006 gene locus_tag LOCUS_14760 gene trmB 21178 20006 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858203.1 protein_id gnl|my_center|LOCUS_14760 22605 21193 gene locus_tag LOCUS_14770 22605 21193 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108527784.1 protein_id gnl|my_center|LOCUS_14770 23524 22553 gene locus_tag LOCUS_14780 23524 22553 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174316.1 protein_id gnl|my_center|LOCUS_14780 23574 24686 gene locus_tag LOCUS_14790 23574 24686 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 protein_id gnl|my_center|LOCUS_14790 24719 25174 gene locus_tag LOCUS_14800 24719 25174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 25268 25192 gene locus_tag LOCUS_t00260 25268 25192 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 25437 25362 gene locus_tag LOCUS_t00270 25437 25362 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25665 25590 gene locus_tag LOCUS_t00280 25665 25590 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 25862 25787 gene locus_tag LOCUS_t00290 25862 25787 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26031 25955 gene locus_tag LOCUS_t00300 26031 25955 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 26119 26044 gene locus_tag LOCUS_t00310 26119 26044 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 27282 26194 gene locus_tag LOCUS_14810 27282 26194 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853490.1 protein_id gnl|my_center|LOCUS_14810 27417 30176 gene locus_tag LOCUS_14820 gene ileS 27417 30176 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907389.1 protein_id gnl|my_center|LOCUS_14820 30245 30673 gene locus_tag LOCUS_14830 30245 30673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 30654 30896 gene locus_tag LOCUS_14840 30654 30896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence21 321 76 gene locus_tag LOCUS_14850 321 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1985 516 gene locus_tag LOCUS_14860 1985 516 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_14860 2482 1982 gene locus_tag LOCUS_14870 2482 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 7065 2479 gene locus_tag LOCUS_14880 7065 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 9722 7062 gene locus_tag LOCUS_14890 9722 7062 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244282.1 protein_id gnl|my_center|LOCUS_14890 12134 9855 gene locus_tag LOCUS_14900 gene metE 12134 9855 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_14900 14321 12546 gene locus_tag LOCUS_14910 gene dsbD 14321 12546 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_14910 15353 14406 gene locus_tag LOCUS_14920 15353 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 15750 15355 gene locus_tag LOCUS_14930 15750 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 16832 15981 gene locus_tag LOCUS_14940 16832 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 16965 18899 gene locus_tag LOCUS_14950 16965 18899 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_14950 19019 19810 gene locus_tag LOCUS_14960 19019 19810 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_14960 19807 20736 gene locus_tag LOCUS_14970 gene pdxA 19807 20736 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075036.1 protein_id gnl|my_center|LOCUS_14970 21519 20887 gene locus_tag LOCUS_14980 21519 20887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 22217 21567 gene locus_tag LOCUS_14990 22217 21567 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_14990 22315 23394 gene locus_tag LOCUS_15000 22315 23394 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908758.1 protein_id gnl|my_center|LOCUS_15000 24406 23522 gene locus_tag LOCUS_15010 24406 23522 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_15010 24509 27310 gene locus_tag LOCUS_15020 24509 27310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 27300 28418 gene locus_tag LOCUS_15030 27300 28418 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_15030 28406 29086 gene locus_tag LOCUS_15040 gene ycbL 28406 29086 CDS product two-component system response regulator YcbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966453.1 protein_id gnl|my_center|LOCUS_15040 29771 29073 gene locus_tag LOCUS_15050 29771 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 30397 29771 gene locus_tag LOCUS_15060 gene hisG 30397 29771 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence22 152 673 gene locus_tag LOCUS_15070 152 673 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 protein_id gnl|my_center|LOCUS_15070 666 1556 gene locus_tag LOCUS_15080 666 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1784 2161 gene locus_tag LOCUS_15090 1784 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2161 2829 gene locus_tag LOCUS_15100 gene arsR 2161 2829 CDS product acid response regulator transcription factor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573710.1 protein_id gnl|my_center|LOCUS_15100 2833 4047 gene locus_tag LOCUS_15110 2833 4047 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857920.1 protein_id gnl|my_center|LOCUS_15110 4674 4054 gene locus_tag LOCUS_15120 gene recO 4674 4054 CDS product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 protein_id gnl|my_center|LOCUS_15120 4854 9293 gene locus_tag LOCUS_15130 gene gltB 4854 9293 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461215.1 protein_id gnl|my_center|LOCUS_15130 9296 10681 gene locus_tag LOCUS_15140 9296 10681 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461217.1 protein_id gnl|my_center|LOCUS_15140 10806 11651 gene locus_tag LOCUS_15150 gene accD 10806 11651 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 protein_id gnl|my_center|LOCUS_15150 11651 12211 gene locus_tag LOCUS_15160 11651 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 12211 12669 gene locus_tag LOCUS_15170 12211 12669 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869860.1 protein_id gnl|my_center|LOCUS_15170 12679 13029 gene locus_tag LOCUS_15180 gene dksA 12679 13029 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_15180 13040 14056 gene locus_tag LOCUS_15190 13040 14056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 14064 15017 gene locus_tag LOCUS_15200 14064 15017 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851926.1 protein_id gnl|my_center|LOCUS_15200 15011 16153 gene locus_tag LOCUS_15210 15011 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 17031 16150 gene locus_tag LOCUS_15220 17031 16150 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889661.1 protein_id gnl|my_center|LOCUS_15220 17366 17028 gene locus_tag LOCUS_15230 gene fliN 17366 17028 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824739.1 protein_id gnl|my_center|LOCUS_15230 17789 17367 gene locus_tag LOCUS_15240 17789 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 17887 18627 gene locus_tag LOCUS_15250 17887 18627 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858695.1 protein_id gnl|my_center|LOCUS_15250 18634 21471 gene locus_tag LOCUS_15260 gene uvrA 18634 21471 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858721.1 protein_id gnl|my_center|LOCUS_15260 21534 22691 gene locus_tag LOCUS_15270 21534 22691 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289438.1 protein_id gnl|my_center|LOCUS_15270 22714 24210 gene locus_tag LOCUS_15280 22714 24210 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_15280 24315 25244 gene locus_tag LOCUS_15290 gene cysK 24315 25244 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_15290 27706 25337 gene locus_tag LOCUS_15300 27706 25337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 28811 27693 gene locus_tag LOCUS_15310 28811 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence23 259 1017 gene locus_tag LOCUS_15320 gene hisF 259 1017 CDS product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880108.1 protein_id gnl|my_center|LOCUS_15320 1028 1573 gene locus_tag LOCUS_15330 1028 1573 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853142.1 protein_id gnl|my_center|LOCUS_15330 1570 2640 gene locus_tag LOCUS_15340 gene rlmN 1570 2640 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_15340 4070 3159 gene locus_tag LOCUS_15350 4070 3159 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_15350 4172 5500 gene locus_tag LOCUS_15360 gene purB 4172 5500 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865088.1 protein_id gnl|my_center|LOCUS_15360 5603 7969 gene locus_tag LOCUS_15370 5603 7969 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865087.1 protein_id gnl|my_center|LOCUS_15370 7983 8348 gene locus_tag LOCUS_15380 7983 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 8507 9892 gene locus_tag LOCUS_15390 gene htrA 8507 9892 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853235.1 protein_id gnl|my_center|LOCUS_15390 10183 11463 gene locus_tag LOCUS_15400 10183 11463 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851494.1 protein_id gnl|my_center|LOCUS_15400 11789 11478 gene locus_tag LOCUS_15410 11789 11478 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_15410 12885 11920 gene locus_tag LOCUS_15420 12885 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 13440 12961 gene locus_tag LOCUS_15430 gene ruvC 13440 12961 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 protein_id gnl|my_center|LOCUS_15430 13548 14858 gene locus_tag LOCUS_15440 gene dnaA 13548 14858 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 protein_id gnl|my_center|LOCUS_15440 15025 16092 gene locus_tag LOCUS_15450 gene dnaN 15025 16092 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_15450 16323 18632 gene locus_tag LOCUS_15460 gene gyrB 16323 18632 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858833.1 protein_id gnl|my_center|LOCUS_15460 18658 20073 gene locus_tag LOCUS_15470 18658 20073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 20075 20452 gene locus_tag LOCUS_15480 gene queF 20075 20452 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 protein_id gnl|my_center|LOCUS_15480 21772 20522 gene locus_tag LOCUS_15490 21772 20522 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868507.1 protein_id gnl|my_center|LOCUS_15490 21912 23714 gene locus_tag LOCUS_15500 gene typA 21912 23714 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_15500 23831 24085 gene locus_tag LOCUS_15510 23831 24085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 25024 24095 gene locus_tag LOCUS_15520 25024 24095 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_15520 25180 26202 gene locus_tag LOCUS_15530 25180 26202 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453999.1 protein_id gnl|my_center|LOCUS_15530 26189 26929 gene locus_tag LOCUS_15540 26189 26929 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880005.1 protein_id gnl|my_center|LOCUS_15540 26922 27560 gene locus_tag LOCUS_15550 gene pcm 26922 27560 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084597.1 protein_id gnl|my_center|LOCUS_15550 27611 28444 gene locus_tag LOCUS_15560 gene thyX 27611 28444 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853111.1 protein_id gnl|my_center|LOCUS_15560 28449 28664 gene locus_tag LOCUS_15570 28449 28664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence24 203 1795 gene locus_tag LOCUS_15580 203 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2387 1833 gene locus_tag LOCUS_15590 2387 1833 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_15590 3548 2400 gene locus_tag LOCUS_15600 gene nspC 3548 2400 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858431.1 protein_id gnl|my_center|LOCUS_15600 4736 3552 gene locus_tag LOCUS_15610 4736 3552 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852026.1 protein_id gnl|my_center|LOCUS_15610 6645 4831 gene locus_tag LOCUS_15620 6645 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7391 6660 gene locus_tag LOCUS_15630 7391 6660 CDS product DUF695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016290.1 protein_id gnl|my_center|LOCUS_15630 8409 7381 gene locus_tag LOCUS_15640 8409 7381 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601458.1 protein_id gnl|my_center|LOCUS_15640 8566 8642 gene locus_tag LOCUS_t00320 8566 8642 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8663 8737 gene locus_tag LOCUS_t00330 8663 8737 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8762 8838 gene locus_tag LOCUS_t00340 8762 8838 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9562 9233 gene locus_tag LOCUS_15650 9562 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 9996 9586 gene locus_tag LOCUS_15660 9996 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 11974 10430 gene locus_tag LOCUS_15670 11974 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 15155 11988 gene locus_tag LOCUS_15680 15155 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 15718 15368 gene locus_tag LOCUS_15690 15718 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 15954 15715 gene locus_tag LOCUS_15700 15954 15715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 16735 15956 gene locus_tag LOCUS_15710 16735 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 17289 16732 gene locus_tag LOCUS_15720 17289 16732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 17536 17279 gene locus_tag LOCUS_15730 17536 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 17724 17521 gene locus_tag LOCUS_15740 17724 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 20091 17737 gene locus_tag LOCUS_15750 20091 17737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 20737 20072 gene locus_tag LOCUS_15760 20737 20072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 20955 20734 gene locus_tag LOCUS_15770 20955 20734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 22057 21236 gene locus_tag LOCUS_15780 22057 21236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 22365 22081 gene locus_tag LOCUS_15790 22365 22081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 22367 22969 gene locus_tag LOCUS_15800 22367 22969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 23823 23020 gene locus_tag LOCUS_15810 23823 23020 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455823.1 protein_id gnl|my_center|LOCUS_15810 24013 23792 gene locus_tag LOCUS_15820 24013 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 25135 24053 gene locus_tag LOCUS_15830 25135 24053 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939045.1 protein_id gnl|my_center|LOCUS_15830 26395 25358 gene locus_tag LOCUS_15840 26395 25358 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_15840 27759 26422 gene locus_tag LOCUS_15850 gene mgtE 27759 26422 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_15850 28212 27775 gene locus_tag LOCUS_15860 gene rimI 28212 27775 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727751.1 protein_id gnl|my_center|LOCUS_15860 28484 28212 gene locus_tag LOCUS_15870 28484 28212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence25 172 318 gene locus_tag LOCUS_15880 172 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 346 531 gene locus_tag LOCUS_15890 346 531 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933349.1 protein_id gnl|my_center|LOCUS_15890 917 666 gene locus_tag LOCUS_15900 917 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1287 907 gene locus_tag LOCUS_15910 1287 907 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681772.1 protein_id gnl|my_center|LOCUS_15910 1634 1287 gene locus_tag LOCUS_15920 1634 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2887 1691 gene locus_tag LOCUS_15930 2887 1691 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_15930 3257 2895 gene locus_tag LOCUS_15940 3257 2895 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261207.1 protein_id gnl|my_center|LOCUS_15940 3951 3235 gene locus_tag LOCUS_15950 3951 3235 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768589.1 protein_id gnl|my_center|LOCUS_15950 5542 3932 gene locus_tag LOCUS_15960 5542 3932 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 protein_id gnl|my_center|LOCUS_15960 7482 5554 gene locus_tag LOCUS_15970 7482 5554 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105914.1 protein_id gnl|my_center|LOCUS_15970 9858 7639 gene locus_tag LOCUS_15980 9858 7639 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 protein_id gnl|my_center|LOCUS_15980 10178 9849 gene locus_tag LOCUS_15990 10178 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 11491 10178 gene locus_tag LOCUS_16000 gene murC 11491 10178 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894779.1 protein_id gnl|my_center|LOCUS_16000 12000 11488 gene locus_tag LOCUS_16010 12000 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 13133 11997 gene locus_tag LOCUS_16020 13133 11997 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142409.1 protein_id gnl|my_center|LOCUS_16020 13912 13241 gene locus_tag LOCUS_16030 13912 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 14815 14000 gene locus_tag LOCUS_16040 14815 14000 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853489.1 protein_id gnl|my_center|LOCUS_16040 15134 14868 gene locus_tag LOCUS_16050 15134 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 16233 15127 gene locus_tag LOCUS_16060 16233 15127 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_16060 17500 16235 gene locus_tag LOCUS_16070 17500 16235 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853122.1 protein_id gnl|my_center|LOCUS_16070 17965 17579 gene locus_tag LOCUS_16080 17965 17579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_16080 18609 18124 gene locus_tag LOCUS_16090 18609 18124 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_16090 20072 18627 gene locus_tag LOCUS_16100 gene guaB 20072 18627 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852968.1 protein_id gnl|my_center|LOCUS_16100 20462 20178 gene locus_tag LOCUS_16110 20462 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 21834 20491 gene locus_tag LOCUS_16120 gene gatA 21834 20491 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631468.1 protein_id gnl|my_center|LOCUS_16120 22337 24463 gene locus_tag LOCUS_16130 22337 24463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 24456 26726 gene locus_tag LOCUS_16140 24456 26726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 27495 26713 gene locus_tag LOCUS_16150 27495 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence26 549 250 gene locus_tag LOCUS_16160 549 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 736 1449 gene locus_tag LOCUS_16170 736 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1711 1469 gene locus_tag LOCUS_16180 1711 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1898 2209 gene locus_tag LOCUS_16190 1898 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2202 2603 gene locus_tag LOCUS_16200 2202 2603 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_16200 2689 3858 gene locus_tag LOCUS_16210 2689 3858 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_16210 3925 4773 gene locus_tag LOCUS_16220 3925 4773 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_16220 4775 4981 gene locus_tag LOCUS_16230 4775 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5000 5686 gene locus_tag LOCUS_16240 5000 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 5777 6079 gene locus_tag LOCUS_16250 5777 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 6088 6819 gene locus_tag LOCUS_16260 6088 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 7077 6859 gene locus_tag LOCUS_16270 gene infA 7077 6859 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781436.1 protein_id gnl|my_center|LOCUS_16270 7852 7094 gene locus_tag LOCUS_16280 gene map 7852 7094 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018129.1 protein_id gnl|my_center|LOCUS_16280 9118 7856 gene locus_tag LOCUS_16290 gene secY 9118 7856 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864789.1 protein_id gnl|my_center|LOCUS_16290 9519 9121 gene locus_tag LOCUS_16300 gene rplO 9519 9121 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851292.1 protein_id gnl|my_center|LOCUS_16300 9963 9523 gene locus_tag LOCUS_16310 gene rpsE 9963 9523 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001860543.1 protein_id gnl|my_center|LOCUS_16310 10328 9972 gene locus_tag LOCUS_16320 gene rplR 10328 9972 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851411.1 protein_id gnl|my_center|LOCUS_16320 10878 10342 gene locus_tag LOCUS_16330 gene rplF 10878 10342 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_16330 11286 10891 gene locus_tag LOCUS_16340 gene rpsH 11286 10891 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851353.1 protein_id gnl|my_center|LOCUS_16340 11518 11333 gene locus_tag LOCUS_16350 11518 11333 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851478.1 protein_id gnl|my_center|LOCUS_16350 12063 11518 gene locus_tag LOCUS_16360 gene rplE 12063 11518 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851453.1 protein_id gnl|my_center|LOCUS_16360 12296 12066 gene locus_tag LOCUS_16370 12296 12066 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779437.1 protein_id gnl|my_center|LOCUS_16370 12664 12296 gene locus_tag LOCUS_16380 gene rplN 12664 12296 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_16380 12912 12664 gene locus_tag LOCUS_16390 gene rpsQ 12912 12664 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851549.1 protein_id gnl|my_center|LOCUS_16390 13107 12922 gene locus_tag LOCUS_16400 gene rpmC 13107 12922 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851566.1 protein_id gnl|my_center|LOCUS_16400 13519 13094 gene locus_tag LOCUS_16410 gene rplP 13519 13094 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779441.1 protein_id gnl|my_center|LOCUS_16410 14247 13522 gene locus_tag LOCUS_16420 gene rpsC 14247 13522 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851138.1 protein_id gnl|my_center|LOCUS_16420 14566 14249 gene locus_tag LOCUS_16430 14566 14249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 14844 14569 gene locus_tag LOCUS_16440 gene rpsS 14844 14569 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_16440 15688 14849 gene locus_tag LOCUS_16450 gene rplB 15688 14849 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 protein_id gnl|my_center|LOCUS_16450 15971 15690 gene locus_tag LOCUS_16460 15971 15690 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851441.1 protein_id gnl|my_center|LOCUS_16460 16586 15972 gene locus_tag LOCUS_16470 gene rplD 16586 15972 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 protein_id gnl|my_center|LOCUS_16470 17161 16586 gene locus_tag LOCUS_16480 gene rplC 17161 16586 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_16480 17482 17171 gene locus_tag LOCUS_16490 gene rpsJ 17482 17171 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_16490 17756 18754 gene locus_tag LOCUS_16500 17756 18754 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611585.1 protein_id gnl|my_center|LOCUS_16500 18813 19358 gene locus_tag LOCUS_16510 18813 19358 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853153.1 protein_id gnl|my_center|LOCUS_16510 20566 19355 gene locus_tag LOCUS_16520 20566 19355 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_16520 21143 20706 gene locus_tag LOCUS_16530 21143 20706 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 protein_id gnl|my_center|LOCUS_16530 21368 21147 gene locus_tag LOCUS_16540 21368 21147 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_16540 21471 22124 gene locus_tag LOCUS_16550 21471 22124 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210707.1 protein_id gnl|my_center|LOCUS_16550 24956 22131 gene locus_tag LOCUS_16560 24956 22131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 25478 26683 gene locus_tag LOCUS_16570 25478 26683 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_16570 26693 27115 gene locus_tag LOCUS_16580 26693 27115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence27 478 212 gene locus_tag LOCUS_16590 478 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 740 540 gene locus_tag LOCUS_16600 740 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2265 1171 gene locus_tag LOCUS_16610 2265 1171 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533675.1 protein_id gnl|my_center|LOCUS_16610 2494 2419 gene locus_tag LOCUS_t00350 2494 2419 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2654 4240 gene locus_tag LOCUS_16620 gene pckA 2654 4240 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 protein_id gnl|my_center|LOCUS_16620 4863 4300 gene locus_tag LOCUS_16630 4863 4300 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856055.1 protein_id gnl|my_center|LOCUS_16630 6852 4879 gene locus_tag LOCUS_16640 gene uvrB 6852 4879 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855027.1 protein_id gnl|my_center|LOCUS_16640 7653 6916 gene locus_tag LOCUS_16650 7653 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 8512 7640 gene locus_tag LOCUS_16660 8512 7640 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_16660 8673 8804 gene locus_tag LOCUS_16670 8673 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 9666 8881 gene locus_tag LOCUS_16680 9666 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 11115 9676 gene locus_tag LOCUS_16690 11115 9676 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218141.1 protein_id gnl|my_center|LOCUS_16690 12181 11147 gene locus_tag LOCUS_16700 12181 11147 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 protein_id gnl|my_center|LOCUS_16700 13113 12181 gene locus_tag LOCUS_16710 gene rimK 13113 12181 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_16710 13553 13131 gene locus_tag LOCUS_16720 13553 13131 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_16720 14510 13731 gene locus_tag LOCUS_16730 gene proB 14510 13731 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851769.1 protein_id gnl|my_center|LOCUS_16730 14740 14967 gene locus_tag LOCUS_16740 14740 14967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 14972 15190 gene locus_tag LOCUS_16750 14972 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 15256 15332 gene locus_tag LOCUS_t00360 15256 15332 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15805 15972 gene locus_tag LOCUS_16760 15805 15972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 16889 16194 gene locus_tag LOCUS_16770 16889 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 17170 17367 gene locus_tag LOCUS_16780 17170 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 17435 18097 gene locus_tag LOCUS_16790 17435 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 18090 18554 gene locus_tag LOCUS_16800 18090 18554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 18556 19035 gene locus_tag LOCUS_16810 18556 19035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 19038 19865 gene locus_tag LOCUS_16820 19038 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 21095 19884 gene locus_tag LOCUS_16830 21095 19884 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_16830 21406 21092 gene locus_tag LOCUS_16840 21406 21092 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894809.1 protein_id gnl|my_center|LOCUS_16840 22017 22805 gene locus_tag LOCUS_16850 22017 22805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942763.1 protein_id gnl|my_center|LOCUS_16850 23105 22845 gene locus_tag LOCUS_16860 23105 22845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 23689 23105 gene locus_tag LOCUS_16870 23689 23105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 23959 25200 gene locus_tag LOCUS_16880 23959 25200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 25600 25253 gene locus_tag LOCUS_16890 25600 25253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 25947 25597 gene locus_tag LOCUS_16900 25947 25597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence28 1417 950 gene locus_tag LOCUS_16910 1417 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2648 1602 gene locus_tag LOCUS_16920 2648 1602 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929220.1 protein_id gnl|my_center|LOCUS_16920 6286 2699 gene locus_tag LOCUS_16930 6286 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 7758 6325 gene locus_tag LOCUS_16940 gene ccoG 7758 6325 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_16940 7997 11488 gene locus_tag LOCUS_16950 gene metH 7997 11488 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_16950 13032 11524 gene locus_tag LOCUS_16960 13032 11524 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611139.1 protein_id gnl|my_center|LOCUS_16960 13693 13166 gene locus_tag LOCUS_16970 gene def 13693 13166 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185845.1 protein_id gnl|my_center|LOCUS_16970 14760 13711 gene locus_tag LOCUS_16980 14760 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 15369 14779 gene locus_tag LOCUS_16990 gene clpP 15369 14779 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001853304.1 protein_id gnl|my_center|LOCUS_16990 16675 15374 gene locus_tag LOCUS_17000 gene tig 16675 15374 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 protein_id gnl|my_center|LOCUS_17000 17203 16748 gene locus_tag LOCUS_17010 gene lspA 17203 16748 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921378.1 protein_id gnl|my_center|LOCUS_17010 18536 17196 gene locus_tag LOCUS_17020 gene glmM 18536 17196 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860288.1 protein_id gnl|my_center|LOCUS_17020 18680 18940 gene locus_tag LOCUS_17030 gene rpsT 18680 18940 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_17030 18955 20022 gene locus_tag LOCUS_17040 gene prfA 18955 20022 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851189.1 protein_id gnl|my_center|LOCUS_17040 20817 20053 gene locus_tag LOCUS_17050 gene dapF 20817 20053 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_17050 21416 20814 gene locus_tag LOCUS_17060 gene coaE 21416 20814 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 protein_id gnl|my_center|LOCUS_17060 21961 21416 gene locus_tag LOCUS_17070 21961 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 22309 22172 gene locus_tag LOCUS_17080 22309 22172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 22299 23528 gene locus_tag LOCUS_17090 22299 23528 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880096.1 protein_id gnl|my_center|LOCUS_17090 23541 23723 gene locus_tag LOCUS_17100 23541 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 23821 23639 gene locus_tag LOCUS_17110 23821 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 23924 24922 gene locus_tag LOCUS_17120 gene purM 23924 24922 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence29 750 202 gene locus_tag LOCUS_17130 gene nadD 750 202 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780449.1 protein_id gnl|my_center|LOCUS_17130 816 1814 gene locus_tag LOCUS_17140 gene gap 816 1814 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780453.1 protein_id gnl|my_center|LOCUS_17140 1823 3016 gene locus_tag LOCUS_17150 1823 3016 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891932.1 protein_id gnl|my_center|LOCUS_17150 3025 3732 gene locus_tag LOCUS_17160 3025 3732 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160988.1 protein_id gnl|my_center|LOCUS_17160 3761 4582 gene locus_tag LOCUS_17170 gene fabI 3761 4582 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780456.1 protein_id gnl|my_center|LOCUS_17170 5109 4624 gene locus_tag LOCUS_17180 5109 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 5253 6596 gene locus_tag LOCUS_17190 5253 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 6680 7639 gene locus_tag LOCUS_17200 6680 7639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_17200 8980 7838 gene locus_tag LOCUS_17210 gene nusA 8980 7838 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 protein_id gnl|my_center|LOCUS_17210 9050 9217 gene locus_tag LOCUS_17220 9050 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 9150 9395 gene locus_tag LOCUS_17230 9150 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 9405 10706 gene locus_tag LOCUS_17240 gene miaB 9405 10706 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 protein_id gnl|my_center|LOCUS_17240 10699 11322 gene locus_tag LOCUS_17250 10699 11322 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_17250 11312 11770 gene locus_tag LOCUS_17260 11312 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 11820 12584 gene locus_tag LOCUS_17270 gene xerD 11820 12584 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583825.1 protein_id gnl|my_center|LOCUS_17270 12584 13591 gene locus_tag LOCUS_17280 12584 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911905.1 protein_id gnl|my_center|LOCUS_17280 13592 14119 gene locus_tag LOCUS_17290 13592 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 14109 14648 gene locus_tag LOCUS_17300 14109 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 15761 14733 gene locus_tag LOCUS_17310 gene tilS 15761 14733 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612475.1 protein_id gnl|my_center|LOCUS_17310 17067 15754 gene locus_tag LOCUS_17320 gene rimO 17067 15754 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 protein_id gnl|my_center|LOCUS_17320 17358 17068 gene locus_tag LOCUS_17330 17358 17068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 17880 17371 gene locus_tag LOCUS_17340 17880 17371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 18778 17894 gene locus_tag LOCUS_17350 18778 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 19160 19657 gene locus_tag LOCUS_17360 19160 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 19725 20873 gene locus_tag LOCUS_17370 19725 20873 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260957.1 protein_id gnl|my_center|LOCUS_17370 20947 20877 gene locus_tag LOCUS_t00370 20947 20877 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21357 21019 gene locus_tag LOCUS_17380 21357 21019 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_17380 21605 21357 gene locus_tag LOCUS_17390 21605 21357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 21712 21996 gene locus_tag LOCUS_17400 21712 21996 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_17400 22778 22023 gene locus_tag LOCUS_17410 22778 22023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 22939 23127 gene locus_tag LOCUS_17420 22939 23127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 23256 23969 gene locus_tag LOCUS_17430 23256 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 24245 24499 gene locus_tag LOCUS_17440 24245 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence30 332 736 gene locus_tag LOCUS_17450 332 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 709 1326 gene locus_tag LOCUS_17460 gene lpoB 709 1326 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851945.1 protein_id gnl|my_center|LOCUS_17460 1332 2339 gene locus_tag LOCUS_17470 1332 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2339 3355 gene locus_tag LOCUS_17480 2339 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3435 4382 gene locus_tag LOCUS_17490 3435 4382 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_17490 4395 5225 gene locus_tag LOCUS_17500 4395 5225 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139456841.1 protein_id gnl|my_center|LOCUS_17500 5225 5632 gene locus_tag LOCUS_17510 5225 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5625 6554 gene locus_tag LOCUS_17520 5625 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 6551 8380 gene locus_tag LOCUS_17530 6551 8380 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263516.1 protein_id gnl|my_center|LOCUS_17530 8402 9823 gene locus_tag LOCUS_17540 8402 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 10620 9820 gene locus_tag LOCUS_17550 10620 9820 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611641.1 protein_id gnl|my_center|LOCUS_17550 10750 13029 gene locus_tag LOCUS_17560 gene bamA 10750 13029 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_17560 14548 13082 gene locus_tag LOCUS_17570 14548 13082 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074267.1 protein_id gnl|my_center|LOCUS_17570 14805 14554 gene locus_tag LOCUS_17580 14805 14554 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055463.1 protein_id gnl|my_center|LOCUS_17580 16205 14907 gene locus_tag LOCUS_17590 16205 14907 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_17590 17030 16356 gene locus_tag LOCUS_17600 gene hsrA 17030 16356 CDS product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 protein_id gnl|my_center|LOCUS_17600 17460 17131 gene locus_tag LOCUS_17610 17460 17131 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850887.1 protein_id gnl|my_center|LOCUS_17610 18074 17460 gene locus_tag LOCUS_17620 gene plsY 18074 17460 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 protein_id gnl|my_center|LOCUS_17620 18192 19190 gene locus_tag LOCUS_17630 gene nadA 18192 19190 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141770.1 protein_id gnl|my_center|LOCUS_17630 19187 20002 gene locus_tag LOCUS_17640 gene nadC 19187 20002 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405980.1 protein_id gnl|my_center|LOCUS_17640 20013 21065 gene locus_tag LOCUS_17650 gene flhB 20013 21065 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_17650 21099 22040 gene locus_tag LOCUS_17660 21099 22040 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_17660 22106 23407 gene locus_tag LOCUS_17670 22106 23407 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence31 249 839 gene locus_tag LOCUS_17680 249 839 CDS product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704661.1 protein_id gnl|my_center|LOCUS_17680 898 1344 gene locus_tag LOCUS_17690 898 1344 CDS product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_17690 2003 3403 gene locus_tag LOCUS_17700 2003 3403 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268924.1 protein_id gnl|my_center|LOCUS_17700 4093 3410 gene locus_tag LOCUS_17710 gene cgpA 4093 3410 CDS product glycoprotein CgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851387.1 protein_id gnl|my_center|LOCUS_17710 4417 4139 gene locus_tag LOCUS_17720 4417 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 5691 4426 gene locus_tag LOCUS_17730 gene eno 5691 4426 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955673.1 protein_id gnl|my_center|LOCUS_17730 6785 5748 gene locus_tag LOCUS_17740 gene recA 6785 5748 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963128.1 protein_id gnl|my_center|LOCUS_17740 7160 9385 gene locus_tag LOCUS_17750 7160 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 9474 10337 gene locus_tag LOCUS_17760 9474 10337 CDS product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626212.1 protein_id gnl|my_center|LOCUS_17760 10337 10603 gene locus_tag LOCUS_17770 gene fliQ 10337 10603 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 protein_id gnl|my_center|LOCUS_17770 10660 11421 gene locus_tag LOCUS_17780 10660 11421 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858257.1 protein_id gnl|my_center|LOCUS_17780 12494 11520 gene locus_tag LOCUS_17790 12494 11520 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051995.1 protein_id gnl|my_center|LOCUS_17790 13865 12654 gene locus_tag LOCUS_17800 13865 12654 CDS product NifS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941691.1 protein_id gnl|my_center|LOCUS_17800 14028 14558 gene locus_tag LOCUS_17810 14028 14558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 15231 14542 gene locus_tag LOCUS_17820 15231 14542 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_17820 15335 16594 gene locus_tag LOCUS_17830 gene leuC 15335 16594 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_17830 16670 17848 gene locus_tag LOCUS_17840 16670 17848 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_17840 17849 18421 gene locus_tag LOCUS_17850 17849 18421 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867312.1 protein_id gnl|my_center|LOCUS_17850 18571 19041 gene locus_tag LOCUS_17860 gene moaC 18571 19041 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851725.1 protein_id gnl|my_center|LOCUS_17860 19022 19291 gene locus_tag LOCUS_17870 19022 19291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 19305 20279 gene locus_tag LOCUS_17880 19305 20279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 21367 20294 gene locus_tag LOCUS_17890 gene aroC 21367 20294 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094036.1 protein_id gnl|my_center|LOCUS_17890 22044 21364 gene locus_tag LOCUS_17900 gene rnc 22044 21364 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_17900 22472 22041 gene locus_tag LOCUS_17910 gene rnhA 22472 22041 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108269329.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence32 1373 231 gene locus_tag LOCUS_17920 gene folP 1373 231 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858587.1 protein_id gnl|my_center|LOCUS_17920 1989 1363 gene locus_tag LOCUS_17930 1989 1363 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 protein_id gnl|my_center|LOCUS_17930 2524 1976 gene locus_tag LOCUS_17940 2524 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3740 2529 gene locus_tag LOCUS_17950 3740 2529 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891865.1 protein_id gnl|my_center|LOCUS_17950 4130 3741 gene locus_tag LOCUS_17960 4130 3741 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_17960 4335 4718 gene locus_tag LOCUS_17970 4335 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 4728 5846 gene locus_tag LOCUS_17980 4728 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 6038 6994 gene locus_tag LOCUS_17990 gene hemW 6038 6994 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852262.1 protein_id gnl|my_center|LOCUS_17990 7047 7445 gene locus_tag LOCUS_18000 7047 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 7438 8238 gene locus_tag LOCUS_18010 gene tatC 7438 8238 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461250.1 protein_id gnl|my_center|LOCUS_18010 8207 9265 gene locus_tag LOCUS_18020 gene queA 8207 9265 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_18020 10036 9260 gene locus_tag LOCUS_18030 gene dprA 10036 9260 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077645213.1 protein_id gnl|my_center|LOCUS_18030 11081 10041 gene locus_tag LOCUS_18040 11081 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 11348 11782 gene locus_tag LOCUS_18050 11348 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 11818 12339 gene locus_tag LOCUS_18060 11818 12339 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865738.1 protein_id gnl|my_center|LOCUS_18060 12367 12630 gene locus_tag LOCUS_18070 gene rpsR 12367 12630 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 protein_id gnl|my_center|LOCUS_18070 12832 14505 gene locus_tag LOCUS_18080 12832 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 14861 14538 gene locus_tag LOCUS_18090 14861 14538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 15484 14855 gene locus_tag LOCUS_18100 gene serB 15484 14855 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_18100 15537 16460 gene locus_tag LOCUS_18110 15537 16460 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545211.1 protein_id gnl|my_center|LOCUS_18110 18990 16561 gene locus_tag LOCUS_18120 18990 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 19111 20358 gene locus_tag LOCUS_18130 gene serS 19111 20358 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858681.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence33 857 123 gene locus_tag LOCUS_18140 857 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1606 854 gene locus_tag LOCUS_18150 1606 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2757 1603 gene locus_tag LOCUS_18160 2757 1603 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 protein_id gnl|my_center|LOCUS_18160 3931 2741 gene locus_tag LOCUS_18170 3931 2741 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261000.1 protein_id gnl|my_center|LOCUS_18170 5528 3948 gene locus_tag LOCUS_18180 5528 3948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858782.1 protein_id gnl|my_center|LOCUS_18180 5758 6738 gene locus_tag LOCUS_18190 gene waaC 5758 6738 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858077.1 protein_id gnl|my_center|LOCUS_18190 6731 7987 gene locus_tag LOCUS_18200 6731 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 8186 9394 gene locus_tag LOCUS_18210 8186 9394 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209197.1 protein_id gnl|my_center|LOCUS_18210 9425 10516 gene locus_tag LOCUS_18220 9425 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 11254 10520 gene locus_tag LOCUS_18230 11254 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 11978 11244 gene locus_tag LOCUS_18240 11978 11244 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783846.1 protein_id gnl|my_center|LOCUS_18240 12122 13306 gene locus_tag LOCUS_18250 12122 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 13939 13367 gene locus_tag LOCUS_18260 13939 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 15365 13932 gene locus_tag LOCUS_18270 gene rfaE1 15365 13932 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_18270 16372 15362 gene locus_tag LOCUS_18280 gene rfaD 16372 15362 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858041.1 protein_id gnl|my_center|LOCUS_18280 16485 16769 gene locus_tag LOCUS_18290 16485 16769 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791548.1 protein_id gnl|my_center|LOCUS_18290 16920 17201 gene locus_tag LOCUS_18300 16920 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 17476 17261 gene locus_tag LOCUS_18310 gene ccoS 17476 17261 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090949.1 protein_id gnl|my_center|LOCUS_18310 19828 17480 gene locus_tag LOCUS_18320 19828 17480 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891913.1 protein_id gnl|my_center|LOCUS_18320 20357 19872 gene locus_tag LOCUS_18330 20357 19872 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_18330 20864 20358 gene locus_tag LOCUS_18340 gene gmhB 20864 20358 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853963.1 protein_id gnl|my_center|LOCUS_18340 21458 20871 gene locus_tag LOCUS_18350 21458 20871 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence34 1268 237 gene locus_tag LOCUS_18360 gene mnmA 1268 237 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851977.1 protein_id gnl|my_center|LOCUS_18360 2120 1347 gene locus_tag LOCUS_18370 2120 1347 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881230.1 protein_id gnl|my_center|LOCUS_18370 2996 2136 gene locus_tag LOCUS_18380 gene fliY 2996 2136 CDS product flagellar motor switch protein FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851810.1 protein_id gnl|my_center|LOCUS_18380 4091 3000 gene locus_tag LOCUS_18390 gene fliM 4091 3000 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763575.1 protein_id gnl|my_center|LOCUS_18390 4777 4094 gene locus_tag LOCUS_18400 4777 4094 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602430.1 protein_id gnl|my_center|LOCUS_18400 5103 4774 gene locus_tag LOCUS_18410 5103 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 6001 5126 gene locus_tag LOCUS_18420 gene flhG 6001 5126 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_18420 7212 5998 gene locus_tag LOCUS_18430 gene flhF 7212 5998 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612466.1 protein_id gnl|my_center|LOCUS_18430 7634 7266 gene locus_tag LOCUS_18440 7634 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 8239 7766 gene locus_tag LOCUS_18450 gene aroQ 8239 7766 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_18450 8333 9565 gene locus_tag LOCUS_18460 8333 9565 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_18460 9553 10422 gene locus_tag LOCUS_18470 gene sppA 9553 10422 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851869.1 protein_id gnl|my_center|LOCUS_18470 10970 10587 gene locus_tag LOCUS_18480 10970 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 11631 11035 gene locus_tag LOCUS_18490 11631 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_18490 12890 11640 gene locus_tag LOCUS_18500 gene xseA 12890 11640 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382848.1 protein_id gnl|my_center|LOCUS_18500 13608 12898 gene locus_tag LOCUS_18510 gene ubiE 13608 12898 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858648.1 protein_id gnl|my_center|LOCUS_18510 14611 13610 gene locus_tag LOCUS_18520 gene ribD 14611 13610 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891948.1 protein_id gnl|my_center|LOCUS_18520 15078 14629 gene locus_tag LOCUS_18530 gene rimP 15078 14629 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 protein_id gnl|my_center|LOCUS_18530 15441 15091 gene locus_tag LOCUS_18540 gene rbfA 15441 15091 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778650.1 protein_id gnl|my_center|LOCUS_18540 18207 15580 gene locus_tag LOCUS_18550 gene infB 18207 15580 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864659.1 protein_id gnl|my_center|LOCUS_18550 18454 18191 gene locus_tag LOCUS_18560 18454 18191 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232480.1 protein_id gnl|my_center|LOCUS_18560 19381 18500 gene locus_tag LOCUS_18570 gene thrB 19381 18500 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261726.1 protein_id gnl|my_center|LOCUS_18570 19850 19389 gene locus_tag LOCUS_18580 19850 19389 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851789.1 protein_id gnl|my_center|LOCUS_18580 20742 19843 gene locus_tag LOCUS_18590 gene lpxC 20742 19843 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815275.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence35 166 2061 gene locus_tag LOCUS_18600 166 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18600 2101 2577 gene locus_tag LOCUS_18610 2101 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18610 2979 2557 gene locus_tag LOCUS_18620 2979 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4409 2979 gene locus_tag LOCUS_18630 4409 2979 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_18630 4963 4412 gene locus_tag LOCUS_18640 4963 4412 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_18640 5208 5828 gene locus_tag LOCUS_18650 5208 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 7139 5937 gene locus_tag LOCUS_18660 7139 5937 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815235.1 protein_id gnl|my_center|LOCUS_18660 7992 7102 gene locus_tag LOCUS_18670 7992 7102 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_18670 8856 8125 gene locus_tag LOCUS_18680 gene hoxU 8856 8125 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_18680 9099 8860 gene locus_tag LOCUS_18690 9099 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 10454 9090 gene locus_tag LOCUS_18700 10454 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 10924 10451 gene locus_tag LOCUS_18710 gene hoxE 10924 10451 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_18710 11012 11752 gene locus_tag LOCUS_18720 gene hypB 11012 11752 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072157.1 protein_id gnl|my_center|LOCUS_18720 11752 11994 gene locus_tag LOCUS_18730 11752 11994 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072156.1 protein_id gnl|my_center|LOCUS_18730 11984 13114 gene locus_tag LOCUS_18740 gene hypD 11984 13114 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 protein_id gnl|my_center|LOCUS_18740 13164 14633 gene locus_tag LOCUS_18750 gene pyk 13164 14633 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858708.1 protein_id gnl|my_center|LOCUS_18750 14702 16261 gene locus_tag LOCUS_18760 14702 16261 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_18760 16248 17342 gene locus_tag LOCUS_18770 16248 17342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 17335 18504 gene locus_tag LOCUS_18780 17335 18504 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890088.1 protein_id gnl|my_center|LOCUS_18780 18718 19347 gene locus_tag LOCUS_18790 18718 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence36 395 649 gene locus_tag LOCUS_18800 395 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 688 1632 gene locus_tag LOCUS_18810 688 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18810 3379 1961 gene locus_tag LOCUS_18820 3379 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4242 3349 gene locus_tag LOCUS_18830 4242 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 4666 4379 gene locus_tag LOCUS_18840 4666 4379 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 protein_id gnl|my_center|LOCUS_18840 4755 7265 gene locus_tag LOCUS_18850 4755 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 7268 9082 gene locus_tag LOCUS_18860 gene glmS 7268 9082 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858421.1 protein_id gnl|my_center|LOCUS_18860 9161 9514 gene locus_tag LOCUS_18870 9161 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 9647 11008 gene locus_tag LOCUS_18880 9647 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18880 12371 11259 gene locus_tag LOCUS_18890 12371 11259 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 protein_id gnl|my_center|LOCUS_18890 13845 12463 gene locus_tag LOCUS_18900 gene thiC 13845 12463 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_18900 14066 15187 gene locus_tag LOCUS_18910 14066 15187 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_18910 15184 16071 gene locus_tag LOCUS_18920 15184 16071 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_18920 16049 17239 gene locus_tag LOCUS_18930 16049 17239 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851486.1 protein_id gnl|my_center|LOCUS_18930 17489 17995 gene locus_tag LOCUS_18940 17489 17995 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851418.1 protein_id gnl|my_center|LOCUS_18940 18655 18155 gene locus_tag LOCUS_18950 18655 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence37 280 423 gene locus_tag LOCUS_18960 280 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1072 410 gene locus_tag LOCUS_18970 1072 410 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_18970 2007 1069 gene locus_tag LOCUS_18980 2007 1069 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_18980 3106 2000 gene locus_tag LOCUS_18990 3106 2000 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263351.1 protein_id gnl|my_center|LOCUS_18990 4602 3118 gene locus_tag LOCUS_19000 4602 3118 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_19000 5708 4602 gene locus_tag LOCUS_19010 5708 4602 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_19010 6403 5795 gene locus_tag LOCUS_19020 gene pyrE 6403 5795 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 protein_id gnl|my_center|LOCUS_19020 6965 6408 gene locus_tag LOCUS_19030 gene frr 6965 6408 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864198.1 protein_id gnl|my_center|LOCUS_19030 7414 7064 gene locus_tag LOCUS_19040 7414 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 7510 8430 gene locus_tag LOCUS_19050 7510 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 8421 9191 gene locus_tag LOCUS_19060 8421 9191 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_19060 9281 10078 gene locus_tag LOCUS_19070 9281 10078 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966162.1 protein_id gnl|my_center|LOCUS_19070 10075 10767 gene locus_tag LOCUS_19080 gene bioC 10075 10767 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016700.1 protein_id gnl|my_center|LOCUS_19080 11195 10749 gene locus_tag LOCUS_19090 11195 10749 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228600.1 protein_id gnl|my_center|LOCUS_19090 11479 12813 gene locus_tag LOCUS_19100 gene soxC 11479 12813 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_19100 12828 13979 gene locus_tag LOCUS_19110 12828 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 14021 14473 gene locus_tag LOCUS_19120 gene soxY 14021 14473 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_19120 14531 14830 gene locus_tag LOCUS_19130 gene soxZ 14531 14830 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_19130 14947 15963 gene locus_tag LOCUS_19140 14947 15963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 15985 16509 gene locus_tag LOCUS_19150 15985 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 16904 16506 gene locus_tag LOCUS_19160 16904 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 17595 16897 gene locus_tag LOCUS_19170 17595 16897 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence38 128 652 gene locus_tag LOCUS_19180 128 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 740 1414 gene locus_tag LOCUS_19190 740 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1538 2122 gene locus_tag LOCUS_19200 gene folE 1538 2122 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 protein_id gnl|my_center|LOCUS_19200 2150 3463 gene locus_tag LOCUS_19210 gene fliI 2150 3463 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851735.1 protein_id gnl|my_center|LOCUS_19210 5585 3444 gene locus_tag LOCUS_19220 5585 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 6482 5673 gene locus_tag LOCUS_19230 6482 5673 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532067.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19230 6647 6486 gene locus_tag LOCUS_19240 6647 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 8225 6744 gene locus_tag LOCUS_19250 8225 6744 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_19250 9977 8358 gene locus_tag LOCUS_19260 gene recJ 9977 8358 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 protein_id gnl|my_center|LOCUS_19260 11619 9991 gene locus_tag LOCUS_19270 11619 9991 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853102.1 protein_id gnl|my_center|LOCUS_19270 11783 13402 gene locus_tag LOCUS_19280 11783 13402 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_19280 13407 14237 gene locus_tag LOCUS_19290 13407 14237 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_19290 14227 15495 gene locus_tag LOCUS_19300 14227 15495 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 protein_id gnl|my_center|LOCUS_19300 15623 16315 gene locus_tag LOCUS_19310 15623 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 16330 17007 gene locus_tag LOCUS_19320 16330 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence39 438 100 gene locus_tag LOCUS_19330 438 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1087 425 gene locus_tag LOCUS_19340 gene dccR 1087 425 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_19340 1411 1112 gene locus_tag LOCUS_19350 1411 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2190 1477 gene locus_tag LOCUS_19360 2190 1477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_19360 3337 2192 gene locus_tag LOCUS_19370 3337 2192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_19370 4479 3334 gene locus_tag LOCUS_19380 4479 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5729 4476 gene locus_tag LOCUS_19390 5729 4476 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930700.1 protein_id gnl|my_center|LOCUS_19390 5996 6277 gene locus_tag LOCUS_19400 5996 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 6364 7590 gene locus_tag LOCUS_19410 6364 7590 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_19410 7940 7617 gene locus_tag LOCUS_19420 7940 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 8450 8049 gene locus_tag LOCUS_19430 8450 8049 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_19430 8686 8447 gene locus_tag LOCUS_19440 8686 8447 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_19440 8941 8741 gene locus_tag LOCUS_19450 8941 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 9020 10537 gene locus_tag LOCUS_19460 9020 10537 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_19460 10546 11685 gene locus_tag LOCUS_19470 10546 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 11943 11767 gene locus_tag LOCUS_19480 11943 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 12266 11961 gene locus_tag LOCUS_19490 12266 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 12479 12273 gene locus_tag LOCUS_19500 12479 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 13828 12578 gene locus_tag LOCUS_19510 13828 12578 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_19510 14565 13828 gene locus_tag LOCUS_19520 14565 13828 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_19520 15335 14553 gene locus_tag LOCUS_19530 15335 14553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_19530 16325 15339 gene locus_tag LOCUS_19540 16325 15339 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681111.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence40 400 74 gene locus_tag LOCUS_19550 400 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 592 987 gene locus_tag LOCUS_19560 592 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1294 974 gene locus_tag LOCUS_19570 1294 974 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816569.1 protein_id gnl|my_center|LOCUS_19570 1351 2259 gene locus_tag LOCUS_19580 1351 2259 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_19580 2256 2930 gene locus_tag LOCUS_19590 2256 2930 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 protein_id gnl|my_center|LOCUS_19590 3244 2993 gene locus_tag LOCUS_19600 3244 2993 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853093.1 protein_id gnl|my_center|LOCUS_19600 5415 3508 gene locus_tag LOCUS_19610 gene tkt 5415 3508 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_19610 6439 5594 gene locus_tag LOCUS_19620 6439 5594 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 protein_id gnl|my_center|LOCUS_19620 7455 6475 gene locus_tag LOCUS_19630 7455 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 7763 7455 gene locus_tag LOCUS_19640 7763 7455 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851172.1 protein_id gnl|my_center|LOCUS_19640 8131 7766 gene locus_tag LOCUS_19650 gene panD 8131 7766 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 protein_id gnl|my_center|LOCUS_19650 8515 8141 gene locus_tag LOCUS_19660 8515 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 9905 8610 gene locus_tag LOCUS_19670 9905 8610 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 protein_id gnl|my_center|LOCUS_19670 10485 9895 gene locus_tag LOCUS_19680 10485 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 10782 10507 gene locus_tag LOCUS_19690 10782 10507 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858971.1 protein_id gnl|my_center|LOCUS_19690 12094 10859 gene locus_tag LOCUS_19700 12094 10859 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067929.1 protein_id gnl|my_center|LOCUS_19700 12642 12292 gene locus_tag LOCUS_19710 gene rplQ 12642 12292 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_19710 13655 12663 gene locus_tag LOCUS_19720 13655 12663 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864547.1 protein_id gnl|my_center|LOCUS_19720 14310 13684 gene locus_tag LOCUS_19730 gene rpsD 14310 13684 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 protein_id gnl|my_center|LOCUS_19730 14714 14322 gene locus_tag LOCUS_19740 gene rpsK 14714 14322 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779544.1 protein_id gnl|my_center|LOCUS_19740 15088 14726 gene locus_tag LOCUS_19750 gene rpsM 15088 14726 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 protein_id gnl|my_center|LOCUS_19750 15855 15511 gene locus_tag LOCUS_19760 15855 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence41 904 464 gene locus_tag LOCUS_19770 904 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1036 2133 gene locus_tag LOCUS_19780 1036 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2162 3031 gene locus_tag LOCUS_19790 2162 3031 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 protein_id gnl|my_center|LOCUS_19790 3335 3060 gene locus_tag LOCUS_19800 3335 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 4029 3424 gene locus_tag LOCUS_19810 4029 3424 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_19810 5485 4040 gene locus_tag LOCUS_19820 gene mltF 5485 4040 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080546580.1 protein_id gnl|my_center|LOCUS_19820 6769 5495 gene locus_tag LOCUS_19830 6769 5495 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_19830 7459 6797 gene locus_tag LOCUS_19840 7459 6797 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853196.1 protein_id gnl|my_center|LOCUS_19840 8038 7523 gene locus_tag LOCUS_19850 8038 7523 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_19850 10241 8103 gene locus_tag LOCUS_19860 gene feoB 10241 8103 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_19860 10492 10238 gene locus_tag LOCUS_19870 10492 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 11765 10551 gene locus_tag LOCUS_19880 11765 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 13413 11782 gene locus_tag LOCUS_19890 13413 11782 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941702.1 protein_id gnl|my_center|LOCUS_19890 13563 14120 gene locus_tag LOCUS_19900 13563 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 14748 14125 gene locus_tag LOCUS_19910 14748 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence42 1034 324 gene locus_tag LOCUS_19920 gene hisA 1034 324 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_19920 1754 1143 gene locus_tag LOCUS_19930 gene hisH 1754 1143 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_19930 2656 1751 gene locus_tag LOCUS_19940 2656 1751 CDS product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 protein_id gnl|my_center|LOCUS_19940 2788 3672 gene locus_tag LOCUS_19950 2788 3672 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221211.1 protein_id gnl|my_center|LOCUS_19950 4718 3669 gene locus_tag LOCUS_19960 4718 3669 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 protein_id gnl|my_center|LOCUS_19960 5725 4715 gene locus_tag LOCUS_19970 gene ruvB 5725 4715 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856258.1 protein_id gnl|my_center|LOCUS_19970 6525 5734 gene locus_tag LOCUS_19980 gene panB 6525 5734 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062669.1 protein_id gnl|my_center|LOCUS_19980 6602 7006 gene locus_tag LOCUS_19990 6602 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 7003 7743 gene locus_tag LOCUS_20000 gene trpA 7003 7743 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_20000 7801 8346 gene locus_tag LOCUS_20010 gene sigZ 7801 8346 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263639.1 protein_id gnl|my_center|LOCUS_20010 8436 9104 gene locus_tag LOCUS_20020 8436 9104 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20020 9471 10613 gene locus_tag LOCUS_20030 9471 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence43 501 139 gene locus_tag LOCUS_20040 501 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1623 736 gene locus_tag LOCUS_20050 1623 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2952 1684 gene locus_tag LOCUS_20060 2952 1684 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996418.1 protein_id gnl|my_center|LOCUS_20060 3690 2968 gene locus_tag LOCUS_20070 gene lptB 3690 2968 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855252.1 protein_id gnl|my_center|LOCUS_20070 4091 3678 gene locus_tag LOCUS_20080 gene tsaE 4091 3678 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202493.1 protein_id gnl|my_center|LOCUS_20080 5074 4088 gene locus_tag LOCUS_20090 gene trpD 5074 4088 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087577.1 protein_id gnl|my_center|LOCUS_20090 5319 5071 gene locus_tag LOCUS_20100 5319 5071 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 protein_id gnl|my_center|LOCUS_20100 5474 5319 gene locus_tag LOCUS_20110 5474 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 7212 5437 gene locus_tag LOCUS_20120 7212 5437 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_20120 7302 7832 gene locus_tag LOCUS_20130 7302 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 7907 9070 gene locus_tag LOCUS_20140 7907 9070 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542869.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence44 242 627 gene locus_tag LOCUS_tm00010 242 627 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 736 1662 gene locus_tag LOCUS_20150 736 1662 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853293.1 protein_id gnl|my_center|LOCUS_20150 1760 3550 gene locus_tag LOCUS_20160 gene lepA 1760 3550 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002837927.1 protein_id gnl|my_center|LOCUS_20160 3719 4282 gene locus_tag LOCUS_20170 3719 4282 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 protein_id gnl|my_center|LOCUS_20170 6320 4311 gene locus_tag LOCUS_20180 6320 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 6502 7059 gene locus_tag LOCUS_20190 gene grpE 6502 7059 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780052.1 protein_id gnl|my_center|LOCUS_20190 7324 9210 gene locus_tag LOCUS_20200 gene dnaK 7324 9210 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826316.1 protein_id gnl|my_center|LOCUS_20200 9400 10083 gene locus_tag LOCUS_20210 9400 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence45 174 1466 gene locus_tag LOCUS_20220 174 1466 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077422.1 protein_id gnl|my_center|LOCUS_20220 1511 2008 gene locus_tag LOCUS_20230 gene purE 1511 2008 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_20230 2163 2633 gene locus_tag LOCUS_20240 2163 2633 CDS product DUF3972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852251.1 protein_id gnl|my_center|LOCUS_20240 2737 3594 gene locus_tag LOCUS_20250 2737 3594 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880542.1 protein_id gnl|my_center|LOCUS_20250 4114 3653 gene locus_tag LOCUS_20260 4114 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 4249 5130 gene locus_tag LOCUS_20270 gene glyQ 4249 5130 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852069.1 protein_id gnl|my_center|LOCUS_20270 5212 6087 gene locus_tag LOCUS_20280 5212 6087 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972462.1 protein_id gnl|my_center|LOCUS_20280 6077 6541 gene locus_tag LOCUS_20290 6077 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence46 863 321 gene locus_tag LOCUS_20300 863 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1917 865 gene locus_tag LOCUS_20310 1917 865 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928656.1 protein_id gnl|my_center|LOCUS_20310 2388 2300 gene locus_tag LOCUS_t00380 2388 2300 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2493 2420 gene locus_tag LOCUS_t00390 2493 2420 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2604 2518 gene locus_tag LOCUS_t00400 2604 2518 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2733 2659 gene locus_tag LOCUS_t00410 2733 2659 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2876 4561 gene locus_tag LOCUS_20320 gene ilvD 2876 4561 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence47 69 1493 gene locus_tag LOCUS_20330 69 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1474 2580 gene locus_tag LOCUS_20340 1474 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2638 3378 gene locus_tag LOCUS_20350 2638 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3408 4286 gene locus_tag LOCUS_20360 3408 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence48 <1 992 gene locus_tag LOCUS_20370 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858687.1:prohibitin family protein 1001 1681 gene locus_tag LOCUS_20380 gene hisIE 1001 1681 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_20380 1688 2197 gene locus_tag LOCUS_20390 1688 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2194 2754 gene locus_tag LOCUS_20400 2194 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3710 2751 gene locus_tag LOCUS_20410 3710 2751 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_20410 5065 3710 gene locus_tag LOCUS_20420 gene purF 5065 3710 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence49 2828 345 gene locus_tag LOCUS_20430 2828 345 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_20430 3436 2834 gene locus_tag LOCUS_20440 3436 2834 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 protein_id gnl|my_center|LOCUS_20440 4224 3439 gene locus_tag LOCUS_20450 4224 3439 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 protein_id gnl|my_center|LOCUS_20450 4795 4226 gene locus_tag LOCUS_20460 gene recR 4795 4226 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099619.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence50 241 375 gene locus_tag LOCUS_20470 241 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 390 998 gene locus_tag LOCUS_20480 390 998 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_20480 995 1993 gene locus_tag LOCUS_20490 995 1993 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence51 1303 383 gene locus_tag LOCUS_20500 gene ilvE 1303 383 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 protein_id gnl|my_center|LOCUS_20500 2849 1560 gene locus_tag LOCUS_20510 2849 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 4036 3032 gene locus_tag LOCUS_20520 gene pstS 4036 3032 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881320.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence52 280 1083 gene locus_tag LOCUS_20530 gene rsmA 280 1083 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_20530 1055 3007 gene locus_tag LOCUS_20540 1055 3007 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864793.1 protein_id gnl|my_center|LOCUS_20540 3203 4357 gene locus_tag LOCUS_20550 3203 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence53 980 327 gene locus_tag LOCUS_20560 980 327 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_20560 2961 970 gene locus_tag LOCUS_20570 gene ftsH 2961 970 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852796.1 protein_id gnl|my_center|LOCUS_20570 3797 2964 gene locus_tag LOCUS_20580 3797 2964 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852657.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence54 869 21 gene locus_tag LOCUS_20590 869 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2032 917 gene locus_tag LOCUS_20600 2032 917 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924085.1 protein_id gnl|my_center|LOCUS_20600 2158 2928 gene locus_tag LOCUS_20610 2158 2928 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222025.1 protein_id gnl|my_center|LOCUS_20610 3651 3064 gene locus_tag LOCUS_20620 gene rdgB 3651 3064 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence55 1455 544 gene locus_tag LOCUS_20630 1455 544 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851738.1 protein_id gnl|my_center|LOCUS_20630 1998 1459 gene locus_tag LOCUS_20640 gene pal 1998 1459 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851617.1 protein_id gnl|my_center|LOCUS_20640 3325 2075 gene locus_tag LOCUS_20650 gene tolB 3325 2075 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence56 404 81 gene locus_tag LOCUS_20660 404 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1489 563 gene locus_tag LOCUS_20670 1489 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2733 1603 gene locus_tag LOCUS_20680 2733 1603 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_20680 2903 3193 gene locus_tag LOCUS_20690 2903 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence57 114 677 gene locus_tag LOCUS_20700 114 677 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_20700 713 1876 gene locus_tag LOCUS_20710 713 1876 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_20710 1893 2990 gene locus_tag LOCUS_20720 1893 2990 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence58 <3147 1571 gene locus_tag LOCUS_20730 <3147 1571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853088.1:dihydroxy-acid dehydratase >Feature sequence59 27 866 gene locus_tag LOCUS_20740 27 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 953 1540 gene locus_tag LOCUS_20750 953 1540 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_20750 1540 2355 gene locus_tag LOCUS_20760 1540 2355 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence60 1660 2 gene locus_tag LOCUS_20770 1660 2 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_20770 2148 1657 gene locus_tag LOCUS_20780 2148 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence61 133 381 gene locus_tag LOCUS_20790 133 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 384 965 gene locus_tag LOCUS_20800 384 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 962 1594 gene locus_tag LOCUS_20810 962 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1596 2216 gene locus_tag LOCUS_20820 1596 2216 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence62 280 423 gene locus_tag LOCUS_20830 280 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1072 410 gene locus_tag LOCUS_20840 1072 410 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_20840 2007 1069 gene locus_tag LOCUS_20850 2007 1069 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence63 659 339 gene locus_tag LOCUS_20860 gene trxA 659 339 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 protein_id gnl|my_center|LOCUS_20860 1513 734 gene locus_tag LOCUS_20870 1513 734 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence64 983 156 gene locus_tag LOCUS_20880 983 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1199 1519 gene locus_tag LOCUS_20890 1199 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1504 2136 gene locus_tag LOCUS_20900 1504 2136 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864777.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence65 772 353 gene locus_tag LOCUS_20910 772 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2064 814 gene locus_tag LOCUS_20920 2064 814 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence66 13 1182 gene locus_tag LOCUS_20930 13 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2140 1223 gene locus_tag LOCUS_20940 2140 1223 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073874.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence67 114 1430 gene locus_tag LOCUS_20950 114 1430 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_20950 2000 1509 gene locus_tag LOCUS_20960 gene infC 2000 1509 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence68 1128 1568 gene locus_tag LOCUS_20970 1128 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence69 1183 572 gene locus_tag LOCUS_20980 gene lnrK 1183 572 CDS product two-component system response regulator LnrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242530.1 protein_id gnl|my_center|LOCUS_20980 <1962 1186 gene locus_tag LOCUS_20990 <1962 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263955.1:HlyD family type I secretion periplasmic adaptor subunit >Feature sequence70 163 1062 gene locus_tag LOCUS_21000 gene lpxC 163 1062 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815275.1 protein_id gnl|my_center|LOCUS_21000 1055 1516 gene locus_tag LOCUS_21010 1055 1516 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851789.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence71 <1789 723 gene locus_tag LOCUS_21020 <1789 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809055.1:type I secretion system permease/ATPase >Feature sequence72 <1 950 gene locus_tag LOCUS_21030 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957654.1:lytic murein transglycosylase B 1208 954 gene locus_tag LOCUS_21040 1208 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence73 167 1075 gene locus_tag LOCUS_21050 167 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21050 1011 1553 gene locus_tag LOCUS_21060 1011 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060