>Feature sequence01 1273 299 gene locus_tag LOCUS_00010 1273 299 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940539.1 protein_id gnl|my_center|LOCUS_00010 1458 1273 gene locus_tag LOCUS_00020 1458 1273 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_00020 2338 1499 gene locus_tag LOCUS_00030 2338 1499 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_00030 3121 2363 gene locus_tag LOCUS_00040 3121 2363 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_00040 3759 3118 gene locus_tag LOCUS_00050 gene rsmG 3759 3118 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 protein_id gnl|my_center|LOCUS_00050 5654 3756 gene locus_tag LOCUS_00060 gene mnmG 5654 3756 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818282.1 protein_id gnl|my_center|LOCUS_00060 6168 5851 gene locus_tag LOCUS_00070 6168 5851 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693849.1 protein_id gnl|my_center|LOCUS_00070 6572 6165 gene locus_tag LOCUS_00080 6572 6165 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693848.1 protein_id gnl|my_center|LOCUS_00080 6797 7051 gene locus_tag LOCUS_00090 6797 7051 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034798187.1 protein_id gnl|my_center|LOCUS_00090 7220 7059 gene locus_tag LOCUS_00100 7220 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7735 7427 gene locus_tag LOCUS_00110 7735 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 8104 7745 gene locus_tag LOCUS_00120 8104 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8620 8336 gene locus_tag LOCUS_00130 8620 8336 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110276.1 protein_id gnl|my_center|LOCUS_00130 8878 8624 gene locus_tag LOCUS_00140 8878 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 9144 10481 gene locus_tag LOCUS_00150 9144 10481 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_00150 10541 11734 gene locus_tag LOCUS_00160 10541 11734 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_00160 11731 14931 gene locus_tag LOCUS_00170 11731 14931 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_00170 14928 15401 gene locus_tag LOCUS_00180 14928 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15398 16543 gene locus_tag LOCUS_00190 15398 16543 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_00190 17036 16701 gene locus_tag LOCUS_00200 17036 16701 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_00200 18676 17141 gene locus_tag LOCUS_00210 18676 17141 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_00210 20650 19007 gene locus_tag LOCUS_00220 gene ettA 20650 19007 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_00220 21005 20763 gene locus_tag LOCUS_00230 21005 20763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22310 21021 gene locus_tag LOCUS_00240 22310 21021 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599076.1 protein_id gnl|my_center|LOCUS_00240 23122 22373 gene locus_tag LOCUS_00250 23122 22373 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_00250 23227 23679 gene locus_tag LOCUS_00260 23227 23679 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_00260 23874 24284 gene locus_tag LOCUS_00270 23874 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24783 24319 gene locus_tag LOCUS_00280 24783 24319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25344 24802 gene locus_tag LOCUS_00290 25344 24802 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552138.1 protein_id gnl|my_center|LOCUS_00290 25793 25341 gene locus_tag LOCUS_00300 25793 25341 CDS product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040632.1 protein_id gnl|my_center|LOCUS_00300 25953 26882 gene locus_tag LOCUS_00310 gene ttcA 25953 26882 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157406.1 protein_id gnl|my_center|LOCUS_00310 28975 27023 gene locus_tag LOCUS_00320 28975 27023 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 protein_id gnl|my_center|LOCUS_00320 31158 28990 gene locus_tag LOCUS_00330 31158 28990 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_00330 32069 31155 gene locus_tag LOCUS_00340 32069 31155 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_00340 32510 32139 gene locus_tag LOCUS_00350 32510 32139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32974 32639 gene locus_tag LOCUS_00360 32974 32639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33842 33258 gene locus_tag LOCUS_00370 33842 33258 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814954.1 protein_id gnl|my_center|LOCUS_00370 35871 33904 gene locus_tag LOCUS_00380 gene dsbD 35871 33904 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_00380 36172 35849 gene locus_tag LOCUS_00390 36172 35849 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038658.1 protein_id gnl|my_center|LOCUS_00390 36439 36636 gene locus_tag LOCUS_00400 36439 36636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 37562 36651 gene locus_tag LOCUS_00410 gene ala 37562 36651 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_00410 37747 39561 gene locus_tag LOCUS_00420 gene typA 37747 39561 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 protein_id gnl|my_center|LOCUS_00420 40662 39616 gene locus_tag LOCUS_00430 40662 39616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 42136 40730 gene locus_tag LOCUS_00440 42136 40730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 44984 42261 gene locus_tag LOCUS_00450 44984 42261 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_00450 46019 44988 gene locus_tag LOCUS_00460 46019 44988 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_00460 46321 46019 gene locus_tag LOCUS_00470 46321 46019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46803 46204 gene locus_tag LOCUS_00480 46803 46204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00480 47405 46827 gene locus_tag LOCUS_00490 47405 46827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00490 47616 47368 gene locus_tag LOCUS_00500 47616 47368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 48324 47728 gene locus_tag LOCUS_00510 48324 47728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 48800 48366 gene locus_tag LOCUS_00520 48800 48366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00520 49812 48877 gene locus_tag LOCUS_00530 49812 48877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 50365 49802 gene locus_tag LOCUS_00540 50365 49802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 51271 50402 gene locus_tag LOCUS_00550 gene dinD 51271 50402 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687842.1 protein_id gnl|my_center|LOCUS_00550 54309 51424 gene locus_tag LOCUS_00560 54309 51424 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035772.1 protein_id gnl|my_center|LOCUS_00560 56799 54394 gene locus_tag LOCUS_00570 gene gyrB 56799 54394 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_00570 58005 56890 gene locus_tag LOCUS_00580 gene dnaN 58005 56890 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223059.1 protein_id gnl|my_center|LOCUS_00580 59574 58198 gene locus_tag LOCUS_00590 gene dnaA 59574 58198 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769932.1 protein_id gnl|my_center|LOCUS_00590 60432 59602 gene locus_tag LOCUS_00600 gene panC 60432 59602 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_00600 61237 60446 gene locus_tag LOCUS_00610 gene panB 61237 60446 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_00610 61728 61234 gene locus_tag LOCUS_00620 gene folK 61728 61234 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_00620 63120 61738 gene locus_tag LOCUS_00630 gene pcnB 63120 61738 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194112.1 protein_id gnl|my_center|LOCUS_00630 64243 63605 gene locus_tag LOCUS_00640 64243 63605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 66248 64263 gene locus_tag LOCUS_00650 66248 64263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 68244 66895 gene locus_tag LOCUS_00660 68244 66895 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_00660 68986 68333 gene locus_tag LOCUS_00670 68986 68333 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_00670 69196 71091 gene locus_tag LOCUS_00680 gene thiC 69196 71091 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 protein_id gnl|my_center|LOCUS_00680 71134 71958 gene locus_tag LOCUS_00690 71134 71958 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_00690 72135 72734 gene locus_tag LOCUS_00700 72135 72734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 73331 75997 gene locus_tag LOCUS_00710 73331 75997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 76660 75980 gene locus_tag LOCUS_00720 gene fnr 76660 75980 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_00720 77237 78373 gene locus_tag LOCUS_00730 gene hemN 77237 78373 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689506.1 protein_id gnl|my_center|LOCUS_00730 78857 78549 gene locus_tag LOCUS_00740 78857 78549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 79391 80146 gene locus_tag LOCUS_00750 79391 80146 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945798.1 protein_id gnl|my_center|LOCUS_00750 80417 83347 gene locus_tag LOCUS_00760 gene rapA 80417 83347 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006492.1 protein_id gnl|my_center|LOCUS_00760 83452 83847 gene locus_tag LOCUS_00770 83452 83847 CDS product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_00770 83837 84271 gene locus_tag LOCUS_00780 83837 84271 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_00780 84544 84167 gene locus_tag LOCUS_00790 84544 84167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84880 85185 gene locus_tag LOCUS_00800 84880 85185 CDS product DCL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388568.1 protein_id gnl|my_center|LOCUS_00800 85198 86124 gene locus_tag LOCUS_00810 85198 86124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 86131 88224 gene locus_tag LOCUS_00820 86131 88224 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 protein_id gnl|my_center|LOCUS_00820 88563 89660 gene locus_tag LOCUS_00830 88563 89660 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_00830 90768 89662 gene locus_tag LOCUS_00840 90768 89662 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035469.1 protein_id gnl|my_center|LOCUS_00840 92107 91016 gene locus_tag LOCUS_00850 gene ychF 92107 91016 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_00850 92734 92165 gene locus_tag LOCUS_00860 gene pth 92734 92165 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_00860 93508 92885 gene locus_tag LOCUS_00870 93508 92885 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_00870 94520 93570 gene locus_tag LOCUS_00880 94520 93570 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_00880 94672 94598 gene locus_tag LOCUS_t00010 94672 94598 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 95546 94671 gene locus_tag LOCUS_00890 gene ispE 95546 94671 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266731.1 protein_id gnl|my_center|LOCUS_00890 96114 95527 gene locus_tag LOCUS_00900 96114 95527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 96480 96202 gene locus_tag LOCUS_00910 gene minE 96480 96202 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_00910 97289 96477 gene locus_tag LOCUS_00920 gene minD 97289 96477 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 protein_id gnl|my_center|LOCUS_00920 98087 97314 gene locus_tag LOCUS_00930 gene minC 98087 97314 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 protein_id gnl|my_center|LOCUS_00930 98026 98184 gene locus_tag LOCUS_00940 98026 98184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 99929 98193 gene locus_tag LOCUS_00950 99929 98193 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_00950 100345 101820 gene locus_tag LOCUS_00960 gene lnt 100345 101820 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483491.1 protein_id gnl|my_center|LOCUS_00960 101862 102788 gene locus_tag LOCUS_00970 gene glyQ 101862 102788 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_00970 102785 104971 gene locus_tag LOCUS_00980 gene glyS 102785 104971 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_00980 104973 105512 gene locus_tag LOCUS_00990 gene gmhB 104973 105512 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814404.1 protein_id gnl|my_center|LOCUS_00990 105509 106246 gene locus_tag LOCUS_01000 105509 106246 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814405.1 protein_id gnl|my_center|LOCUS_01000 106249 106938 gene locus_tag LOCUS_01010 106249 106938 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_01010 107017 107565 gene locus_tag LOCUS_01020 107017 107565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 107646 107927 gene locus_tag LOCUS_01030 107646 107927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 108449 108192 gene locus_tag LOCUS_01040 108449 108192 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_01040 108712 108452 gene locus_tag LOCUS_01050 108712 108452 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 protein_id gnl|my_center|LOCUS_01050 108931 110073 gene locus_tag LOCUS_01060 108931 110073 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_01060 110221 110868 gene locus_tag LOCUS_01070 110221 110868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 111060 111485 gene locus_tag LOCUS_01080 111060 111485 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_01080 111633 113558 gene locus_tag LOCUS_01090 111633 113558 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553869.1 protein_id gnl|my_center|LOCUS_01090 113666 113992 gene locus_tag LOCUS_01100 113666 113992 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814065.1 protein_id gnl|my_center|LOCUS_01100 114020 114349 gene locus_tag LOCUS_01110 114020 114349 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 protein_id gnl|my_center|LOCUS_01110 114856 114416 gene locus_tag LOCUS_01120 114856 114416 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_01120 115491 114859 gene locus_tag LOCUS_01130 gene nth 115491 114859 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_01130 116176 115478 gene locus_tag LOCUS_01140 gene rsxB 116176 115478 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929011.1 protein_id gnl|my_center|LOCUS_01140 117213 116173 gene locus_tag LOCUS_01150 117213 116173 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207200.1 protein_id gnl|my_center|LOCUS_01150 117961 117254 gene locus_tag LOCUS_01160 117961 117254 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_01160 118721 117969 gene locus_tag LOCUS_01170 gene aat 118721 117969 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_01170 118812 119729 gene locus_tag LOCUS_01180 118812 119729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 122808 120031 gene locus_tag LOCUS_01190 122808 120031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 123834 122818 gene locus_tag LOCUS_01200 123834 122818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 124789 124064 gene locus_tag LOCUS_01210 124789 124064 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_01210 125197 126024 gene locus_tag LOCUS_01220 125197 126024 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_01220 126727 126086 gene locus_tag LOCUS_01230 126727 126086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 127514 126702 gene locus_tag LOCUS_01240 127514 126702 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_01240 128738 127536 gene locus_tag LOCUS_01250 128738 127536 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_01250 129431 128766 gene locus_tag LOCUS_01260 129431 128766 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_01260 130056 129424 gene locus_tag LOCUS_01270 130056 129424 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 protein_id gnl|my_center|LOCUS_01270 130959 130099 gene locus_tag LOCUS_01280 130959 130099 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_01280 131087 132322 gene locus_tag LOCUS_01290 131087 132322 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_01290 132348 133301 gene locus_tag LOCUS_01300 132348 133301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 133321 133584 gene locus_tag LOCUS_01310 133321 133584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 133592 133987 gene locus_tag LOCUS_01320 133592 133987 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_01320 134558 135082 gene locus_tag LOCUS_01330 134558 135082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 136014 135079 gene locus_tag LOCUS_01340 gene cysB 136014 135079 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_01340 136371 136595 gene locus_tag LOCUS_01350 136371 136595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 136648 138387 gene locus_tag LOCUS_01360 136648 138387 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192117.1 protein_id gnl|my_center|LOCUS_01360 138393 138926 gene locus_tag LOCUS_01370 138393 138926 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_01370 138919 139617 gene locus_tag LOCUS_01380 138919 139617 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_01380 139692 140597 gene locus_tag LOCUS_01390 gene cysD 139692 140597 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_01390 140734 142017 gene locus_tag LOCUS_01400 140734 142017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 142199 142594 gene locus_tag LOCUS_01410 142199 142594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 142881 146420 gene locus_tag LOCUS_01420 142881 146420 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_01420 146427 146804 gene locus_tag LOCUS_01430 146427 146804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 146965 148086 gene locus_tag LOCUS_01440 146965 148086 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813035.1 protein_id gnl|my_center|LOCUS_01440 148147 148455 gene locus_tag LOCUS_01450 148147 148455 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 protein_id gnl|my_center|LOCUS_01450 148456 149835 gene locus_tag LOCUS_01460 148456 149835 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083975.1 protein_id gnl|my_center|LOCUS_01460 151432 149882 gene locus_tag LOCUS_01470 151432 149882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 152527 151484 gene locus_tag LOCUS_01480 152527 151484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193226.1 protein_id gnl|my_center|LOCUS_01480 154330 152621 gene locus_tag LOCUS_01490 154330 152621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_01490 155062 154373 gene locus_tag LOCUS_01500 gene lolD 155062 154373 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_01500 156347 155055 gene locus_tag LOCUS_01510 156347 155055 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_01510 157118 156399 gene locus_tag LOCUS_01520 157118 156399 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162185.1 protein_id gnl|my_center|LOCUS_01520 157828 157355 gene locus_tag LOCUS_01530 157828 157355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 158057 159034 gene locus_tag LOCUS_01540 gene speB 158057 159034 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_01540 160407 159082 gene locus_tag LOCUS_01550 160407 159082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 162428 160587 gene locus_tag LOCUS_01560 162428 160587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 163324 162425 gene locus_tag LOCUS_01570 163324 162425 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966857.1 protein_id gnl|my_center|LOCUS_01570 163539 165368 gene locus_tag LOCUS_01580 163539 165368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 165459 166109 gene locus_tag LOCUS_01590 165459 166109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 166400 167473 gene locus_tag LOCUS_01600 166400 167473 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_01600 167567 169234 gene locus_tag LOCUS_01610 167567 169234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 protein_id gnl|my_center|LOCUS_01610 169261 170187 gene locus_tag LOCUS_01620 169261 170187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 170212 171552 gene locus_tag LOCUS_01630 170212 171552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 171969 171595 gene locus_tag LOCUS_01640 171969 171595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 172791 172009 gene locus_tag LOCUS_01650 gene yaaA 172791 172009 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 protein_id gnl|my_center|LOCUS_01650 172920 174401 gene locus_tag LOCUS_01660 172920 174401 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883612.1 protein_id gnl|my_center|LOCUS_01660 174553 177216 gene locus_tag LOCUS_01670 174553 177216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 177266 178624 gene locus_tag LOCUS_01680 gene rlmD 177266 178624 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_01680 179745 178681 gene locus_tag LOCUS_01690 179745 178681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 180321 180689 gene locus_tag LOCUS_01700 180321 180689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 180690 182036 gene locus_tag LOCUS_01710 gene miaB 180690 182036 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 protein_id gnl|my_center|LOCUS_01710 182153 183157 gene locus_tag LOCUS_01720 182153 183157 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 protein_id gnl|my_center|LOCUS_01720 183154 183609 gene locus_tag LOCUS_01730 gene ybeY 183154 183609 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093160.1 protein_id gnl|my_center|LOCUS_01730 183657 184505 gene locus_tag LOCUS_01740 183657 184505 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_01740 184549 186336 gene locus_tag LOCUS_01750 gene recJ 184549 186336 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_01750 186326 187585 gene locus_tag LOCUS_01760 186326 187585 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_01760 189505 187589 gene locus_tag LOCUS_01770 189505 187589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 190540 189743 gene locus_tag LOCUS_01780 gene fliR 190540 189743 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_01780 190882 190610 gene locus_tag LOCUS_01790 gene fliQ 190882 190610 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500315.1 protein_id gnl|my_center|LOCUS_01790 191630 190896 gene locus_tag LOCUS_01800 gene fliP 191630 190896 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 protein_id gnl|my_center|LOCUS_01800 192174 191743 gene locus_tag LOCUS_01810 192174 191743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 192693 192184 gene locus_tag LOCUS_01820 gene fliN 192693 192184 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 protein_id gnl|my_center|LOCUS_01820 193685 192705 gene locus_tag LOCUS_01830 gene fliM 193685 192705 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_01830 194202 193693 gene locus_tag LOCUS_01840 194202 193693 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945280.1 protein_id gnl|my_center|LOCUS_01840 195620 194460 gene locus_tag LOCUS_01850 195620 194460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 196161 195700 gene locus_tag LOCUS_01860 196161 195700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 197594 196173 gene locus_tag LOCUS_01870 gene fliI 197594 196173 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_01870 198285 197581 gene locus_tag LOCUS_01880 gene fliH 198285 197581 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930338.1 protein_id gnl|my_center|LOCUS_01880 199345 198350 gene locus_tag LOCUS_01890 gene fliG 199345 198350 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_01890 201056 199338 gene locus_tag LOCUS_01900 gene fliF 201056 199338 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_01900 201438 202580 gene locus_tag LOCUS_01910 gene fleS 201438 202580 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_01910 202584 203891 gene locus_tag LOCUS_01920 202584 203891 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_01920 203989 204312 gene locus_tag LOCUS_01930 gene fliE 203989 204312 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 protein_id gnl|my_center|LOCUS_01930 206205 204352 gene locus_tag LOCUS_01940 206205 204352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261067.1 protein_id gnl|my_center|LOCUS_01940 206476 208896 gene locus_tag LOCUS_01950 206476 208896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 208995 209210 gene locus_tag LOCUS_01960 208995 209210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 209235 209585 gene locus_tag LOCUS_01970 209235 209585 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986793.1 protein_id gnl|my_center|LOCUS_01970 209671 210756 gene locus_tag LOCUS_01980 209671 210756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 212157 210889 gene locus_tag LOCUS_01990 212157 210889 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 protein_id gnl|my_center|LOCUS_01990 214109 212199 gene locus_tag LOCUS_02000 214109 212199 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525894.1 protein_id gnl|my_center|LOCUS_02000 215842 214382 gene locus_tag LOCUS_02010 gene gdhA 215842 214382 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206092.1 protein_id gnl|my_center|LOCUS_02010 216254 217939 gene locus_tag LOCUS_02020 216254 217939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 217923 218690 gene locus_tag LOCUS_02030 217923 218690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 218866 220374 gene locus_tag LOCUS_02040 gene lysS 218866 220374 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205152.1 protein_id gnl|my_center|LOCUS_02040 220918 221940 gene locus_tag LOCUS_02050 220918 221940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 222069 222794 gene locus_tag LOCUS_02060 222069 222794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 222942 223169 gene locus_tag LOCUS_02070 222942 223169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 223166 223372 gene locus_tag LOCUS_02080 223166 223372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 223980 223474 gene locus_tag LOCUS_02090 223980 223474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 224577 226193 gene locus_tag LOCUS_02100 224577 226193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 226353 228167 gene locus_tag LOCUS_02110 226353 228167 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_02110 228185 232024 gene locus_tag LOCUS_02120 228185 232024 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204931.1 protein_id gnl|my_center|LOCUS_02120 232736 232074 gene locus_tag LOCUS_02130 232736 232074 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_02130 233404 232733 gene locus_tag LOCUS_02140 gene hda 233404 232733 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039150.1 protein_id gnl|my_center|LOCUS_02140 234504 233440 gene locus_tag LOCUS_02150 234504 233440 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_02150 235904 234510 gene locus_tag LOCUS_02160 gene hpnO 235904 234510 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_02160 237209 236355 gene locus_tag LOCUS_02170 237209 236355 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_02170 237735 238793 gene locus_tag LOCUS_02180 gene purM 237735 238793 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_02180 238810 239448 gene locus_tag LOCUS_02190 gene purN 238810 239448 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 protein_id gnl|my_center|LOCUS_02190 239445 240161 gene locus_tag LOCUS_02200 239445 240161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 240206 241468 gene locus_tag LOCUS_02210 240206 241468 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 protein_id gnl|my_center|LOCUS_02210 243987 241480 gene locus_tag LOCUS_02220 243987 241480 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_02220 244776 244180 gene locus_tag LOCUS_02230 244776 244180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 245923 244796 gene locus_tag LOCUS_02240 245923 244796 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012165757.1 protein_id gnl|my_center|LOCUS_02240 247096 245978 gene locus_tag LOCUS_02250 gene hpnH 247096 245978 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_02250 248057 247524 gene locus_tag LOCUS_02260 248057 247524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 248363 249433 gene locus_tag LOCUS_02270 248363 249433 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922286.1 protein_id gnl|my_center|LOCUS_02270 250884 249481 gene locus_tag LOCUS_02280 250884 249481 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269201.1 protein_id gnl|my_center|LOCUS_02280 252270 250888 gene locus_tag LOCUS_02290 252270 250888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 252405 253121 gene locus_tag LOCUS_02300 252405 253121 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_02300 253237 253485 gene locus_tag LOCUS_02310 253237 253485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 254472 253462 gene locus_tag LOCUS_02320 254472 253462 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_02320 254844 255734 gene locus_tag LOCUS_02330 254844 255734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 256483 255836 gene locus_tag LOCUS_02340 256483 255836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 257738 256557 gene locus_tag LOCUS_02350 257738 256557 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524929.1 protein_id gnl|my_center|LOCUS_02350 257992 257738 gene locus_tag LOCUS_02360 257992 257738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 258931 258017 gene locus_tag LOCUS_02370 258931 258017 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077137.1 protein_id gnl|my_center|LOCUS_02370 260762 258939 gene locus_tag LOCUS_02380 260762 258939 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390306.1 protein_id gnl|my_center|LOCUS_02380 262308 261058 gene locus_tag LOCUS_02390 262308 261058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 262562 262954 gene locus_tag LOCUS_02400 262562 262954 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_02400 262957 263226 gene locus_tag LOCUS_02410 262957 263226 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_02410 263223 264953 gene locus_tag LOCUS_02420 gene ptsP 263223 264953 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_02420 265064 266191 gene locus_tag LOCUS_02430 265064 266191 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_02430 266199 266816 gene locus_tag LOCUS_02440 gene metW 266199 266816 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 protein_id gnl|my_center|LOCUS_02440 267701 266856 gene locus_tag LOCUS_02450 267701 266856 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_02450 267836 268258 gene locus_tag LOCUS_02460 267836 268258 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_02460 269061 268381 gene locus_tag LOCUS_02470 gene pgl 269061 268381 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185596.1 protein_id gnl|my_center|LOCUS_02470 269719 269078 gene locus_tag LOCUS_02480 269719 269078 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_02480 270662 269724 gene locus_tag LOCUS_02490 270662 269724 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_02490 271591 270659 gene locus_tag LOCUS_02500 271591 270659 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_02500 272358 271591 gene locus_tag LOCUS_02510 272358 271591 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_02510 273122 272373 gene locus_tag LOCUS_02520 273122 272373 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_02520 273398 274663 gene locus_tag LOCUS_02530 273398 274663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 274721 275485 gene locus_tag LOCUS_02540 274721 275485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 275632 276660 gene locus_tag LOCUS_02550 275632 276660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 276639 277868 gene locus_tag LOCUS_02560 276639 277868 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094903.1 protein_id gnl|my_center|LOCUS_02560 277855 278838 gene locus_tag LOCUS_02570 277855 278838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 278814 279515 gene locus_tag LOCUS_02580 278814 279515 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902491.1 protein_id gnl|my_center|LOCUS_02580 280196 279600 gene locus_tag LOCUS_02590 280196 279600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 280688 280299 gene locus_tag LOCUS_02600 280688 280299 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684748.1 protein_id gnl|my_center|LOCUS_02600 280882 280688 gene locus_tag LOCUS_02610 280882 280688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 281851 281267 gene locus_tag LOCUS_02620 281851 281267 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_02620 282284 282538 gene locus_tag LOCUS_02630 282284 282538 CDS product DUF2024 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086057.1 protein_id gnl|my_center|LOCUS_02630 282643 283158 gene locus_tag LOCUS_02640 282643 283158 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_02640 283181 283528 gene locus_tag LOCUS_02650 gene arsC 283181 283528 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 protein_id gnl|my_center|LOCUS_02650 284055 283636 gene locus_tag LOCUS_02660 gene rplS 284055 283636 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 protein_id gnl|my_center|LOCUS_02660 284851 284078 gene locus_tag LOCUS_02670 gene trmD 284851 284078 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 protein_id gnl|my_center|LOCUS_02670 285367 284864 gene locus_tag LOCUS_02680 gene rimM 285367 284864 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690619.1 protein_id gnl|my_center|LOCUS_02680 285665 285390 gene locus_tag LOCUS_02690 gene rpsP 285665 285390 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926757.1 protein_id gnl|my_center|LOCUS_02690 286483 287112 gene locus_tag LOCUS_02700 286483 287112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 287186 287812 gene locus_tag LOCUS_02710 gene coq7 287186 287812 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527787.1 protein_id gnl|my_center|LOCUS_02710 287877 288437 gene locus_tag LOCUS_02720 287877 288437 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_02720 288453 288941 gene locus_tag LOCUS_02730 gene ruvX 288453 288941 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213272.1 protein_id gnl|my_center|LOCUS_02730 288913 289428 gene locus_tag LOCUS_02740 gene pyrR 288913 289428 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_02740 289425 290378 gene locus_tag LOCUS_02750 289425 290378 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_02750 290388 291662 gene locus_tag LOCUS_02760 290388 291662 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_02760 291736 293829 gene locus_tag LOCUS_02770 291736 293829 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550186.1 protein_id gnl|my_center|LOCUS_02770 294070 294834 gene locus_tag LOCUS_02780 294070 294834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 295060 296211 gene locus_tag LOCUS_02790 295060 296211 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105519.1 protein_id gnl|my_center|LOCUS_02790 296270 296887 gene locus_tag LOCUS_02800 296270 296887 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_02800 296890 297192 gene locus_tag LOCUS_02810 296890 297192 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367051.1 protein_id gnl|my_center|LOCUS_02810 297345 298139 gene locus_tag LOCUS_02820 297345 298139 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 protein_id gnl|my_center|LOCUS_02820 299252 298179 gene locus_tag LOCUS_02830 gene dadX 299252 298179 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705840.1 protein_id gnl|my_center|LOCUS_02830 299471 300745 gene locus_tag LOCUS_02840 gene lplT 299471 300745 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_02840 301518 300784 gene locus_tag LOCUS_02850 301518 300784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 301970 301515 gene locus_tag LOCUS_02860 gene rimI 301970 301515 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481582.1 protein_id gnl|my_center|LOCUS_02860 302593 301967 gene locus_tag LOCUS_02870 gene tsaB 302593 301967 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262263.1 protein_id gnl|my_center|LOCUS_02870 303250 302702 gene locus_tag LOCUS_02880 303250 302702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 303731 303252 gene locus_tag LOCUS_02890 gene ispF 303731 303252 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_02890 304441 303737 gene locus_tag LOCUS_02900 gene ispD 304441 303737 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_02900 304692 305747 gene locus_tag LOCUS_02910 gene prfB 304692 305747 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 protein_id gnl|my_center|LOCUS_02910 305872 307095 gene locus_tag LOCUS_02920 gene argJ 305872 307095 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 protein_id gnl|my_center|LOCUS_02920 307114 307980 gene locus_tag LOCUS_02930 307114 307980 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_02930 307993 308970 gene locus_tag LOCUS_02940 307993 308970 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_02940 310088 308967 gene locus_tag LOCUS_02950 310088 308967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 310442 311038 gene locus_tag LOCUS_02960 310442 311038 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_02960 311035 311409 gene locus_tag LOCUS_02970 311035 311409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 311391 311819 gene locus_tag LOCUS_02980 311391 311819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 312955 311834 gene locus_tag LOCUS_02990 gene mnmE 312955 311834 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 protein_id gnl|my_center|LOCUS_02990 315062 313263 gene locus_tag LOCUS_03000 gene yidC 315062 313263 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_03000 316356 316730 gene locus_tag LOCUS_03010 316356 316730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 318085 316751 gene locus_tag LOCUS_03020 318085 316751 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113107.1 protein_id gnl|my_center|LOCUS_03020 319443 318091 gene locus_tag LOCUS_03030 319443 318091 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_03030 321283 319517 gene locus_tag LOCUS_03040 gene aprD 321283 319517 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_03040 322244 321354 gene locus_tag LOCUS_03050 322244 321354 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_03050 323178 322237 gene locus_tag LOCUS_03060 323178 322237 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_03060 324254 323253 gene locus_tag LOCUS_03070 324254 323253 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946516.1 protein_id gnl|my_center|LOCUS_03070 328173 324310 gene locus_tag LOCUS_03080 328173 324310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 329012 328233 gene locus_tag LOCUS_03090 329012 328233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 330159 328978 gene locus_tag LOCUS_03100 330159 328978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 332002 330173 gene locus_tag LOCUS_03110 332002 330173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 333275 332013 gene locus_tag LOCUS_03120 333275 332013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 333981 333265 gene locus_tag LOCUS_03130 333981 333265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_03130 334603 337221 gene locus_tag LOCUS_03140 334603 337221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 337358 338893 gene locus_tag LOCUS_03150 337358 338893 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265659.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence02 136 564 gene locus_tag LOCUS_03160 136 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 904 1830 gene locus_tag LOCUS_03170 904 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 1870 2217 gene locus_tag LOCUS_03180 1870 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2274 3119 gene locus_tag LOCUS_03190 2274 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3831 3652 gene locus_tag LOCUS_03200 3831 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 4623 4225 gene locus_tag LOCUS_03210 4623 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 4901 5596 gene locus_tag LOCUS_03220 4901 5596 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_03220 5593 5826 gene locus_tag LOCUS_03230 5593 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 5909 7207 gene locus_tag LOCUS_03240 5909 7207 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 protein_id gnl|my_center|LOCUS_03240 7237 10077 gene locus_tag LOCUS_03250 7237 10077 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_03250 10090 11352 gene locus_tag LOCUS_03260 gene odhB 10090 11352 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065167.1 protein_id gnl|my_center|LOCUS_03260 11679 13952 gene locus_tag LOCUS_03270 11679 13952 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_03270 14168 15115 gene locus_tag LOCUS_03280 14168 15115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 18672 15190 gene locus_tag LOCUS_03290 gene dnaE 18672 15190 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 protein_id gnl|my_center|LOCUS_03290 18878 20245 gene locus_tag LOCUS_03300 gene yegQ 18878 20245 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_03300 21250 20252 gene locus_tag LOCUS_03310 21250 20252 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_03310 23142 21430 gene locus_tag LOCUS_03320 23142 21430 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811863.1 protein_id gnl|my_center|LOCUS_03320 23741 25384 gene locus_tag LOCUS_03330 23741 25384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 25403 25846 gene locus_tag LOCUS_03340 25403 25846 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889046.1 protein_id gnl|my_center|LOCUS_03340 25853 27310 gene locus_tag LOCUS_03350 25853 27310 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545843.1 protein_id gnl|my_center|LOCUS_03350 27303 27935 gene locus_tag LOCUS_03360 27303 27935 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_03360 28589 27951 gene locus_tag LOCUS_03370 28589 27951 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_03370 28925 28617 gene locus_tag LOCUS_03380 28925 28617 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_03380 30478 28964 gene locus_tag LOCUS_03390 gene ubiB 30478 28964 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_03390 31180 30581 gene locus_tag LOCUS_03400 31180 30581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 32828 31389 gene locus_tag LOCUS_03410 gene gatB 32828 31389 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_03410 34320 32872 gene locus_tag LOCUS_03420 gene gatA 34320 32872 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_03420 34678 34391 gene locus_tag LOCUS_03430 gene gatC 34678 34391 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688831.1 protein_id gnl|my_center|LOCUS_03430 34809 35867 gene locus_tag LOCUS_03440 34809 35867 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_03440 35940 36830 gene locus_tag LOCUS_03450 35940 36830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 36811 37362 gene locus_tag LOCUS_03460 gene mreD 36811 37362 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_03460 37359 39272 gene locus_tag LOCUS_03470 gene mrdA 37359 39272 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_03470 39332 40432 gene locus_tag LOCUS_03480 gene rodA 39332 40432 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_03480 40429 41403 gene locus_tag LOCUS_03490 40429 41403 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_03490 42565 41696 gene locus_tag LOCUS_03500 42565 41696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 44831 42843 gene locus_tag LOCUS_03510 44831 42843 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_03510 45805 45212 gene locus_tag LOCUS_03520 45805 45212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 47724 45805 gene locus_tag LOCUS_03530 47724 45805 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_03530 49958 47898 gene locus_tag LOCUS_03540 49958 47898 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_03540 50728 50114 gene locus_tag LOCUS_03550 50728 50114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 52811 50700 gene locus_tag LOCUS_03560 52811 50700 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_03560 54865 52799 gene locus_tag LOCUS_03570 54865 52799 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_03570 55596 55021 gene locus_tag LOCUS_03580 55596 55021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 57725 55611 gene locus_tag LOCUS_03590 57725 55611 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_03590 59740 57713 gene locus_tag LOCUS_03600 59740 57713 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_03600 61901 59958 gene locus_tag LOCUS_03610 61901 59958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 63948 61888 gene locus_tag LOCUS_03620 63948 61888 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044977.1 protein_id gnl|my_center|LOCUS_03620 66767 64005 gene locus_tag LOCUS_03630 66767 64005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 67252 66767 gene locus_tag LOCUS_03640 67252 66767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 69318 67435 gene locus_tag LOCUS_03650 gene cirA 69318 67435 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489223.1 protein_id gnl|my_center|LOCUS_03650 71478 69466 gene locus_tag LOCUS_03660 71478 69466 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074140.1 protein_id gnl|my_center|LOCUS_03660 73667 71817 gene locus_tag LOCUS_03670 73667 71817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263365.1 protein_id gnl|my_center|LOCUS_03670 74909 73674 gene locus_tag LOCUS_03680 74909 73674 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_03680 75400 75891 gene locus_tag LOCUS_03690 75400 75891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 77626 75926 gene locus_tag LOCUS_03700 77626 75926 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_03700 78694 77636 gene locus_tag LOCUS_03710 gene hypE 78694 77636 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_03710 79842 78694 gene locus_tag LOCUS_03720 gene hypD 79842 78694 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_03720 80088 79849 gene locus_tag LOCUS_03730 80088 79849 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948175.1 protein_id gnl|my_center|LOCUS_03730 80196 80738 gene locus_tag LOCUS_03740 80196 80738 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236185.1 protein_id gnl|my_center|LOCUS_03740 81014 81304 gene locus_tag LOCUS_03750 81014 81304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 82318 81392 gene locus_tag LOCUS_03760 82318 81392 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_03760 82767 83963 gene locus_tag LOCUS_03770 82767 83963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 84109 84567 gene locus_tag LOCUS_03780 84109 84567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 84575 85156 gene locus_tag LOCUS_03790 84575 85156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 86417 85146 gene locus_tag LOCUS_03800 86417 85146 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_03800 89233 86414 gene locus_tag LOCUS_03810 gene uvrA 89233 86414 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_03810 89327 90685 gene locus_tag LOCUS_03820 89327 90685 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002251980.1 protein_id gnl|my_center|LOCUS_03820 90686 91138 gene locus_tag LOCUS_03830 gene ssb 90686 91138 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_03830 91375 91169 gene locus_tag LOCUS_03840 91375 91169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 91662 92522 gene locus_tag LOCUS_03850 91662 92522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 92757 93620 gene locus_tag LOCUS_03860 92757 93620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 95860 93932 gene locus_tag LOCUS_03870 95860 93932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 99657 95857 gene locus_tag LOCUS_03880 99657 95857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 99859 99647 gene locus_tag LOCUS_03890 99859 99647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 100454 100041 gene locus_tag LOCUS_03900 100454 100041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 101443 101093 gene locus_tag LOCUS_03910 101443 101093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 102602 101622 gene locus_tag LOCUS_03920 102602 101622 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485753.1 protein_id gnl|my_center|LOCUS_03920 102807 102610 gene locus_tag LOCUS_03930 102807 102610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 103259 102825 gene locus_tag LOCUS_03940 103259 102825 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550737.1 protein_id gnl|my_center|LOCUS_03940 105087 103288 gene locus_tag LOCUS_03950 105087 103288 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234887077.1 protein_id gnl|my_center|LOCUS_03950 105961 105272 gene locus_tag LOCUS_03960 105961 105272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 106315 107841 gene locus_tag LOCUS_03970 106315 107841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 107838 109289 gene locus_tag LOCUS_03980 107838 109289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 109426 109779 gene locus_tag LOCUS_03990 109426 109779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 109859 110194 gene locus_tag LOCUS_04000 109859 110194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 110549 110268 gene locus_tag LOCUS_04010 110549 110268 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_04010 111986 110712 gene locus_tag LOCUS_04020 111986 110712 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 protein_id gnl|my_center|LOCUS_04020 112215 112529 gene locus_tag LOCUS_04030 112215 112529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 112915 113580 gene locus_tag LOCUS_04040 112915 113580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_04040 113577 116123 gene locus_tag LOCUS_04050 113577 116123 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915882.1 protein_id gnl|my_center|LOCUS_04050 116123 117217 gene locus_tag LOCUS_04060 116123 117217 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_04060 118202 117993 gene locus_tag LOCUS_04070 118202 117993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 120623 118227 gene locus_tag LOCUS_04080 120623 118227 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_04080 121287 120661 gene locus_tag LOCUS_04090 121287 120661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 122202 121408 gene locus_tag LOCUS_04100 gene tatC 122202 121408 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199900.1 protein_id gnl|my_center|LOCUS_04100 122623 122195 gene locus_tag LOCUS_04110 gene tatB 122623 122195 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906112.1 protein_id gnl|my_center|LOCUS_04110 123030 122704 gene locus_tag LOCUS_04120 123030 122704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 123413 123063 gene locus_tag LOCUS_04130 123413 123063 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 protein_id gnl|my_center|LOCUS_04130 123743 123417 gene locus_tag LOCUS_04140 123743 123417 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222845.1 protein_id gnl|my_center|LOCUS_04140 124132 123740 gene locus_tag LOCUS_04150 gene hisI 124132 123740 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 protein_id gnl|my_center|LOCUS_04150 124959 124186 gene locus_tag LOCUS_04160 gene hisF 124959 124186 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_04160 125783 125028 gene locus_tag LOCUS_04170 gene hisA 125783 125028 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_04170 126492 125848 gene locus_tag LOCUS_04180 gene hisH 126492 125848 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_04180 127108 126521 gene locus_tag LOCUS_04190 127108 126521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 128231 127146 gene locus_tag LOCUS_04200 gene hisC 128231 127146 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_04200 129209 128325 gene locus_tag LOCUS_04210 129209 128325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 130541 129372 gene locus_tag LOCUS_04220 130541 129372 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064710.1 protein_id gnl|my_center|LOCUS_04220 130765 131379 gene locus_tag LOCUS_04230 130765 131379 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_04230 131619 131918 gene locus_tag LOCUS_04240 131619 131918 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066603.1 protein_id gnl|my_center|LOCUS_04240 131956 133308 gene locus_tag LOCUS_04250 131956 133308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 133468 134022 gene locus_tag LOCUS_04260 gene sigK 133468 134022 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_04260 134019 134867 gene locus_tag LOCUS_04270 134019 134867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 135083 136333 gene locus_tag LOCUS_04280 135083 136333 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_04280 136348 137754 gene locus_tag LOCUS_04290 136348 137754 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_04290 140561 137769 gene locus_tag LOCUS_04300 140561 137769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 142182 140836 gene locus_tag LOCUS_04310 142182 140836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_04310 142597 142214 gene locus_tag LOCUS_04320 142597 142214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 143504 142734 gene locus_tag LOCUS_04330 143504 142734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 145082 143847 gene locus_tag LOCUS_04340 145082 143847 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_04340 146656 145082 gene locus_tag LOCUS_04350 146656 145082 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_04350 146852 148246 gene locus_tag LOCUS_04360 gene gltX 146852 148246 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197094.1 protein_id gnl|my_center|LOCUS_04360 148300 148375 gene locus_tag LOCUS_t00020 148300 148375 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 148420 148495 gene locus_tag LOCUS_t00030 148420 148495 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 149506 148667 gene locus_tag LOCUS_04370 149506 148667 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071369.1 protein_id gnl|my_center|LOCUS_04370 150240 149503 gene locus_tag LOCUS_04380 150240 149503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 152923 150335 gene locus_tag LOCUS_04390 152923 150335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 155488 152936 gene locus_tag LOCUS_04400 155488 152936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 155894 155655 gene locus_tag LOCUS_04410 155894 155655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 156552 156325 gene locus_tag LOCUS_04420 156552 156325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 156946 157758 gene locus_tag LOCUS_04430 156946 157758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 158533 157823 gene locus_tag LOCUS_04440 158533 157823 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_04440 158652 159014 gene locus_tag LOCUS_04450 158652 159014 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_04450 160467 159091 gene locus_tag LOCUS_04460 160467 159091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 161353 160838 gene locus_tag LOCUS_04470 161353 160838 CDS product CNP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195111.1 protein_id gnl|my_center|LOCUS_04470 163338 161350 gene locus_tag LOCUS_04480 163338 161350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 163852 163433 gene locus_tag LOCUS_04490 163852 163433 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_04490 164417 165472 gene locus_tag LOCUS_04500 164417 165472 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_04500 165554 166963 gene locus_tag LOCUS_04510 gene leuC 165554 166963 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_04510 166995 167633 gene locus_tag LOCUS_04520 gene leuD 166995 167633 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_04520 167660 168724 gene locus_tag LOCUS_04530 gene leuB 167660 168724 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_04530 168863 169975 gene locus_tag LOCUS_04540 gene asd 168863 169975 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_04540 170180 172627 gene locus_tag LOCUS_04550 gene fimV 170180 172627 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_04550 173516 174142 gene locus_tag LOCUS_04560 173516 174142 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_04560 174129 175328 gene locus_tag LOCUS_04570 gene trpB 174129 175328 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_04570 175391 176254 gene locus_tag LOCUS_04580 gene trpA 175391 176254 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_04580 176291 177166 gene locus_tag LOCUS_04590 gene accD 176291 177166 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_04590 177190 178488 gene locus_tag LOCUS_04600 gene folC 177190 178488 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 protein_id gnl|my_center|LOCUS_04600 178511 179233 gene locus_tag LOCUS_04610 178511 179233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 179289 179795 gene locus_tag LOCUS_04620 179289 179795 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957874.1 protein_id gnl|my_center|LOCUS_04620 179929 181449 gene locus_tag LOCUS_04630 gene purF 179929 181449 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_04630 181538 182713 gene locus_tag LOCUS_04640 181538 182713 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_04640 183270 182779 gene locus_tag LOCUS_04650 183270 182779 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_04650 183893 183300 gene locus_tag LOCUS_04660 183893 183300 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_04660 184044 185426 gene locus_tag LOCUS_04670 gene cysS 184044 185426 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355798.1 protein_id gnl|my_center|LOCUS_04670 186186 185440 gene locus_tag LOCUS_04680 186186 185440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 187127 186210 gene locus_tag LOCUS_04690 gene motB 187127 186210 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811924.1 protein_id gnl|my_center|LOCUS_04690 188025 187165 gene locus_tag LOCUS_04700 gene motA 188025 187165 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_04700 190063 188240 gene locus_tag LOCUS_04710 190063 188240 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_04710 191353 190085 gene locus_tag LOCUS_04720 191353 190085 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_04720 191531 191935 gene locus_tag LOCUS_04730 191531 191935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 192244 191942 gene locus_tag LOCUS_04740 192244 191942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 194019 192301 gene locus_tag LOCUS_04750 194019 192301 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 protein_id gnl|my_center|LOCUS_04750 195955 194057 gene locus_tag LOCUS_04760 195955 194057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 196234 197973 gene locus_tag LOCUS_04770 196234 197973 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 protein_id gnl|my_center|LOCUS_04770 198110 198340 gene locus_tag LOCUS_04780 198110 198340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 198333 198674 gene locus_tag LOCUS_04790 198333 198674 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074374.1 protein_id gnl|my_center|LOCUS_04790 199078 199425 gene locus_tag LOCUS_04800 199078 199425 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941219.1 protein_id gnl|my_center|LOCUS_04800 200130 199477 gene locus_tag LOCUS_04810 200130 199477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 202510 200183 gene locus_tag LOCUS_04820 202510 200183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 203372 202566 gene locus_tag LOCUS_04830 203372 202566 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_04830 203859 203503 gene locus_tag LOCUS_04840 203859 203503 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_04840 205361 203940 gene locus_tag LOCUS_04850 205361 203940 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_04850 205599 206513 gene locus_tag LOCUS_04860 205599 206513 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_04860 206532 207317 gene locus_tag LOCUS_04870 206532 207317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 207327 207557 gene locus_tag LOCUS_04880 207327 207557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 protein_id gnl|my_center|LOCUS_04880 207786 209120 gene locus_tag LOCUS_04890 gene rimO 207786 209120 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 protein_id gnl|my_center|LOCUS_04890 210296 209250 gene locus_tag LOCUS_04900 gene truB 210296 209250 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222326.1 protein_id gnl|my_center|LOCUS_04900 210627 210253 gene locus_tag LOCUS_04910 gene rbfA 210627 210253 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_04910 213290 210654 gene locus_tag LOCUS_04920 gene infB 213290 210654 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025871401.1 protein_id gnl|my_center|LOCUS_04920 214843 213371 gene locus_tag LOCUS_04930 gene nusA 214843 213371 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_04930 215338 214871 gene locus_tag LOCUS_04940 gene rimP 215338 214871 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_04940 215574 217550 gene locus_tag LOCUS_04950 gene acs 215574 217550 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_04950 217601 218566 gene locus_tag LOCUS_04960 217601 218566 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_04960 218740 218561 gene locus_tag LOCUS_04970 218740 218561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 218938 218753 gene locus_tag LOCUS_04980 218938 218753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 220611 219385 gene locus_tag LOCUS_04990 220611 219385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 221309 220611 gene locus_tag LOCUS_05000 221309 220611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 221866 222759 gene locus_tag LOCUS_05010 221866 222759 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_05010 225642 222874 gene locus_tag LOCUS_05020 225642 222874 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_05020 226142 225783 gene locus_tag LOCUS_05030 226142 225783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 226600 226154 gene locus_tag LOCUS_05040 226600 226154 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_05040 228166 226670 gene locus_tag LOCUS_05050 gene pepA 228166 226670 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209310.1 protein_id gnl|my_center|LOCUS_05050 228748 229917 gene locus_tag LOCUS_05060 228748 229917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 229961 230797 gene locus_tag LOCUS_05070 gene serB 229961 230797 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_05070 232485 230875 gene locus_tag LOCUS_05080 232485 230875 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_05080 232714 233142 gene locus_tag LOCUS_05090 232714 233142 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 protein_id gnl|my_center|LOCUS_05090 233271 234839 gene locus_tag LOCUS_05100 233271 234839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 235636 234854 gene locus_tag LOCUS_05110 235636 234854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 235931 236371 gene locus_tag LOCUS_05120 235931 236371 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188457.1 protein_id gnl|my_center|LOCUS_05120 236430 237212 gene locus_tag LOCUS_05130 236430 237212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 237293 238429 gene locus_tag LOCUS_05140 gene earP 237293 238429 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 protein_id gnl|my_center|LOCUS_05140 238524 239075 gene locus_tag LOCUS_05150 gene efp 238524 239075 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707002.1 protein_id gnl|my_center|LOCUS_05150 239693 239133 gene locus_tag LOCUS_05160 239693 239133 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639868.1 protein_id gnl|my_center|LOCUS_05160 240252 239770 gene locus_tag LOCUS_05170 240252 239770 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_05170 241511 240252 gene locus_tag LOCUS_05180 241511 240252 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_05180 242806 241517 gene locus_tag LOCUS_05190 gene sufD 242806 241517 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_05190 243603 242809 gene locus_tag LOCUS_05200 gene sufC 243603 242809 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_05200 245036 243600 gene locus_tag LOCUS_05210 gene sufB 245036 243600 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_05210 245486 245139 gene locus_tag LOCUS_05220 gene iscA 245486 245139 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_05220 246111 245650 gene locus_tag LOCUS_05230 gene iscR 246111 245650 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_05230 246577 247176 gene locus_tag LOCUS_05240 gene rpoE 246577 247176 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_05240 247178 247747 gene locus_tag LOCUS_05250 247178 247747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 247747 248727 gene locus_tag LOCUS_05260 247747 248727 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524615.1 protein_id gnl|my_center|LOCUS_05260 248840 250255 gene locus_tag LOCUS_05270 248840 250255 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363717.1 protein_id gnl|my_center|LOCUS_05270 250239 250529 gene locus_tag LOCUS_05280 250239 250529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 250631 252424 gene locus_tag LOCUS_05290 gene lepA 250631 252424 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_05290 252519 253322 gene locus_tag LOCUS_05300 gene lepB 252519 253322 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_05300 253356 253727 gene locus_tag LOCUS_05310 253356 253727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 253742 254455 gene locus_tag LOCUS_05320 253742 254455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 254477 255400 gene locus_tag LOCUS_05330 gene era 254477 255400 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_05330 255445 256170 gene locus_tag LOCUS_05340 gene pdxJ 255445 256170 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192885.1 protein_id gnl|my_center|LOCUS_05340 256167 256544 gene locus_tag LOCUS_05350 gene acpS 256167 256544 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_05350 256547 257599 gene locus_tag LOCUS_05360 gene nagZ 256547 257599 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_05360 257700 259160 gene locus_tag LOCUS_05370 gene lpdA 257700 259160 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813626.1 protein_id gnl|my_center|LOCUS_05370 259816 259370 gene locus_tag LOCUS_05380 259816 259370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 260326 261477 gene locus_tag LOCUS_05390 260326 261477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 261825 262610 gene locus_tag LOCUS_05400 261825 262610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05400 262621 263211 gene locus_tag LOCUS_05410 262621 263211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 263204 264301 gene locus_tag LOCUS_05420 gene amrS 263204 264301 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_05420 264681 265364 gene locus_tag LOCUS_05430 264681 265364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 266551 265439 gene locus_tag LOCUS_05440 gene corA 266551 265439 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_05440 266888 266712 gene locus_tag LOCUS_05450 266888 266712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 267033 267608 gene locus_tag LOCUS_05460 267033 267608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 268009 269391 gene locus_tag LOCUS_05470 268009 269391 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868922.1 protein_id gnl|my_center|LOCUS_05470 269395 270720 gene locus_tag LOCUS_05480 269395 270720 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868923.1 protein_id gnl|my_center|LOCUS_05480 270717 272891 gene locus_tag LOCUS_05490 270717 272891 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868920.1 protein_id gnl|my_center|LOCUS_05490 272875 273945 gene locus_tag LOCUS_05500 272875 273945 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263329.1 protein_id gnl|my_center|LOCUS_05500 274990 273995 gene locus_tag LOCUS_05510 274990 273995 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_05510 277239 275050 gene locus_tag LOCUS_05520 277239 275050 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195838.1 protein_id gnl|my_center|LOCUS_05520 278594 277329 gene locus_tag LOCUS_05530 278594 277329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 278479 278781 gene locus_tag LOCUS_05540 278479 278781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 278955 280067 gene locus_tag LOCUS_05550 278955 280067 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_05550 280087 280968 gene locus_tag LOCUS_05560 280087 280968 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_05560 281053 281403 gene locus_tag LOCUS_05570 281053 281403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 281524 282015 gene locus_tag LOCUS_05580 281524 282015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 282018 282401 gene locus_tag LOCUS_05590 282018 282401 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_05590 282409 282933 gene locus_tag LOCUS_05600 282409 282933 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_05600 283211 283050 gene locus_tag LOCUS_05610 283211 283050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 283323 284120 gene locus_tag LOCUS_05620 283323 284120 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967021.1 protein_id gnl|my_center|LOCUS_05620 286348 284246 gene locus_tag LOCUS_05630 286348 284246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 287037 288890 gene locus_tag LOCUS_05640 gene ftsH 287037 288890 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_05640 290182 288902 gene locus_tag LOCUS_05650 290182 288902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 292843 290507 gene locus_tag LOCUS_05660 292843 290507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_05660 294148 293105 gene locus_tag LOCUS_05670 294148 293105 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967012.1 protein_id gnl|my_center|LOCUS_05670 294301 294987 gene locus_tag LOCUS_05680 294301 294987 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence03 364 4104 gene locus_tag LOCUS_05690 364 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4875 4264 gene locus_tag LOCUS_05700 4875 4264 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920979.1 protein_id gnl|my_center|LOCUS_05700 6144 4921 gene locus_tag LOCUS_05710 6144 4921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_05710 6958 6212 gene locus_tag LOCUS_05720 6958 6212 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_05720 8103 6958 gene locus_tag LOCUS_05730 8103 6958 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_05730 9786 8512 gene locus_tag LOCUS_05740 9786 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 11499 9982 gene locus_tag LOCUS_05750 11499 9982 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_05750 13126 11750 gene locus_tag LOCUS_05760 13126 11750 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_05760 13430 13227 gene locus_tag LOCUS_05770 13430 13227 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197553.1 protein_id gnl|my_center|LOCUS_05770 14378 13458 gene locus_tag LOCUS_05780 14378 13458 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_05780 15396 14491 gene locus_tag LOCUS_05790 15396 14491 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057945.1 protein_id gnl|my_center|LOCUS_05790 15678 16541 gene locus_tag LOCUS_05800 15678 16541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 16712 17935 gene locus_tag LOCUS_05810 16712 17935 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_05810 17943 18347 gene locus_tag LOCUS_05820 17943 18347 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_05820 18360 19145 gene locus_tag LOCUS_05830 18360 19145 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084054.1 protein_id gnl|my_center|LOCUS_05830 20215 19238 gene locus_tag LOCUS_05840 20215 19238 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_05840 20830 20318 gene locus_tag LOCUS_05850 20830 20318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 22616 21189 gene locus_tag LOCUS_05860 22616 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 23666 22995 gene locus_tag LOCUS_05870 gene trmB 23666 22995 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527577.1 protein_id gnl|my_center|LOCUS_05870 24516 23701 gene locus_tag LOCUS_05880 24516 23701 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_05880 24768 24565 gene locus_tag LOCUS_05890 gene thiS 24768 24565 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_05890 25391 26584 gene locus_tag LOCUS_05900 25391 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 26766 27110 gene locus_tag LOCUS_05910 26766 27110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 28124 27243 gene locus_tag LOCUS_05920 gene htpX 28124 27243 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 protein_id gnl|my_center|LOCUS_05920 28620 28285 gene locus_tag LOCUS_05930 gene ftsB 28620 28285 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813698.1 protein_id gnl|my_center|LOCUS_05930 29900 28617 gene locus_tag LOCUS_05940 gene eno 29900 28617 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813700.1 protein_id gnl|my_center|LOCUS_05940 31685 30009 gene locus_tag LOCUS_05950 31685 30009 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_05950 32664 31780 gene locus_tag LOCUS_05960 32664 31780 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_05960 34084 32657 gene locus_tag LOCUS_05970 gene argH 34084 32657 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704829.1 protein_id gnl|my_center|LOCUS_05970 34330 34941 gene locus_tag LOCUS_05980 34330 34941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 36267 35014 gene locus_tag LOCUS_05990 gene murA 36267 35014 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527889.1 protein_id gnl|my_center|LOCUS_05990 36419 36802 gene locus_tag LOCUS_06000 36419 36802 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_06000 36844 38883 gene locus_tag LOCUS_06010 gene recG 36844 38883 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_06010 38907 39839 gene locus_tag LOCUS_06020 38907 39839 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815989.1 protein_id gnl|my_center|LOCUS_06020 41010 39865 gene locus_tag LOCUS_06030 41010 39865 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480635.1 protein_id gnl|my_center|LOCUS_06030 41355 41897 gene locus_tag LOCUS_06040 41355 41897 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 protein_id gnl|my_center|LOCUS_06040 41894 42763 gene locus_tag LOCUS_06050 gene ubiA 41894 42763 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_06050 42773 44236 gene locus_tag LOCUS_06060 gene ubiD 42773 44236 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 protein_id gnl|my_center|LOCUS_06060 44240 44584 gene locus_tag LOCUS_06070 44240 44584 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068360.1 protein_id gnl|my_center|LOCUS_06070 44783 46978 gene locus_tag LOCUS_06080 44783 46978 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_06080 47018 48343 gene locus_tag LOCUS_06090 47018 48343 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_06090 48340 49338 gene locus_tag LOCUS_06100 gene pdxA 48340 49338 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103187.1 protein_id gnl|my_center|LOCUS_06100 49341 50114 gene locus_tag LOCUS_06110 gene rsmA 49341 50114 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706653.1 protein_id gnl|my_center|LOCUS_06110 50901 50122 gene locus_tag LOCUS_06120 50901 50122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 51233 50904 gene locus_tag LOCUS_06130 51233 50904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 52275 51220 gene locus_tag LOCUS_06140 52275 51220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 52673 52341 gene locus_tag LOCUS_06150 52673 52341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 53123 52698 gene locus_tag LOCUS_06160 gene fliS 53123 52698 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160351.1 protein_id gnl|my_center|LOCUS_06160 55145 53175 gene locus_tag LOCUS_06170 55145 53175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 55521 55171 gene locus_tag LOCUS_06180 55521 55171 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_06180 57060 55609 gene locus_tag LOCUS_06190 57060 55609 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_06190 57358 58920 gene locus_tag LOCUS_06200 57358 58920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 58937 59569 gene locus_tag LOCUS_06210 gene rqpR 58937 59569 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_06210 59705 61417 gene locus_tag LOCUS_06220 59705 61417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 61623 62420 gene locus_tag LOCUS_06230 61623 62420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 62557 63795 gene locus_tag LOCUS_06240 62557 63795 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_06240 64801 63866 gene locus_tag LOCUS_06250 gene lpxK 64801 63866 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 protein_id gnl|my_center|LOCUS_06250 65125 66018 gene locus_tag LOCUS_06260 65125 66018 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_06260 66360 67529 gene locus_tag LOCUS_06270 gene moeZ 66360 67529 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223024.1 protein_id gnl|my_center|LOCUS_06270 67625 68065 gene locus_tag LOCUS_06280 67625 68065 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_06280 68289 68561 gene locus_tag LOCUS_06290 68289 68561 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559268.1 protein_id gnl|my_center|LOCUS_06290 68710 70479 gene locus_tag LOCUS_06300 68710 70479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 70476 72161 gene locus_tag LOCUS_06310 70476 72161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 72161 73363 gene locus_tag LOCUS_06320 72161 73363 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_06320 73418 74617 gene locus_tag LOCUS_06330 73418 74617 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089891.1 protein_id gnl|my_center|LOCUS_06330 75418 74633 gene locus_tag LOCUS_06340 75418 74633 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_06340 75581 77014 gene locus_tag LOCUS_06350 75581 77014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 77026 78159 gene locus_tag LOCUS_06360 77026 78159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 78271 79488 gene locus_tag LOCUS_06370 78271 79488 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730128.1 protein_id gnl|my_center|LOCUS_06370 79807 81336 gene locus_tag LOCUS_06380 79807 81336 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731610.1 protein_id gnl|my_center|LOCUS_06380 81493 82305 gene locus_tag LOCUS_06390 81493 82305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 84159 82459 gene locus_tag LOCUS_06400 84159 82459 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_06400 85326 84466 gene locus_tag LOCUS_06410 85326 84466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 85462 85818 gene locus_tag LOCUS_06420 gene queD 85462 85818 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189793.1 protein_id gnl|my_center|LOCUS_06420 85848 86630 gene locus_tag LOCUS_06430 85848 86630 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930598.1 protein_id gnl|my_center|LOCUS_06430 86614 87267 gene locus_tag LOCUS_06440 86614 87267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 87296 88039 gene locus_tag LOCUS_06450 87296 88039 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121677.1 protein_id gnl|my_center|LOCUS_06450 88061 89182 gene locus_tag LOCUS_06460 gene ald 88061 89182 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958016.1 protein_id gnl|my_center|LOCUS_06460 89340 90674 gene locus_tag LOCUS_06470 89340 90674 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_06470 92963 90777 gene locus_tag LOCUS_06480 92963 90777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 93972 93145 gene locus_tag LOCUS_06490 93972 93145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 94518 95312 gene locus_tag LOCUS_06500 94518 95312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 96192 98501 gene locus_tag LOCUS_06510 96192 98501 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810115.1 protein_id gnl|my_center|LOCUS_06510 98834 100672 gene locus_tag LOCUS_06520 98834 100672 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_06520 100852 101262 gene locus_tag LOCUS_06530 100852 101262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 101814 101290 gene locus_tag LOCUS_06540 101814 101290 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_06540 101875 103362 gene locus_tag LOCUS_06550 gene ppx 101875 103362 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731673.1 protein_id gnl|my_center|LOCUS_06550 103524 104729 gene locus_tag LOCUS_06560 gene dapC 103524 104729 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_06560 104751 105572 gene locus_tag LOCUS_06570 gene dapD 104751 105572 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095650.1 protein_id gnl|my_center|LOCUS_06570 105964 105629 gene locus_tag LOCUS_06580 105964 105629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 107107 106121 gene locus_tag LOCUS_06590 gene miaA 107107 106121 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065014.1 protein_id gnl|my_center|LOCUS_06590 107540 108739 gene locus_tag LOCUS_06600 107540 108739 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 protein_id gnl|my_center|LOCUS_06600 108826 109074 gene locus_tag LOCUS_06610 108826 109074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 109426 110235 gene locus_tag LOCUS_06620 109426 110235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 110403 111227 gene locus_tag LOCUS_06630 110403 111227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 111227 112489 gene locus_tag LOCUS_06640 111227 112489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 112691 114214 gene locus_tag LOCUS_06650 112691 114214 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_06650 114677 114297 gene locus_tag LOCUS_06660 114677 114297 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_06660 115504 117966 gene locus_tag LOCUS_06670 115504 117966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 118448 118254 gene locus_tag LOCUS_06680 118448 118254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 118754 119020 gene locus_tag LOCUS_06690 118754 119020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 119041 119844 gene locus_tag LOCUS_06700 119041 119844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 120029 120655 gene locus_tag LOCUS_06710 120029 120655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 122246 120720 gene locus_tag LOCUS_06720 122246 120720 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224914.1 protein_id gnl|my_center|LOCUS_06720 122622 122356 gene locus_tag LOCUS_06730 122622 122356 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030003521.1 protein_id gnl|my_center|LOCUS_06730 122847 123851 gene locus_tag LOCUS_06740 122847 123851 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_06740 123901 124563 gene locus_tag LOCUS_06750 123901 124563 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 protein_id gnl|my_center|LOCUS_06750 124592 125899 gene locus_tag LOCUS_06760 124592 125899 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065042.1 protein_id gnl|my_center|LOCUS_06760 125896 126267 gene locus_tag LOCUS_06770 125896 126267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 127114 126284 gene locus_tag LOCUS_06780 gene lgt 127114 126284 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_06780 127209 128882 gene locus_tag LOCUS_06790 gene ilvD 127209 128882 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_06790 129113 129424 gene locus_tag LOCUS_06800 gene nirM 129113 129424 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_06800 129529 129945 gene locus_tag LOCUS_06810 129529 129945 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_06810 130417 130055 gene locus_tag LOCUS_06820 130417 130055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 131551 130604 gene locus_tag LOCUS_06830 gene lipA 131551 130604 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807146.1 protein_id gnl|my_center|LOCUS_06830 132222 131548 gene locus_tag LOCUS_06840 gene lipB 132222 131548 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313884.1 protein_id gnl|my_center|LOCUS_06840 132431 132219 gene locus_tag LOCUS_06850 132431 132219 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_06850 133374 132517 gene locus_tag LOCUS_06860 133374 132517 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_06860 134367 133411 gene locus_tag LOCUS_06870 134367 133411 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_06870 135173 134628 gene locus_tag LOCUS_06880 135173 134628 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_06880 136027 135209 gene locus_tag LOCUS_06890 136027 135209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 136148 138217 gene locus_tag LOCUS_06900 gene ligA 136148 138217 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_06900 138783 138226 gene locus_tag LOCUS_06910 138783 138226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 138925 139494 gene locus_tag LOCUS_06920 138925 139494 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194377.1 protein_id gnl|my_center|LOCUS_06920 139488 140234 gene locus_tag LOCUS_06930 139488 140234 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_06930 140224 140757 gene locus_tag LOCUS_06940 gene def 140224 140757 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_06940 141172 142263 gene locus_tag LOCUS_06950 gene gcvT 141172 142263 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202927.1 protein_id gnl|my_center|LOCUS_06950 142297 142686 gene locus_tag LOCUS_06960 gene gcvH 142297 142686 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_06960 142735 144087 gene locus_tag LOCUS_06970 gene gcvPA 142735 144087 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_06970 144124 144621 gene locus_tag LOCUS_06980 gene tpx 144124 144621 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_06980 144642 146093 gene locus_tag LOCUS_06990 gene gcvPB 144642 146093 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_06990 146141 147076 gene locus_tag LOCUS_07000 146141 147076 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_07000 148008 147145 gene locus_tag LOCUS_07010 148008 147145 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_07010 148367 148912 gene locus_tag LOCUS_07020 148367 148912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 149535 148984 gene locus_tag LOCUS_07030 149535 148984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 150173 149973 gene locus_tag LOCUS_07040 150173 149973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 150894 150292 gene locus_tag LOCUS_07050 150894 150292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 151143 153068 gene locus_tag LOCUS_07060 151143 153068 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_07060 153114 154817 gene locus_tag LOCUS_07070 153114 154817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 154884 155651 gene locus_tag LOCUS_07080 gene xth 154884 155651 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 protein_id gnl|my_center|LOCUS_07080 156119 155664 gene locus_tag LOCUS_07090 156119 155664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 156599 156156 gene locus_tag LOCUS_07100 156599 156156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 158192 156783 gene locus_tag LOCUS_07110 gene glnA 158192 156783 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 protein_id gnl|my_center|LOCUS_07110 158503 160317 gene locus_tag LOCUS_07120 gene recQ 158503 160317 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 protein_id gnl|my_center|LOCUS_07120 160425 160607 gene locus_tag LOCUS_07130 160425 160607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 161314 162279 gene locus_tag LOCUS_07140 161314 162279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 162364 163152 gene locus_tag LOCUS_07150 162364 163152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 163263 164627 gene locus_tag LOCUS_07160 163263 164627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 164629 165561 gene locus_tag LOCUS_07170 gene epsG 164629 165561 CDS product chain length determinant protein tyrosine kinase EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106760242.1 protein_id gnl|my_center|LOCUS_07170 165585 166481 gene locus_tag LOCUS_07180 165585 166481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 166525 167211 gene locus_tag LOCUS_07190 166525 167211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 167204 168703 gene locus_tag LOCUS_07200 167204 168703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 169014 170354 gene locus_tag LOCUS_07210 169014 170354 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850092.1 protein_id gnl|my_center|LOCUS_07210 170736 171746 gene locus_tag LOCUS_07220 170736 171746 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296319.1 protein_id gnl|my_center|LOCUS_07220 171875 173101 gene locus_tag LOCUS_07230 171875 173101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 173150 174388 gene locus_tag LOCUS_07240 173150 174388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 174395 175918 gene locus_tag LOCUS_07250 174395 175918 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_07250 175981 177855 gene locus_tag LOCUS_07260 gene asnB 175981 177855 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089038.1 protein_id gnl|my_center|LOCUS_07260 177944 179941 gene locus_tag LOCUS_07270 177944 179941 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089039.1 protein_id gnl|my_center|LOCUS_07270 179996 181306 gene locus_tag LOCUS_07280 gene algD 179996 181306 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110461.1 protein_id gnl|my_center|LOCUS_07280 181287 181982 gene locus_tag LOCUS_07290 181287 181982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 182157 182783 gene locus_tag LOCUS_07300 182157 182783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878513.1 protein_id gnl|my_center|LOCUS_07300 182787 183989 gene locus_tag LOCUS_07310 182787 183989 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_07310 184253 185173 gene locus_tag LOCUS_07320 184253 185173 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_07320 185164 187065 gene locus_tag LOCUS_07330 185164 187065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 187102 188055 gene locus_tag LOCUS_07340 187102 188055 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_07340 188083 188661 gene locus_tag LOCUS_07350 188083 188661 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010578411.1 protein_id gnl|my_center|LOCUS_07350 188658 189770 gene locus_tag LOCUS_07360 188658 189770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 189806 190795 gene locus_tag LOCUS_07370 189806 190795 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061298.1 protein_id gnl|my_center|LOCUS_07370 190902 191882 gene locus_tag LOCUS_07380 190902 191882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494134.1 protein_id gnl|my_center|LOCUS_07380 191894 193345 gene locus_tag LOCUS_07390 191894 193345 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_07390 194248 193406 gene locus_tag LOCUS_07400 194248 193406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 195191 194346 gene locus_tag LOCUS_07410 gene trpC 195191 194346 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_07410 196223 195198 gene locus_tag LOCUS_07420 gene trpD 196223 195198 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_07420 196813 196247 gene locus_tag LOCUS_07430 196813 196247 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186792.1 protein_id gnl|my_center|LOCUS_07430 197059 197349 gene locus_tag LOCUS_07440 197059 197349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 198503 197916 gene locus_tag LOCUS_07450 198503 197916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence04 120 602 gene locus_tag LOCUS_07460 120 602 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_07460 2092 674 gene locus_tag LOCUS_07470 2092 674 CDS product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_07470 4110 2332 gene locus_tag LOCUS_07480 4110 2332 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_07480 4312 4830 gene locus_tag LOCUS_07490 4312 4830 CDS product DUF3617 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401328.1 protein_id gnl|my_center|LOCUS_07490 5591 4992 gene locus_tag LOCUS_07500 5591 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7634 5610 gene locus_tag LOCUS_07510 7634 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 7973 8671 gene locus_tag LOCUS_07520 7973 8671 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_07520 8924 9667 gene locus_tag LOCUS_07530 8924 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10275 9835 gene locus_tag LOCUS_07540 10275 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 11016 10387 gene locus_tag LOCUS_07550 11016 10387 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_07550 11591 11016 gene locus_tag LOCUS_07560 11591 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 12769 11591 gene locus_tag LOCUS_07570 12769 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 12902 13309 gene locus_tag LOCUS_07580 12902 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 13622 14131 gene locus_tag LOCUS_07590 13622 14131 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_07590 14164 14613 gene locus_tag LOCUS_07600 14164 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14742 17126 gene locus_tag LOCUS_07610 gene lon 14742 17126 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088915.1 protein_id gnl|my_center|LOCUS_07610 17313 17609 gene locus_tag LOCUS_07620 17313 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 18348 17734 gene locus_tag LOCUS_07630 18348 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 19016 18555 gene locus_tag LOCUS_07640 19016 18555 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_07640 19423 19025 gene locus_tag LOCUS_07650 19423 19025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 20556 19558 gene locus_tag LOCUS_07660 20556 19558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 21013 20786 gene locus_tag LOCUS_07670 21013 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 22960 21539 gene locus_tag LOCUS_07680 gene nhaC 22960 21539 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_07680 23587 22970 gene locus_tag LOCUS_07690 23587 22970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 23623 24840 gene locus_tag LOCUS_07700 23623 24840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 25043 25357 gene locus_tag LOCUS_07710 25043 25357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 25553 27040 gene locus_tag LOCUS_07720 25553 27040 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_07720 27077 27460 gene locus_tag LOCUS_07730 27077 27460 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_07730 28115 27501 gene locus_tag LOCUS_07740 28115 27501 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105558.1 protein_id gnl|my_center|LOCUS_07740 29611 28115 gene locus_tag LOCUS_07750 29611 28115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 30212 31204 gene locus_tag LOCUS_07760 30212 31204 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_07760 31339 31106 gene locus_tag LOCUS_07770 31339 31106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 31379 31705 gene locus_tag LOCUS_07780 31379 31705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 32261 33709 gene locus_tag LOCUS_07790 32261 33709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 34172 35545 gene locus_tag LOCUS_07800 34172 35545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 35618 36787 gene locus_tag LOCUS_07810 35618 36787 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_07810 36784 39852 gene locus_tag LOCUS_07820 36784 39852 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_07820 39862 40188 gene locus_tag LOCUS_07830 39862 40188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 41065 40193 gene locus_tag LOCUS_07840 41065 40193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 42563 41073 gene locus_tag LOCUS_07850 42563 41073 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946783.1 protein_id gnl|my_center|LOCUS_07850 43302 42553 gene locus_tag LOCUS_07860 43302 42553 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946784.1 protein_id gnl|my_center|LOCUS_07860 43584 43318 gene locus_tag LOCUS_07870 43584 43318 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019235654.1 protein_id gnl|my_center|LOCUS_07870 44258 43581 gene locus_tag LOCUS_07880 44258 43581 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946786.1 protein_id gnl|my_center|LOCUS_07880 44530 44258 gene locus_tag LOCUS_07890 44530 44258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 44943 44536 gene locus_tag LOCUS_07900 44943 44536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 46337 44940 gene locus_tag LOCUS_07910 gene atpD 46337 44940 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946152.1 protein_id gnl|my_center|LOCUS_07910 47866 46556 gene locus_tag LOCUS_07920 47866 46556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 48544 48356 gene locus_tag LOCUS_07930 48544 48356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 49090 48587 gene locus_tag LOCUS_07940 49090 48587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 49513 49109 gene locus_tag LOCUS_07950 49513 49109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 50080 49643 gene locus_tag LOCUS_07960 50080 49643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 50914 50198 gene locus_tag LOCUS_07970 50914 50198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 52637 50997 gene locus_tag LOCUS_07980 52637 50997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 52910 52710 gene locus_tag LOCUS_07990 52910 52710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 53406 52867 gene locus_tag LOCUS_08000 53406 52867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 54101 53454 gene locus_tag LOCUS_08010 54101 53454 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018676.1 protein_id gnl|my_center|LOCUS_08010 56628 54130 gene locus_tag LOCUS_08020 56628 54130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 58117 56771 gene locus_tag LOCUS_08030 58117 56771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 58212 58418 gene locus_tag LOCUS_08040 58212 58418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 60174 58387 gene locus_tag LOCUS_08050 60174 58387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 61275 60184 gene locus_tag LOCUS_08060 61275 60184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 65021 61788 gene locus_tag LOCUS_08070 65021 61788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 68142 65026 gene locus_tag LOCUS_08080 68142 65026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 68458 68129 gene locus_tag LOCUS_08090 68458 68129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 69293 68460 gene locus_tag LOCUS_08100 69293 68460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 73096 69266 gene locus_tag LOCUS_08110 73096 69266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 73566 73114 gene locus_tag LOCUS_08120 73566 73114 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_08120 73855 73556 gene locus_tag LOCUS_08130 73855 73556 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_08130 75692 73902 gene locus_tag LOCUS_08140 75692 73902 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_08140 76402 75701 gene locus_tag LOCUS_08150 76402 75701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 76567 76403 gene locus_tag LOCUS_08160 76567 76403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 77067 76585 gene locus_tag LOCUS_08170 77067 76585 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_08170 77549 77091 gene locus_tag LOCUS_08180 77549 77091 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_08180 79217 77628 gene locus_tag LOCUS_08190 79217 77628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 79800 79420 gene locus_tag LOCUS_08200 79800 79420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 80207 80359 gene locus_tag LOCUS_08210 80207 80359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 80990 80493 gene locus_tag LOCUS_08220 80990 80493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 82322 81213 gene locus_tag LOCUS_08230 gene dnaJ 82322 81213 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_08230 84408 82471 gene locus_tag LOCUS_08240 gene dnaK 84408 82471 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_08240 85070 84477 gene locus_tag LOCUS_08250 gene grpE 85070 84477 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_08250 86574 85201 gene locus_tag LOCUS_08260 gene purB 86574 85201 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224850.1 protein_id gnl|my_center|LOCUS_08260 86792 86607 gene locus_tag LOCUS_08270 86792 86607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 86805 87299 gene locus_tag LOCUS_08280 86805 87299 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_08280 87310 88416 gene locus_tag LOCUS_08290 87310 88416 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189192.1 protein_id gnl|my_center|LOCUS_08290 88416 89258 gene locus_tag LOCUS_08300 gene fghA 88416 89258 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526232.1 protein_id gnl|my_center|LOCUS_08300 89390 90268 gene locus_tag LOCUS_08310 89390 90268 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_08310 90439 90627 gene locus_tag LOCUS_08320 90439 90627 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_08320 90636 90848 gene locus_tag LOCUS_08330 90636 90848 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_08330 90885 91082 gene locus_tag LOCUS_08340 90885 91082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 91079 91318 gene locus_tag LOCUS_08350 91079 91318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 91416 91688 gene locus_tag LOCUS_08360 91416 91688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 91705 91938 gene locus_tag LOCUS_08370 91705 91938 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681991.1 protein_id gnl|my_center|LOCUS_08370 91941 93566 gene locus_tag LOCUS_08380 91941 93566 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_08380 96664 93617 gene locus_tag LOCUS_08390 96664 93617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 96901 97629 gene locus_tag LOCUS_08400 gene phoB 96901 97629 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_08400 99087 97891 gene locus_tag LOCUS_08410 99087 97891 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036845.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08410 99434 100981 gene locus_tag LOCUS_08420 99434 100981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 101110 101418 gene locus_tag LOCUS_08430 101110 101418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 101509 101880 gene locus_tag LOCUS_08440 101509 101880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 102322 101891 gene locus_tag LOCUS_08450 102322 101891 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 protein_id gnl|my_center|LOCUS_08450 103654 102359 gene locus_tag LOCUS_08460 103654 102359 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852902.1 protein_id gnl|my_center|LOCUS_08460 104839 103688 gene locus_tag LOCUS_08470 104839 103688 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_08470 105070 104885 gene locus_tag LOCUS_08480 105070 104885 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193501.1 protein_id gnl|my_center|LOCUS_08480 106199 105324 gene locus_tag LOCUS_08490 gene hflC 106199 105324 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_08490 107390 106200 gene locus_tag LOCUS_08500 gene hflK 107390 106200 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_08500 108614 107412 gene locus_tag LOCUS_08510 gene hflX 108614 107412 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_08510 108856 108611 gene locus_tag LOCUS_08520 gene hfq 108856 108611 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_08520 110090 109098 gene locus_tag LOCUS_08530 110090 109098 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_08530 110814 110254 gene locus_tag LOCUS_08540 110814 110254 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_08540 111020 112729 gene locus_tag LOCUS_08550 111020 112729 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_08550 112717 113307 gene locus_tag LOCUS_08560 112717 113307 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_08560 113790 113341 gene locus_tag LOCUS_08570 113790 113341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 115361 113826 gene locus_tag LOCUS_08580 115361 113826 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_08580 116369 115587 gene locus_tag LOCUS_08590 gene pssA 116369 115587 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522420.1 protein_id gnl|my_center|LOCUS_08590 117169 116504 gene locus_tag LOCUS_08600 117169 116504 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 protein_id gnl|my_center|LOCUS_08600 118244 117228 gene locus_tag LOCUS_08610 gene ilvC 118244 117228 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_08610 118855 118364 gene locus_tag LOCUS_08620 gene ilvN 118855 118364 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_08620 120563 118860 gene locus_tag LOCUS_08630 120563 118860 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 protein_id gnl|my_center|LOCUS_08630 122163 120679 gene locus_tag LOCUS_08640 gene tldD 122163 120679 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_08640 123080 122217 gene locus_tag LOCUS_08650 123080 122217 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_08650 123326 126112 gene locus_tag LOCUS_08660 gene glnE 123326 126112 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951341.1 protein_id gnl|my_center|LOCUS_08660 126316 126759 gene locus_tag LOCUS_08670 126316 126759 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 protein_id gnl|my_center|LOCUS_08670 129505 127118 gene locus_tag LOCUS_08680 129505 127118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 130281 129517 gene locus_tag LOCUS_08690 130281 129517 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_08690 130728 130303 gene locus_tag LOCUS_08700 130728 130303 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_08700 131484 130762 gene locus_tag LOCUS_08710 131484 130762 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 protein_id gnl|my_center|LOCUS_08710 132707 131523 gene locus_tag LOCUS_08720 132707 131523 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_08720 132957 132700 gene locus_tag LOCUS_08730 132957 132700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 133106 134062 gene locus_tag LOCUS_08740 gene pip 133106 134062 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_08740 134790 134095 gene locus_tag LOCUS_08750 134790 134095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 135646 134690 gene locus_tag LOCUS_08760 135646 134690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 135885 137123 gene locus_tag LOCUS_08770 135885 137123 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_08770 137609 137154 gene locus_tag LOCUS_08780 137609 137154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 138526 137606 gene locus_tag LOCUS_08790 138526 137606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 138722 139684 gene locus_tag LOCUS_08800 138722 139684 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_08800 140257 139868 gene locus_tag LOCUS_08810 140257 139868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 140488 140276 gene locus_tag LOCUS_08820 140488 140276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 141210 140629 gene locus_tag LOCUS_08830 141210 140629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 protein_id gnl|my_center|LOCUS_08830 141989 141402 gene locus_tag LOCUS_08840 141989 141402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 142866 142165 gene locus_tag LOCUS_08850 142866 142165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 143709 143059 gene locus_tag LOCUS_08860 143709 143059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 144090 143794 gene locus_tag LOCUS_08870 144090 143794 CDS product DUF3175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957602.1 protein_id gnl|my_center|LOCUS_08870 144839 144282 gene locus_tag LOCUS_08880 144839 144282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 145767 145105 gene locus_tag LOCUS_08890 gene bioD 145767 145105 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 protein_id gnl|my_center|LOCUS_08890 146654 145776 gene locus_tag LOCUS_08900 gene bioC 146654 145776 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957596.1 protein_id gnl|my_center|LOCUS_08900 147402 146632 gene locus_tag LOCUS_08910 gene bioH 147402 146632 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_08910 148565 147405 gene locus_tag LOCUS_08920 gene bioF 148565 147405 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_08920 149573 148566 gene locus_tag LOCUS_08930 gene bioB 149573 148566 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_08930 149894 150403 gene locus_tag LOCUS_08940 149894 150403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 150414 150878 gene locus_tag LOCUS_08950 gene trmL 150414 150878 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 protein_id gnl|my_center|LOCUS_08950 152998 150887 gene locus_tag LOCUS_08960 152998 150887 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_08960 153527 153009 gene locus_tag LOCUS_08970 gene pilP 153527 153009 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266376.1 protein_id gnl|my_center|LOCUS_08970 154148 153531 gene locus_tag LOCUS_08980 154148 153531 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_08980 154742 154158 gene locus_tag LOCUS_08990 gene pilN 154742 154158 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_08990 155839 154739 gene locus_tag LOCUS_09000 155839 154739 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_09000 156064 158385 gene locus_tag LOCUS_09010 156064 158385 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_09010 159355 158390 gene locus_tag LOCUS_09020 gene hemB 159355 158390 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 protein_id gnl|my_center|LOCUS_09020 160187 159591 gene locus_tag LOCUS_09030 gene yihA 160187 159591 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687358.1 protein_id gnl|my_center|LOCUS_09030 160957 160199 gene locus_tag LOCUS_09040 160957 160199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09040 161483 160965 gene locus_tag LOCUS_09050 161483 160965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 162208 161870 gene locus_tag LOCUS_09060 gene rplQ 162208 161870 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_09060 163256 162255 gene locus_tag LOCUS_09070 gene rpoA 163256 162255 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_09070 163921 163295 gene locus_tag LOCUS_09080 gene rpsD 163921 163295 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_09080 164320 163931 gene locus_tag LOCUS_09090 gene rpsK 164320 163931 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_09090 164710 164351 gene locus_tag LOCUS_09100 gene rpsM 164710 164351 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 protein_id gnl|my_center|LOCUS_09100 165087 164869 gene locus_tag LOCUS_09110 gene infA 165087 164869 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215452.1 protein_id gnl|my_center|LOCUS_09110 166450 165122 gene locus_tag LOCUS_09120 gene secY 166450 165122 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_09120 166899 166447 gene locus_tag LOCUS_09130 gene rplO 166899 166447 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957463.1 protein_id gnl|my_center|LOCUS_09130 167087 166905 gene locus_tag LOCUS_09140 gene rpmD 167087 166905 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_09140 167622 167074 gene locus_tag LOCUS_09150 gene rpsE 167622 167074 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215445.1 protein_id gnl|my_center|LOCUS_09150 167988 167632 gene locus_tag LOCUS_09160 gene rplR 167988 167632 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 protein_id gnl|my_center|LOCUS_09160 168533 168000 gene locus_tag LOCUS_09170 gene rplF 168533 168000 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_09170 168948 168553 gene locus_tag LOCUS_09180 gene rpsH 168948 168553 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_09180 169287 168982 gene locus_tag LOCUS_09190 gene rpsN 169287 168982 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806919.1 protein_id gnl|my_center|LOCUS_09190 169834 169295 gene locus_tag LOCUS_09200 gene rplE 169834 169295 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690070.1 protein_id gnl|my_center|LOCUS_09200 170167 169853 gene locus_tag LOCUS_09210 gene rplX 170167 169853 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317102.1 protein_id gnl|my_center|LOCUS_09210 170550 170182 gene locus_tag LOCUS_09220 gene rplN 170550 170182 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197951.1 protein_id gnl|my_center|LOCUS_09220 170923 170660 gene locus_tag LOCUS_09230 gene rpsQ 170923 170660 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_09230 171110 170913 gene locus_tag LOCUS_09240 171110 170913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 171528 171112 gene locus_tag LOCUS_09250 gene rplP 171528 171112 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_09250 172357 171584 gene locus_tag LOCUS_09260 gene rpsC 172357 171584 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_09260 172719 172372 gene locus_tag LOCUS_09270 gene rplV 172719 172372 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199272.1 protein_id gnl|my_center|LOCUS_09270 173010 172729 gene locus_tag LOCUS_09280 gene rpsS 173010 172729 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215422.1 protein_id gnl|my_center|LOCUS_09280 173852 173019 gene locus_tag LOCUS_09290 gene rplB 173852 173019 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199274.1 protein_id gnl|my_center|LOCUS_09290 174187 173852 gene locus_tag LOCUS_09300 gene rplW 174187 173852 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_09300 174798 174184 gene locus_tag LOCUS_09310 gene rplD 174798 174184 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215402.1 protein_id gnl|my_center|LOCUS_09310 175479 174838 gene locus_tag LOCUS_09320 gene rplC 175479 174838 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521904.1 protein_id gnl|my_center|LOCUS_09320 175881 175573 gene locus_tag LOCUS_09330 gene rpsJ 175881 175573 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence05 140 541 gene locus_tag LOCUS_09340 140 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 554 2581 gene locus_tag LOCUS_09350 554 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3267 2650 gene locus_tag LOCUS_09360 3267 2650 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766688.1 protein_id gnl|my_center|LOCUS_09360 4346 3270 gene locus_tag LOCUS_09370 gene cobT 4346 3270 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038174.1 protein_id gnl|my_center|LOCUS_09370 4873 4343 gene locus_tag LOCUS_09380 gene cobU 4873 4343 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_09380 6351 4870 gene locus_tag LOCUS_09390 6351 4870 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 protein_id gnl|my_center|LOCUS_09390 6969 6364 gene locus_tag LOCUS_09400 gene cobO 6969 6364 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393737.1 protein_id gnl|my_center|LOCUS_09400 7555 6974 gene locus_tag LOCUS_09410 7555 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038180.1 protein_id gnl|my_center|LOCUS_09410 9417 7570 gene locus_tag LOCUS_09420 gene btuB 9417 7570 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_09420 9984 10060 gene locus_tag LOCUS_t00040 9984 10060 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10525 10998 gene locus_tag LOCUS_09430 gene creA 10525 10998 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 protein_id gnl|my_center|LOCUS_09430 11117 12370 gene locus_tag LOCUS_09440 gene hemA 11117 12370 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_09440 12367 13446 gene locus_tag LOCUS_09450 gene prfA 12367 13446 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186862.1 protein_id gnl|my_center|LOCUS_09450 13454 14359 gene locus_tag LOCUS_09460 gene prmC 13454 14359 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948043.1 protein_id gnl|my_center|LOCUS_09460 14422 14736 gene locus_tag LOCUS_09470 gene grxD 14422 14736 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_09470 15255 14836 gene locus_tag LOCUS_09480 15255 14836 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370062.1 protein_id gnl|my_center|LOCUS_09480 15452 16117 gene locus_tag LOCUS_09490 15452 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 17181 16282 gene locus_tag LOCUS_09500 17181 16282 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_09500 17286 19583 gene locus_tag LOCUS_09510 gene metE 17286 19583 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_09510 19655 20398 gene locus_tag LOCUS_09520 19655 20398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 21440 20475 gene locus_tag LOCUS_09530 gene gshB 21440 20475 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 protein_id gnl|my_center|LOCUS_09530 22744 21437 gene locus_tag LOCUS_09540 gene gshA 22744 21437 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_09540 22858 24837 gene locus_tag LOCUS_09550 22858 24837 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522854.1 protein_id gnl|my_center|LOCUS_09550 25084 26181 gene locus_tag LOCUS_09560 gene nirK 25084 26181 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965519.1 protein_id gnl|my_center|LOCUS_09560 26278 26805 gene locus_tag LOCUS_09570 26278 26805 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383583.1 protein_id gnl|my_center|LOCUS_09570 28227 26842 gene locus_tag LOCUS_09580 gene mpl 28227 26842 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_09580 28412 29299 gene locus_tag LOCUS_09590 gene gluQRS 28412 29299 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221978.1 protein_id gnl|my_center|LOCUS_09590 29444 30628 gene locus_tag LOCUS_09600 29444 30628 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100962.1 protein_id gnl|my_center|LOCUS_09600 30650 31129 gene locus_tag LOCUS_09610 30650 31129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 31184 31636 gene locus_tag LOCUS_09620 31184 31636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 31923 33083 gene locus_tag LOCUS_09630 31923 33083 CDS product NAD-dependent formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169958.1 protein_id gnl|my_center|LOCUS_09630 33548 33458 gene locus_tag LOCUS_t00050 33548 33458 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33761 35581 gene locus_tag LOCUS_09640 33761 35581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 35693 36148 gene locus_tag LOCUS_09650 35693 36148 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_09650 36138 37253 gene locus_tag LOCUS_09660 gene mnmA 36138 37253 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_09660 37433 38116 gene locus_tag LOCUS_09670 37433 38116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 38554 38844 gene locus_tag LOCUS_09680 gene groES 38554 38844 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808621.1 protein_id gnl|my_center|LOCUS_09680 38907 40556 gene locus_tag LOCUS_09690 gene groL 38907 40556 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_09690 40722 41468 gene locus_tag LOCUS_09700 40722 41468 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_09700 41544 41628 gene locus_tag LOCUS_t00060 41544 41628 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41724 43028 gene locus_tag LOCUS_09710 gene tig 41724 43028 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_09710 43030 43671 gene locus_tag LOCUS_09720 gene clpP 43030 43671 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122257.1 protein_id gnl|my_center|LOCUS_09720 43744 45018 gene locus_tag LOCUS_09730 gene clpX 43744 45018 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_09730 45236 47647 gene locus_tag LOCUS_09740 gene lon 45236 47647 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_09740 48442 47687 gene locus_tag LOCUS_09750 48442 47687 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011945636.1 protein_id gnl|my_center|LOCUS_09750 49026 49610 gene locus_tag LOCUS_09760 49026 49610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 49685 50878 gene locus_tag LOCUS_09770 49685 50878 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_09770 51650 51012 gene locus_tag LOCUS_09780 51650 51012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 52693 51692 gene locus_tag LOCUS_09790 52693 51692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 53055 54377 gene locus_tag LOCUS_09800 53055 54377 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_09800 55836 54391 gene locus_tag LOCUS_09810 55836 54391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 56538 56044 gene locus_tag LOCUS_09820 56538 56044 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_09820 56626 57588 gene locus_tag LOCUS_09830 56626 57588 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_09830 57624 57956 gene locus_tag LOCUS_09840 57624 57956 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_09840 59281 57965 gene locus_tag LOCUS_09850 59281 57965 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020429.1 protein_id gnl|my_center|LOCUS_09850 59424 59972 gene locus_tag LOCUS_09860 gene greB 59424 59972 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_09860 60269 59982 gene locus_tag LOCUS_09870 60269 59982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 60435 61628 gene locus_tag LOCUS_09880 gene dinB 60435 61628 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 protein_id gnl|my_center|LOCUS_09880 61803 62468 gene locus_tag LOCUS_09890 61803 62468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 63384 62500 gene locus_tag LOCUS_09900 63384 62500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 63779 65176 gene locus_tag LOCUS_09910 63779 65176 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121818.1 protein_id gnl|my_center|LOCUS_09910 66173 65241 gene locus_tag LOCUS_09920 gene rluD 66173 65241 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073400.1 protein_id gnl|my_center|LOCUS_09920 66247 67065 gene locus_tag LOCUS_09930 66247 67065 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193722.1 protein_id gnl|my_center|LOCUS_09930 67524 67078 gene locus_tag LOCUS_09940 67524 67078 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_09940 68462 67728 gene locus_tag LOCUS_09950 68462 67728 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250141.1 protein_id gnl|my_center|LOCUS_09950 68434 68616 gene locus_tag LOCUS_09960 68434 68616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 69235 70902 gene locus_tag LOCUS_09970 69235 70902 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259629.1 protein_id gnl|my_center|LOCUS_09970 71940 70939 gene locus_tag LOCUS_09980 71940 70939 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 protein_id gnl|my_center|LOCUS_09980 73468 71921 gene locus_tag LOCUS_09990 73468 71921 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261592.1 protein_id gnl|my_center|LOCUS_09990 74109 73468 gene locus_tag LOCUS_10000 74109 73468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 74747 74340 gene locus_tag LOCUS_10010 74747 74340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 76565 74811 gene locus_tag LOCUS_10020 gene lpdA 76565 74811 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035792.1 protein_id gnl|my_center|LOCUS_10020 77852 76587 gene locus_tag LOCUS_10030 77852 76587 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_10030 78461 79633 gene locus_tag LOCUS_10040 78461 79633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 80383 79733 gene locus_tag LOCUS_10050 80383 79733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 80972 80508 gene locus_tag LOCUS_10060 gene bfr 80972 80508 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188572.1 protein_id gnl|my_center|LOCUS_10060 81378 81193 gene locus_tag LOCUS_10070 81378 81193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 83385 81838 gene locus_tag LOCUS_10080 83385 81838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 84813 83398 gene locus_tag LOCUS_10090 84813 83398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 85391 84813 gene locus_tag LOCUS_10100 85391 84813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 87300 85375 gene locus_tag LOCUS_10110 87300 85375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 87878 87297 gene locus_tag LOCUS_10120 87878 87297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 94078 87890 gene locus_tag LOCUS_10130 94078 87890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 95314 94286 gene locus_tag LOCUS_10140 95314 94286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 96741 95317 gene locus_tag LOCUS_10150 96741 95317 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_10150 97248 96760 gene locus_tag LOCUS_10160 97248 96760 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_10160 98019 97402 gene locus_tag LOCUS_10170 98019 97402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 98566 98024 gene locus_tag LOCUS_10180 98566 98024 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_10180 99154 101265 gene locus_tag LOCUS_10190 99154 101265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 101258 101908 gene locus_tag LOCUS_10200 101258 101908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_10200 102311 102081 gene locus_tag LOCUS_10210 102311 102081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 102744 102340 gene locus_tag LOCUS_10220 102744 102340 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120966.1 protein_id gnl|my_center|LOCUS_10220 104172 102829 gene locus_tag LOCUS_10230 104172 102829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 104828 104580 gene locus_tag LOCUS_10240 104828 104580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 106496 104916 gene locus_tag LOCUS_10250 106496 104916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 106920 106483 gene locus_tag LOCUS_10260 106920 106483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 108164 106917 gene locus_tag LOCUS_10270 108164 106917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 protein_id gnl|my_center|LOCUS_10270 109580 108381 gene locus_tag LOCUS_10280 109580 108381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_10280 111057 109795 gene locus_tag LOCUS_10290 111057 109795 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038451.1 protein_id gnl|my_center|LOCUS_10290 111665 111252 gene locus_tag LOCUS_10300 gene rnk 111665 111252 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_10300 112264 111806 gene locus_tag LOCUS_10310 112264 111806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 113427 112516 gene locus_tag LOCUS_10320 113427 112516 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_10320 113760 113966 gene locus_tag LOCUS_10330 113760 113966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 114259 114609 gene locus_tag LOCUS_10340 114259 114609 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813393.1 protein_id gnl|my_center|LOCUS_10340 114898 115191 gene locus_tag LOCUS_10350 114898 115191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 115465 115656 gene locus_tag LOCUS_10360 115465 115656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 116908 115706 gene locus_tag LOCUS_10370 116908 115706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_10370 117578 116895 gene locus_tag LOCUS_10380 117578 116895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_10380 118726 117575 gene locus_tag LOCUS_10390 118726 117575 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946587.1 protein_id gnl|my_center|LOCUS_10390 118857 120488 gene locus_tag LOCUS_10400 118857 120488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 121880 120789 gene locus_tag LOCUS_10410 121880 120789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 122770 121946 gene locus_tag LOCUS_10420 122770 121946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 123267 124832 gene locus_tag LOCUS_10430 123267 124832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 124829 126913 gene locus_tag LOCUS_10440 124829 126913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 126938 127795 gene locus_tag LOCUS_10450 126938 127795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 127888 128181 gene locus_tag LOCUS_10460 127888 128181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 128178 128684 gene locus_tag LOCUS_10470 128178 128684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 128700 129890 gene locus_tag LOCUS_10480 gene sucC 128700 129890 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_10480 129909 130784 gene locus_tag LOCUS_10490 gene sucD 129909 130784 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_10490 130813 131124 gene locus_tag LOCUS_10500 130813 131124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 131139 132581 gene locus_tag LOCUS_10510 gene dacB 131139 132581 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189150.1 protein_id gnl|my_center|LOCUS_10510 132706 133296 gene locus_tag LOCUS_10520 132706 133296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 134876 133404 gene locus_tag LOCUS_10530 gene trpE 134876 133404 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 protein_id gnl|my_center|LOCUS_10530 135607 134879 gene locus_tag LOCUS_10540 135607 134879 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_10540 136322 135642 gene locus_tag LOCUS_10550 gene rpe 136322 135642 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186923.1 protein_id gnl|my_center|LOCUS_10550 136467 136871 gene locus_tag LOCUS_10560 gene apaG 136467 136871 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_10560 136930 137634 gene locus_tag LOCUS_10570 136930 137634 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_10570 138080 137685 gene locus_tag LOCUS_10580 gene gloA 138080 137685 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814410.1 protein_id gnl|my_center|LOCUS_10580 138269 138081 gene locus_tag LOCUS_10590 138269 138081 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_10590 138322 139185 gene locus_tag LOCUS_10600 138322 139185 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_10600 139190 139879 gene locus_tag LOCUS_10610 gene thiE 139190 139879 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038371.1 protein_id gnl|my_center|LOCUS_10610 139902 141182 gene locus_tag LOCUS_10620 gene hemL 139902 141182 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_10620 141907 141242 gene locus_tag LOCUS_10630 141907 141242 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_10630 142042 142632 gene locus_tag LOCUS_10640 142042 142632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 142760 143527 gene locus_tag LOCUS_10650 gene map 142760 143527 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_10650 143547 144269 gene locus_tag LOCUS_10660 gene rph 143547 144269 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_10660 144266 144868 gene locus_tag LOCUS_10670 gene rdgB 144266 144868 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222823.1 protein_id gnl|my_center|LOCUS_10670 145365 144919 gene locus_tag LOCUS_10680 145365 144919 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941761.1 protein_id gnl|my_center|LOCUS_10680 147556 145496 gene locus_tag LOCUS_10690 147556 145496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 148311 147553 gene locus_tag LOCUS_10700 148311 147553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 148908 148330 gene locus_tag LOCUS_10710 148908 148330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 149109 150284 gene locus_tag LOCUS_10720 149109 150284 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_10720 150775 151428 gene locus_tag LOCUS_10730 150775 151428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 153208 151868 gene locus_tag LOCUS_10740 153208 151868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 156901 153386 gene locus_tag LOCUS_10750 gene mfd 156901 153386 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_10750 157115 157948 gene locus_tag LOCUS_10760 157115 157948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 158090 158686 gene locus_tag LOCUS_10770 158090 158686 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766688.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence06 1405 134 gene locus_tag LOCUS_10780 1405 134 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494096.1 protein_id gnl|my_center|LOCUS_10780 2121 1402 gene locus_tag LOCUS_10790 2121 1402 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815182.1 protein_id gnl|my_center|LOCUS_10790 3312 2389 gene locus_tag LOCUS_10800 3312 2389 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 protein_id gnl|my_center|LOCUS_10800 3482 4540 gene locus_tag LOCUS_10810 3482 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5068 4595 gene locus_tag LOCUS_10820 5068 4595 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_10820 5321 6121 gene locus_tag LOCUS_10830 5321 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_10830 7835 6183 gene locus_tag LOCUS_10840 7835 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 9014 7875 gene locus_tag LOCUS_10850 9014 7875 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_10850 9076 9822 gene locus_tag LOCUS_10860 9076 9822 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202811.1 protein_id gnl|my_center|LOCUS_10860 10050 11252 gene locus_tag LOCUS_10870 10050 11252 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549948.1 protein_id gnl|my_center|LOCUS_10870 12020 11298 gene locus_tag LOCUS_10880 12020 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 13212 12046 gene locus_tag LOCUS_10890 13212 12046 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_10890 13302 13377 gene locus_tag LOCUS_t00070 13302 13377 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13721 13933 gene locus_tag LOCUS_10900 gene rpsU 13721 13933 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_10900 14048 14494 gene locus_tag LOCUS_10910 14048 14494 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_10910 14574 16376 gene locus_tag LOCUS_10920 gene dnaG 14574 16376 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190679.1 protein_id gnl|my_center|LOCUS_10920 16446 18722 gene locus_tag LOCUS_10930 gene rpoD 16446 18722 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930783.1 protein_id gnl|my_center|LOCUS_10930 18734 18810 gene locus_tag LOCUS_t00080 18734 18810 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19860 18835 gene locus_tag LOCUS_10940 19860 18835 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_10940 20340 20047 gene locus_tag LOCUS_10950 20340 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 20887 20330 gene locus_tag LOCUS_10960 20887 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 21758 21441 gene locus_tag LOCUS_10970 21758 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 23118 22159 gene locus_tag LOCUS_10980 23118 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 24502 23129 gene locus_tag LOCUS_10990 24502 23129 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_10990 24810 25061 gene locus_tag LOCUS_11000 24810 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 25061 25375 gene locus_tag LOCUS_11010 25061 25375 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_11010 25717 26334 gene locus_tag LOCUS_11020 25717 26334 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 protein_id gnl|my_center|LOCUS_11020 26505 28424 gene locus_tag LOCUS_11030 gene ftsH 26505 28424 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_11030 28551 29342 gene locus_tag LOCUS_11040 gene folP 28551 29342 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275372.1 protein_id gnl|my_center|LOCUS_11040 29384 30745 gene locus_tag LOCUS_11050 gene glmM 29384 30745 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_11050 30925 31923 gene locus_tag LOCUS_11060 30925 31923 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_11060 32068 33504 gene locus_tag LOCUS_11070 gene cysG 32068 33504 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_11070 33531 33887 gene locus_tag LOCUS_11080 33531 33887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 34376 33900 gene locus_tag LOCUS_11090 gene greA 34376 33900 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_11090 37650 34429 gene locus_tag LOCUS_11100 gene carB 37650 34429 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_11100 38840 37680 gene locus_tag LOCUS_11110 gene carA 38840 37680 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_11110 39212 39679 gene locus_tag LOCUS_11120 39212 39679 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395634.1 protein_id gnl|my_center|LOCUS_11120 39710 42028 gene locus_tag LOCUS_11130 39710 42028 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974776.1 protein_id gnl|my_center|LOCUS_11130 42714 42109 gene locus_tag LOCUS_11140 42714 42109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 43069 43782 gene locus_tag LOCUS_11150 43069 43782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 44145 43789 gene locus_tag LOCUS_11160 44145 43789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 44921 44259 gene locus_tag LOCUS_11170 44921 44259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 46978 45152 gene locus_tag LOCUS_11180 gene oadA 46978 45152 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269402.1 protein_id gnl|my_center|LOCUS_11180 48459 47011 gene locus_tag LOCUS_11190 48459 47011 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 protein_id gnl|my_center|LOCUS_11190 48767 49717 gene locus_tag LOCUS_11200 48767 49717 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_11200 50727 49831 gene locus_tag LOCUS_11210 gene rfbD 50727 49831 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023610.1 protein_id gnl|my_center|LOCUS_11210 51784 50729 gene locus_tag LOCUS_11220 gene rfbB 51784 50729 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_11220 53219 51861 gene locus_tag LOCUS_11230 gene tilS 53219 51861 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_11230 54156 53188 gene locus_tag LOCUS_11240 54156 53188 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691155.1 protein_id gnl|my_center|LOCUS_11240 54342 54857 gene locus_tag LOCUS_11250 gene msrB 54342 54857 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404837.1 protein_id gnl|my_center|LOCUS_11250 54956 56080 gene locus_tag LOCUS_11260 54956 56080 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_11260 56212 56361 gene locus_tag LOCUS_11270 56212 56361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 56698 56919 gene locus_tag LOCUS_11280 56698 56919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 58168 57011 gene locus_tag LOCUS_11290 gene bamC 58168 57011 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_11290 59057 58170 gene locus_tag LOCUS_11300 gene dapA 59057 58170 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_11300 61787 59202 gene locus_tag LOCUS_11310 gene clpB 61787 59202 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_11310 64525 61853 gene locus_tag LOCUS_11320 64525 61853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 66216 64723 gene locus_tag LOCUS_11330 66216 64723 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_11330 66326 67171 gene locus_tag LOCUS_11340 gene nadC 66326 67171 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_11340 67855 67205 gene locus_tag LOCUS_11350 67855 67205 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_11350 68881 67910 gene locus_tag LOCUS_11360 68881 67910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 protein_id gnl|my_center|LOCUS_11360 69882 68890 gene locus_tag LOCUS_11370 69882 68890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 71141 69909 gene locus_tag LOCUS_11380 71141 69909 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 protein_id gnl|my_center|LOCUS_11380 72399 71257 gene locus_tag LOCUS_11390 gene lptG 72399 71257 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296409.1 protein_id gnl|my_center|LOCUS_11390 73397 72315 gene locus_tag LOCUS_11400 gene lptF 73397 72315 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779645.1 protein_id gnl|my_center|LOCUS_11400 74689 73538 gene locus_tag LOCUS_11410 gene yghO 74689 73538 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305975.1 protein_id gnl|my_center|LOCUS_11410 75282 74812 gene locus_tag LOCUS_11420 75282 74812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 75661 76050 gene locus_tag LOCUS_11430 75661 76050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 76043 76936 gene locus_tag LOCUS_11440 76043 76936 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697633.1 protein_id gnl|my_center|LOCUS_11440 76972 78816 gene locus_tag LOCUS_11450 gene dxs 76972 78816 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_11450 78887 79705 gene locus_tag LOCUS_11460 gene folE2 78887 79705 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_11460 79815 80909 gene locus_tag LOCUS_11470 79815 80909 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 protein_id gnl|my_center|LOCUS_11470 81361 81038 gene locus_tag LOCUS_11480 81361 81038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 81561 81358 gene locus_tag LOCUS_11490 81561 81358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 82066 81923 gene locus_tag LOCUS_11500 82066 81923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 83449 82094 gene locus_tag LOCUS_11510 83449 82094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 84808 83639 gene locus_tag LOCUS_11520 84808 83639 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_11520 86919 84805 gene locus_tag LOCUS_11530 gene ovoA 86919 84805 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_11530 87148 87837 gene locus_tag LOCUS_11540 87148 87837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 87821 88519 gene locus_tag LOCUS_11550 87821 88519 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_11550 88559 89605 gene locus_tag LOCUS_11560 88559 89605 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_11560 89608 90555 gene locus_tag LOCUS_11570 89608 90555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 90556 92715 gene locus_tag LOCUS_11580 90556 92715 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_11580 93572 92712 gene locus_tag LOCUS_11590 93572 92712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 94175 93606 gene locus_tag LOCUS_11600 94175 93606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 95729 94209 gene locus_tag LOCUS_11610 95729 94209 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_11610 95890 96888 gene locus_tag LOCUS_11620 95890 96888 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_11620 96970 99525 gene locus_tag LOCUS_11630 96970 99525 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_11630 99563 99943 gene locus_tag LOCUS_11640 99563 99943 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_11640 100499 100161 gene locus_tag LOCUS_11650 100499 100161 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948678.1 protein_id gnl|my_center|LOCUS_11650 101604 100486 gene locus_tag LOCUS_11660 101604 100486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 101607 102476 gene locus_tag LOCUS_11670 gene rsmI 101607 102476 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016568902.1 protein_id gnl|my_center|LOCUS_11670 102531 103571 gene locus_tag LOCUS_11680 gene pyrC 102531 103571 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_11680 103948 103580 gene locus_tag LOCUS_11690 103948 103580 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 protein_id gnl|my_center|LOCUS_11690 105038 104949 gene locus_tag LOCUS_t00090 105038 104949 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 105118 105045 gene locus_tag LOCUS_t00100 105118 105045 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 105306 105232 gene locus_tag LOCUS_t00110 105306 105232 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 105496 105777 gene locus_tag LOCUS_11700 105496 105777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 105847 106260 gene locus_tag LOCUS_11710 105847 106260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068582.1 protein_id gnl|my_center|LOCUS_11710 106828 106418 gene locus_tag LOCUS_11720 106828 106418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 108979 107507 gene locus_tag LOCUS_11730 108979 107507 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_11730 109784 109212 gene locus_tag LOCUS_11740 109784 109212 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066626.1 protein_id gnl|my_center|LOCUS_11740 110276 109848 gene locus_tag LOCUS_11750 110276 109848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11750 110574 110350 gene locus_tag LOCUS_11760 110574 110350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 110801 111694 gene locus_tag LOCUS_11770 110801 111694 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211685.1 protein_id gnl|my_center|LOCUS_11770 111777 112403 gene locus_tag LOCUS_11780 gene ycaC 111777 112403 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943220.1 protein_id gnl|my_center|LOCUS_11780 112692 113918 gene locus_tag LOCUS_11790 112692 113918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 115278 113962 gene locus_tag LOCUS_11800 115278 113962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 116278 115439 gene locus_tag LOCUS_11810 116278 115439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 118175 116556 gene locus_tag LOCUS_11820 118175 116556 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089705.1 protein_id gnl|my_center|LOCUS_11820 118714 120621 gene locus_tag LOCUS_11830 118714 120621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 121342 121028 gene locus_tag LOCUS_11840 121342 121028 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_11840 121781 121485 gene locus_tag LOCUS_11850 121781 121485 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463615.1 protein_id gnl|my_center|LOCUS_11850 122179 121952 gene locus_tag LOCUS_11860 122179 121952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 123158 122184 gene locus_tag LOCUS_11870 123158 122184 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_11870 123357 123977 gene locus_tag LOCUS_11880 123357 123977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 123996 124253 gene locus_tag LOCUS_11890 123996 124253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 125318 124428 gene locus_tag LOCUS_11900 125318 124428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 125830 126216 gene locus_tag LOCUS_11910 125830 126216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 126227 127306 gene locus_tag LOCUS_11920 126227 127306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 127300 127503 gene locus_tag LOCUS_11930 127300 127503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 127533 127685 gene locus_tag LOCUS_11940 127533 127685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 127691 129307 gene locus_tag LOCUS_11950 127691 129307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 129532 130797 gene locus_tag LOCUS_11960 129532 130797 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_11960 130805 131128 gene locus_tag LOCUS_11970 130805 131128 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703181.1 protein_id gnl|my_center|LOCUS_11970 131100 131408 gene locus_tag LOCUS_11980 131100 131408 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_11980 131676 132344 gene locus_tag LOCUS_11990 131676 132344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 132458 132652 gene locus_tag LOCUS_12000 132458 132652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 132660 134303 gene locus_tag LOCUS_12010 132660 134303 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090628599.1 protein_id gnl|my_center|LOCUS_12010 135865 134387 gene locus_tag LOCUS_12020 135865 134387 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943105.1 protein_id gnl|my_center|LOCUS_12020 139295 136164 gene locus_tag LOCUS_12030 139295 136164 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_12030 140888 139308 gene locus_tag LOCUS_12040 140888 139308 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_12040 142258 140900 gene locus_tag LOCUS_12050 142258 140900 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444633.1 protein_id gnl|my_center|LOCUS_12050 142838 142467 gene locus_tag LOCUS_12060 142838 142467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 143086 143364 gene locus_tag LOCUS_12070 143086 143364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_12070 143361 143663 gene locus_tag LOCUS_12080 143361 143663 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_12080 143975 145237 gene locus_tag LOCUS_12090 143975 145237 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964746.1 protein_id gnl|my_center|LOCUS_12090 145349 146176 gene locus_tag LOCUS_12100 145349 146176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 148181 146583 gene locus_tag LOCUS_12110 148181 146583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence07 <1 815 gene locus_tag LOCUS_12120 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_128955176.1:IS21 family transposase 805 1551 gene locus_tag LOCUS_12130 gene istB 805 1551 CDS product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 protein_id gnl|my_center|LOCUS_12130 1618 2517 gene locus_tag LOCUS_12140 1618 2517 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_12140 3551 2937 gene locus_tag LOCUS_12150 3551 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4907 3582 gene locus_tag LOCUS_12160 4907 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682207.1 protein_id gnl|my_center|LOCUS_12160 6637 5840 gene locus_tag LOCUS_12170 6637 5840 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_12170 7876 6683 gene locus_tag LOCUS_12180 gene hemW 7876 6683 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_12180 10391 7881 gene locus_tag LOCUS_12190 10391 7881 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_12190 11127 10438 gene locus_tag LOCUS_12200 11127 10438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_12200 11126 11773 gene locus_tag LOCUS_12210 11126 11773 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_12210 12828 11764 gene locus_tag LOCUS_12220 12828 11764 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_12220 13294 15786 gene locus_tag LOCUS_12230 13294 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 18568 15827 gene locus_tag LOCUS_12240 gene polA 18568 15827 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_12240 18668 19303 gene locus_tag LOCUS_12250 18668 19303 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_12250 19362 19766 gene locus_tag LOCUS_12260 19362 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 19846 20799 gene locus_tag LOCUS_12270 19846 20799 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_12270 20846 21826 gene locus_tag LOCUS_12280 20846 21826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 23049 21850 gene locus_tag LOCUS_12290 23049 21850 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037142.1 protein_id gnl|my_center|LOCUS_12290 25603 23072 gene locus_tag LOCUS_12300 25603 23072 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037143.1 protein_id gnl|my_center|LOCUS_12300 26131 25778 gene locus_tag LOCUS_12310 26131 25778 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218967.1 protein_id gnl|my_center|LOCUS_12310 26499 26161 gene locus_tag LOCUS_12320 26499 26161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 28737 26533 gene locus_tag LOCUS_12330 gene uvrD 28737 26533 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980762.1 protein_id gnl|my_center|LOCUS_12330 29753 28884 gene locus_tag LOCUS_12340 29753 28884 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_12340 30118 30795 gene locus_tag LOCUS_12350 30118 30795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 31016 31540 gene locus_tag LOCUS_12360 31016 31540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 31618 31980 gene locus_tag LOCUS_12370 31618 31980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 32467 32075 gene locus_tag LOCUS_12380 32467 32075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 33108 32689 gene locus_tag LOCUS_12390 33108 32689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 33223 34263 gene locus_tag LOCUS_12400 33223 34263 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_12400 35001 34294 gene locus_tag LOCUS_12410 35001 34294 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168989238.1 protein_id gnl|my_center|LOCUS_12410 35362 36825 gene locus_tag LOCUS_12420 35362 36825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 37287 36895 gene locus_tag LOCUS_12430 37287 36895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 37794 38912 gene locus_tag LOCUS_12440 gene hcuB 37794 38912 CDS product hydrophobic compound transporter HcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_12440 38970 41051 gene locus_tag LOCUS_12450 gene ppk1 38970 41051 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_12450 43939 41060 gene locus_tag LOCUS_12460 43939 41060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 45591 43936 gene locus_tag LOCUS_12470 45591 43936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 46129 45650 gene locus_tag LOCUS_12480 46129 45650 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_12480 46601 46119 gene locus_tag LOCUS_12490 46601 46119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 46737 47636 gene locus_tag LOCUS_12500 gene prmB 46737 47636 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_12500 47633 48763 gene locus_tag LOCUS_12510 47633 48763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 48843 49097 gene locus_tag LOCUS_12520 48843 49097 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460845.1 protein_id gnl|my_center|LOCUS_12520 49165 50253 gene locus_tag LOCUS_12530 gene mutY 49165 50253 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_12530 50246 50857 gene locus_tag LOCUS_12540 50246 50857 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536308.1 protein_id gnl|my_center|LOCUS_12540 51443 50877 gene locus_tag LOCUS_12550 gene ubiX 51443 50877 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_12550 52507 51548 gene locus_tag LOCUS_12560 gene hprK 52507 51548 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687702.1 protein_id gnl|my_center|LOCUS_12560 52964 52494 gene locus_tag LOCUS_12570 gene ptsN 52964 52494 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_12570 53414 53091 gene locus_tag LOCUS_12580 gene hpf 53414 53091 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_12580 54887 53433 gene locus_tag LOCUS_12590 54887 53433 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_12590 55664 54942 gene locus_tag LOCUS_12600 gene lptB 55664 54942 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_12600 56222 55689 gene locus_tag LOCUS_12610 gene lptA 56222 55689 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_12610 56798 56232 gene locus_tag LOCUS_12620 56798 56232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 57026 58123 gene locus_tag LOCUS_12630 gene nadA 57026 58123 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_12630 58202 59380 gene locus_tag LOCUS_12640 gene clsB 58202 59380 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_12640 59438 60490 gene locus_tag LOCUS_12650 59438 60490 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 protein_id gnl|my_center|LOCUS_12650 60490 61260 gene locus_tag LOCUS_12660 60490 61260 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_12660 62656 61397 gene locus_tag LOCUS_12670 62656 61397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 63408 62725 gene locus_tag LOCUS_12680 63408 62725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 64014 63412 gene locus_tag LOCUS_12690 64014 63412 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036842.1 protein_id gnl|my_center|LOCUS_12690 64846 64118 gene locus_tag LOCUS_12700 64846 64118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 65907 66584 gene locus_tag LOCUS_12710 65907 66584 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090002.1 protein_id gnl|my_center|LOCUS_12710 66581 67459 gene locus_tag LOCUS_12720 66581 67459 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189948.1 protein_id gnl|my_center|LOCUS_12720 67460 67960 gene locus_tag LOCUS_12730 67460 67960 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_12730 68006 68512 gene locus_tag LOCUS_12740 68006 68512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 68585 68935 gene locus_tag LOCUS_12750 gene hypA 68585 68935 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_12750 68946 69851 gene locus_tag LOCUS_12760 gene hypB 68946 69851 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337682.1 protein_id gnl|my_center|LOCUS_12760 69838 70959 gene locus_tag LOCUS_12770 69838 70959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 70959 71849 gene locus_tag LOCUS_12780 gene hslO 70959 71849 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 protein_id gnl|my_center|LOCUS_12780 72024 72836 gene locus_tag LOCUS_12790 72024 72836 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_12790 72877 74370 gene locus_tag LOCUS_12800 72877 74370 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_12800 75304 74381 gene locus_tag LOCUS_12810 75304 74381 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_12810 75897 75325 gene locus_tag LOCUS_12820 75897 75325 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_12820 76066 76437 gene locus_tag LOCUS_12830 76066 76437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 77018 77473 gene locus_tag LOCUS_12840 77018 77473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 77470 84867 gene locus_tag LOCUS_12850 77470 84867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 86331 84877 gene locus_tag LOCUS_12860 gene rng 86331 84877 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_12860 86930 86403 gene locus_tag LOCUS_12870 86930 86403 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813200.1 protein_id gnl|my_center|LOCUS_12870 87019 87162 gene locus_tag LOCUS_12880 87019 87162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 87604 87134 gene locus_tag LOCUS_12890 gene rlmH 87604 87134 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_12890 87964 87617 gene locus_tag LOCUS_12900 87964 87617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 88638 87970 gene locus_tag LOCUS_12910 gene nadD 88638 87970 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_12910 89986 88667 gene locus_tag LOCUS_12920 gene aceF 89986 88667 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_12920 92863 90203 gene locus_tag LOCUS_12930 gene aceE 92863 90203 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199569.1 protein_id gnl|my_center|LOCUS_12930 93905 93030 gene locus_tag LOCUS_12940 gene folD 93905 93030 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_12940 94682 93993 gene locus_tag LOCUS_12950 94682 93993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 95712 94852 gene locus_tag LOCUS_12960 gene metF 95712 94852 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_12960 97275 95842 gene locus_tag LOCUS_12970 gene ahcY 97275 95842 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_12970 98580 97417 gene locus_tag LOCUS_12980 gene metK 98580 97417 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_12980 98856 100148 gene locus_tag LOCUS_12990 98856 100148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 100148 101593 gene locus_tag LOCUS_13000 100148 101593 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121014.1 protein_id gnl|my_center|LOCUS_13000 104422 101699 gene locus_tag LOCUS_13010 104422 101699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 104662 106365 gene locus_tag LOCUS_13020 104662 106365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 109219 106421 gene locus_tag LOCUS_13030 109219 106421 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071683.1 protein_id gnl|my_center|LOCUS_13030 109770 110168 gene locus_tag LOCUS_13040 109770 110168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13040 110213 110977 gene locus_tag LOCUS_13050 110213 110977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13050 111595 111834 gene locus_tag LOCUS_13060 111595 111834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 112273 111875 gene locus_tag LOCUS_13070 112273 111875 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566317.1 protein_id gnl|my_center|LOCUS_13070 112469 112287 gene locus_tag LOCUS_13080 112469 112287 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930090.1 protein_id gnl|my_center|LOCUS_13080 113429 112956 gene locus_tag LOCUS_13090 113429 112956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 114131 113745 gene locus_tag LOCUS_13100 114131 113745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 114680 115522 gene locus_tag LOCUS_13110 114680 115522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 115674 115931 gene locus_tag LOCUS_13120 115674 115931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 115928 116380 gene locus_tag LOCUS_13130 115928 116380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 116658 117572 gene locus_tag LOCUS_13140 116658 117572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 117550 120195 gene locus_tag LOCUS_13150 117550 120195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 120188 120829 gene locus_tag LOCUS_13160 120188 120829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 121383 121299 gene locus_tag LOCUS_t00120 121383 121299 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 121465 123666 gene locus_tag LOCUS_13170 gene rnr 121465 123666 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695198.1 protein_id gnl|my_center|LOCUS_13170 123752 124492 gene locus_tag LOCUS_13180 gene rlmB 123752 124492 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231513.1 protein_id gnl|my_center|LOCUS_13180 124572 126329 gene locus_tag LOCUS_13190 gene argS 124572 126329 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_13190 126354 127157 gene locus_tag LOCUS_13200 126354 127157 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 protein_id gnl|my_center|LOCUS_13200 127241 127879 gene locus_tag LOCUS_13210 127241 127879 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804825.1 protein_id gnl|my_center|LOCUS_13210 128146 127916 gene locus_tag LOCUS_13220 128146 127916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 128327 129937 gene locus_tag LOCUS_13230 128327 129937 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521883.1 protein_id gnl|my_center|LOCUS_13230 129972 130589 gene locus_tag LOCUS_13240 gene gmk 129972 130589 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_13240 130679 130882 gene locus_tag LOCUS_13250 gene rpoZ 130679 130882 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_13250 131011 133113 gene locus_tag LOCUS_13260 131011 133113 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811115.1 protein_id gnl|my_center|LOCUS_13260 133960 133127 gene locus_tag LOCUS_13270 gene ccsA 133960 133127 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929606.1 protein_id gnl|my_center|LOCUS_13270 134104 135453 gene locus_tag LOCUS_13280 gene ffh 134104 135453 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_13280 135929 135480 gene locus_tag LOCUS_13290 gene dut 135929 135480 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_13290 137143 135926 gene locus_tag LOCUS_13300 gene coaBC 137143 135926 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_13300 137320 137994 gene locus_tag LOCUS_13310 gene radC 137320 137994 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_13310 138055 138291 gene locus_tag LOCUS_13320 gene rpmB 138055 138291 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 protein_id gnl|my_center|LOCUS_13320 138337 138492 gene locus_tag LOCUS_13330 gene rpmG 138337 138492 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_13330 139852 138623 gene locus_tag LOCUS_13340 139852 138623 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_13340 140588 140019 gene locus_tag LOCUS_13350 140588 140019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 140768 140995 gene locus_tag LOCUS_13360 140768 140995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 141070 141672 gene locus_tag LOCUS_13370 gene nudF 141070 141672 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_13370 141898 142392 gene locus_tag LOCUS_13380 141898 142392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 143734 142433 gene locus_tag LOCUS_13390 143734 142433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_13390 145127 143742 gene locus_tag LOCUS_13400 gene fumC 145127 143742 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189867.1 protein_id gnl|my_center|LOCUS_13400 145948 145355 gene locus_tag LOCUS_13410 145948 145355 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_13410 146420 145956 gene locus_tag LOCUS_13420 146420 145956 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891185.1 protein_id gnl|my_center|LOCUS_13420 146613 146798 gene locus_tag LOCUS_13430 146613 146798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 146788 146967 gene locus_tag LOCUS_13440 146788 146967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 147321 147461 gene locus_tag LOCUS_13450 147321 147461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence08 1970 597 gene locus_tag LOCUS_13460 1970 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2954 2106 gene locus_tag LOCUS_13470 2954 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3419 2988 gene locus_tag LOCUS_13480 3419 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 4251 3436 gene locus_tag LOCUS_13490 4251 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4532 4368 gene locus_tag LOCUS_13500 4532 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 5788 4547 gene locus_tag LOCUS_13510 5788 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6149 5799 gene locus_tag LOCUS_13520 6149 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 7652 6561 gene locus_tag LOCUS_13530 7652 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 8309 8938 gene locus_tag LOCUS_13540 8309 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 9062 9640 gene locus_tag LOCUS_13550 9062 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 9907 10632 gene locus_tag LOCUS_13560 9907 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 10724 10527 gene locus_tag LOCUS_13570 10724 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 13895 10740 gene locus_tag LOCUS_13580 13895 10740 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_13580 15442 13925 gene locus_tag LOCUS_13590 15442 13925 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109532.1 protein_id gnl|my_center|LOCUS_13590 16869 15442 gene locus_tag LOCUS_13600 16869 15442 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_13600 17360 16986 gene locus_tag LOCUS_13610 17360 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 18068 17472 gene locus_tag LOCUS_13620 18068 17472 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925884.1 protein_id gnl|my_center|LOCUS_13620 18325 18107 gene locus_tag LOCUS_13630 18325 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 18236 18643 gene locus_tag LOCUS_13640 18236 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 18661 18840 gene locus_tag LOCUS_13650 gene rpmF 18661 18840 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_13650 18904 19932 gene locus_tag LOCUS_13660 gene plsX 18904 19932 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_13660 19947 20903 gene locus_tag LOCUS_13670 19947 20903 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_13670 20907 21851 gene locus_tag LOCUS_13680 gene fabD 20907 21851 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_13680 21907 22644 gene locus_tag LOCUS_13690 gene fabG 21907 22644 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097120.1 protein_id gnl|my_center|LOCUS_13690 22757 22996 gene locus_tag LOCUS_13700 gene acpP 22757 22996 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_13700 23035 24276 gene locus_tag LOCUS_13710 gene fabF 23035 24276 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_13710 24339 25289 gene locus_tag LOCUS_13720 gene mltG 24339 25289 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_13720 25329 27920 gene locus_tag LOCUS_13730 25329 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 28343 27930 gene locus_tag LOCUS_13740 28343 27930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 29210 28404 gene locus_tag LOCUS_13750 29210 28404 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_13750 30036 29281 gene locus_tag LOCUS_13760 gene pgeF 30036 29281 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_13760 30265 31416 gene locus_tag LOCUS_13770 30265 31416 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_13770 31431 32186 gene locus_tag LOCUS_13780 31431 32186 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_13780 32183 33772 gene locus_tag LOCUS_13790 32183 33772 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_13790 33769 35169 gene locus_tag LOCUS_13800 gene glpK 33769 35169 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759995.1 protein_id gnl|my_center|LOCUS_13800 35348 35938 gene locus_tag LOCUS_13810 35348 35938 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256689.1 protein_id gnl|my_center|LOCUS_13810 36007 36732 gene locus_tag LOCUS_13820 36007 36732 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_13820 36764 37984 gene locus_tag LOCUS_13830 36764 37984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 37981 39090 gene locus_tag LOCUS_13840 37981 39090 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161413.1 protein_id gnl|my_center|LOCUS_13840 39424 41040 gene locus_tag LOCUS_13850 39424 41040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 42257 41076 gene locus_tag LOCUS_13860 42257 41076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 43801 42407 gene locus_tag LOCUS_13870 43801 42407 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_13870 44374 43919 gene locus_tag LOCUS_13880 gene rplI 44374 43919 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813092.1 protein_id gnl|my_center|LOCUS_13880 44668 44387 gene locus_tag LOCUS_13890 gene rpsR 44668 44387 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193360.1 protein_id gnl|my_center|LOCUS_13890 44994 44692 gene locus_tag LOCUS_13900 44994 44692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 45414 45001 gene locus_tag LOCUS_13910 gene rpsF 45414 45001 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_13910 46094 45648 gene locus_tag LOCUS_13920 gene arfB 46094 45648 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_13920 46190 47455 gene locus_tag LOCUS_13930 46190 47455 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213326.1 protein_id gnl|my_center|LOCUS_13930 47663 49042 gene locus_tag LOCUS_13940 47663 49042 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971847.1 protein_id gnl|my_center|LOCUS_13940 49477 49905 gene locus_tag LOCUS_13950 49477 49905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 50606 49989 gene locus_tag LOCUS_13960 50606 49989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 51431 51195 gene locus_tag LOCUS_13970 51431 51195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 52878 51637 gene locus_tag LOCUS_13980 52878 51637 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_13980 53115 53405 gene locus_tag LOCUS_13990 53115 53405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 53708 53409 gene locus_tag LOCUS_14000 53708 53409 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 protein_id gnl|my_center|LOCUS_14000 54132 53695 gene locus_tag LOCUS_14010 54132 53695 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_14010 54222 54665 gene locus_tag LOCUS_14020 gene smpB 54222 54665 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811754.1 protein_id gnl|my_center|LOCUS_14020 54771 55736 gene locus_tag LOCUS_14030 54771 55736 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 protein_id gnl|my_center|LOCUS_14030 57233 55803 gene locus_tag LOCUS_14040 gene pilR 57233 55803 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_14040 58834 57224 gene locus_tag LOCUS_14050 58834 57224 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769277.1 protein_id gnl|my_center|LOCUS_14050 59114 58887 gene locus_tag LOCUS_14060 59114 58887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 60739 59771 gene locus_tag LOCUS_14070 gene ispB 60739 59771 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929988.1 protein_id gnl|my_center|LOCUS_14070 60884 61195 gene locus_tag LOCUS_14080 gene rplU 60884 61195 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_14080 61207 61464 gene locus_tag LOCUS_14090 gene rpmA 61207 61464 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212328.1 protein_id gnl|my_center|LOCUS_14090 61565 62638 gene locus_tag LOCUS_14100 gene obgE 61565 62638 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_14100 62632 63741 gene locus_tag LOCUS_14110 gene proB 62632 63741 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_14110 63758 64870 gene locus_tag LOCUS_14120 63758 64870 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208088.1 protein_id gnl|my_center|LOCUS_14120 65150 65479 gene locus_tag LOCUS_14130 65150 65479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 65595 65846 gene locus_tag LOCUS_14140 65595 65846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 65918 66601 gene locus_tag LOCUS_14150 65918 66601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_14150 66601 67941 gene locus_tag LOCUS_14160 66601 67941 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 protein_id gnl|my_center|LOCUS_14160 68255 67983 gene locus_tag LOCUS_14170 68255 67983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 68438 69439 gene locus_tag LOCUS_14180 68438 69439 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_14180 69876 71153 gene locus_tag LOCUS_14190 69876 71153 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_14190 71232 72125 gene locus_tag LOCUS_14200 gene mak 71232 72125 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208690.1 protein_id gnl|my_center|LOCUS_14200 74082 72196 gene locus_tag LOCUS_14210 74082 72196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 74670 74092 gene locus_tag LOCUS_14220 74670 74092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 76873 74675 gene locus_tag LOCUS_14230 gene glgB 76873 74675 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_14230 77011 78324 gene locus_tag LOCUS_14240 gene glgC 77011 78324 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_14240 78442 80145 gene locus_tag LOCUS_14250 78442 80145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 80369 82384 gene locus_tag LOCUS_14260 80369 82384 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_14260 82439 84073 gene locus_tag LOCUS_14270 gene pgi 82439 84073 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261112.1 protein_id gnl|my_center|LOCUS_14270 84082 85548 gene locus_tag LOCUS_14280 gene glgA 84082 85548 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_14280 86423 85629 gene locus_tag LOCUS_14290 86423 85629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 90572 86862 gene locus_tag LOCUS_14300 gene metH 90572 86862 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 protein_id gnl|my_center|LOCUS_14300 90907 91539 gene locus_tag LOCUS_14310 90907 91539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 91894 93345 gene locus_tag LOCUS_14320 91894 93345 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262914.1 protein_id gnl|my_center|LOCUS_14320 93583 94317 gene locus_tag LOCUS_14330 93583 94317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 95072 94359 gene locus_tag LOCUS_14340 95072 94359 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_14340 95155 95676 gene locus_tag LOCUS_14350 95155 95676 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971406.1 protein_id gnl|my_center|LOCUS_14350 96717 95677 gene locus_tag LOCUS_14360 96717 95677 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_14360 97336 96710 gene locus_tag LOCUS_14370 gene tmk 97336 96710 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225507.1 protein_id gnl|my_center|LOCUS_14370 97335 97997 gene locus_tag LOCUS_14380 gene ampD 97335 97997 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 protein_id gnl|my_center|LOCUS_14380 98141 98350 gene locus_tag LOCUS_14390 98141 98350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 98334 98618 gene locus_tag LOCUS_14400 98334 98618 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525420.1 protein_id gnl|my_center|LOCUS_14400 99314 98679 gene locus_tag LOCUS_14410 99314 98679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 99831 99328 gene locus_tag LOCUS_14420 99831 99328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 100931 100023 gene locus_tag LOCUS_14430 100931 100023 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365085.1 protein_id gnl|my_center|LOCUS_14430 102172 100961 gene locus_tag LOCUS_14440 gene purT 102172 100961 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522466.1 protein_id gnl|my_center|LOCUS_14440 103284 102184 gene locus_tag LOCUS_14450 gene queG 103284 102184 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244608.1 protein_id gnl|my_center|LOCUS_14450 103321 103782 gene locus_tag LOCUS_14460 103321 103782 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189096.1 protein_id gnl|my_center|LOCUS_14460 103749 105206 gene locus_tag LOCUS_14470 103749 105206 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_14470 105379 106518 gene locus_tag LOCUS_14480 105379 106518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929619.1 protein_id gnl|my_center|LOCUS_14480 106523 107332 gene locus_tag LOCUS_14490 106523 107332 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190185.1 protein_id gnl|my_center|LOCUS_14490 107305 108204 gene locus_tag LOCUS_14500 107305 108204 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189757.1 protein_id gnl|my_center|LOCUS_14500 108201 108836 gene locus_tag LOCUS_14510 108201 108836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 109060 110316 gene locus_tag LOCUS_14520 gene lysA 109060 110316 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_14520 110384 111442 gene locus_tag LOCUS_14530 110384 111442 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_14530 111501 112490 gene locus_tag LOCUS_14540 111501 112490 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_14540 114176 112536 gene locus_tag LOCUS_14550 114176 112536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 114485 115132 gene locus_tag LOCUS_14560 114485 115132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14560 116276 115374 gene locus_tag LOCUS_14570 116276 115374 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349104.1 protein_id gnl|my_center|LOCUS_14570 116593 116273 gene locus_tag LOCUS_14580 116593 116273 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_14580 116665 116952 gene locus_tag LOCUS_14590 116665 116952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14590 117521 119071 gene locus_tag LOCUS_14600 117521 119071 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_14600 119909 119100 gene locus_tag LOCUS_14610 119909 119100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 120259 119969 gene locus_tag LOCUS_14620 120259 119969 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 protein_id gnl|my_center|LOCUS_14620 120761 120381 gene locus_tag LOCUS_14630 120761 120381 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 protein_id gnl|my_center|LOCUS_14630 121081 122436 gene locus_tag LOCUS_14640 121081 122436 CDS product integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407714.1 protein_id gnl|my_center|LOCUS_14640 122471 122779 gene locus_tag LOCUS_14650 122471 122779 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_14650 122792 123079 gene locus_tag LOCUS_14660 122792 123079 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 protein_id gnl|my_center|LOCUS_14660 123192 123431 gene locus_tag LOCUS_14670 123192 123431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 123534 124196 gene locus_tag LOCUS_14680 123534 124196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 124533 125093 gene locus_tag LOCUS_14690 124533 125093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 125157 125615 gene locus_tag LOCUS_14700 125157 125615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 125615 126622 gene locus_tag LOCUS_14710 125615 126622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 126728 127036 gene locus_tag LOCUS_14720 126728 127036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 127218 127760 gene locus_tag LOCUS_14730 127218 127760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 127949 129019 gene locus_tag LOCUS_14740 127949 129019 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039177.1 protein_id gnl|my_center|LOCUS_14740 129274 129198 gene locus_tag LOCUS_t00130 129274 129198 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 130204 129338 gene locus_tag LOCUS_14750 130204 129338 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318655.1 protein_id gnl|my_center|LOCUS_14750 130521 131735 gene locus_tag LOCUS_14760 130521 131735 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_14760 133002 131749 gene locus_tag LOCUS_14770 133002 131749 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_14770 133906 133010 gene locus_tag LOCUS_14780 gene hemF 133906 133010 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703138.1 protein_id gnl|my_center|LOCUS_14780 134132 135301 gene locus_tag LOCUS_14790 gene aroC 134132 135301 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_14790 135524 135600 gene locus_tag LOCUS_t00140 135524 135600 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 135663 135738 gene locus_tag LOCUS_t00150 135663 135738 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 137254 135674 gene locus_tag LOCUS_14800 137254 135674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 137525 137268 gene locus_tag LOCUS_14810 137525 137268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence09 388 972 gene locus_tag LOCUS_14820 388 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1033 1398 gene locus_tag LOCUS_14830 1033 1398 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_14830 1538 3721 gene locus_tag LOCUS_14840 gene cheA 1538 3721 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205291.1 protein_id gnl|my_center|LOCUS_14840 4015 4878 gene locus_tag LOCUS_14850 4015 4878 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832274.1 protein_id gnl|my_center|LOCUS_14850 4886 5497 gene locus_tag LOCUS_14860 gene cheD 4886 5497 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_14860 5534 6613 gene locus_tag LOCUS_14870 5534 6613 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198645.1 protein_id gnl|my_center|LOCUS_14870 6667 7155 gene locus_tag LOCUS_14880 6667 7155 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209775.1 protein_id gnl|my_center|LOCUS_14880 7299 7556 gene locus_tag LOCUS_14890 7299 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 7721 8791 gene locus_tag LOCUS_14900 7721 8791 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175517123.1 protein_id gnl|my_center|LOCUS_14900 8901 9113 gene locus_tag LOCUS_14910 8901 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 10626 9148 gene locus_tag LOCUS_14920 10626 9148 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_14920 11173 10628 gene locus_tag LOCUS_14930 11173 10628 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_14930 11380 11514 gene locus_tag LOCUS_14940 11380 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 11511 12158 gene locus_tag LOCUS_14950 11511 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 12208 12729 gene locus_tag LOCUS_14960 12208 12729 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_14960 12762 13280 gene locus_tag LOCUS_14970 12762 13280 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_14970 13329 13829 gene locus_tag LOCUS_14980 13329 13829 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_14980 14343 14185 gene locus_tag LOCUS_14990 14343 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 15434 14679 gene locus_tag LOCUS_15000 15434 14679 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687893.1 protein_id gnl|my_center|LOCUS_15000 16375 15638 gene locus_tag LOCUS_15010 16375 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 18039 16372 gene locus_tag LOCUS_15020 18039 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 18871 18203 gene locus_tag LOCUS_15030 18871 18203 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970750.1 protein_id gnl|my_center|LOCUS_15030 19296 19006 gene locus_tag LOCUS_15040 19296 19006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 21196 19424 gene locus_tag LOCUS_15050 21196 19424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 21387 22751 gene locus_tag LOCUS_15060 21387 22751 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_15060 23263 23108 gene locus_tag LOCUS_15070 23263 23108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15070 25665 23779 gene locus_tag LOCUS_15080 25665 23779 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_15080 28415 26529 gene locus_tag LOCUS_15090 28415 26529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 29283 30650 gene locus_tag LOCUS_15100 29283 30650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 30647 30976 gene locus_tag LOCUS_15110 30647 30976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 30997 31866 gene locus_tag LOCUS_15120 30997 31866 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_15120 32114 33340 gene locus_tag LOCUS_15130 32114 33340 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_15130 33691 33449 gene locus_tag LOCUS_15140 33691 33449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 33937 34203 gene locus_tag LOCUS_15150 33937 34203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 34200 34532 gene locus_tag LOCUS_15160 34200 34532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 34843 34553 gene locus_tag LOCUS_15170 34843 34553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 35081 34812 gene locus_tag LOCUS_15180 35081 34812 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140411.1 protein_id gnl|my_center|LOCUS_15180 35187 35861 gene locus_tag LOCUS_15190 35187 35861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 36045 36239 gene locus_tag LOCUS_15200 36045 36239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 36247 37890 gene locus_tag LOCUS_15210 36247 37890 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090628599.1 protein_id gnl|my_center|LOCUS_15210 38108 38260 gene locus_tag LOCUS_15220 38108 38260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 38278 39222 gene locus_tag LOCUS_15230 38278 39222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 39226 39720 gene locus_tag LOCUS_15240 39226 39720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 39717 40613 gene locus_tag LOCUS_15250 39717 40613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 40613 41788 gene locus_tag LOCUS_15260 40613 41788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 41785 42330 gene locus_tag LOCUS_15270 41785 42330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195773.1 protein_id gnl|my_center|LOCUS_15270 42699 42624 gene locus_tag LOCUS_t00160 42699 42624 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42925 43380 gene locus_tag LOCUS_15280 gene aroQ 42925 43380 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068810.1 protein_id gnl|my_center|LOCUS_15280 43495 43977 gene locus_tag LOCUS_15290 gene accB 43495 43977 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_15290 44002 45357 gene locus_tag LOCUS_15300 gene accC 44002 45357 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_15300 45393 46310 gene locus_tag LOCUS_15310 gene prmA 45393 46310 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223022.1 protein_id gnl|my_center|LOCUS_15310 46408 47214 gene locus_tag LOCUS_15320 46408 47214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 48463 47279 gene locus_tag LOCUS_15330 48463 47279 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_15330 48765 48463 gene locus_tag LOCUS_15340 gene lsrG 48765 48463 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 protein_id gnl|my_center|LOCUS_15340 48961 49293 gene locus_tag LOCUS_15350 48961 49293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 49303 50046 gene locus_tag LOCUS_15360 49303 50046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15360 50590 50060 gene locus_tag LOCUS_15370 50590 50060 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545495.1 protein_id gnl|my_center|LOCUS_15370 50800 52146 gene locus_tag LOCUS_15380 50800 52146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 52268 52531 gene locus_tag LOCUS_15390 52268 52531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15390 52906 53376 gene locus_tag LOCUS_15400 52906 53376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 53714 54094 gene locus_tag LOCUS_15410 53714 54094 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388677.1 protein_id gnl|my_center|LOCUS_15410 54081 54395 gene locus_tag LOCUS_15420 54081 54395 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141642.1 protein_id gnl|my_center|LOCUS_15420 55609 55364 gene locus_tag LOCUS_15430 55609 55364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15430 56253 55726 gene locus_tag LOCUS_15440 56253 55726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15440 56570 56250 gene locus_tag LOCUS_15450 56570 56250 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_15450 56771 57553 gene locus_tag LOCUS_15460 56771 57553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 57675 57584 gene locus_tag LOCUS_t00170 57675 57584 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58229 57762 gene locus_tag LOCUS_15470 58229 57762 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_15470 59899 58304 gene locus_tag LOCUS_15480 gene nadB 59899 58304 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_15480 60794 60261 gene locus_tag LOCUS_15490 60794 60261 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700187.1 protein_id gnl|my_center|LOCUS_15490 62443 60839 gene locus_tag LOCUS_15500 62443 60839 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097447.1 protein_id gnl|my_center|LOCUS_15500 63204 63689 gene locus_tag LOCUS_15510 63204 63689 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_15510 64184 63756 gene locus_tag LOCUS_15520 64184 63756 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051418.1 protein_id gnl|my_center|LOCUS_15520 64429 64181 gene locus_tag LOCUS_15530 64429 64181 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_15530 65040 64654 gene locus_tag LOCUS_15540 65040 64654 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_15540 65274 65041 gene locus_tag LOCUS_15550 65274 65041 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_15550 66124 65378 gene locus_tag LOCUS_15560 66124 65378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 66891 66274 gene locus_tag LOCUS_15570 66891 66274 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_15570 67534 68526 gene locus_tag LOCUS_15580 67534 68526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 70894 68720 gene locus_tag LOCUS_15590 70894 68720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 71932 70982 gene locus_tag LOCUS_15600 71932 70982 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941713.1 protein_id gnl|my_center|LOCUS_15600 72321 71929 gene locus_tag LOCUS_15610 72321 71929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 73710 72436 gene locus_tag LOCUS_15620 73710 72436 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_15620 74950 73985 gene locus_tag LOCUS_15630 74950 73985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 75200 78706 gene locus_tag LOCUS_15640 75200 78706 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680859.1 protein_id gnl|my_center|LOCUS_15640 78880 80160 gene locus_tag LOCUS_15650 78880 80160 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_15650 80234 81217 gene locus_tag LOCUS_15660 80234 81217 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_15660 81236 83614 gene locus_tag LOCUS_15670 81236 83614 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126413.1 protein_id gnl|my_center|LOCUS_15670 83721 85436 gene locus_tag LOCUS_15680 83721 85436 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_15680 87522 85465 gene locus_tag LOCUS_15690 87522 85465 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_15690 88013 88357 gene locus_tag LOCUS_15700 88013 88357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 89490 88405 gene locus_tag LOCUS_15710 gene hemH 89490 88405 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_15710 90546 89527 gene locus_tag LOCUS_15720 gene hrcA 90546 89527 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814090.1 protein_id gnl|my_center|LOCUS_15720 90841 91713 gene locus_tag LOCUS_15730 90841 91713 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_15730 91736 93409 gene locus_tag LOCUS_15740 gene recN 91736 93409 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 protein_id gnl|my_center|LOCUS_15740 94985 93438 gene locus_tag LOCUS_15750 94985 93438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 95345 96088 gene locus_tag LOCUS_15760 95345 96088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 96185 96970 gene locus_tag LOCUS_15770 96185 96970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 97147 97605 gene locus_tag LOCUS_15780 97147 97605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 97608 98084 gene locus_tag LOCUS_15790 97608 98084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 98148 98651 gene locus_tag LOCUS_15800 98148 98651 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_15800 98660 98902 gene locus_tag LOCUS_15810 98660 98902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 98912 101668 gene locus_tag LOCUS_15820 98912 101668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 101711 102616 gene locus_tag LOCUS_15830 101711 102616 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_15830 103349 102717 gene locus_tag LOCUS_15840 103349 102717 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_15840 105825 103378 gene locus_tag LOCUS_15850 105825 103378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 105983 106609 gene locus_tag LOCUS_15860 gene ccmA 105983 106609 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370110.1 protein_id gnl|my_center|LOCUS_15860 106602 107276 gene locus_tag LOCUS_15870 gene ccmB 106602 107276 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_15870 107500 108243 gene locus_tag LOCUS_15880 gene ccmC 107500 108243 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_15880 108423 108872 gene locus_tag LOCUS_15890 gene ccmE 108423 108872 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_15890 109249 111000 gene locus_tag LOCUS_15900 109249 111000 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_15900 110997 111527 gene locus_tag LOCUS_15910 110997 111527 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_15910 111558 112058 gene locus_tag LOCUS_15920 111558 112058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 112055 113404 gene locus_tag LOCUS_15930 gene ccmI 112055 113404 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_15930 113413 113880 gene locus_tag LOCUS_15940 113413 113880 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443925.1 protein_id gnl|my_center|LOCUS_15940 114322 114059 gene locus_tag LOCUS_15950 114322 114059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 114364 114630 gene locus_tag LOCUS_15960 114364 114630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 114954 115199 gene locus_tag LOCUS_15970 114954 115199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 115977 115201 gene locus_tag LOCUS_15980 115977 115201 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349104.1 protein_id gnl|my_center|LOCUS_15980 116414 116103 gene locus_tag LOCUS_15990 116414 116103 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_15990 116538 117041 gene locus_tag LOCUS_16000 116538 117041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 117359 117057 gene locus_tag LOCUS_16010 117359 117057 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 protein_id gnl|my_center|LOCUS_16010 117681 117349 gene locus_tag LOCUS_16020 117681 117349 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_16020 118021 117815 gene locus_tag LOCUS_16030 118021 117815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 118398 118802 gene locus_tag LOCUS_16040 118398 118802 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932430.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence10 10 411 gene locus_tag LOCUS_16050 10 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 670 371 gene locus_tag LOCUS_16060 670 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 853 1755 gene locus_tag LOCUS_16070 853 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1739 2290 gene locus_tag LOCUS_16080 1739 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2281 2931 gene locus_tag LOCUS_16090 2281 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3074 3712 gene locus_tag LOCUS_16100 3074 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3950 4717 gene locus_tag LOCUS_16110 3950 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4723 5223 gene locus_tag LOCUS_16120 4723 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5314 5484 gene locus_tag LOCUS_16130 5314 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5520 6194 gene locus_tag LOCUS_16140 5520 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16140 6184 6750 gene locus_tag LOCUS_16150 6184 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 6899 7135 gene locus_tag LOCUS_16160 6899 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16160 7132 7374 gene locus_tag LOCUS_16170 7132 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7580 8653 gene locus_tag LOCUS_16180 7580 8653 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348805.1 protein_id gnl|my_center|LOCUS_16180 8804 9220 gene locus_tag LOCUS_16190 8804 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 9464 9162 gene locus_tag LOCUS_16200 9464 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 10325 11275 gene locus_tag LOCUS_16210 10325 11275 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_16210 11377 12555 gene locus_tag LOCUS_16220 11377 12555 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_16220 12565 13452 gene locus_tag LOCUS_16230 gene sucD 12565 13452 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329405.1 protein_id gnl|my_center|LOCUS_16230 13843 14841 gene locus_tag LOCUS_16240 13843 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 15284 15544 gene locus_tag LOCUS_16250 15284 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 16954 15608 gene locus_tag LOCUS_16260 16954 15608 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121818.1 protein_id gnl|my_center|LOCUS_16260 17569 17120 gene locus_tag LOCUS_16270 17569 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 18023 18586 gene locus_tag LOCUS_16280 18023 18586 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087162.1 protein_id gnl|my_center|LOCUS_16280 18628 19962 gene locus_tag LOCUS_16290 18628 19962 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_16290 22796 19998 gene locus_tag LOCUS_16300 22796 19998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 23256 22816 gene locus_tag LOCUS_16310 gene pncC 23256 22816 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 protein_id gnl|my_center|LOCUS_16310 23960 23751 gene locus_tag LOCUS_16320 23960 23751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 23905 24177 gene locus_tag LOCUS_16330 23905 24177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 25037 24216 gene locus_tag LOCUS_16340 25037 24216 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_16340 25575 25042 gene locus_tag LOCUS_16350 25575 25042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 28776 25606 gene locus_tag LOCUS_16360 28776 25606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 28819 29019 gene locus_tag LOCUS_16370 28819 29019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 29431 28964 gene locus_tag LOCUS_16380 29431 28964 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507823.1 protein_id gnl|my_center|LOCUS_16380 29620 30081 gene locus_tag LOCUS_16390 29620 30081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 30330 31847 gene locus_tag LOCUS_16400 30330 31847 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 protein_id gnl|my_center|LOCUS_16400 32080 32436 gene locus_tag LOCUS_16410 32080 32436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 32544 33920 gene locus_tag LOCUS_16420 32544 33920 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_16420 35042 33969 gene locus_tag LOCUS_16430 35042 33969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 35803 35267 gene locus_tag LOCUS_16440 35803 35267 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730265.1 protein_id gnl|my_center|LOCUS_16440 36557 35817 gene locus_tag LOCUS_16450 gene gpmA 36557 35817 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_16450 37654 36557 gene locus_tag LOCUS_16460 37654 36557 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_16460 38106 37651 gene locus_tag LOCUS_16470 38106 37651 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919041.1 protein_id gnl|my_center|LOCUS_16470 38862 38113 gene locus_tag LOCUS_16480 38862 38113 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_16480 40092 38935 gene locus_tag LOCUS_16490 gene nifS 40092 38935 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_16490 40458 40147 gene locus_tag LOCUS_16500 40458 40147 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693849.1 protein_id gnl|my_center|LOCUS_16500 40874 40458 gene locus_tag LOCUS_16510 40874 40458 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257767.1 protein_id gnl|my_center|LOCUS_16510 41897 41097 gene locus_tag LOCUS_16520 41897 41097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 42959 42621 gene locus_tag LOCUS_16530 42959 42621 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_16530 43682 43065 gene locus_tag LOCUS_16540 43682 43065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 43996 44442 gene locus_tag LOCUS_16550 gene mraZ 43996 44442 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_16550 44466 45422 gene locus_tag LOCUS_16560 gene rsmH 44466 45422 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970466.1 protein_id gnl|my_center|LOCUS_16560 45415 45723 gene locus_tag LOCUS_16570 gene ftsL 45415 45723 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340690.1 protein_id gnl|my_center|LOCUS_16570 45710 47440 gene locus_tag LOCUS_16580 45710 47440 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528508.1 protein_id gnl|my_center|LOCUS_16580 47437 48990 gene locus_tag LOCUS_16590 47437 48990 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224920.1 protein_id gnl|my_center|LOCUS_16590 48987 50393 gene locus_tag LOCUS_16600 48987 50393 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_16600 50384 51469 gene locus_tag LOCUS_16610 gene mraY 50384 51469 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_16610 51477 52892 gene locus_tag LOCUS_16620 gene murD 51477 52892 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_16620 52896 54056 gene locus_tag LOCUS_16630 gene ftsW 52896 54056 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_16630 54053 55144 gene locus_tag LOCUS_16640 gene murG 54053 55144 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_16640 55134 56555 gene locus_tag LOCUS_16650 gene murC 55134 56555 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_16650 56575 57561 gene locus_tag LOCUS_16660 gene murB 56575 57561 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_16660 57561 58478 gene locus_tag LOCUS_16670 gene ddlB 57561 58478 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130042.1 protein_id gnl|my_center|LOCUS_16670 58468 59241 gene locus_tag LOCUS_16680 58468 59241 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_16680 59262 60500 gene locus_tag LOCUS_16690 gene ftsA 59262 60500 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_16690 60578 61735 gene locus_tag LOCUS_16700 gene ftsZ 60578 61735 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_16700 61969 62259 gene locus_tag LOCUS_16710 61969 62259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 62468 63277 gene locus_tag LOCUS_16720 gene cysM 62468 63277 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_16720 63274 63723 gene locus_tag LOCUS_16730 gene ybgC 63274 63723 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 protein_id gnl|my_center|LOCUS_16730 63720 64400 gene locus_tag LOCUS_16740 gene tolQ 63720 64400 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_16740 64419 64832 gene locus_tag LOCUS_16750 gene tolR 64419 64832 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_16750 64903 65865 gene locus_tag LOCUS_16760 64903 65865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 65914 67212 gene locus_tag LOCUS_16770 gene tolB 65914 67212 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_16770 67239 67760 gene locus_tag LOCUS_16780 67239 67760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 67763 68665 gene locus_tag LOCUS_16790 gene ybgF 67763 68665 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_16790 68758 69414 gene locus_tag LOCUS_16800 gene queE 68758 69414 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_16800 69411 70088 gene locus_tag LOCUS_16810 gene queC 69411 70088 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_16810 70440 70099 gene locus_tag LOCUS_16820 70440 70099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 71339 70566 gene locus_tag LOCUS_16830 gene traT 71339 70566 CDS product conjugal transfer complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782438.1 protein_id gnl|my_center|LOCUS_16830 71812 71450 gene locus_tag LOCUS_16840 71812 71450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 72427 72068 gene locus_tag LOCUS_16850 gene folB 72427 72068 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361952.1 protein_id gnl|my_center|LOCUS_16850 72508 73122 gene locus_tag LOCUS_16860 gene plsY 72508 73122 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_16860 74153 73119 gene locus_tag LOCUS_16870 gene tsaD 74153 73119 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_16870 74311 74499 gene locus_tag LOCUS_16880 74311 74499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 74502 75032 gene locus_tag LOCUS_16890 74502 75032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 75895 75059 gene locus_tag LOCUS_16900 75895 75059 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167389.1 protein_id gnl|my_center|LOCUS_16900 76030 76395 gene locus_tag LOCUS_16910 76030 76395 CDS product DUF6164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_16910 76499 77020 gene locus_tag LOCUS_16920 76499 77020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 77092 77478 gene locus_tag LOCUS_16930 77092 77478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 77539 78723 gene locus_tag LOCUS_16940 77539 78723 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_16940 78828 79238 gene locus_tag LOCUS_16950 78828 79238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 79270 80079 gene locus_tag LOCUS_16960 gene atpB 79270 80079 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035796.1 protein_id gnl|my_center|LOCUS_16960 80134 80406 gene locus_tag LOCUS_16970 gene atpE 80134 80406 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195828.1 protein_id gnl|my_center|LOCUS_16970 80444 80917 gene locus_tag LOCUS_16980 gene atpF 80444 80917 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 protein_id gnl|my_center|LOCUS_16980 80917 81453 gene locus_tag LOCUS_16990 80917 81453 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524508.1 protein_id gnl|my_center|LOCUS_16990 81466 83007 gene locus_tag LOCUS_17000 gene atpA 81466 83007 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_17000 83010 83894 gene locus_tag LOCUS_17010 gene atpG 83010 83894 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_17010 83926 85305 gene locus_tag LOCUS_17020 gene atpD 83926 85305 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_17020 85321 85743 gene locus_tag LOCUS_17030 85321 85743 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_17030 85859 87241 gene locus_tag LOCUS_17040 gene glmU 85859 87241 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190034.1 protein_id gnl|my_center|LOCUS_17040 87501 88229 gene locus_tag LOCUS_17050 87501 88229 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185607.1 protein_id gnl|my_center|LOCUS_17050 88302 88772 gene locus_tag LOCUS_17060 gene ruvC 88302 88772 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_17060 88769 89353 gene locus_tag LOCUS_17070 gene ruvA 88769 89353 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_17070 89378 90424 gene locus_tag LOCUS_17080 gene ruvB 89378 90424 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_17080 90457 90894 gene locus_tag LOCUS_17090 90457 90894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 91006 91677 gene locus_tag LOCUS_17100 91006 91677 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095848.1 protein_id gnl|my_center|LOCUS_17100 92384 93139 gene locus_tag LOCUS_17110 92384 93139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 93152 94738 gene locus_tag LOCUS_17120 gene ctaD 93152 94738 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197996.1 protein_id gnl|my_center|LOCUS_17120 94860 95411 gene locus_tag LOCUS_17130 94860 95411 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_17130 95421 95630 gene locus_tag LOCUS_17140 95421 95630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 95662 96519 gene locus_tag LOCUS_17150 95662 96519 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_17150 96702 97430 gene locus_tag LOCUS_17160 96702 97430 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 protein_id gnl|my_center|LOCUS_17160 97453 97977 gene locus_tag LOCUS_17170 97453 97977 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204230.1 protein_id gnl|my_center|LOCUS_17170 98048 98941 gene locus_tag LOCUS_17180 gene cyoE 98048 98941 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522902.1 protein_id gnl|my_center|LOCUS_17180 100413 99037 gene locus_tag LOCUS_17190 100413 99037 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_17190 101007 100432 gene locus_tag LOCUS_17200 101007 100432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 101114 101623 gene locus_tag LOCUS_17210 101114 101623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 101681 102568 gene locus_tag LOCUS_17220 gene argB 101681 102568 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_17220 103312 102587 gene locus_tag LOCUS_17230 gene trmJ 103312 102587 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947473.1 protein_id gnl|my_center|LOCUS_17230 104202 103393 gene locus_tag LOCUS_17240 104202 103393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17240 104552 104262 gene locus_tag LOCUS_17250 104552 104262 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 protein_id gnl|my_center|LOCUS_17250 104649 104909 gene locus_tag LOCUS_17260 104649 104909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 106277 105582 gene locus_tag LOCUS_17270 106277 105582 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 protein_id gnl|my_center|LOCUS_17270 107573 106632 gene locus_tag LOCUS_17280 107573 106632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 107942 109473 gene locus_tag LOCUS_r00010 107942 109473 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 109587 109663 gene locus_tag LOCUS_t00180 109587 109663 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 109675 109750 gene locus_tag LOCUS_t00190 109675 109750 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 109967 112892 gene locus_tag LOCUS_r00020 109967 112892 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 113091 113199 gene locus_tag LOCUS_r00030 113091 113199 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence11 <1 2368 gene locus_tag LOCUS_17290 <1 2368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000126413.1:S8 family peptidase 2382 4088 gene locus_tag LOCUS_17300 2382 4088 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_17300 4135 4308 gene locus_tag LOCUS_17310 4135 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 4305 4484 gene locus_tag LOCUS_17320 4305 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4481 7168 gene locus_tag LOCUS_17330 4481 7168 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_17330 8022 7201 gene locus_tag LOCUS_17340 8022 7201 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 protein_id gnl|my_center|LOCUS_17340 8389 9033 gene locus_tag LOCUS_17350 8389 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 9311 9550 gene locus_tag LOCUS_17360 9311 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 9552 10406 gene locus_tag LOCUS_17370 9552 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 10623 12299 gene locus_tag LOCUS_17380 10623 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 12695 12985 gene locus_tag LOCUS_17390 12695 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 12985 13392 gene locus_tag LOCUS_17400 12985 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 14026 13448 gene locus_tag LOCUS_17410 14026 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 14952 14032 gene locus_tag LOCUS_17420 14952 14032 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_17420 15177 14962 gene locus_tag LOCUS_17430 15177 14962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 15686 15378 gene locus_tag LOCUS_17440 15686 15378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_17440 16209 18557 gene locus_tag LOCUS_17450 16209 18557 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_17450 18676 19278 gene locus_tag LOCUS_17460 gene wrbA 18676 19278 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328347.1 protein_id gnl|my_center|LOCUS_17460 19332 20150 gene locus_tag LOCUS_17470 19332 20150 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_17470 20176 20505 gene locus_tag LOCUS_17480 20176 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 20520 21434 gene locus_tag LOCUS_17490 20520 21434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 21446 22990 gene locus_tag LOCUS_17500 21446 22990 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029761399.1 protein_id gnl|my_center|LOCUS_17500 23041 24153 gene locus_tag LOCUS_17510 23041 24153 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 protein_id gnl|my_center|LOCUS_17510 24217 25722 gene locus_tag LOCUS_17520 24217 25722 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 protein_id gnl|my_center|LOCUS_17520 26679 25807 gene locus_tag LOCUS_17530 26679 25807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 28101 26812 gene locus_tag LOCUS_17540 28101 26812 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005023250.1 protein_id gnl|my_center|LOCUS_17540 28346 30943 gene locus_tag LOCUS_17550 gene mutS 28346 30943 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_17550 31588 31109 gene locus_tag LOCUS_17560 31588 31109 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_17560 31874 32494 gene locus_tag LOCUS_17570 31874 32494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 33158 32550 gene locus_tag LOCUS_17580 gene rnhB 33158 32550 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811770.1 protein_id gnl|my_center|LOCUS_17580 33608 33174 gene locus_tag LOCUS_17590 gene fabZ 33608 33174 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_17590 34213 33677 gene locus_tag LOCUS_17600 34213 33677 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_17600 36564 34237 gene locus_tag LOCUS_17610 gene bamA 36564 34237 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_17610 37932 36565 gene locus_tag LOCUS_17620 gene rseP 37932 36565 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 protein_id gnl|my_center|LOCUS_17620 39275 38088 gene locus_tag LOCUS_17630 gene ispC 39275 38088 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_17630 40096 39272 gene locus_tag LOCUS_17640 40096 39272 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690029.1 protein_id gnl|my_center|LOCUS_17640 40877 40110 gene locus_tag LOCUS_17650 gene uppS 40877 40110 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_17650 41436 40879 gene locus_tag LOCUS_17660 gene frr 41436 40879 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_17660 42203 41487 gene locus_tag LOCUS_17670 gene pyrH 42203 41487 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_17670 43120 42236 gene locus_tag LOCUS_17680 gene tsf 43120 42236 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 protein_id gnl|my_center|LOCUS_17680 44040 43321 gene locus_tag LOCUS_17690 gene rpsB 44040 43321 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_17690 44387 45661 gene locus_tag LOCUS_17700 44387 45661 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_17700 45654 46214 gene locus_tag LOCUS_17710 45654 46214 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_17710 47319 46222 gene locus_tag LOCUS_17720 gene ribD 47319 46222 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186140.1 protein_id gnl|my_center|LOCUS_17720 47877 47392 gene locus_tag LOCUS_17730 gene nrdR 47877 47392 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_17730 49134 47887 gene locus_tag LOCUS_17740 49134 47887 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_17740 49651 51042 gene locus_tag LOCUS_17750 49651 51042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 53010 51658 gene locus_tag LOCUS_17760 53010 51658 CDS product IS5-like element IS1478 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035783.1 protein_id gnl|my_center|LOCUS_17760 53767 54753 gene locus_tag LOCUS_17770 53767 54753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946008.1 protein_id gnl|my_center|LOCUS_17770 55123 55872 gene locus_tag LOCUS_17780 55123 55872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 56761 55973 gene locus_tag LOCUS_17790 56761 55973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 60037 56777 gene locus_tag LOCUS_17800 60037 56777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 60511 61173 gene locus_tag LOCUS_17810 60511 61173 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_17810 63458 61239 gene locus_tag LOCUS_17820 63458 61239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 63756 64247 gene locus_tag LOCUS_17830 63756 64247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 64361 64762 gene locus_tag LOCUS_17840 gene crcB 64361 64762 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_17840 64779 65096 gene locus_tag LOCUS_17850 64779 65096 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425054.1 protein_id gnl|my_center|LOCUS_17850 65289 66047 gene locus_tag LOCUS_17860 65289 66047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17860 68089 66302 gene locus_tag LOCUS_17870 gene arsA 68089 66302 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705614.1 protein_id gnl|my_center|LOCUS_17870 68460 68110 gene locus_tag LOCUS_17880 gene arsD 68460 68110 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 protein_id gnl|my_center|LOCUS_17880 69575 68640 gene locus_tag LOCUS_17890 69575 68640 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 protein_id gnl|my_center|LOCUS_17890 70833 69832 gene locus_tag LOCUS_17900 70833 69832 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_17900 72541 70865 gene locus_tag LOCUS_17910 72541 70865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 74244 72931 gene locus_tag LOCUS_17920 74244 72931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 79218 74368 gene locus_tag LOCUS_17930 79218 74368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 79601 80632 gene locus_tag LOCUS_17940 79601 80632 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_17940 80620 81378 gene locus_tag LOCUS_17950 80620 81378 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_17950 83983 81455 gene locus_tag LOCUS_17960 gene mdoH 83983 81455 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097163.1 protein_id gnl|my_center|LOCUS_17960 85532 83976 gene locus_tag LOCUS_17970 gene mdoG 85532 83976 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097164.1 protein_id gnl|my_center|LOCUS_17970 86067 87824 gene locus_tag LOCUS_17980 86067 87824 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_17980 89212 87872 gene locus_tag LOCUS_17990 89212 87872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 89858 92305 gene locus_tag LOCUS_18000 89858 92305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_18000 92369 93523 gene locus_tag LOCUS_18010 92369 93523 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_18010 96466 93608 gene locus_tag LOCUS_18020 96466 93608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 97018 96476 gene locus_tag LOCUS_18030 97018 96476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 97499 98044 gene locus_tag LOCUS_18040 97499 98044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 99150 98179 gene locus_tag LOCUS_18050 99150 98179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 100856 99150 gene locus_tag LOCUS_18060 100856 99150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 101378 102352 gene locus_tag LOCUS_18070 101378 102352 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_18070 102619 102461 gene locus_tag LOCUS_18080 102619 102461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 104376 103075 gene locus_tag LOCUS_18090 104376 103075 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_18090 105302 104394 gene locus_tag LOCUS_18100 105302 104394 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098128.1 protein_id gnl|my_center|LOCUS_18100 106397 105393 gene locus_tag LOCUS_18110 106397 105393 CDS product ribonuclease T2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443921.1 protein_id gnl|my_center|LOCUS_18110 106623 107375 gene locus_tag LOCUS_18120 106623 107375 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191554.1 protein_id gnl|my_center|LOCUS_18120 108611 107406 gene locus_tag LOCUS_18130 gene zapE 108611 107406 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_18130 110000 108624 gene locus_tag LOCUS_18140 110000 108624 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_18140 110770 109997 gene locus_tag LOCUS_18150 110770 109997 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815212.1 protein_id gnl|my_center|LOCUS_18150 110802 111446 gene locus_tag LOCUS_18160 gene pyrE 110802 111446 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_18160 111605 111832 gene locus_tag LOCUS_18170 111605 111832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence12 636 388 gene locus_tag LOCUS_18180 636 388 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_18180 3832 1100 gene locus_tag LOCUS_18190 3832 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 4818 3841 gene locus_tag LOCUS_18200 4818 3841 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814066.1 protein_id gnl|my_center|LOCUS_18200 6213 4843 gene locus_tag LOCUS_18210 6213 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 7668 6697 gene locus_tag LOCUS_18220 7668 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079007.1 protein_id gnl|my_center|LOCUS_18220 8309 7689 gene locus_tag LOCUS_18230 8309 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464623.1 protein_id gnl|my_center|LOCUS_18230 8451 9329 gene locus_tag LOCUS_18240 gene cmrA 8451 9329 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_18240 12440 9645 gene locus_tag LOCUS_18250 12440 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 15561 12763 gene locus_tag LOCUS_18260 15561 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 15732 16688 gene locus_tag LOCUS_18270 15732 16688 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_18270 16701 17930 gene locus_tag LOCUS_18280 16701 17930 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_18280 18116 18583 gene locus_tag LOCUS_18290 gene bfr 18116 18583 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_18290 18910 21723 gene locus_tag LOCUS_18300 18910 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 22440 21847 gene locus_tag LOCUS_18310 22440 21847 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 protein_id gnl|my_center|LOCUS_18310 24062 22488 gene locus_tag LOCUS_18320 24062 22488 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389689.1 protein_id gnl|my_center|LOCUS_18320 25513 24536 gene locus_tag LOCUS_18330 25513 24536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 26880 25510 gene locus_tag LOCUS_18340 26880 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 27327 26998 gene locus_tag LOCUS_18350 27327 26998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 27518 28654 gene locus_tag LOCUS_18360 27518 28654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 28830 31649 gene locus_tag LOCUS_18370 28830 31649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 31652 33130 gene locus_tag LOCUS_18380 31652 33130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 39241 33200 gene locus_tag LOCUS_18390 39241 33200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 35746 35843 gene locus_tag LOCUS_t00200 35746 35843 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 40335 39355 gene locus_tag LOCUS_18400 40335 39355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 41167 40442 gene locus_tag LOCUS_18410 41167 40442 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039263.1 protein_id gnl|my_center|LOCUS_18410 41330 42559 gene locus_tag LOCUS_18420 41330 42559 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_18420 42560 44125 gene locus_tag LOCUS_18430 42560 44125 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537520.1 protein_id gnl|my_center|LOCUS_18430 44146 44907 gene locus_tag LOCUS_18440 44146 44907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 44985 45998 gene locus_tag LOCUS_18450 44985 45998 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096289.1 protein_id gnl|my_center|LOCUS_18450 46037 47701 gene locus_tag LOCUS_18460 46037 47701 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266271.1 protein_id gnl|my_center|LOCUS_18460 47706 48761 gene locus_tag LOCUS_18470 47706 48761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_18470 48988 49314 gene locus_tag LOCUS_18480 gene trxA 48988 49314 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_18480 49458 50717 gene locus_tag LOCUS_18490 gene rho 49458 50717 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_18490 50815 51024 gene locus_tag LOCUS_18500 gene rpmE 50815 51024 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946387.1 protein_id gnl|my_center|LOCUS_18500 51390 51082 gene locus_tag LOCUS_18510 51390 51082 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073565.1 protein_id gnl|my_center|LOCUS_18510 51485 52300 gene locus_tag LOCUS_18520 51485 52300 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_18520 53512 52823 gene locus_tag LOCUS_18530 53512 52823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18530 54508 53564 gene locus_tag LOCUS_18540 54508 53564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 56812 55310 gene locus_tag LOCUS_18550 gene murJ 56812 55310 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816533.1 protein_id gnl|my_center|LOCUS_18550 57694 56972 gene locus_tag LOCUS_18560 57694 56972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 57973 58311 gene locus_tag LOCUS_18570 57973 58311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 58324 59181 gene locus_tag LOCUS_18580 58324 59181 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 protein_id gnl|my_center|LOCUS_18580 59150 59935 gene locus_tag LOCUS_18590 59150 59935 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113019.1 protein_id gnl|my_center|LOCUS_18590 60037 60759 gene locus_tag LOCUS_18600 60037 60759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 60781 62421 gene locus_tag LOCUS_18610 60781 62421 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 protein_id gnl|my_center|LOCUS_18610 64061 62442 gene locus_tag LOCUS_18620 64061 62442 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_18620 66005 64284 gene locus_tag LOCUS_18630 66005 64284 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_18630 67561 66203 gene locus_tag LOCUS_18640 gene chrA 67561 66203 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_18640 68718 67621 gene locus_tag LOCUS_18650 68718 67621 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 protein_id gnl|my_center|LOCUS_18650 68995 69399 gene locus_tag LOCUS_18660 68995 69399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 71508 69439 gene locus_tag LOCUS_18670 71508 69439 CDS product 10S-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114857.1 protein_id gnl|my_center|LOCUS_18670 71879 71664 gene locus_tag LOCUS_18680 71879 71664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 71920 73137 gene locus_tag LOCUS_18690 71920 73137 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096703.1 protein_id gnl|my_center|LOCUS_18690 73134 74288 gene locus_tag LOCUS_18700 73134 74288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 74294 77446 gene locus_tag LOCUS_18710 74294 77446 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_18710 77958 77617 gene locus_tag LOCUS_18720 77958 77617 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_18720 78231 77962 gene locus_tag LOCUS_18730 78231 77962 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_18730 78725 78225 gene locus_tag LOCUS_18740 78725 78225 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721310.1 protein_id gnl|my_center|LOCUS_18740 80257 78722 gene locus_tag LOCUS_18750 80257 78722 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_18750 80583 80254 gene locus_tag LOCUS_18760 80583 80254 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_18760 83387 80583 gene locus_tag LOCUS_18770 83387 80583 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_18770 84345 83644 gene locus_tag LOCUS_18780 84345 83644 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_18780 84632 86371 gene locus_tag LOCUS_18790 84632 86371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 86604 86386 gene locus_tag LOCUS_18800 86604 86386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 86938 87957 gene locus_tag LOCUS_18810 86938 87957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 88870 88010 gene locus_tag LOCUS_18820 88870 88010 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_18820 89005 89436 gene locus_tag LOCUS_18830 89005 89436 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_18830 89470 89886 gene locus_tag LOCUS_18840 89470 89886 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_18840 89991 90326 gene locus_tag LOCUS_18850 89991 90326 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807250.1 protein_id gnl|my_center|LOCUS_18850 90423 92033 gene locus_tag LOCUS_18860 90423 92033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 92008 92871 gene locus_tag LOCUS_18870 92008 92871 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266172.1 protein_id gnl|my_center|LOCUS_18870 93922 92891 gene locus_tag LOCUS_18880 93922 92891 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_18880 94417 95322 gene locus_tag LOCUS_18890 94417 95322 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 protein_id gnl|my_center|LOCUS_18890 95327 96781 gene locus_tag LOCUS_18900 gene glcD 95327 96781 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_18900 96787 97860 gene locus_tag LOCUS_18910 gene glcE 96787 97860 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_18910 97861 99102 gene locus_tag LOCUS_18920 gene glcF 97861 99102 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 protein_id gnl|my_center|LOCUS_18920 99250 100002 gene locus_tag LOCUS_18930 99250 100002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence13 289 113 gene locus_tag LOCUS_18940 289 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 539 312 gene locus_tag LOCUS_18950 539 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1574 540 gene locus_tag LOCUS_18960 1574 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 2095 1595 gene locus_tag LOCUS_18970 2095 1595 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213216.1 protein_id gnl|my_center|LOCUS_18970 2169 3044 gene locus_tag LOCUS_18980 gene flgJ 2169 3044 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 protein_id gnl|my_center|LOCUS_18980 3124 5022 gene locus_tag LOCUS_18990 gene flgK 3124 5022 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_18990 5048 6256 gene locus_tag LOCUS_19000 gene flgL 5048 6256 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_19000 7585 6269 gene locus_tag LOCUS_19010 gene purD 7585 6269 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_19010 9154 7595 gene locus_tag LOCUS_19020 gene purH 9154 7595 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_19020 9393 9151 gene locus_tag LOCUS_19030 9393 9151 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_19030 10404 9397 gene locus_tag LOCUS_19040 gene dusB 10404 9397 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_19040 11713 10541 gene locus_tag LOCUS_19050 gene ubiH 11713 10541 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132411.1 protein_id gnl|my_center|LOCUS_19050 12051 12800 gene locus_tag LOCUS_19060 12051 12800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 12891 13565 gene locus_tag LOCUS_19070 12891 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 14658 13609 gene locus_tag LOCUS_19080 gene fbaB 14658 13609 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 protein_id gnl|my_center|LOCUS_19080 15034 17259 gene locus_tag LOCUS_19090 15034 17259 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063648.1 protein_id gnl|my_center|LOCUS_19090 18739 17297 gene locus_tag LOCUS_19100 18739 17297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 19144 18755 gene locus_tag LOCUS_19110 19144 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 20213 19398 gene locus_tag LOCUS_19120 gene ubiE 20213 19398 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217627.1 protein_id gnl|my_center|LOCUS_19120 20587 20210 gene locus_tag LOCUS_19130 20587 20210 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_19130 20677 21399 gene locus_tag LOCUS_19140 gene phoB 20677 21399 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192125.1 protein_id gnl|my_center|LOCUS_19140 21647 22822 gene locus_tag LOCUS_19150 gene phoR 21647 22822 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_19150 23344 22961 gene locus_tag LOCUS_19160 23344 22961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 23610 24437 gene locus_tag LOCUS_19170 23610 24437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 24742 25932 gene locus_tag LOCUS_19180 24742 25932 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_19180 26476 26045 gene locus_tag LOCUS_19190 26476 26045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 27704 26640 gene locus_tag LOCUS_19200 27704 26640 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_19200 28103 28732 gene locus_tag LOCUS_19210 28103 28732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 29627 31315 gene locus_tag LOCUS_19220 29627 31315 CDS product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_19220 31324 32145 gene locus_tag LOCUS_19230 31324 32145 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266172.1 protein_id gnl|my_center|LOCUS_19230 32343 32852 gene locus_tag LOCUS_19240 32343 32852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187158.1 protein_id gnl|my_center|LOCUS_19240 34427 33042 gene locus_tag LOCUS_19250 34427 33042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 36764 34509 gene locus_tag LOCUS_19260 36764 34509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 37501 37091 gene locus_tag LOCUS_19270 37501 37091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 37613 38056 gene locus_tag LOCUS_19280 37613 38056 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086970.1 protein_id gnl|my_center|LOCUS_19280 39593 38046 gene locus_tag LOCUS_19290 39593 38046 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_19290 39671 43660 gene locus_tag LOCUS_19300 gene purL 39671 43660 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_19300 43699 44928 gene locus_tag LOCUS_19310 43699 44928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 44947 46986 gene locus_tag LOCUS_19320 44947 46986 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_19320 48019 48831 gene locus_tag LOCUS_19330 48019 48831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 50201 48915 gene locus_tag LOCUS_19340 50201 48915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 50287 51024 gene locus_tag LOCUS_19350 50287 51024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 51191 52591 gene locus_tag LOCUS_19360 51191 52591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 52594 52941 gene locus_tag LOCUS_19370 52594 52941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 53043 53870 gene locus_tag LOCUS_19380 53043 53870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 53971 53896 gene locus_tag LOCUS_t00210 53971 53896 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 54251 54817 gene locus_tag LOCUS_19390 54251 54817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 55165 56199 gene locus_tag LOCUS_19400 gene galE 55165 56199 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967679.1 protein_id gnl|my_center|LOCUS_19400 56268 57161 gene locus_tag LOCUS_19410 gene galU 56268 57161 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_19410 59548 57248 gene locus_tag LOCUS_19420 59548 57248 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 protein_id gnl|my_center|LOCUS_19420 59834 60973 gene locus_tag LOCUS_19430 gene flhB 59834 60973 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_19430 61016 63097 gene locus_tag LOCUS_19440 gene flhA 61016 63097 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_19440 63094 64380 gene locus_tag LOCUS_19450 63094 64380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 64373 65269 gene locus_tag LOCUS_19460 64373 65269 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073096.1 protein_id gnl|my_center|LOCUS_19460 65270 65992 gene locus_tag LOCUS_19470 65270 65992 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_19470 66034 66792 gene locus_tag LOCUS_19480 66034 66792 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_19480 66874 67611 gene locus_tag LOCUS_19490 gene motD 66874 67611 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_19490 68088 67627 gene locus_tag LOCUS_19500 68088 67627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 68395 68090 gene locus_tag LOCUS_19510 68395 68090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 68634 69365 gene locus_tag LOCUS_19520 68634 69365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 69513 70205 gene locus_tag LOCUS_19530 69513 70205 CDS product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_19530 70214 70693 gene locus_tag LOCUS_19540 70214 70693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 70824 71249 gene locus_tag LOCUS_19550 gene ndk 70824 71249 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_19550 71410 72378 gene locus_tag LOCUS_19560 gene rlmN 71410 72378 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_19560 72375 73160 gene locus_tag LOCUS_19570 gene pilW 72375 73160 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 protein_id gnl|my_center|LOCUS_19570 73157 74323 gene locus_tag LOCUS_19580 gene rodZ 73157 74323 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090905.1 protein_id gnl|my_center|LOCUS_19580 74423 75598 gene locus_tag LOCUS_19590 gene ispG 74423 75598 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_19590 75598 76872 gene locus_tag LOCUS_19600 gene hisS 75598 76872 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_19600 76882 77517 gene locus_tag LOCUS_19610 76882 77517 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_19610 77673 78755 gene locus_tag LOCUS_19620 gene bamB 77673 78755 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 protein_id gnl|my_center|LOCUS_19620 78809 80236 gene locus_tag LOCUS_19630 gene der 78809 80236 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_19630 80253 80915 gene locus_tag LOCUS_19640 80253 80915 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_19640 80946 81134 gene locus_tag LOCUS_19650 80946 81134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 81140 82957 gene locus_tag LOCUS_19660 gene uvrC 81140 82957 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930726.1 protein_id gnl|my_center|LOCUS_19660 82988 83566 gene locus_tag LOCUS_19670 gene pgsA 82988 83566 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192722.1 protein_id gnl|my_center|LOCUS_19670 84477 84250 gene locus_tag LOCUS_19680 84477 84250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 84798 84571 gene locus_tag LOCUS_19690 84798 84571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 86633 85995 gene locus_tag LOCUS_19700 86633 85995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 87588 86974 gene locus_tag LOCUS_19710 87588 86974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 87986 87606 gene locus_tag LOCUS_19720 87986 87606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 88926 88618 gene locus_tag LOCUS_19730 88926 88618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 89853 89416 gene locus_tag LOCUS_19740 89853 89416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 91042 89915 gene locus_tag LOCUS_19750 91042 89915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 93165 91039 gene locus_tag LOCUS_19760 93165 91039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 93458 93249 gene locus_tag LOCUS_19770 93458 93249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 93539 93940 gene locus_tag LOCUS_19780 93539 93940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 94395 94210 gene locus_tag LOCUS_19790 94395 94210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 94867 94583 gene locus_tag LOCUS_19800 gene vapD 94867 94583 CDS product virulence-associated protein VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693712.1 protein_id gnl|my_center|LOCUS_19800 95064 94867 gene locus_tag LOCUS_19810 95064 94867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 95339 95070 gene locus_tag LOCUS_19820 95339 95070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 96650 95643 gene locus_tag LOCUS_19830 96650 95643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 96938 96651 gene locus_tag LOCUS_19840 96938 96651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence14 <1 939 gene locus_tag LOCUS_19850 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028841931.1:adenylate/guanylate cyclase domain-containing protein 1226 4603 gene locus_tag LOCUS_19860 1226 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4619 4954 gene locus_tag LOCUS_19870 4619 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 7155 5095 gene locus_tag LOCUS_19880 7155 5095 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_19880 8638 7379 gene locus_tag LOCUS_19890 8638 7379 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_19890 9448 8774 gene locus_tag LOCUS_19900 gene adk 9448 8774 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_19900 9650 10699 gene locus_tag LOCUS_19910 gene recA 9650 10699 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_19910 10705 11163 gene locus_tag LOCUS_19920 10705 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 11160 11525 gene locus_tag LOCUS_19930 11160 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 11522 14119 gene locus_tag LOCUS_19940 gene alaS 11522 14119 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_19940 14216 14476 gene locus_tag LOCUS_19950 14216 14476 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_19950 14469 14678 gene locus_tag LOCUS_19960 14469 14678 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_19960 14678 14848 gene locus_tag LOCUS_19970 14678 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 15039 16058 gene locus_tag LOCUS_19980 15039 16058 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705723.1 protein_id gnl|my_center|LOCUS_19980 16326 16114 gene locus_tag LOCUS_19990 16326 16114 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_19990 16439 16729 gene locus_tag LOCUS_20000 16439 16729 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_20000 16722 17066 gene locus_tag LOCUS_20010 16722 17066 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_20010 17177 17632 gene locus_tag LOCUS_20020 17177 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 17743 18150 gene locus_tag LOCUS_20030 17743 18150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 18147 18740 gene locus_tag LOCUS_20040 18147 18740 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970715.1 protein_id gnl|my_center|LOCUS_20040 19926 18790 gene locus_tag LOCUS_20050 19926 18790 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_20050 21011 19968 gene locus_tag LOCUS_20060 21011 19968 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_20060 22402 21152 gene locus_tag LOCUS_20070 22402 21152 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_20070 23284 22442 gene locus_tag LOCUS_20080 23284 22442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 23777 23505 gene locus_tag LOCUS_20090 23777 23505 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763614.1 protein_id gnl|my_center|LOCUS_20090 24271 23786 gene locus_tag LOCUS_20100 gene coaD 24271 23786 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_20100 24818 24264 gene locus_tag LOCUS_20110 gene rsmD 24818 24264 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_20110 26134 24830 gene locus_tag LOCUS_20120 26134 24830 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_20120 29011 26195 gene locus_tag LOCUS_20130 gene ppc 29011 26195 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_20130 29186 30076 gene locus_tag LOCUS_20140 gene hemC 29186 30076 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687436.1 protein_id gnl|my_center|LOCUS_20140 30076 30867 gene locus_tag LOCUS_20150 gene hemD 30076 30867 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703978.1 protein_id gnl|my_center|LOCUS_20150 31027 32202 gene locus_tag LOCUS_20160 31027 32202 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_20160 33239 32199 gene locus_tag LOCUS_20170 33239 32199 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_20170 33603 34214 gene locus_tag LOCUS_20180 33603 34214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 34411 35634 gene locus_tag LOCUS_20190 34411 35634 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_20190 35693 36538 gene locus_tag LOCUS_20200 35693 36538 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_20200 36542 37144 gene locus_tag LOCUS_20210 gene coaE 36542 37144 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770017.1 protein_id gnl|my_center|LOCUS_20210 37263 38018 gene locus_tag LOCUS_20220 gene zapD 37263 38018 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_20220 38359 40209 gene locus_tag LOCUS_20230 38359 40209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 40510 40725 gene locus_tag LOCUS_20240 40510 40725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20240 41177 40998 gene locus_tag LOCUS_20250 41177 40998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 41637 42611 gene locus_tag LOCUS_20260 41637 42611 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_20260 42663 45044 gene locus_tag LOCUS_20270 gene ppsA 42663 45044 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818062.1 protein_id gnl|my_center|LOCUS_20270 45011 45871 gene locus_tag LOCUS_20280 45011 45871 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120310.1 protein_id gnl|my_center|LOCUS_20280 47226 45928 gene locus_tag LOCUS_20290 47226 45928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 49265 47475 gene locus_tag LOCUS_20300 gene mutL 49265 47475 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065015.1 protein_id gnl|my_center|LOCUS_20300 49366 49965 gene locus_tag LOCUS_20310 49366 49965 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693948.1 protein_id gnl|my_center|LOCUS_20310 49962 50471 gene locus_tag LOCUS_20320 49962 50471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 51349 50480 gene locus_tag LOCUS_20330 51349 50480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 51760 51359 gene locus_tag LOCUS_20340 51760 51359 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_20340 52424 51747 gene locus_tag LOCUS_20350 52424 51747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 52799 53167 gene locus_tag LOCUS_20360 52799 53167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 53925 53164 gene locus_tag LOCUS_20370 53925 53164 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_20370 54087 54278 gene locus_tag LOCUS_20380 54087 54278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 55709 54435 gene locus_tag LOCUS_20390 55709 54435 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082852.1 protein_id gnl|my_center|LOCUS_20390 57803 55752 gene locus_tag LOCUS_20400 57803 55752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 60165 58318 gene locus_tag LOCUS_20410 gene glmS 60165 58318 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_20410 60736 61884 gene locus_tag LOCUS_20420 60736 61884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 61971 62150 gene locus_tag LOCUS_20430 61971 62150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 63513 63022 gene locus_tag LOCUS_20440 gene lspA 63513 63022 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704644.1 protein_id gnl|my_center|LOCUS_20440 66346 63545 gene locus_tag LOCUS_20450 gene ileS 66346 63545 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541624.1 protein_id gnl|my_center|LOCUS_20450 67249 66365 gene locus_tag LOCUS_20460 67249 66365 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20460 67458 68072 gene locus_tag LOCUS_20470 gene slmA 67458 68072 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 protein_id gnl|my_center|LOCUS_20470 68862 68092 gene locus_tag LOCUS_20480 gene moeB 68862 68092 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_20480 70304 68859 gene locus_tag LOCUS_20490 gene cptA 70304 68859 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_20490 71601 70351 gene locus_tag LOCUS_20500 71601 70351 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_20500 72350 71598 gene locus_tag LOCUS_20510 gene gpmA 72350 71598 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_20510 72750 73085 gene locus_tag LOCUS_20520 72750 73085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 73093 73350 gene locus_tag LOCUS_20530 gene grxC 73093 73350 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_20530 73420 73863 gene locus_tag LOCUS_20540 gene secB 73420 73863 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_20540 73914 74363 gene locus_tag LOCUS_20550 73914 74363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 74360 75349 gene locus_tag LOCUS_20560 74360 75349 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_20560 75585 75857 gene locus_tag LOCUS_20570 75585 75857 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_20570 75872 75947 gene locus_tag LOCUS_t00220 75872 75947 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 75966 76042 gene locus_tag LOCUS_t00230 75966 76042 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 76105 77985 gene locus_tag LOCUS_20580 76105 77985 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527215.1 protein_id gnl|my_center|LOCUS_20580 78802 78014 gene locus_tag LOCUS_20590 gene fabI 78802 78014 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_20590 78856 81129 gene locus_tag LOCUS_20600 78856 81129 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_20600 81153 82130 gene locus_tag LOCUS_20610 81153 82130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_20610 82289 82373 gene locus_tag LOCUS_t00240 82289 82373 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 82461 82534 gene locus_tag LOCUS_t00250 82461 82534 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 82575 82649 gene locus_tag LOCUS_t00260 82575 82649 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 82700 83890 gene locus_tag LOCUS_20620 gene tuf 82700 83890 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806883.1 protein_id gnl|my_center|LOCUS_20620 83970 84045 gene locus_tag LOCUS_t00270 83970 84045 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 84185 84487 gene locus_tag LOCUS_20630 84185 84487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 84509 85042 gene locus_tag LOCUS_20640 gene nusG 84509 85042 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525645.1 protein_id gnl|my_center|LOCUS_20640 85144 85575 gene locus_tag LOCUS_20650 gene rplK 85144 85575 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_20650 85577 86269 gene locus_tag LOCUS_20660 gene rplA 85577 86269 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_20660 86573 87088 gene locus_tag LOCUS_20670 gene rplJ 86573 87088 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_20670 87148 87531 gene locus_tag LOCUS_20680 gene rplL 87148 87531 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_20680 87688 91761 gene locus_tag LOCUS_20690 gene rpoB 87688 91761 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_20690 91860 96062 gene locus_tag LOCUS_20700 gene rpoC 91860 96062 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521902.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence15 961 1383 gene locus_tag LOCUS_20710 961 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2388 4916 gene locus_tag LOCUS_20720 2388 4916 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_20720 4969 5460 gene locus_tag LOCUS_20730 4969 5460 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539816.1 protein_id gnl|my_center|LOCUS_20730 5484 6758 gene locus_tag LOCUS_20740 5484 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 6872 7285 gene locus_tag LOCUS_20750 6872 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 7302 8003 gene locus_tag LOCUS_20760 7302 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 8160 8549 gene locus_tag LOCUS_20770 8160 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 8688 9068 gene locus_tag LOCUS_20780 8688 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 9055 9315 gene locus_tag LOCUS_20790 9055 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 9366 9911 gene locus_tag LOCUS_20800 9366 9911 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_20800 9915 10742 gene locus_tag LOCUS_20810 gene dapF 9915 10742 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 protein_id gnl|my_center|LOCUS_20810 10760 11437 gene locus_tag LOCUS_20820 10760 11437 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931281.1 protein_id gnl|my_center|LOCUS_20820 11449 12342 gene locus_tag LOCUS_20830 gene xerC 11449 12342 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_20830 12421 12942 gene locus_tag LOCUS_20840 gene hslV 12421 12942 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_20840 13052 14383 gene locus_tag LOCUS_20850 gene hslU 13052 14383 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198316.1 protein_id gnl|my_center|LOCUS_20850 14657 17980 gene locus_tag LOCUS_20860 14657 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 18197 18502 gene locus_tag LOCUS_20870 18197 18502 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807023.1 protein_id gnl|my_center|LOCUS_20870 18633 20414 gene locus_tag LOCUS_20880 gene aspS 18633 20414 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_20880 20433 20864 gene locus_tag LOCUS_20890 gene nudB 20433 20864 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_20890 21701 20886 gene locus_tag LOCUS_20900 21701 20886 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391622.1 protein_id gnl|my_center|LOCUS_20900 23091 21799 gene locus_tag LOCUS_20910 23091 21799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 24479 23484 gene locus_tag LOCUS_20920 24479 23484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 27721 24776 gene locus_tag LOCUS_20930 27721 24776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 28842 27721 gene locus_tag LOCUS_20940 28842 27721 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 protein_id gnl|my_center|LOCUS_20940 30399 28846 gene locus_tag LOCUS_20950 30399 28846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 30631 30933 gene locus_tag LOCUS_20960 30631 30933 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_20960 30933 31223 gene locus_tag LOCUS_20970 30933 31223 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_20970 32138 31332 gene locus_tag LOCUS_20980 32138 31332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 32919 32140 gene locus_tag LOCUS_20990 32919 32140 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_20990 33340 34323 gene locus_tag LOCUS_21000 33340 34323 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187735.1 protein_id gnl|my_center|LOCUS_21000 35696 34437 gene locus_tag LOCUS_21010 35696 34437 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925859.1 protein_id gnl|my_center|LOCUS_21010 36140 35700 gene locus_tag LOCUS_21020 gene fur 36140 35700 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_21020 36275 36625 gene locus_tag LOCUS_21030 36275 36625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 36720 37484 gene locus_tag LOCUS_21040 gene dapB 36720 37484 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_21040 37494 38297 gene locus_tag LOCUS_21050 37494 38297 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103186.1 protein_id gnl|my_center|LOCUS_21050 39042 38248 gene locus_tag LOCUS_21060 39042 38248 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_21060 39509 39192 gene locus_tag LOCUS_21070 39509 39192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 40508 39552 gene locus_tag LOCUS_21080 40508 39552 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_21080 42087 40813 gene locus_tag LOCUS_21090 42087 40813 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808475.1 protein_id gnl|my_center|LOCUS_21090 42757 42068 gene locus_tag LOCUS_21100 42757 42068 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_21100 43862 42789 gene locus_tag LOCUS_21110 gene hemE 43862 42789 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706638.1 protein_id gnl|my_center|LOCUS_21110 45187 44066 gene locus_tag LOCUS_21120 45187 44066 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806949.1 protein_id gnl|my_center|LOCUS_21120 46877 45180 gene locus_tag LOCUS_21130 46877 45180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 50152 46982 gene locus_tag LOCUS_21140 50152 46982 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_21140 52360 50630 gene locus_tag LOCUS_21150 52360 50630 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452234.1 protein_id gnl|my_center|LOCUS_21150 52911 52399 gene locus_tag LOCUS_21160 gene cheW 52911 52399 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_21160 53643 54026 gene locus_tag LOCUS_21170 53643 54026 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188348.1 protein_id gnl|my_center|LOCUS_21170 54820 54035 gene locus_tag LOCUS_21180 54820 54035 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_21180 54900 55106 gene locus_tag LOCUS_21190 54900 55106 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_21190 55853 55176 gene locus_tag LOCUS_21200 55853 55176 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_21200 57022 55853 gene locus_tag LOCUS_21210 gene devC 57022 55853 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140489.1 protein_id gnl|my_center|LOCUS_21210 57831 57019 gene locus_tag LOCUS_21220 57831 57019 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124972.1 protein_id gnl|my_center|LOCUS_21220 58016 60616 gene locus_tag LOCUS_21230 gene leuS 58016 60616 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_21230 60783 61139 gene locus_tag LOCUS_21240 60783 61139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 61162 62172 gene locus_tag LOCUS_21250 gene holA 61162 62172 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_21250 62284 62718 gene locus_tag LOCUS_21260 gene rplM 62284 62718 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_21260 62720 63112 gene locus_tag LOCUS_21270 gene rpsI 62720 63112 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_21270 63210 64238 gene locus_tag LOCUS_21280 gene argC 63210 64238 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767875.1 protein_id gnl|my_center|LOCUS_21280 64479 65081 gene locus_tag LOCUS_21290 64479 65081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 65095 65553 gene locus_tag LOCUS_21300 65095 65553 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909388.1 protein_id gnl|my_center|LOCUS_21300 65604 65948 gene locus_tag LOCUS_21310 gene erpA 65604 65948 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_21310 67050 65977 gene locus_tag LOCUS_21320 67050 65977 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269098.1 protein_id gnl|my_center|LOCUS_21320 68528 67191 gene locus_tag LOCUS_21330 68528 67191 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_21330 68684 69886 gene locus_tag LOCUS_21340 gene tyrS 68684 69886 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444785.1 protein_id gnl|my_center|LOCUS_21340 70135 71532 gene locus_tag LOCUS_21350 70135 71532 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_21350 72399 71614 gene locus_tag LOCUS_21360 72399 71614 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_21360 73775 72426 gene locus_tag LOCUS_21370 gene radA 73775 72426 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_21370 74396 73851 gene locus_tag LOCUS_21380 gene rfbC 74396 73851 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_21380 75280 74396 gene locus_tag LOCUS_21390 gene rfbA 75280 74396 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_21390 75517 77103 gene locus_tag LOCUS_21400 gene msbA 75517 77103 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037271.1 protein_id gnl|my_center|LOCUS_21400 78996 77128 gene locus_tag LOCUS_21410 78996 77128 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_21410 79990 78998 gene locus_tag LOCUS_21420 79990 78998 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 protein_id gnl|my_center|LOCUS_21420 81321 80104 gene locus_tag LOCUS_21430 81321 80104 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_21430 81620 81695 gene locus_tag LOCUS_t00280 81620 81695 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 82291 81815 gene locus_tag LOCUS_21440 82291 81815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 83078 82722 gene locus_tag LOCUS_21450 83078 82722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 83706 83248 gene locus_tag LOCUS_21460 83706 83248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 84378 83806 gene locus_tag LOCUS_21470 84378 83806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 85038 84460 gene locus_tag LOCUS_21480 85038 84460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 85646 85344 gene locus_tag LOCUS_21490 85646 85344 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence16 1204 506 gene locus_tag LOCUS_21500 gene pyrF 1204 506 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_21500 1846 1556 gene locus_tag LOCUS_21510 1846 1556 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_21510 3568 1856 gene locus_tag LOCUS_21520 gene rpsA 3568 1856 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_21520 4365 3685 gene locus_tag LOCUS_21530 gene cmK 4365 3685 CDS product cytidylate kinase CmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532324.1 protein_id gnl|my_center|LOCUS_21530 5734 4403 gene locus_tag LOCUS_21540 5734 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 6017 6262 gene locus_tag LOCUS_21550 6017 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 8931 6412 gene locus_tag LOCUS_21560 8931 6412 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_21560 9543 9085 gene locus_tag LOCUS_21570 9543 9085 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040781.1 protein_id gnl|my_center|LOCUS_21570 10705 9605 gene locus_tag LOCUS_21580 gene dprA 10705 9605 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_21580 11751 10717 gene locus_tag LOCUS_21590 11751 10717 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_21590 11847 12350 gene locus_tag LOCUS_21600 gene def 11847 12350 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201745.1 protein_id gnl|my_center|LOCUS_21600 12469 13425 gene locus_tag LOCUS_21610 gene fmt 12469 13425 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099014.1 protein_id gnl|my_center|LOCUS_21610 13418 14695 gene locus_tag LOCUS_21620 gene rsmB 13418 14695 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951361.1 protein_id gnl|my_center|LOCUS_21620 14715 15299 gene locus_tag LOCUS_21630 14715 15299 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_21630 15299 17479 gene locus_tag LOCUS_21640 gene esaS 15299 17479 CDS product sensor histidine kinase EsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523096.1 protein_id gnl|my_center|LOCUS_21640 17628 18890 gene locus_tag LOCUS_21650 17628 18890 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 protein_id gnl|my_center|LOCUS_21650 19028 21043 gene locus_tag LOCUS_21660 gene tkt 19028 21043 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244175.1 protein_id gnl|my_center|LOCUS_21660 21119 22117 gene locus_tag LOCUS_21670 gene gap 21119 22117 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_21670 22250 23428 gene locus_tag LOCUS_21680 22250 23428 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704731.1 protein_id gnl|my_center|LOCUS_21680 23443 24894 gene locus_tag LOCUS_21690 gene pyk 23443 24894 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_21690 25021 26085 gene locus_tag LOCUS_21700 gene fba 25021 26085 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190157.1 protein_id gnl|my_center|LOCUS_21700 26514 26236 gene locus_tag LOCUS_21710 26514 26236 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_21710 27957 26590 gene locus_tag LOCUS_21720 gene argA 27957 26590 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930879.1 protein_id gnl|my_center|LOCUS_21720 28703 27957 gene locus_tag LOCUS_21730 28703 27957 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_21730 28861 29418 gene locus_tag LOCUS_21740 28861 29418 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_21740 29403 30209 gene locus_tag LOCUS_21750 29403 30209 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_21750 30219 31652 gene locus_tag LOCUS_21760 gene trkA 30219 31652 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_21760 31664 33121 gene locus_tag LOCUS_21770 31664 33121 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_21770 33271 33666 gene locus_tag LOCUS_21780 gene pilG 33271 33666 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_21780 33968 34777 gene locus_tag LOCUS_21790 33968 34777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 34945 35769 gene locus_tag LOCUS_21800 34945 35769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 35769 37031 gene locus_tag LOCUS_21810 35769 37031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 37192 37860 gene locus_tag LOCUS_21820 37192 37860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 37863 38447 gene locus_tag LOCUS_21830 37863 38447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 39289 38675 gene locus_tag LOCUS_21840 39289 38675 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_21840 40307 39369 gene locus_tag LOCUS_21850 gene secF 40307 39369 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064325.1 protein_id gnl|my_center|LOCUS_21850 42387 40333 gene locus_tag LOCUS_21860 gene secD 42387 40333 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930154.1 protein_id gnl|my_center|LOCUS_21860 42898 42467 gene locus_tag LOCUS_21870 42898 42467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 44030 42945 gene locus_tag LOCUS_21880 gene tgt 44030 42945 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809419.1 protein_id gnl|my_center|LOCUS_21880 45061 44027 gene locus_tag LOCUS_21890 gene queA 45061 44027 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064321.1 protein_id gnl|my_center|LOCUS_21890 45174 45260 gene locus_tag LOCUS_t00290 45174 45260 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46826 46320 gene locus_tag LOCUS_21900 46826 46320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 51613 47045 gene locus_tag LOCUS_21910 51613 47045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 53761 51653 gene locus_tag LOCUS_21920 gene pilJ 53761 51653 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_21920 55596 54085 gene locus_tag LOCUS_21930 gene ilvA 55596 54085 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_21930 57175 55742 gene locus_tag LOCUS_21940 gene sbcB 57175 55742 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 protein_id gnl|my_center|LOCUS_21940 57289 57681 gene locus_tag LOCUS_21950 57289 57681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 58337 57759 gene locus_tag LOCUS_21960 58337 57759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 60605 58752 gene locus_tag LOCUS_21970 60605 58752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 61704 60952 gene locus_tag LOCUS_21980 61704 60952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 62087 61698 gene locus_tag LOCUS_21990 62087 61698 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_21990 62596 62087 gene locus_tag LOCUS_22000 62596 62087 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_22000 64893 62602 gene locus_tag LOCUS_22010 64893 62602 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_22010 65456 64890 gene locus_tag LOCUS_22020 65456 64890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 66066 65461 gene locus_tag LOCUS_22030 66066 65461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 66596 66057 gene locus_tag LOCUS_22040 66596 66057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 67417 66584 gene locus_tag LOCUS_22050 67417 66584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 69083 67398 gene locus_tag LOCUS_22060 69083 67398 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_22060 70267 69083 gene locus_tag LOCUS_22070 70267 69083 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_22070 70711 70277 gene locus_tag LOCUS_22080 gene gspG 70711 70277 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738789.1 protein_id gnl|my_center|LOCUS_22080 71525 70842 gene locus_tag LOCUS_22090 71525 70842 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_22090 72034 75447 gene locus_tag LOCUS_22100 72034 75447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 75748 75584 gene locus_tag LOCUS_22110 75748 75584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 76503 75685 gene locus_tag LOCUS_22120 76503 75685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 76863 77093 gene locus_tag LOCUS_22130 76863 77093 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_22130 77743 77099 gene locus_tag LOCUS_22140 77743 77099 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_22140 79148 77736 gene locus_tag LOCUS_22150 79148 77736 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939070.1 protein_id gnl|my_center|LOCUS_22150 79909 79145 gene locus_tag LOCUS_22160 79909 79145 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_22160 80091 81770 gene locus_tag LOCUS_22170 80091 81770 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626068.1 protein_id gnl|my_center|LOCUS_22170 83157 81799 gene locus_tag LOCUS_22180 gene pmbA 83157 81799 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_22180 83209 83760 gene locus_tag LOCUS_22190 gene yjgA 83209 83760 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 protein_id gnl|my_center|LOCUS_22190 83819 84547 gene locus_tag LOCUS_22200 83819 84547 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065753.1 protein_id gnl|my_center|LOCUS_22200 84639 84851 gene locus_tag LOCUS_22210 84639 84851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 85147 84848 gene locus_tag LOCUS_22220 85147 84848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 85520 85287 gene locus_tag LOCUS_22230 85520 85287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence17 564 247 gene locus_tag LOCUS_22240 564 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1509 568 gene locus_tag LOCUS_22250 1509 568 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_22250 2975 1803 gene locus_tag LOCUS_22260 2975 1803 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_22260 3053 3439 gene locus_tag LOCUS_22270 3053 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3696 3869 gene locus_tag LOCUS_22280 3696 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 5890 3983 gene locus_tag LOCUS_22290 5890 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 6912 5998 gene locus_tag LOCUS_22300 6912 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 7357 8109 gene locus_tag LOCUS_22310 7357 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 8106 9032 gene locus_tag LOCUS_22320 gene fabD 8106 9032 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048428.1 protein_id gnl|my_center|LOCUS_22320 9029 11005 gene locus_tag LOCUS_22330 gene iorA 9029 11005 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430808.1 protein_id gnl|my_center|LOCUS_22330 11048 11323 gene locus_tag LOCUS_22340 11048 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 11375 12589 gene locus_tag LOCUS_22350 gene fabF 11375 12589 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_22350 12593 13336 gene locus_tag LOCUS_22360 gene fabG 12593 13336 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_22360 13329 14084 gene locus_tag LOCUS_22370 13329 14084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 14077 15279 gene locus_tag LOCUS_22380 gene fabF 14077 15279 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080861.1 protein_id gnl|my_center|LOCUS_22380 15284 15712 gene locus_tag LOCUS_22390 15284 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 16097 17611 gene locus_tag LOCUS_22400 16097 17611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 17604 18248 gene locus_tag LOCUS_22410 17604 18248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 18289 19065 gene locus_tag LOCUS_22420 gene fabG 18289 19065 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_22420 19059 19739 gene locus_tag LOCUS_22430 19059 19739 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227250.1 protein_id gnl|my_center|LOCUS_22430 19898 20617 gene locus_tag LOCUS_22440 19898 20617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966848.1 protein_id gnl|my_center|LOCUS_22440 20604 21830 gene locus_tag LOCUS_22450 20604 21830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012257.1 protein_id gnl|my_center|LOCUS_22450 21857 22633 gene locus_tag LOCUS_22460 21857 22633 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481719.1 protein_id gnl|my_center|LOCUS_22460 22657 23928 gene locus_tag LOCUS_22470 22657 23928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 23944 24612 gene locus_tag LOCUS_22480 23944 24612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 28393 24770 gene locus_tag LOCUS_22490 gene uca 28393 24770 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 protein_id gnl|my_center|LOCUS_22490 29073 28414 gene locus_tag LOCUS_22500 29073 28414 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206333.1 protein_id gnl|my_center|LOCUS_22500 29792 29070 gene locus_tag LOCUS_22510 29792 29070 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_22510 31219 29789 gene locus_tag LOCUS_22520 31219 29789 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082330.1 protein_id gnl|my_center|LOCUS_22520 32099 31557 gene locus_tag LOCUS_22530 32099 31557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 32302 33873 gene locus_tag LOCUS_22540 32302 33873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 34080 34397 gene locus_tag LOCUS_22550 gene flhD 34080 34397 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_22550 34431 34967 gene locus_tag LOCUS_22560 gene flhC 34431 34967 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_22560 36187 34994 gene locus_tag LOCUS_22570 36187 34994 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_22570 36269 38299 gene locus_tag LOCUS_22580 gene uvrB 36269 38299 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_22580 38648 38304 gene locus_tag LOCUS_22590 38648 38304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 39520 38699 gene locus_tag LOCUS_22600 39520 38699 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191284.1 protein_id gnl|my_center|LOCUS_22600 40870 39563 gene locus_tag LOCUS_22610 gene hisD 40870 39563 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_22610 41550 40906 gene locus_tag LOCUS_22620 gene hisG 41550 40906 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_22620 42203 41562 gene locus_tag LOCUS_22630 42203 41562 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_22630 42707 42267 gene locus_tag LOCUS_22640 42707 42267 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_22640 42932 43420 gene locus_tag LOCUS_22650 gene purE 42932 43420 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_22650 43420 44553 gene locus_tag LOCUS_22660 43420 44553 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_22660 44564 45448 gene locus_tag LOCUS_22670 44564 45448 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_22670 45518 46816 gene locus_tag LOCUS_22680 45518 46816 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198176.1 protein_id gnl|my_center|LOCUS_22680 46986 47276 gene locus_tag LOCUS_22690 46986 47276 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_22690 47248 47514 gene locus_tag LOCUS_22700 47248 47514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 47775 48479 gene locus_tag LOCUS_22710 47775 48479 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_22710 49029 49271 gene locus_tag LOCUS_22720 49029 49271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 49272 49532 gene locus_tag LOCUS_22730 49272 49532 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_22730 50320 49601 gene locus_tag LOCUS_22740 50320 49601 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_22740 52490 50463 gene locus_tag LOCUS_22750 52490 50463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 53133 54014 gene locus_tag LOCUS_22760 53133 54014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 54200 54745 gene locus_tag LOCUS_22770 gene ppa 54200 54745 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083378.1 protein_id gnl|my_center|LOCUS_22770 54802 55260 gene locus_tag LOCUS_22780 54802 55260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 55297 55626 gene locus_tag LOCUS_22790 55297 55626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 56464 55667 gene locus_tag LOCUS_22800 56464 55667 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_22800 56951 56496 gene locus_tag LOCUS_22810 56951 56496 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_22810 57002 57718 gene locus_tag LOCUS_22820 57002 57718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 58379 57738 gene locus_tag LOCUS_22830 58379 57738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 58956 58657 gene locus_tag LOCUS_22840 58956 58657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 59146 58949 gene locus_tag LOCUS_22850 59146 58949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 59523 59278 gene locus_tag LOCUS_22860 59523 59278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 60932 59760 gene locus_tag LOCUS_22870 60932 59760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 64576 61031 gene locus_tag LOCUS_22880 gene smc 64576 61031 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205139.1 protein_id gnl|my_center|LOCUS_22880 64673 65092 gene locus_tag LOCUS_22890 gene queF 64673 65092 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_22890 65246 66538 gene locus_tag LOCUS_22900 65246 66538 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_22900 67871 66561 gene locus_tag LOCUS_22910 67871 66561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 68204 68998 gene locus_tag LOCUS_22920 gene thyA 68204 68998 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 protein_id gnl|my_center|LOCUS_22920 69112 69504 gene locus_tag LOCUS_22930 69112 69504 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189313.1 protein_id gnl|my_center|LOCUS_22930 70770 69598 gene locus_tag LOCUS_22940 70770 69598 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880438.1 protein_id gnl|my_center|LOCUS_22940 72401 71145 gene locus_tag LOCUS_22950 72401 71145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 73007 72441 gene locus_tag LOCUS_22960 gene dcd 73007 72441 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_22960 74107 73019 gene locus_tag LOCUS_22970 gene apbC 74107 73019 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_22970 74235 76340 gene locus_tag LOCUS_22980 gene metG 74235 76340 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538477.1 protein_id gnl|my_center|LOCUS_22980 76351 76722 gene locus_tag LOCUS_22990 76351 76722 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965849.1 protein_id gnl|my_center|LOCUS_22990 76747 77496 gene locus_tag LOCUS_23000 76747 77496 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence18 18 343 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtagcgcccggccccaaagccgggcgaggattgaaac 541 1377 gene locus_tag LOCUS_23010 541 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2404 1937 gene locus_tag LOCUS_23020 2404 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2626 3393 gene locus_tag LOCUS_23030 2626 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3390 4883 gene locus_tag LOCUS_23040 3390 4883 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707899.1 protein_id gnl|my_center|LOCUS_23040 4876 5517 gene locus_tag LOCUS_23050 4876 5517 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_23050 5507 5911 gene locus_tag LOCUS_23060 5507 5911 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_23060 5911 6552 gene locus_tag LOCUS_23070 5911 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 6562 7734 gene locus_tag LOCUS_23080 6562 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 7852 11058 gene locus_tag LOCUS_23090 7852 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 11264 12211 gene locus_tag LOCUS_23100 11264 12211 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798219.1 protein_id gnl|my_center|LOCUS_23100 12360 12638 gene locus_tag LOCUS_23110 12360 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 12889 14304 gene locus_tag LOCUS_23120 12889 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 14726 16327 gene locus_tag LOCUS_23130 14726 16327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275264.1 protein_id gnl|my_center|LOCUS_23130 16682 16957 gene locus_tag LOCUS_23140 16682 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 17266 18309 gene locus_tag LOCUS_23150 gene pstS 17266 18309 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_23150 18416 19354 gene locus_tag LOCUS_23160 gene pstC 18416 19354 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_23160 19366 20211 gene locus_tag LOCUS_23170 gene pstA 19366 20211 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_23170 20293 21147 gene locus_tag LOCUS_23180 gene pstB 20293 21147 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 protein_id gnl|my_center|LOCUS_23180 21596 23449 gene locus_tag LOCUS_23190 21596 23449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 24285 23806 gene locus_tag LOCUS_23200 24285 23806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 26702 24447 gene locus_tag LOCUS_23210 gene clpA 26702 24447 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_23210 27012 26704 gene locus_tag LOCUS_23220 gene clpS 27012 26704 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812950.1 protein_id gnl|my_center|LOCUS_23220 27291 27494 gene locus_tag LOCUS_23230 27291 27494 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_23230 28956 27700 gene locus_tag LOCUS_23240 gene icd 28956 27700 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_23240 29225 30526 gene locus_tag LOCUS_23250 29225 30526 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194395.1 protein_id gnl|my_center|LOCUS_23250 30789 30865 gene locus_tag LOCUS_t00300 30789 30865 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30910 31509 gene locus_tag LOCUS_23260 30910 31509 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_23260 31530 32633 gene locus_tag LOCUS_23270 gene ribBA 31530 32633 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_23270 32694 33176 gene locus_tag LOCUS_23280 gene ribH 32694 33176 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_23280 33182 33673 gene locus_tag LOCUS_23290 gene nusB 33182 33673 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_23290 33687 34655 gene locus_tag LOCUS_23300 gene thiL 33687 34655 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_23300 34636 35184 gene locus_tag LOCUS_23310 34636 35184 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_23310 36648 35266 gene locus_tag LOCUS_23320 36648 35266 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_23320 37872 36964 gene locus_tag LOCUS_23330 37872 36964 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_23330 38463 39722 gene locus_tag LOCUS_23340 38463 39722 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 protein_id gnl|my_center|LOCUS_23340 39958 40989 gene locus_tag LOCUS_23350 39958 40989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 41597 41052 gene locus_tag LOCUS_23360 41597 41052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 43643 41733 gene locus_tag LOCUS_23370 43643 41733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 49285 43646 gene locus_tag LOCUS_23380 49285 43646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 52643 49329 gene locus_tag LOCUS_23390 52643 49329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 56041 52643 gene locus_tag LOCUS_23400 56041 52643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 57590 56031 gene locus_tag LOCUS_23410 57590 56031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 58513 57653 gene locus_tag LOCUS_23420 58513 57653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 58954 59949 gene locus_tag LOCUS_23430 58954 59949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 60978 60181 gene locus_tag LOCUS_23440 60978 60181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 62160 61273 gene locus_tag LOCUS_23450 62160 61273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 63330 62185 gene locus_tag LOCUS_23460 gene hisC 63330 62185 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_23460 64441 63371 gene locus_tag LOCUS_23470 gene pheA 64441 63371 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_23470 65670 64480 gene locus_tag LOCUS_23480 65670 64480 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_23480 66742 65663 gene locus_tag LOCUS_23490 gene serC 66742 65663 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_23490 69341 66777 gene locus_tag LOCUS_23500 gene gyrA 69341 66777 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527513.1 protein_id gnl|my_center|LOCUS_23500 69627 70799 gene locus_tag LOCUS_23510 69627 70799 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_23510 70848 71774 gene locus_tag LOCUS_23520 gene argF 70848 71774 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_23520 71836 73062 gene locus_tag LOCUS_23530 71836 73062 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_23530 73147 73632 gene locus_tag LOCUS_23540 73147 73632 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_23540 73935 74312 gene locus_tag LOCUS_23550 gene rpsL 73935 74312 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450478.1 protein_id gnl|my_center|LOCUS_23550 74380 74850 gene locus_tag LOCUS_23560 gene rpsG 74380 74850 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_23560 74934 76979 gene locus_tag LOCUS_23570 gene fusA 74934 76979 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198357.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence19 1573 746 gene locus_tag LOCUS_23580 1573 746 CDS product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880559.1 protein_id gnl|my_center|LOCUS_23580 1754 1578 gene locus_tag LOCUS_23590 1754 1578 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 protein_id gnl|my_center|LOCUS_23590 3149 1947 gene locus_tag LOCUS_23600 3149 1947 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954590.1 protein_id gnl|my_center|LOCUS_23600 5016 3454 gene locus_tag LOCUS_23610 gene guaA 5016 3454 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_23610 6492 5029 gene locus_tag LOCUS_23620 gene guaB 6492 5029 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192833.1 protein_id gnl|my_center|LOCUS_23620 6663 7109 gene locus_tag LOCUS_23630 6663 7109 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266668.1 protein_id gnl|my_center|LOCUS_23630 7129 8571 gene locus_tag LOCUS_23640 7129 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 9710 8619 gene locus_tag LOCUS_23650 9710 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 9967 13401 gene locus_tag LOCUS_23660 9967 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 13707 15107 gene locus_tag LOCUS_23670 13707 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 15200 15409 gene locus_tag LOCUS_23680 15200 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 15610 15981 gene locus_tag LOCUS_23690 15610 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 16083 16655 gene locus_tag LOCUS_23700 16083 16655 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_23700 16652 16861 gene locus_tag LOCUS_23710 16652 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 16933 17319 gene locus_tag LOCUS_23720 16933 17319 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099935.1 protein_id gnl|my_center|LOCUS_23720 17529 17882 gene locus_tag LOCUS_23730 17529 17882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 18351 18797 gene locus_tag LOCUS_23740 18351 18797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 18865 20397 gene locus_tag LOCUS_23750 18865 20397 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 protein_id gnl|my_center|LOCUS_23750 20847 23072 gene locus_tag LOCUS_23760 20847 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 24332 23553 gene locus_tag LOCUS_23770 gene djlA 24332 23553 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_23770 24667 24422 gene locus_tag LOCUS_23780 24667 24422 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_23780 25468 24713 gene locus_tag LOCUS_23790 25468 24713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_23790 26379 25465 gene locus_tag LOCUS_23800 26379 25465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_23800 26777 26433 gene locus_tag LOCUS_23810 26777 26433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 27336 26782 gene locus_tag LOCUS_23820 27336 26782 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_23820 27950 27483 gene locus_tag LOCUS_23830 gene mlaD 27950 27483 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_23830 28747 27950 gene locus_tag LOCUS_23840 gene mlaE 28747 27950 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219882.1 protein_id gnl|my_center|LOCUS_23840 29552 28740 gene locus_tag LOCUS_23850 29552 28740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_23850 31160 29712 gene locus_tag LOCUS_23860 31160 29712 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_23860 31465 32301 gene locus_tag LOCUS_23870 31465 32301 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266373.1 protein_id gnl|my_center|LOCUS_23870 32409 35138 gene locus_tag LOCUS_23880 32409 35138 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 protein_id gnl|my_center|LOCUS_23880 36601 35270 gene locus_tag LOCUS_23890 36601 35270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263244.1 protein_id gnl|my_center|LOCUS_23890 38724 36961 gene locus_tag LOCUS_23900 gene sdhA 38724 36961 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813651.1 protein_id gnl|my_center|LOCUS_23900 39079 38726 gene locus_tag LOCUS_23910 gene sdhD 39079 38726 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_23910 39462 39073 gene locus_tag LOCUS_23920 gene sdhC 39462 39073 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217390.1 protein_id gnl|my_center|LOCUS_23920 40881 39706 gene locus_tag LOCUS_23930 40881 39706 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_23930 41992 41009 gene locus_tag LOCUS_23940 41992 41009 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331384.1 protein_id gnl|my_center|LOCUS_23940 42950 42189 gene locus_tag LOCUS_23950 42950 42189 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331386.1 protein_id gnl|my_center|LOCUS_23950 44483 43014 gene locus_tag LOCUS_23960 44483 43014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 45180 44485 gene locus_tag LOCUS_23970 45180 44485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 46376 45177 gene locus_tag LOCUS_23980 46376 45177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 46978 46373 gene locus_tag LOCUS_23990 46978 46373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 47838 46975 gene locus_tag LOCUS_24000 47838 46975 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_24000 48898 47819 gene locus_tag LOCUS_24010 48898 47819 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_24010 49875 48895 gene locus_tag LOCUS_24020 49875 48895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 51391 50306 gene locus_tag LOCUS_24030 gene gmd 51391 50306 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048162.1 protein_id gnl|my_center|LOCUS_24030 52921 51422 gene locus_tag LOCUS_24040 52921 51422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 55203 52930 gene locus_tag LOCUS_24050 55203 52930 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268289.1 protein_id gnl|my_center|LOCUS_24050 56469 55225 gene locus_tag LOCUS_24060 56469 55225 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 protein_id gnl|my_center|LOCUS_24060 58591 56744 gene locus_tag LOCUS_24070 gene glmS 58591 56744 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_24070 59344 58955 gene locus_tag LOCUS_24080 59344 58955 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527651.1 protein_id gnl|my_center|LOCUS_24080 60473 59439 gene locus_tag LOCUS_24090 60473 59439 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_24090 61532 60738 gene locus_tag LOCUS_24100 61532 60738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 62212 61835 gene locus_tag LOCUS_24110 62212 61835 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352231.1 protein_id gnl|my_center|LOCUS_24110 63113 62244 gene locus_tag LOCUS_24120 63113 62244 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_24120 63240 64157 gene locus_tag LOCUS_24130 63240 64157 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_24130 64720 64241 gene locus_tag LOCUS_24140 gene sixA 64720 64241 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_24140 65022 64717 gene locus_tag LOCUS_24150 gene yggU 65022 64717 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417561.1 protein_id gnl|my_center|LOCUS_24150 65423 65037 gene locus_tag LOCUS_24160 65423 65037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 66628 65816 gene locus_tag LOCUS_24170 gene proC 66628 65816 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_24170 67495 66665 gene locus_tag LOCUS_24180 gene mutM 67495 66665 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225172.1 protein_id gnl|my_center|LOCUS_24180 68364 67495 gene locus_tag LOCUS_24190 68364 67495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 69725 68361 gene locus_tag LOCUS_24200 69725 68361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 70489 69746 gene locus_tag LOCUS_24210 70489 69746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 71290 70508 gene locus_tag LOCUS_24220 71290 70508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 71652 72344 gene locus_tag LOCUS_24230 71652 72344 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_24230 72464 73798 gene locus_tag LOCUS_24240 72464 73798 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957634.1 protein_id gnl|my_center|LOCUS_24240 73811 74518 gene locus_tag LOCUS_24250 gene ubiG 73811 74518 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_24250 74564 75211 gene locus_tag LOCUS_24260 gene gph 74564 75211 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence20 570 770 gene locus_tag LOCUS_24270 570 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2384 1320 gene locus_tag LOCUS_24280 2384 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 3672 2389 gene locus_tag LOCUS_24290 3672 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 4902 3736 gene locus_tag LOCUS_24300 4902 3736 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023668.1 protein_id gnl|my_center|LOCUS_24300 5780 4902 gene locus_tag LOCUS_24310 5780 4902 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023669.1 protein_id gnl|my_center|LOCUS_24310 6624 5839 gene locus_tag LOCUS_24320 6624 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 8139 6628 gene locus_tag LOCUS_24330 8139 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967013.1 protein_id gnl|my_center|LOCUS_24330 9218 8145 gene locus_tag LOCUS_24340 9218 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 10237 9284 gene locus_tag LOCUS_24350 10237 9284 CDS product Kdo hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210901.1 protein_id gnl|my_center|LOCUS_24350 11667 10360 gene locus_tag LOCUS_24360 11667 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 12006 12602 gene locus_tag LOCUS_24370 12006 12602 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_24370 12669 12941 gene locus_tag LOCUS_24380 12669 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 12943 14664 gene locus_tag LOCUS_24390 12943 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_24390 15507 14689 gene locus_tag LOCUS_24400 15507 14689 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728286.1 protein_id gnl|my_center|LOCUS_24400 16298 15504 gene locus_tag LOCUS_24410 16298 15504 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056662.1 protein_id gnl|my_center|LOCUS_24410 17268 16300 gene locus_tag LOCUS_24420 17268 16300 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_24420 17439 19520 gene locus_tag LOCUS_24430 17439 19520 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767848.1 protein_id gnl|my_center|LOCUS_24430 19606 20067 gene locus_tag LOCUS_24440 gene nikR 19606 20067 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_24440 21118 20135 gene locus_tag LOCUS_24450 21118 20135 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938457.1 protein_id gnl|my_center|LOCUS_24450 21833 21195 gene locus_tag LOCUS_24460 gene ureG 21833 21195 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_24460 22528 21851 gene locus_tag LOCUS_24470 22528 21851 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533998.1 protein_id gnl|my_center|LOCUS_24470 23064 22537 gene locus_tag LOCUS_24480 gene ureE 23064 22537 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_24480 24927 23221 gene locus_tag LOCUS_24490 gene ureC 24927 23221 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_24490 25280 24960 gene locus_tag LOCUS_24500 25280 24960 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_24500 25606 25304 gene locus_tag LOCUS_24510 25606 25304 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099389.1 protein_id gnl|my_center|LOCUS_24510 26642 25698 gene locus_tag LOCUS_24520 26642 25698 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269030.1 protein_id gnl|my_center|LOCUS_24520 27964 26678 gene locus_tag LOCUS_24530 27964 26678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 28329 29309 gene locus_tag LOCUS_24540 gene cysK 28329 29309 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706833.1 protein_id gnl|my_center|LOCUS_24540 29306 30256 gene locus_tag LOCUS_24550 29306 30256 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_24550 30301 30723 gene locus_tag LOCUS_24560 30301 30723 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199588.1 protein_id gnl|my_center|LOCUS_24560 31257 30763 gene locus_tag LOCUS_24570 31257 30763 CDS product DUF2165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209941.1 protein_id gnl|my_center|LOCUS_24570 32430 31564 gene locus_tag LOCUS_24580 32430 31564 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 protein_id gnl|my_center|LOCUS_24580 33041 32556 gene locus_tag LOCUS_24590 33041 32556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 33711 33013 gene locus_tag LOCUS_24600 33711 33013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 33910 34569 gene locus_tag LOCUS_24610 gene rpiA 33910 34569 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 protein_id gnl|my_center|LOCUS_24610 34628 35335 gene locus_tag LOCUS_24620 gene phoU 34628 35335 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813242.1 protein_id gnl|my_center|LOCUS_24620 35957 35400 gene locus_tag LOCUS_24630 gene tppA 35957 35400 CDS product type IVa pilus pseudopilin TppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704652.1 protein_id gnl|my_center|LOCUS_24630 39399 35908 gene locus_tag LOCUS_24640 39399 35908 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_24640 40053 39466 gene locus_tag LOCUS_24650 40053 39466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 40814 40050 gene locus_tag LOCUS_24660 40814 40050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 41320 40814 gene locus_tag LOCUS_24670 gene pilV 41320 40814 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037628.1 protein_id gnl|my_center|LOCUS_24670 41856 41317 gene locus_tag LOCUS_24680 41856 41317 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957587.1 protein_id gnl|my_center|LOCUS_24680 42075 43181 gene locus_tag LOCUS_24690 gene thiO 42075 43181 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_24690 44131 43187 gene locus_tag LOCUS_24700 gene ispH 44131 43187 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446429.1 protein_id gnl|my_center|LOCUS_24700 44635 44560 gene locus_tag LOCUS_t00310 44635 44560 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45168 45716 gene locus_tag LOCUS_24710 gene bcp 45168 45716 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_24710 45798 46169 gene locus_tag LOCUS_24720 45798 46169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 46736 46188 gene locus_tag LOCUS_24730 46736 46188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 47730 46774 gene locus_tag LOCUS_24740 gene trxB 47730 46774 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_24740 48396 47734 gene locus_tag LOCUS_24750 48396 47734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 49056 48817 gene locus_tag LOCUS_24760 49056 48817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 49344 49544 gene locus_tag LOCUS_24770 49344 49544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 50763 49744 gene locus_tag LOCUS_24780 50763 49744 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545034.1 protein_id gnl|my_center|LOCUS_24780 51799 50756 gene locus_tag LOCUS_24790 51799 50756 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073877.1 protein_id gnl|my_center|LOCUS_24790 52837 51935 gene locus_tag LOCUS_24800 52837 51935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 53651 52842 gene locus_tag LOCUS_24810 53651 52842 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_24810 54474 53752 gene locus_tag LOCUS_24820 54474 53752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 55412 54729 gene locus_tag LOCUS_24830 55412 54729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 55784 56215 gene locus_tag LOCUS_24840 55784 56215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 56459 57547 gene locus_tag LOCUS_24850 56459 57547 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_24850 57571 60813 gene locus_tag LOCUS_24860 57571 60813 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_24860 60842 62233 gene locus_tag LOCUS_24870 60842 62233 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_24870 62698 62913 gene locus_tag LOCUS_24880 62698 62913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 62910 63332 gene locus_tag LOCUS_24890 62910 63332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence21 368 2095 gene locus_tag LOCUS_24900 368 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2146 3171 gene locus_tag LOCUS_24910 2146 3171 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_24910 3525 4931 gene locus_tag LOCUS_24920 3525 4931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_24920 4928 6976 gene locus_tag LOCUS_24930 4928 6976 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_24930 6981 8591 gene locus_tag LOCUS_24940 6981 8591 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040766.1 protein_id gnl|my_center|LOCUS_24940 8591 9655 gene locus_tag LOCUS_24950 8591 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_24950 9658 10524 gene locus_tag LOCUS_24960 9658 10524 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687657.1 protein_id gnl|my_center|LOCUS_24960 10922 11206 gene locus_tag LOCUS_24970 gene cas2 10922 11206 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 protein_id gnl|my_center|LOCUS_24970 11210 12166 gene locus_tag LOCUS_24980 11210 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 12316 12912 gene locus_tag LOCUS_24990 12316 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 12912 13226 gene locus_tag LOCUS_25000 12912 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 13338 14291 gene locus_tag LOCUS_25010 gene cas6 13338 14291 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_25010 14284 15417 gene locus_tag LOCUS_25020 14284 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 15432 17993 gene locus_tag LOCUS_25030 gene cas10 15432 17993 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261170.1 protein_id gnl|my_center|LOCUS_25030 17986 18366 gene locus_tag LOCUS_25040 gene csm2 17986 18366 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256464.1 protein_id gnl|my_center|LOCUS_25040 18379 19173 gene locus_tag LOCUS_25050 gene csm3 18379 19173 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_25050 19175 20146 gene locus_tag LOCUS_25060 19175 20146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 20154 21560 gene locus_tag LOCUS_25070 20154 21560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 21580 21777 gene locus_tag LOCUS_25080 21580 21777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 21784 23049 gene locus_tag LOCUS_25090 21784 23049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 23080 24213 gene locus_tag LOCUS_25100 23080 24213 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419707.1 protein_id gnl|my_center|LOCUS_25100 24287 24605 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgaactaaagacctgattaataagggattaaga 25396 25908 gene locus_tag LOCUS_25110 gene cheW 25396 25908 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_25110 25949 27676 gene locus_tag LOCUS_25120 25949 27676 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063733.1 protein_id gnl|my_center|LOCUS_25120 29267 27828 gene locus_tag LOCUS_25130 gene mgtE 29267 27828 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085996.1 protein_id gnl|my_center|LOCUS_25130 30435 29608 gene locus_tag LOCUS_25140 gene aroE 30435 29608 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_25140 31405 30491 gene locus_tag LOCUS_25150 31405 30491 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_25150 33442 31520 gene locus_tag LOCUS_25160 33442 31520 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527764.1 protein_id gnl|my_center|LOCUS_25160 34798 34337 gene locus_tag LOCUS_25170 34798 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 34831 35748 gene locus_tag LOCUS_25180 34831 35748 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707577.1 protein_id gnl|my_center|LOCUS_25180 35850 38579 gene locus_tag LOCUS_25190 gene secA 35850 38579 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814564.1 protein_id gnl|my_center|LOCUS_25190 38768 39379 gene locus_tag LOCUS_25200 gene petA 38768 39379 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_25200 39380 40627 gene locus_tag LOCUS_25210 39380 40627 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_25210 40632 41345 gene locus_tag LOCUS_25220 40632 41345 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699304.1 protein_id gnl|my_center|LOCUS_25220 41467 41994 gene locus_tag LOCUS_25230 41467 41994 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_25230 41991 42413 gene locus_tag LOCUS_25240 41991 42413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 42440 42515 gene locus_tag LOCUS_t00320 42440 42515 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42828 42604 gene locus_tag LOCUS_25250 42828 42604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 43376 42948 gene locus_tag LOCUS_25260 43376 42948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 44104 43373 gene locus_tag LOCUS_25270 44104 43373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 44427 44104 gene locus_tag LOCUS_25280 44427 44104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 44632 44420 gene locus_tag LOCUS_25290 44632 44420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 44765 45133 gene locus_tag LOCUS_25300 gene traJ 44765 45133 CDS product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039733.1 protein_id gnl|my_center|LOCUS_25300 45175 46779 gene locus_tag LOCUS_25310 45175 46779 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938884.1 protein_id gnl|my_center|LOCUS_25310 46800 48635 gene locus_tag LOCUS_25320 46800 48635 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 protein_id gnl|my_center|LOCUS_25320 48650 49204 gene locus_tag LOCUS_25330 gene traF 48650 49204 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970269.1 protein_id gnl|my_center|LOCUS_25330 49223 49441 gene locus_tag LOCUS_25340 49223 49441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 49428 52280 gene locus_tag LOCUS_25350 49428 52280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 52302 53423 gene locus_tag LOCUS_25360 52302 53423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 <54458 53461 gene locus_tag LOCUS_25370 <54458 53461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966108.1:nucleoside triphosphate pyrophosphohydrolase >Feature sequence22 321 58 gene locus_tag LOCUS_25380 gene rpsT 321 58 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_25380 1260 430 gene locus_tag LOCUS_25390 1260 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 1877 1554 gene locus_tag LOCUS_25400 1877 1554 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_25400 3484 1892 gene locus_tag LOCUS_25410 3484 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 3810 4937 gene locus_tag LOCUS_25420 3810 4937 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_25420 5127 4915 gene locus_tag LOCUS_25430 5127 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 5300 6625 gene locus_tag LOCUS_25440 5300 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 7040 6702 gene locus_tag LOCUS_25450 7040 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 7172 8374 gene locus_tag LOCUS_25460 gene dapE 7172 8374 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688278.1 protein_id gnl|my_center|LOCUS_25460 9014 8400 gene locus_tag LOCUS_25470 9014 8400 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_25470 9398 10501 gene locus_tag LOCUS_25480 9398 10501 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 protein_id gnl|my_center|LOCUS_25480 10545 10637 gene locus_tag LOCUS_t00330 10545 10637 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10770 11090 gene locus_tag LOCUS_25490 10770 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 11087 12016 gene locus_tag LOCUS_25500 11087 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25500 12584 13201 gene locus_tag LOCUS_25510 gene umuD 12584 13201 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069871.1 protein_id gnl|my_center|LOCUS_25510 13330 14259 gene locus_tag LOCUS_25520 13330 14259 CDS product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941416.1 protein_id gnl|my_center|LOCUS_25520 14898 14296 gene locus_tag LOCUS_25530 14898 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 15079 15597 gene locus_tag LOCUS_25540 15079 15597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 16591 15614 gene locus_tag LOCUS_25550 16591 15614 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629595.1 protein_id gnl|my_center|LOCUS_25550 16972 17586 gene locus_tag LOCUS_25560 16972 17586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 18977 17703 gene locus_tag LOCUS_25570 18977 17703 CDS product serralysin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104500.1 protein_id gnl|my_center|LOCUS_25570 19604 19188 gene locus_tag LOCUS_25580 19604 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 21317 19614 gene locus_tag LOCUS_25590 21317 19614 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083081.1 protein_id gnl|my_center|LOCUS_25590 22132 21314 gene locus_tag LOCUS_25600 22132 21314 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083080.1 protein_id gnl|my_center|LOCUS_25600 22369 23037 gene locus_tag LOCUS_25610 22369 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 24291 23092 gene locus_tag LOCUS_25620 24291 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 24790 24344 gene locus_tag LOCUS_25630 24790 24344 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970037.1 protein_id gnl|my_center|LOCUS_25630 25346 24948 gene locus_tag LOCUS_25640 25346 24948 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522206.1 protein_id gnl|my_center|LOCUS_25640 25858 25514 gene locus_tag LOCUS_25650 25858 25514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 26222 25890 gene locus_tag LOCUS_25660 26222 25890 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 protein_id gnl|my_center|LOCUS_25660 26842 26258 gene locus_tag LOCUS_25670 26842 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 27183 26929 gene locus_tag LOCUS_25680 27183 26929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 28419 27202 gene locus_tag LOCUS_25690 gene fabF 28419 27202 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_25690 28874 28599 gene locus_tag LOCUS_25700 28874 28599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 29783 28947 gene locus_tag LOCUS_25710 gene dapF 29783 28947 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_25710 30305 29841 gene locus_tag LOCUS_25720 30305 29841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 31390 30302 gene locus_tag LOCUS_25730 31390 30302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 31885 32802 gene locus_tag LOCUS_25740 31885 32802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 33557 32799 gene locus_tag LOCUS_25750 33557 32799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 33935 34333 gene locus_tag LOCUS_25760 33935 34333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 34667 36817 gene locus_tag LOCUS_25770 gene pqqU 34667 36817 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_25770 37001 37357 gene locus_tag LOCUS_25780 37001 37357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 38498 37440 gene locus_tag LOCUS_25790 38498 37440 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 protein_id gnl|my_center|LOCUS_25790 39165 38530 gene locus_tag LOCUS_25800 39165 38530 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406213.1 protein_id gnl|my_center|LOCUS_25800 39979 39236 gene locus_tag LOCUS_25810 gene surE 39979 39236 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527164.1 protein_id gnl|my_center|LOCUS_25810 40289 41575 gene locus_tag LOCUS_25820 40289 41575 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025385041.1 protein_id gnl|my_center|LOCUS_25820 41672 41908 gene locus_tag LOCUS_25830 41672 41908 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532247.1 protein_id gnl|my_center|LOCUS_25830 41917 42192 gene locus_tag LOCUS_25840 41917 42192 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141822.1 protein_id gnl|my_center|LOCUS_25840 43017 42208 gene locus_tag LOCUS_25850 43017 42208 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 protein_id gnl|my_center|LOCUS_25850 43551 43294 gene locus_tag LOCUS_25860 43551 43294 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_25860 43640 44407 gene locus_tag LOCUS_25870 43640 44407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 44411 45004 gene locus_tag LOCUS_25880 44411 45004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 45997 45137 gene locus_tag LOCUS_25890 45997 45137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 46866 46030 gene locus_tag LOCUS_25900 46866 46030 CDS product OST-HTH/LOTUS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102935.1 protein_id gnl|my_center|LOCUS_25900 47026 47280 gene locus_tag LOCUS_25910 47026 47280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence23 393 1208 gene locus_tag LOCUS_25920 gene pstC 393 1208 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941759.1 protein_id gnl|my_center|LOCUS_25920 1293 2219 gene locus_tag LOCUS_25930 gene pstA 1293 2219 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_25930 2226 3020 gene locus_tag LOCUS_25940 gene pstB 2226 3020 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_25940 3234 3989 gene locus_tag LOCUS_25950 gene tpiA 3234 3989 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_25950 4008 4382 gene locus_tag LOCUS_25960 4008 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 4442 4524 gene locus_tag LOCUS_t00340 4442 4524 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4645 4935 gene locus_tag LOCUS_25970 4645 4935 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_25970 4940 5416 gene locus_tag LOCUS_25980 4940 5416 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_25980 5424 6044 gene locus_tag LOCUS_25990 5424 6044 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_25990 6100 7353 gene locus_tag LOCUS_26000 6100 7353 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_26000 7356 7832 gene locus_tag LOCUS_26010 gene nuoE 7356 7832 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185492.1 protein_id gnl|my_center|LOCUS_26010 7829 9106 gene locus_tag LOCUS_26020 gene nuoF 7829 9106 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_26020 9651 11576 gene locus_tag LOCUS_26030 gene nuoG 9651 11576 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186393.1 protein_id gnl|my_center|LOCUS_26030 11601 12698 gene locus_tag LOCUS_26040 gene nuoH 11601 12698 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_26040 12714 13202 gene locus_tag LOCUS_26050 gene nuoI 12714 13202 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_26050 13222 13827 gene locus_tag LOCUS_26060 13222 13827 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_26060 13874 14179 gene locus_tag LOCUS_26070 gene nuoK 13874 14179 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_26070 14232 16172 gene locus_tag LOCUS_26080 gene nuoL 14232 16172 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_26080 16265 17749 gene locus_tag LOCUS_26090 16265 17749 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_26090 17840 19237 gene locus_tag LOCUS_26100 gene nuoN 17840 19237 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_26100 19455 19270 gene locus_tag LOCUS_26110 19455 19270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 19486 21396 gene locus_tag LOCUS_26120 gene htpG 19486 21396 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_26120 21502 22047 gene locus_tag LOCUS_26130 21502 22047 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189321.1 protein_id gnl|my_center|LOCUS_26130 22034 22945 gene locus_tag LOCUS_26140 gene xerD 22034 22945 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 protein_id gnl|my_center|LOCUS_26140 23426 22953 gene locus_tag LOCUS_26150 23426 22953 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_26150 23581 23934 gene locus_tag LOCUS_26160 23581 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 24375 24001 gene locus_tag LOCUS_26170 24375 24001 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_26170 25779 24433 gene locus_tag LOCUS_26180 gene xseA 25779 24433 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197496.1 protein_id gnl|my_center|LOCUS_26180 26130 26738 gene locus_tag LOCUS_26190 26130 26738 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_26190 27125 27949 gene locus_tag LOCUS_26200 27125 27949 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931638.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence24 1319 210 gene locus_tag LOCUS_26210 1319 210 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817185.1 protein_id gnl|my_center|LOCUS_26210 2078 1359 gene locus_tag LOCUS_26220 gene flgH 2078 1359 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 protein_id gnl|my_center|LOCUS_26220 2863 2075 gene locus_tag LOCUS_26230 gene flgG 2863 2075 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050114401.1 protein_id gnl|my_center|LOCUS_26230 3637 2891 gene locus_tag LOCUS_26240 gene flgF 3637 2891 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_26240 4952 3687 gene locus_tag LOCUS_26250 gene flgE 4952 3687 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_26250 5633 4965 gene locus_tag LOCUS_26260 gene flgD 5633 4965 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020450.1 protein_id gnl|my_center|LOCUS_26260 6049 5645 gene locus_tag LOCUS_26270 gene flgC 6049 5645 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 protein_id gnl|my_center|LOCUS_26270 6466 6053 gene locus_tag LOCUS_26280 gene flgB 6466 6053 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887042.1 protein_id gnl|my_center|LOCUS_26280 6687 7409 gene locus_tag LOCUS_26290 gene flgA 6687 7409 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_26290 7509 7808 gene locus_tag LOCUS_26300 7509 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 8002 8370 gene locus_tag LOCUS_26310 8002 8370 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_26310 8571 8801 gene locus_tag LOCUS_26320 8571 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 9151 9972 gene locus_tag LOCUS_26330 gene pbpG 9151 9972 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706303.1 protein_id gnl|my_center|LOCUS_26330 11497 9989 gene locus_tag LOCUS_26340 11497 9989 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_26340 11620 12063 gene locus_tag LOCUS_26350 11620 12063 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_26350 12242 12511 gene locus_tag LOCUS_26360 gene rpsO 12242 12511 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_26360 12645 14786 gene locus_tag LOCUS_26370 gene pnp 12645 14786 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_26370 15330 14905 gene locus_tag LOCUS_26380 gene dksA 15330 14905 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140367.1 protein_id gnl|my_center|LOCUS_26380 15612 15688 gene locus_tag LOCUS_t00350 15612 15688 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15725 15801 gene locus_tag LOCUS_t00360 15725 15801 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15850 15925 gene locus_tag LOCUS_t00370 15850 15925 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 16091 18994 gene locus_tag LOCUS_26390 gene acn 16091 18994 CDS product iron-regulated aconitate hydratase Acn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898889.1 protein_id gnl|my_center|LOCUS_26390 19370 20185 gene locus_tag LOCUS_26400 gene sul2 19370 20185 CDS product sulfonamide-resistant dihydropteroate synthase Sul2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043260.1 protein_id gnl|my_center|LOCUS_26400 20272 20574 gene locus_tag LOCUS_26410 20272 20574 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251875.1 protein_id gnl|my_center|LOCUS_26410 22243 20750 gene locus_tag LOCUS_26420 22243 20750 CDS product IS91-like element ISVsa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120888.1 protein_id gnl|my_center|LOCUS_26420 22678 22454 gene locus_tag LOCUS_26430 22678 22454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743213.1 protein_id gnl|my_center|LOCUS_26430 23412 22675 gene locus_tag LOCUS_26440 23412 22675 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001366550.1 protein_id gnl|my_center|LOCUS_26440 23560 23892 gene locus_tag LOCUS_26450 23560 23892 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_26450 23889 24656 gene locus_tag LOCUS_26460 gene arsH 23889 24656 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239389.1 protein_id gnl|my_center|LOCUS_26460 24653 25159 gene locus_tag LOCUS_26470 24653 25159 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_26470 25156 26223 gene locus_tag LOCUS_26480 gene arsB 25156 26223 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_26480 26802 26578 gene locus_tag LOCUS_26490 26802 26578 CDS product type I toxin-antitoxin system ptaRNA1 family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039740.1 protein_id gnl|my_center|LOCUS_26490 27114 26866 gene locus_tag LOCUS_26500 27114 26866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 28567 27119 gene locus_tag LOCUS_26510 gene trbL 28567 27119 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001405816.1 protein_id gnl|my_center|LOCUS_26510 28727 28557 gene locus_tag LOCUS_26520 28727 28557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence25 23 3145 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatcctcgcccggctttggggccgggcgctac 3622 3326 gene locus_tag LOCUS_26530 gene cas2 3622 3326 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_26530 4653 3619 gene locus_tag LOCUS_26540 gene cas1c 4653 3619 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_26540 5281 4661 gene locus_tag LOCUS_26550 gene cas4 5281 4661 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_26550 5658 5311 gene locus_tag LOCUS_26560 5658 5311 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_26560 6660 5674 gene locus_tag LOCUS_26570 gene cas7c 6660 5674 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_26570 8420 6660 gene locus_tag LOCUS_26580 gene cas8c 8420 6660 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_26580 9193 8423 gene locus_tag LOCUS_26590 gene cas5c 9193 8423 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_26590 11520 9211 gene locus_tag LOCUS_26600 11520 9211 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_26600 11785 11504 gene locus_tag LOCUS_26610 11785 11504 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096668979.1 protein_id gnl|my_center|LOCUS_26610 12168 11773 gene locus_tag LOCUS_26620 12168 11773 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940728.1 protein_id gnl|my_center|LOCUS_26620 13672 12242 gene locus_tag LOCUS_26630 13672 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 14567 13656 gene locus_tag LOCUS_26640 14567 13656 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_26640 15132 15644 gene locus_tag LOCUS_26650 gene cheW 15132 15644 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_26650 15685 17412 gene locus_tag LOCUS_26660 15685 17412 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063733.1 protein_id gnl|my_center|LOCUS_26660 18396 17473 gene locus_tag LOCUS_26670 gene rsgA 18396 17473 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_26670 18734 18393 gene locus_tag LOCUS_26680 18734 18393 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_26680 19993 18731 gene locus_tag LOCUS_26690 19993 18731 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_26690 20147 20692 gene locus_tag LOCUS_26700 gene orn 20147 20692 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_26700 20785 21159 gene locus_tag LOCUS_26710 20785 21159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 22633 21230 gene locus_tag LOCUS_26720 22633 21230 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_26720 22709 23734 gene locus_tag LOCUS_26730 22709 23734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 23759 24412 gene locus_tag LOCUS_26740 gene ftsE 23759 24412 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_26740 24409 25320 gene locus_tag LOCUS_26750 gene ftsX 24409 25320 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084508.1 protein_id gnl|my_center|LOCUS_26750 25383 26285 gene locus_tag LOCUS_26760 gene rpoH 25383 26285 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815756.1 protein_id gnl|my_center|LOCUS_26760 26360 26449 gene locus_tag LOCUS_t00380 26360 26449 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 3556 77 gene locus_tag LOCUS_26770 3556 77 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_26770 6327 3559 gene locus_tag LOCUS_26780 6327 3559 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_26780 6689 6366 gene locus_tag LOCUS_26790 6689 6366 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_26790 6960 7889 gene locus_tag LOCUS_26800 6960 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 8588 9895 gene locus_tag LOCUS_26810 8588 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 10741 12093 gene locus_tag LOCUS_26820 10741 12093 CDS product IS5-like element IS1478 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035783.1 protein_id gnl|my_center|LOCUS_26820 12299 12565 gene locus_tag LOCUS_26830 12299 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 13354 14703 gene locus_tag LOCUS_26840 13354 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 16647 15100 gene locus_tag LOCUS_26850 16647 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 17468 17148 gene locus_tag LOCUS_26860 17468 17148 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_26860 17815 20010 gene locus_tag LOCUS_26870 gene rlmKL 17815 20010 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_26870 21122 20208 gene locus_tag LOCUS_26880 21122 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 21285 22001 gene locus_tag LOCUS_26890 21285 22001 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 protein_id gnl|my_center|LOCUS_26890 22005 23063 gene locus_tag LOCUS_26900 22005 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 23528 23109 gene locus_tag LOCUS_26910 23528 23109 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_26910 23980 23516 gene locus_tag LOCUS_26920 23980 23516 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038625.1 protein_id gnl|my_center|LOCUS_26920 <25665 23991 gene locus_tag LOCUS_26930 <25665 23991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193654.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence27 2459 2085 gene locus_tag LOCUS_26940 2459 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 2827 2474 gene locus_tag LOCUS_26950 2827 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3283 2948 gene locus_tag LOCUS_26960 3283 2948 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704337.1 protein_id gnl|my_center|LOCUS_26960 3332 4219 gene locus_tag LOCUS_26970 3332 4219 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_26970 5662 4355 gene locus_tag LOCUS_26980 gene serS 5662 4355 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_26980 7024 5696 gene locus_tag LOCUS_26990 7024 5696 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_26990 7634 7008 gene locus_tag LOCUS_27000 gene lolA 7634 7008 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 protein_id gnl|my_center|LOCUS_27000 9991 7691 gene locus_tag LOCUS_27010 9991 7691 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186104.1 protein_id gnl|my_center|LOCUS_27010 11228 10296 gene locus_tag LOCUS_27020 11228 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 11798 11424 gene locus_tag LOCUS_27030 11798 11424 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 protein_id gnl|my_center|LOCUS_27030 12132 12833 gene locus_tag LOCUS_27040 12132 12833 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530728.1 protein_id gnl|my_center|LOCUS_27040 12837 13595 gene locus_tag LOCUS_27050 12837 13595 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039565.1 protein_id gnl|my_center|LOCUS_27050 13595 14014 gene locus_tag LOCUS_27060 13595 14014 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064111.1 protein_id gnl|my_center|LOCUS_27060 14596 16923 gene locus_tag LOCUS_27070 14596 16923 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 protein_id gnl|my_center|LOCUS_27070 17033 19282 gene locus_tag LOCUS_27080 17033 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 19519 20592 gene locus_tag LOCUS_27090 19519 20592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 21315 20695 gene locus_tag LOCUS_27100 21315 20695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 21512 23071 gene locus_tag LOCUS_27110 21512 23071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence28 549 4310 gene locus_tag LOCUS_27120 gene hrpA 549 4310 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_27120 4611 4363 gene locus_tag LOCUS_27130 4611 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 4793 5857 gene locus_tag LOCUS_27140 gene aroG 4793 5857 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 protein_id gnl|my_center|LOCUS_27140 7119 5863 gene locus_tag LOCUS_27150 7119 5863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_27150 7849 7109 gene locus_tag LOCUS_27160 7849 7109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110874.1 protein_id gnl|my_center|LOCUS_27160 7839 8558 gene locus_tag LOCUS_27170 7839 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 9120 8569 gene locus_tag LOCUS_27180 9120 8569 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707298.1 protein_id gnl|my_center|LOCUS_27180 10216 9110 gene locus_tag LOCUS_27190 10216 9110 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_27190 10703 10239 gene locus_tag LOCUS_27200 gene zur 10703 10239 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095057.1 protein_id gnl|my_center|LOCUS_27200 11246 13375 gene locus_tag LOCUS_27210 11246 13375 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529100.1 protein_id gnl|my_center|LOCUS_27210 13701 16559 gene locus_tag LOCUS_27220 13701 16559 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814928.1 protein_id gnl|my_center|LOCUS_27220 16644 17834 gene locus_tag LOCUS_27230 16644 17834 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 protein_id gnl|my_center|LOCUS_27230 17942 19912 gene locus_tag LOCUS_27240 17942 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 20315 20037 gene locus_tag LOCUS_27250 20315 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence29 114 869 gene locus_tag LOCUS_27260 114 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 934 2856 gene locus_tag LOCUS_27270 gene thrS 934 2856 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_27270 2908 3462 gene locus_tag LOCUS_27280 gene infC 2908 3462 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_27280 3581 3778 gene locus_tag LOCUS_27290 gene rpmI 3581 3778 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_27290 3790 4149 gene locus_tag LOCUS_27300 gene rplT 3790 4149 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_27300 4253 5272 gene locus_tag LOCUS_27310 gene pheS 4253 5272 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_27310 5314 7683 gene locus_tag LOCUS_27320 gene pheT 5314 7683 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_27320 7854 8162 gene locus_tag LOCUS_27330 7854 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 8140 8520 gene locus_tag LOCUS_27340 8140 8520 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812822.1 protein_id gnl|my_center|LOCUS_27340 8582 8658 gene locus_tag LOCUS_t00390 8582 8658 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9052 9945 gene locus_tag LOCUS_27350 9052 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 11482 12717 gene locus_tag LOCUS_27360 11482 12717 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926512.1 protein_id gnl|my_center|LOCUS_27360 13957 12773 gene locus_tag LOCUS_27370 13957 12773 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_27370 15530 14400 gene locus_tag LOCUS_27380 15530 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 16735 15527 gene locus_tag LOCUS_27390 16735 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 17278 16985 gene locus_tag LOCUS_27400 17278 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence30 1293 2309 gene locus_tag LOCUS_27410 1293 2309 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_27410 2548 3741 gene locus_tag LOCUS_27420 2548 3741 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_27420 4240 4488 gene locus_tag LOCUS_27430 4240 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 4485 4784 gene locus_tag LOCUS_27440 4485 4784 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971862.1 protein_id gnl|my_center|LOCUS_27440 6087 5704 gene locus_tag LOCUS_27450 6087 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 6734 6294 gene locus_tag LOCUS_27460 6734 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27460 7369 6878 gene locus_tag LOCUS_27470 7369 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27470 8137 8907 gene locus_tag LOCUS_27480 8137 8907 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234254.1 protein_id gnl|my_center|LOCUS_27480 9031 10011 gene locus_tag LOCUS_27490 9031 10011 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094852.1 protein_id gnl|my_center|LOCUS_27490 10058 10852 gene locus_tag LOCUS_27500 10058 10852 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529223.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence31 2113 989 gene locus_tag LOCUS_27510 2113 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 5538 2722 gene locus_tag LOCUS_27520 5538 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 5904 6596 gene locus_tag LOCUS_27530 5904 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 6593 7681 gene locus_tag LOCUS_27540 6593 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 7675 7887 gene locus_tag LOCUS_27550 7675 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 7912 8067 gene locus_tag LOCUS_27560 7912 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 8064 9713 gene locus_tag LOCUS_27570 8064 9713 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_27570 10637 9765 gene locus_tag LOCUS_27580 10637 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence32 390 169 gene locus_tag LOCUS_27590 390 169 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928916.1 protein_id gnl|my_center|LOCUS_27590 1229 1717 gene locus_tag LOCUS_27600 1229 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2429 2992 gene locus_tag LOCUS_27610 2429 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 3781 3302 gene locus_tag LOCUS_27620 3781 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4419 4153 gene locus_tag LOCUS_27630 4419 4153 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143075704.1 protein_id gnl|my_center|LOCUS_27630 5070 5462 gene locus_tag LOCUS_27640 5070 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 6422 5559 gene locus_tag LOCUS_27650 6422 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 8669 6504 gene locus_tag LOCUS_27660 8669 6504 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 protein_id gnl|my_center|LOCUS_27660 9558 8833 gene locus_tag LOCUS_27670 9558 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 9788 10063 gene locus_tag LOCUS_27680 9788 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence33 797 426 gene locus_tag LOCUS_27690 797 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1346 957 gene locus_tag LOCUS_27700 1346 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 1890 1411 gene locus_tag LOCUS_27710 1890 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27710 2229 1987 gene locus_tag LOCUS_27720 2229 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27720 2489 2223 gene locus_tag LOCUS_27730 2489 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27730 2969 2736 gene locus_tag LOCUS_27740 2969 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 3567 3295 gene locus_tag LOCUS_27750 3567 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3679 4275 gene locus_tag LOCUS_27760 3679 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 5311 4538 gene locus_tag LOCUS_27770 gene gloB 5311 4538 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939287.1 protein_id gnl|my_center|LOCUS_27770 5920 6144 gene locus_tag LOCUS_27780 5920 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 6086 6607 gene locus_tag LOCUS_27790 gene rnhA 6086 6607 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_27790 6618 7334 gene locus_tag LOCUS_27800 gene dnaQ 6618 7334 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_27800 8235 7477 gene locus_tag LOCUS_27810 gene cheZ 8235 7477 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524402.1 protein_id gnl|my_center|LOCUS_27810 8675 8268 gene locus_tag LOCUS_27820 gene cheY 8675 8268 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence34 1145 153 gene locus_tag LOCUS_27830 1145 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 1324 1142 gene locus_tag LOCUS_27840 1324 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2617 2955 gene locus_tag LOCUS_27850 2617 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 4739 3180 gene locus_tag LOCUS_27860 4739 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 5211 4963 gene locus_tag LOCUS_27870 5211 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 5809 5195 gene locus_tag LOCUS_27880 5809 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 6987 6637 gene locus_tag LOCUS_27890 6987 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence35 726 496 gene locus_tag LOCUS_27900 726 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27900 2768 816 gene locus_tag LOCUS_27910 2768 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 4417 3185 gene locus_tag LOCUS_27920 4417 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 4895 4698 gene locus_tag LOCUS_27930 4895 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 5361 5059 gene locus_tag LOCUS_27940 5361 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 5706 5398 gene locus_tag LOCUS_27950 5706 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence36 559 233 gene locus_tag LOCUS_27960 559 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1744 1343 gene locus_tag LOCUS_27970 1744 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 2198 1821 gene locus_tag LOCUS_27980 2198 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 2999 3469 gene locus_tag LOCUS_27990 2999 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 4516 3803 gene locus_tag LOCUS_28000 4516 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 4719 4513 gene locus_tag LOCUS_28010 4719 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 4923 5600 gene locus_tag LOCUS_28020 4923 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 5575 6771 gene locus_tag LOCUS_28030 5575 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence37 1744 1310 gene locus_tag LOCUS_28040 1744 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3391 2678 gene locus_tag LOCUS_28050 3391 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3594 3388 gene locus_tag LOCUS_28060 3594 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3797 4474 gene locus_tag LOCUS_28070 3797 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 4643 5338 gene locus_tag LOCUS_28080 4643 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 5368 6564 gene locus_tag LOCUS_28090 5368 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence38 176 1672 gene locus_tag LOCUS_28100 176 1672 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_28100 1678 1860 gene locus_tag LOCUS_28110 1678 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 1886 3115 gene locus_tag LOCUS_28120 1886 3115 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_28120 3167 4480 gene locus_tag LOCUS_28130 3167 4480 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_28130 4569 5984 gene locus_tag LOCUS_28140 gene thrC 4569 5984 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence39 790 2316 gene locus_tag LOCUS_28150 790 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2814 2452 gene locus_tag LOCUS_28160 2814 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2922 3116 gene locus_tag LOCUS_28170 2922 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 4205 3225 gene locus_tag LOCUS_28180 4205 3225 CDS product IS5-like element ISPsy2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054991743.1 protein_id gnl|my_center|LOCUS_28180 4564 4268 gene locus_tag LOCUS_28190 4564 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 5110 5958 gene locus_tag LOCUS_28200 5110 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence40 151 378 gene locus_tag LOCUS_28210 151 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence41 355 519 gene locus_tag LOCUS_28220 355 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2610 1396 gene locus_tag LOCUS_28230 2610 1396 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_28230 3637 3215 gene locus_tag LOCUS_28240 3637 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3945 4361 gene locus_tag LOCUS_28250 3945 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence42 222 776 gene locus_tag LOCUS_28260 222 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 988 1569 gene locus_tag LOCUS_28270 988 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2782 1925 gene locus_tag LOCUS_28280 2782 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2858 3238 gene locus_tag LOCUS_28290 2858 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence43 242 1258 gene locus_tag LOCUS_28300 242 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1255 2205 gene locus_tag LOCUS_28310 1255 2205 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence44 <1 1185 gene locus_tag LOCUS_28320 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870274.1:restriction endonuclease subunit S 1189 1860 gene locus_tag LOCUS_28330 1189 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1919 2107 gene locus_tag LOCUS_28340 1919 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence45 951 1775 gene locus_tag LOCUS_28350 951 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence46 1252 518 gene locus_tag LOCUS_28360 1252 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence47 300 599 gene locus_tag LOCUS_28370 300 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28370 596 859 gene locus_tag LOCUS_28380 596 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1107 1000 gene locus_tag LOCUS_r00040 1107 1000 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence48 <1 742 gene locus_tag LOCUS_28390 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950967.1:DNA polymerase III subunit beta >Feature sequence49 258 1067 gene locus_tag LOCUS_28400 258 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28400