>Feature sequence1 253 1071 gene locus_tag LOCUS_00010 253 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1655 2269 gene locus_tag LOCUS_00020 1655 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3282 2314 gene locus_tag LOCUS_00030 3282 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3900 3373 gene locus_tag LOCUS_00040 3900 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5114 3918 gene locus_tag LOCUS_00050 5114 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5424 5158 gene locus_tag LOCUS_00060 5424 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6129 6842 gene locus_tag LOCUS_00070 6129 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6923 7549 gene locus_tag LOCUS_00080 6923 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7546 8691 gene locus_tag LOCUS_00090 7546 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8688 9320 gene locus_tag LOCUS_00100 8688 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9317 9925 gene locus_tag LOCUS_00110 9317 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9922 10566 gene locus_tag LOCUS_00120 9922 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10563 11201 gene locus_tag LOCUS_00130 10563 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11198 11827 gene locus_tag LOCUS_00140 11198 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11824 12456 gene locus_tag LOCUS_00150 11824 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12453 13100 gene locus_tag LOCUS_00160 12453 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13097 14260 gene locus_tag LOCUS_00170 13097 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14374 15426 gene locus_tag LOCUS_00180 14374 15426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15423 16052 gene locus_tag LOCUS_00190 15423 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16052 16219 gene locus_tag LOCUS_00200 16052 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 16433 19117 gene locus_tag LOCUS_00210 16433 19117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19261 19536 gene locus_tag LOCUS_00220 19261 19536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 19728 20336 gene locus_tag LOCUS_00230 19728 20336 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_00230 20685 20314 gene locus_tag LOCUS_00240 20685 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 20584 24324 gene locus_tag LOCUS_00250 20584 24324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 25835 24729 gene locus_tag LOCUS_00260 25835 24729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26901 27254 gene locus_tag LOCUS_00270 26901 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28892 27972 gene locus_tag LOCUS_00280 28892 27972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29877 28897 gene locus_tag LOCUS_00290 29877 28897 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_00290 31776 29893 gene locus_tag LOCUS_00300 31776 29893 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_00300 31910 33319 gene locus_tag LOCUS_00310 31910 33319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33404 34693 gene locus_tag LOCUS_00320 33404 34693 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_00320 35535 34723 gene locus_tag LOCUS_00330 35535 34723 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_00330 35727 35590 gene locus_tag LOCUS_00340 35727 35590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37891 35960 gene locus_tag LOCUS_00350 gene dnaK 37891 35960 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_00350 38264 41317 gene locus_tag LOCUS_00360 38264 41317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41520 43022 gene locus_tag LOCUS_00370 41520 43022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43169 44494 gene locus_tag LOCUS_00380 43169 44494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970398.1 protein_id gnl|my_center|LOCUS_00380 45687 44512 gene locus_tag LOCUS_00390 45687 44512 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_00390 46918 45764 gene locus_tag LOCUS_00400 46918 45764 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393522.1 protein_id gnl|my_center|LOCUS_00400 47737 46952 gene locus_tag LOCUS_00410 47737 46952 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_00410 47815 48801 gene locus_tag LOCUS_00420 gene nadC 47815 48801 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085327.1 protein_id gnl|my_center|LOCUS_00420 48776 49654 gene locus_tag LOCUS_00430 48776 49654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 51387 49648 gene locus_tag LOCUS_00440 51387 49648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51591 52784 gene locus_tag LOCUS_00450 51591 52784 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_00450 53333 52863 gene locus_tag LOCUS_00460 53333 52863 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_00460 53767 56784 gene locus_tag LOCUS_00470 53767 56784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 59610 56923 gene locus_tag LOCUS_00480 gene ppdK 59610 56923 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921479.1 protein_id gnl|my_center|LOCUS_00480 60161 61348 gene locus_tag LOCUS_00490 gene pabB 60161 61348 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 protein_id gnl|my_center|LOCUS_00490 61345 62190 gene locus_tag LOCUS_00500 61345 62190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 62255 63700 gene locus_tag LOCUS_00510 62255 63700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_00510 63721 64989 gene locus_tag LOCUS_00520 gene trpB 63721 64989 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_00520 66052 65030 gene locus_tag LOCUS_00530 66052 65030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 66136 69426 gene locus_tag LOCUS_00540 66136 69426 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040079.1 protein_id gnl|my_center|LOCUS_00540 69423 70532 gene locus_tag LOCUS_00550 69423 70532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 71225 70572 gene locus_tag LOCUS_00560 71225 70572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 72496 71339 gene locus_tag LOCUS_00570 72496 71339 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_00570 72626 73570 gene locus_tag LOCUS_00580 gene rsmH 72626 73570 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_00580 73689 74690 gene locus_tag LOCUS_00590 73689 74690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 74730 75308 gene locus_tag LOCUS_00600 74730 75308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 75313 77337 gene locus_tag LOCUS_00610 75313 77337 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_00610 77521 78300 gene locus_tag LOCUS_00620 77521 78300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 78528 79391 gene locus_tag LOCUS_00630 gene phhA 78528 79391 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195799.1 protein_id gnl|my_center|LOCUS_00630 79466 80347 gene locus_tag LOCUS_00640 79466 80347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 80658 82661 gene locus_tag LOCUS_00650 gene speA 80658 82661 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119511.1 protein_id gnl|my_center|LOCUS_00650 82805 83320 gene locus_tag LOCUS_00660 82805 83320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 83437 83736 gene locus_tag LOCUS_00670 gene groES 83437 83736 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970827.1 protein_id gnl|my_center|LOCUS_00670 83761 84009 gene locus_tag LOCUS_00680 83761 84009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 84163 85797 gene locus_tag LOCUS_00690 gene groL 84163 85797 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975850.1 protein_id gnl|my_center|LOCUS_00690 86196 85879 gene locus_tag LOCUS_00700 86196 85879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 86303 87013 gene locus_tag LOCUS_00710 86303 87013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 89057 87042 gene locus_tag LOCUS_00720 89057 87042 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_00720 89159 91483 gene locus_tag LOCUS_00730 89159 91483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 91871 94003 gene locus_tag LOCUS_00740 gene fusA 91871 94003 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898554.1 protein_id gnl|my_center|LOCUS_00740 94257 95042 gene locus_tag LOCUS_00750 94257 95042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 95440 95511 gene locus_tag LOCUS_t00010 95440 95511 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 95904 96281 gene locus_tag LOCUS_00760 95904 96281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 97733 97056 gene locus_tag LOCUS_00770 97733 97056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 98950 97775 gene locus_tag LOCUS_00780 98950 97775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 101180 99870 gene locus_tag LOCUS_00790 101180 99870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 101996 101496 gene locus_tag LOCUS_00800 101996 101496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 102470 102126 gene locus_tag LOCUS_00810 102470 102126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 103498 102716 gene locus_tag LOCUS_00820 103498 102716 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152386036.1 protein_id gnl|my_center|LOCUS_00820 104630 103539 gene locus_tag LOCUS_00830 104630 103539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 104762 106099 gene locus_tag LOCUS_00840 gene purT 104762 106099 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962580.1 protein_id gnl|my_center|LOCUS_00840 106347 107429 gene locus_tag LOCUS_00850 106347 107429 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948100.1 protein_id gnl|my_center|LOCUS_00850 108914 107493 gene locus_tag LOCUS_00860 gene mqnC 108914 107493 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_00860 110015 109044 gene locus_tag LOCUS_00870 gene xerD 110015 109044 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_00870 110254 110829 gene locus_tag LOCUS_00880 110254 110829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 111676 110852 gene locus_tag LOCUS_00890 gene proC 111676 110852 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_00890 111773 112813 gene locus_tag LOCUS_00900 111773 112813 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_00900 112915 113145 gene locus_tag LOCUS_00910 112915 113145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 113186 113410 gene locus_tag LOCUS_00920 113186 113410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 113989 113504 gene locus_tag LOCUS_00930 113989 113504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 114462 114220 gene locus_tag LOCUS_00940 114462 114220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 114616 115074 gene locus_tag LOCUS_00950 114616 115074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 116464 115088 gene locus_tag LOCUS_00960 gene mnmE 116464 115088 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887659.1 protein_id gnl|my_center|LOCUS_00960 117386 116451 gene locus_tag LOCUS_00970 117386 116451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 117684 118250 gene locus_tag LOCUS_00980 117684 118250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 119979 118261 gene locus_tag LOCUS_00990 119979 118261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 120307 120234 gene locus_tag LOCUS_t00020 120307 120234 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 121860 120397 gene locus_tag LOCUS_01000 gene radA 121860 120397 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_01000 122056 126216 gene locus_tag LOCUS_01010 122056 126216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 126304 127437 gene locus_tag LOCUS_01020 126304 127437 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_01020 127539 128456 gene locus_tag LOCUS_01030 127539 128456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 128554 129744 gene locus_tag LOCUS_01040 128554 129744 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813028.1 protein_id gnl|my_center|LOCUS_01040 131620 129755 gene locus_tag LOCUS_01050 131620 129755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 132838 131900 gene locus_tag LOCUS_01060 132838 131900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 134363 132972 gene locus_tag LOCUS_01070 134363 132972 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_01070 135798 134494 gene locus_tag LOCUS_01080 135798 134494 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228734.1 protein_id gnl|my_center|LOCUS_01080 137895 135856 gene locus_tag LOCUS_01090 gene bcrD 137895 135856 CDS product SctV family type III secretion system export apparatus subunit BcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930831.1 protein_id gnl|my_center|LOCUS_01090 137894 138316 gene locus_tag LOCUS_01100 137894 138316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 138313 139215 gene locus_tag LOCUS_01110 138313 139215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 139303 139956 gene locus_tag LOCUS_01120 139303 139956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 140073 140687 gene locus_tag LOCUS_01130 140073 140687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 140684 142051 gene locus_tag LOCUS_01140 gene fliI 140684 142051 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_01140 142076 142579 gene locus_tag LOCUS_01150 142076 142579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 144131 142593 gene locus_tag LOCUS_01160 144131 142593 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_01160 144401 145813 gene locus_tag LOCUS_01170 144401 145813 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615986.1 protein_id gnl|my_center|LOCUS_01170 145836 147413 gene locus_tag LOCUS_01180 gene crtI 145836 147413 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_01180 147430 148251 gene locus_tag LOCUS_01190 147430 148251 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123503.1 protein_id gnl|my_center|LOCUS_01190 148248 149432 gene locus_tag LOCUS_01200 148248 149432 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922473.1 protein_id gnl|my_center|LOCUS_01200 149487 149789 gene locus_tag LOCUS_01210 149487 149789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 149786 150703 gene locus_tag LOCUS_01220 149786 150703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 151385 150783 gene locus_tag LOCUS_01230 151385 150783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 152060 153076 gene locus_tag LOCUS_01240 152060 153076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 153129 153200 gene locus_tag LOCUS_t00030 153129 153200 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 153250 154917 gene locus_tag LOCUS_01250 gene gpmI 153250 154917 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_01250 155538 154981 gene locus_tag LOCUS_01260 155538 154981 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_01260 155947 155561 gene locus_tag LOCUS_01270 155947 155561 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_01270 156516 156097 gene locus_tag LOCUS_01280 156516 156097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 156511 157323 gene locus_tag LOCUS_01290 156511 157323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 157746 157819 gene locus_tag LOCUS_t00040 157746 157819 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 158124 158384 gene locus_tag LOCUS_01300 158124 158384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 160016 158814 gene locus_tag LOCUS_01310 160016 158814 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928611.1 protein_id gnl|my_center|LOCUS_01310 160211 160789 gene locus_tag LOCUS_01320 160211 160789 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393845.1 protein_id gnl|my_center|LOCUS_01320 160786 162213 gene locus_tag LOCUS_01330 160786 162213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 162210 165362 gene locus_tag LOCUS_01340 162210 165362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 166226 165537 gene locus_tag LOCUS_01350 166226 165537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 166852 167328 gene locus_tag LOCUS_01360 166852 167328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 167355 168308 gene locus_tag LOCUS_01370 167355 168308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 168525 168310 gene locus_tag LOCUS_01380 168525 168310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 168788 168600 gene locus_tag LOCUS_01390 168788 168600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 168934 168850 gene locus_tag LOCUS_t00050 168934 168850 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 169460 171448 gene locus_tag LOCUS_01400 169460 171448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 171471 171836 gene locus_tag LOCUS_01410 gene queD 171471 171836 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102949761.1 protein_id gnl|my_center|LOCUS_01410 172756 171815 gene locus_tag LOCUS_01420 gene miaA 172756 171815 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_01420 173668 172781 gene locus_tag LOCUS_01430 173668 172781 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_01430 173862 175499 gene locus_tag LOCUS_01440 gene rimO 173862 175499 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889448.1 protein_id gnl|my_center|LOCUS_01440 176371 175550 gene locus_tag LOCUS_01450 176371 175550 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311156.1 protein_id gnl|my_center|LOCUS_01450 176610 176353 gene locus_tag LOCUS_01460 176610 176353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 177170 176691 gene locus_tag LOCUS_01470 177170 176691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 177547 177185 gene locus_tag LOCUS_01480 177547 177185 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081309.1 protein_id gnl|my_center|LOCUS_01480 177689 179458 gene locus_tag LOCUS_01490 177689 179458 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_01490 179684 181216 gene locus_tag LOCUS_01500 179684 181216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 182275 181463 gene locus_tag LOCUS_01510 182275 181463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 185266 182804 gene locus_tag LOCUS_01520 185266 182804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 187070 185466 gene locus_tag LOCUS_01530 187070 185466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 187451 188434 gene locus_tag LOCUS_01540 187451 188434 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_01540 188431 189150 gene locus_tag LOCUS_01550 gene gldF 188431 189150 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_01550 189141 191312 gene locus_tag LOCUS_01560 189141 191312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 191781 191248 gene locus_tag LOCUS_01570 191781 191248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 191875 193329 gene locus_tag LOCUS_01580 gene cls 191875 193329 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 protein_id gnl|my_center|LOCUS_01580 194220 193354 gene locus_tag LOCUS_01590 gene prmC 194220 193354 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933153.1 protein_id gnl|my_center|LOCUS_01590 196203 194308 gene locus_tag LOCUS_01600 196203 194308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 196967 196275 gene locus_tag LOCUS_01610 gene elbB 196967 196275 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099212.1 protein_id gnl|my_center|LOCUS_01610 197736 197521 gene locus_tag LOCUS_01620 197736 197521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 197794 199488 gene locus_tag LOCUS_01630 197794 199488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 199522 200643 gene locus_tag LOCUS_01640 199522 200643 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 protein_id gnl|my_center|LOCUS_01640 200619 201581 gene locus_tag LOCUS_01650 gene murQ 200619 201581 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144000.1 protein_id gnl|my_center|LOCUS_01650 201609 202616 gene locus_tag LOCUS_01660 201609 202616 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_01660 202741 203865 gene locus_tag LOCUS_01670 gene bioF 202741 203865 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057171.1 protein_id gnl|my_center|LOCUS_01670 204034 204405 gene locus_tag LOCUS_01680 204034 204405 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703181.1 protein_id gnl|my_center|LOCUS_01680 204420 204818 gene locus_tag LOCUS_01690 204420 204818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 204942 207530 gene locus_tag LOCUS_01700 204942 207530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 208014 207805 gene locus_tag LOCUS_01710 208014 207805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 208192 208644 gene locus_tag LOCUS_01720 208192 208644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 208648 209565 gene locus_tag LOCUS_01730 208648 209565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 209689 210012 gene locus_tag LOCUS_01740 209689 210012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 210141 210755 gene locus_tag LOCUS_01750 210141 210755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 210824 211432 gene locus_tag LOCUS_01760 210824 211432 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_01760 211481 212686 gene locus_tag LOCUS_01770 211481 212686 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_01770 213596 217216 gene locus_tag LOCUS_01780 213596 217216 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_01780 218616 217207 gene locus_tag LOCUS_01790 218616 217207 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_01790 219261 218671 gene locus_tag LOCUS_01800 219261 218671 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917909.1 protein_id gnl|my_center|LOCUS_01800 220033 219248 gene locus_tag LOCUS_01810 gene xdhC 220033 219248 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 protein_id gnl|my_center|LOCUS_01810 221466 220030 gene locus_tag LOCUS_01820 gene mgtE 221466 220030 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_01820 222286 221510 gene locus_tag LOCUS_01830 gene bshB1 222286 221510 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_01830 222782 222330 gene locus_tag LOCUS_01840 222782 222330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 222871 224322 gene locus_tag LOCUS_01850 222871 224322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 224452 224832 gene locus_tag LOCUS_01860 224452 224832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 224954 225925 gene locus_tag LOCUS_01870 224954 225925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_01870 225934 226197 gene locus_tag LOCUS_01880 225934 226197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 226422 228068 gene locus_tag LOCUS_01890 226422 228068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 228752 228102 gene locus_tag LOCUS_01900 gene gmk 228752 228102 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_01900 231695 228837 gene locus_tag LOCUS_01910 231695 228837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 233138 231762 gene locus_tag LOCUS_01920 233138 231762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 234553 233159 gene locus_tag LOCUS_01930 234553 233159 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_01930 234604 235749 gene locus_tag LOCUS_01940 234604 235749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 235808 237220 gene locus_tag LOCUS_01950 235808 237220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 237217 237798 gene locus_tag LOCUS_01960 237217 237798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 237761 238969 gene locus_tag LOCUS_01970 237761 238969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 238966 240114 gene locus_tag LOCUS_01980 238966 240114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 240118 240852 gene locus_tag LOCUS_01990 gene cas6e 240118 240852 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_01990 241031 241996 gene locus_tag LOCUS_02000 gene cas1e 241031 241996 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_02000 242290 242992 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatgtccccacgcacgtgggggtgaaccg 244001 243060 gene locus_tag LOCUS_02010 244001 243060 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_02010 244330 246054 gene locus_tag LOCUS_02020 244330 246054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 246119 246847 gene locus_tag LOCUS_02030 246119 246847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 247948 246905 gene locus_tag LOCUS_02040 247948 246905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 248220 249098 gene locus_tag LOCUS_02050 248220 249098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 249200 250273 gene locus_tag LOCUS_02060 249200 250273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 250287 250886 gene locus_tag LOCUS_02070 250287 250886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 250982 252475 gene locus_tag LOCUS_02080 250982 252475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 253663 252488 gene locus_tag LOCUS_02090 gene dusB 253663 252488 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323230.1 protein_id gnl|my_center|LOCUS_02090 254153 255337 gene locus_tag LOCUS_02100 254153 255337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 255486 256043 gene locus_tag LOCUS_02110 255486 256043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 256040 256513 gene locus_tag LOCUS_02120 256040 256513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 256656 256898 gene locus_tag LOCUS_02130 256656 256898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 257014 257556 gene locus_tag LOCUS_02140 257014 257556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 258263 257607 gene locus_tag LOCUS_02150 258263 257607 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722188.1 protein_id gnl|my_center|LOCUS_02150 259285 258260 gene locus_tag LOCUS_02160 259285 258260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 260653 259712 gene locus_tag LOCUS_02170 260653 259712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 260758 261723 gene locus_tag LOCUS_02180 gene ubiA 260758 261723 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_02180 262001 264682 gene locus_tag LOCUS_02190 262001 264682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 265071 267746 gene locus_tag LOCUS_02200 265071 267746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 268120 269211 gene locus_tag LOCUS_02210 268120 269211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 269629 272286 gene locus_tag LOCUS_02220 269629 272286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 273872 272454 gene locus_tag LOCUS_02230 gene sthA 273872 272454 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_02230 273960 274904 gene locus_tag LOCUS_02240 gene rbsK 273960 274904 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_02240 275111 274899 gene locus_tag LOCUS_02250 275111 274899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 278052 275167 gene locus_tag LOCUS_02260 gene alaS 278052 275167 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036901.1 protein_id gnl|my_center|LOCUS_02260 279187 280737 gene locus_tag LOCUS_02270 279187 280737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 280763 282271 gene locus_tag LOCUS_02280 280763 282271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 283616 282279 gene locus_tag LOCUS_02290 gene purD 283616 282279 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_02290 284710 283664 gene locus_tag LOCUS_02300 284710 283664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 284831 286663 gene locus_tag LOCUS_02310 284831 286663 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121786.1 protein_id gnl|my_center|LOCUS_02310 286767 287807 gene locus_tag LOCUS_02320 286767 287807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 288222 287869 gene locus_tag LOCUS_02330 gene hup 288222 287869 CDS product DNA-binding protein HU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865085.1 protein_id gnl|my_center|LOCUS_02330 289186 288404 gene locus_tag LOCUS_02340 289186 288404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 289366 290061 gene locus_tag LOCUS_02350 289366 290061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 290308 290940 gene locus_tag LOCUS_02360 290308 290940 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_02360 290967 292700 gene locus_tag LOCUS_02370 290967 292700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 292802 293836 gene locus_tag LOCUS_02380 292802 293836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 293963 294259 gene locus_tag LOCUS_02390 293963 294259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 295271 294267 gene locus_tag LOCUS_02400 295271 294267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 295407 295838 gene locus_tag LOCUS_02410 295407 295838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 295894 296535 gene locus_tag LOCUS_02420 295894 296535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 296613 297425 gene locus_tag LOCUS_02430 296613 297425 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223116247.1 protein_id gnl|my_center|LOCUS_02430 298334 297597 gene locus_tag LOCUS_02440 298334 297597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 298453 299025 gene locus_tag LOCUS_02450 298453 299025 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_02450 299022 302738 gene locus_tag LOCUS_02460 299022 302738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 302754 304445 gene locus_tag LOCUS_02470 302754 304445 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_02470 304896 304516 gene locus_tag LOCUS_02480 304896 304516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 306167 304893 gene locus_tag LOCUS_02490 306167 304893 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_02490 307673 306327 gene locus_tag LOCUS_02500 307673 306327 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117835.1 protein_id gnl|my_center|LOCUS_02500 308483 307737 gene locus_tag LOCUS_02510 308483 307737 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009567369.1 protein_id gnl|my_center|LOCUS_02510 308953 309504 gene locus_tag LOCUS_02520 308953 309504 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186620.1 protein_id gnl|my_center|LOCUS_02520 309720 310361 gene locus_tag LOCUS_02530 309720 310361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 310358 311500 gene locus_tag LOCUS_02540 310358 311500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 312143 311559 gene locus_tag LOCUS_02550 312143 311559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 312681 313325 gene locus_tag LOCUS_02560 312681 313325 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110886.1 protein_id gnl|my_center|LOCUS_02560 313878 313642 gene locus_tag LOCUS_02570 313878 313642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 314699 313965 gene locus_tag LOCUS_02580 314699 313965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 315137 315715 gene locus_tag LOCUS_02590 315137 315715 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_02590 316180 319146 gene locus_tag LOCUS_02600 316180 319146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 320326 321396 gene locus_tag LOCUS_02610 320326 321396 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 protein_id gnl|my_center|LOCUS_02610 321400 324168 gene locus_tag LOCUS_02620 gene rbbA 321400 324168 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 protein_id gnl|my_center|LOCUS_02620 324169 325299 gene locus_tag LOCUS_02630 324169 325299 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 protein_id gnl|my_center|LOCUS_02630 325685 326221 gene locus_tag LOCUS_02640 gene yetL 325685 326221 CDS product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 protein_id gnl|my_center|LOCUS_02640 326218 327738 gene locus_tag LOCUS_02650 326218 327738 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035535025.1 protein_id gnl|my_center|LOCUS_02650 327728 328984 gene locus_tag LOCUS_02660 gene bpeA 327728 328984 CDS product efflux RND transporter periplasmic adaptor BpeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197561.1 protein_id gnl|my_center|LOCUS_02660 328994 332170 gene locus_tag LOCUS_02670 328994 332170 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_02670 332549 333106 gene locus_tag LOCUS_02680 332549 333106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 334114 333452 gene locus_tag LOCUS_02690 334114 333452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 334194 334679 gene locus_tag LOCUS_02700 334194 334679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 335805 334897 gene locus_tag LOCUS_02710 335805 334897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 336400 335798 gene locus_tag LOCUS_02720 336400 335798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 337425 336397 gene locus_tag LOCUS_02730 337425 336397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 338238 337429 gene locus_tag LOCUS_02740 338238 337429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 340245 338251 gene locus_tag LOCUS_02750 340245 338251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 340689 340249 gene locus_tag LOCUS_02760 340689 340249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 341174 340686 gene locus_tag LOCUS_02770 341174 340686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 341398 341171 gene locus_tag LOCUS_02780 341398 341171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 341916 341413 gene locus_tag LOCUS_02790 341916 341413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 342408 341980 gene locus_tag LOCUS_02800 342408 341980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 342681 342424 gene locus_tag LOCUS_02810 342681 342424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 343115 342684 gene locus_tag LOCUS_02820 343115 342684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 343381 343112 gene locus_tag LOCUS_02830 343381 343112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 343761 343381 gene locus_tag LOCUS_02840 343761 343381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 344124 343777 gene locus_tag LOCUS_02850 344124 343777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 346201 344207 gene locus_tag LOCUS_02860 346201 344207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 347588 346140 gene locus_tag LOCUS_02870 347588 346140 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 protein_id gnl|my_center|LOCUS_02870 347948 347712 gene locus_tag LOCUS_02880 347948 347712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 350518 348224 gene locus_tag LOCUS_02890 350518 348224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 350789 350508 gene locus_tag LOCUS_02900 350789 350508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 350948 351268 gene locus_tag LOCUS_02910 350948 351268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 351329 351598 gene locus_tag LOCUS_02920 351329 351598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 351614 351898 gene locus_tag LOCUS_02930 351614 351898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 351992 352450 gene locus_tag LOCUS_02940 351992 352450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 352454 352720 gene locus_tag LOCUS_02950 352454 352720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 354105 352729 gene locus_tag LOCUS_02960 354105 352729 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_02960 354505 354260 gene locus_tag LOCUS_02970 354505 354260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 356840 354666 gene locus_tag LOCUS_02980 356840 354666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 358531 356840 gene locus_tag LOCUS_02990 358531 356840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 359061 358699 gene locus_tag LOCUS_03000 359061 358699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 359778 359161 gene locus_tag LOCUS_03010 359778 359161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 360376 359909 gene locus_tag LOCUS_03020 360376 359909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 361361 360465 gene locus_tag LOCUS_03030 361361 360465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 361654 361358 gene locus_tag LOCUS_03040 361654 361358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 362381 361788 gene locus_tag LOCUS_03050 362381 361788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 363573 362599 gene locus_tag LOCUS_03060 363573 362599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 364747 363560 gene locus_tag LOCUS_03070 364747 363560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 365543 364836 gene locus_tag LOCUS_03080 365543 364836 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922416.1 protein_id gnl|my_center|LOCUS_03080 365947 365540 gene locus_tag LOCUS_03090 365947 365540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 366008 370867 gene locus_tag LOCUS_03100 366008 370867 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_03100 370755 371885 gene locus_tag LOCUS_03110 370755 371885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 372400 371906 gene locus_tag LOCUS_03120 372400 371906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 375010 372575 gene locus_tag LOCUS_03130 375010 372575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 374956 375342 gene locus_tag LOCUS_03140 374956 375342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 375739 375353 gene locus_tag LOCUS_03150 375739 375353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 377334 375736 gene locus_tag LOCUS_03160 377334 375736 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_03160 377837 377331 gene locus_tag LOCUS_03170 377837 377331 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870236.1 protein_id gnl|my_center|LOCUS_03170 378560 378485 gene locus_tag LOCUS_t00060 378560 378485 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 379949 378597 gene locus_tag LOCUS_03180 379949 378597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 381390 380071 gene locus_tag LOCUS_03190 381390 380071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 382995 381502 gene locus_tag LOCUS_03200 382995 381502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 384624 383311 gene locus_tag LOCUS_03210 384624 383311 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570288.1 protein_id gnl|my_center|LOCUS_03210 384851 384924 gene locus_tag LOCUS_t00070 384851 384924 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 385002 386066 gene locus_tag LOCUS_03220 385002 386066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 386105 386896 gene locus_tag LOCUS_03230 386105 386896 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_03230 386896 388395 gene locus_tag LOCUS_03240 gene hpaE 386896 388395 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807572.1 protein_id gnl|my_center|LOCUS_03240 388441 388860 gene locus_tag LOCUS_03250 388441 388860 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_03250 391009 388871 gene locus_tag LOCUS_03260 391009 388871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 392131 391073 gene locus_tag LOCUS_03270 gene gmd 392131 391073 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_03270 392511 393632 gene locus_tag LOCUS_03280 392511 393632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03280 394034 394402 gene locus_tag LOCUS_03290 394034 394402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 394430 395167 gene locus_tag LOCUS_03300 394430 395167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 395828 395181 gene locus_tag LOCUS_03310 395828 395181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 396406 395825 gene locus_tag LOCUS_03320 396406 395825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 398031 396403 gene locus_tag LOCUS_03330 398031 396403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 398909 398028 gene locus_tag LOCUS_03340 398909 398028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 399859 399002 gene locus_tag LOCUS_03350 399859 399002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 401046 399859 gene locus_tag LOCUS_03360 401046 399859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 401648 401043 gene locus_tag LOCUS_03370 401648 401043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 402183 401743 gene locus_tag LOCUS_03380 gene gspG 402183 401743 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_03380 402440 402252 gene locus_tag LOCUS_03390 402440 402252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 403704 402445 gene locus_tag LOCUS_03400 403704 402445 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 protein_id gnl|my_center|LOCUS_03400 406760 403887 gene locus_tag LOCUS_03410 gene acnA 406760 403887 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_03410 407333 406914 gene locus_tag LOCUS_03420 407333 406914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 407629 407330 gene locus_tag LOCUS_03430 407629 407330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 407619 408149 gene locus_tag LOCUS_03440 gene moaC 407619 408149 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969379.1 protein_id gnl|my_center|LOCUS_03440 408146 408643 gene locus_tag LOCUS_03450 408146 408643 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_03450 408716 410164 gene locus_tag LOCUS_03460 408716 410164 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_03460 411102 410173 gene locus_tag LOCUS_03470 411102 410173 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169980830.1 protein_id gnl|my_center|LOCUS_03470 412079 411150 gene locus_tag LOCUS_03480 412079 411150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 413119 412520 gene locus_tag LOCUS_03490 413119 412520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 415257 413578 gene locus_tag LOCUS_03500 415257 413578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 416882 415332 gene locus_tag LOCUS_03510 416882 415332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 417263 416895 gene locus_tag LOCUS_03520 417263 416895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 417592 417281 gene locus_tag LOCUS_03530 417592 417281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 418025 417690 gene locus_tag LOCUS_03540 418025 417690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 418833 418588 gene locus_tag LOCUS_03550 418833 418588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 418904 422062 gene locus_tag LOCUS_03560 418904 422062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 422416 422081 gene locus_tag LOCUS_03570 422416 422081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 423215 423009 gene locus_tag LOCUS_03580 423215 423009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 424476 423880 gene locus_tag LOCUS_03590 424476 423880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 424520 424990 gene locus_tag LOCUS_03600 424520 424990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 424987 426009 gene locus_tag LOCUS_03610 424987 426009 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_03610 427099 426029 gene locus_tag LOCUS_03620 gene trpS 427099 426029 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769841.1 protein_id gnl|my_center|LOCUS_03620 428579 427143 gene locus_tag LOCUS_03630 gene hpnO 428579 427143 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_03630 428986 428597 gene locus_tag LOCUS_03640 428986 428597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 428894 430720 gene locus_tag LOCUS_03650 gene shc 428894 430720 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_03650 432309 430741 gene locus_tag LOCUS_03660 432309 430741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 432405 432492 gene locus_tag LOCUS_t00080 432405 432492 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 432619 433641 gene locus_tag LOCUS_03670 432619 433641 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388814.1 protein_id gnl|my_center|LOCUS_03670 435558 433681 gene locus_tag LOCUS_03680 435558 433681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 435833 437275 gene locus_tag LOCUS_03690 gene murC 435833 437275 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_03690 437310 438227 gene locus_tag LOCUS_03700 gene murB 437310 438227 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_03700 438427 439644 gene locus_tag LOCUS_03710 438427 439644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 441374 439803 gene locus_tag LOCUS_03720 441374 439803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 443466 441673 gene locus_tag LOCUS_03730 443466 441673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 443701 443471 gene locus_tag LOCUS_03740 443701 443471 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048105191.1 protein_id gnl|my_center|LOCUS_03740 443928 443698 gene locus_tag LOCUS_03750 443928 443698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 444063 444596 gene locus_tag LOCUS_03760 444063 444596 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_03760 447042 444676 gene locus_tag LOCUS_03770 447042 444676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 449995 447197 gene locus_tag LOCUS_03780 449995 447197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 450388 451401 gene locus_tag LOCUS_03790 450388 451401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 453656 451416 gene locus_tag LOCUS_03800 453656 451416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 453714 453902 gene locus_tag LOCUS_03810 453714 453902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 455894 454668 gene locus_tag LOCUS_03820 455894 454668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 456523 455891 gene locus_tag LOCUS_03830 456523 455891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 456820 456536 gene locus_tag LOCUS_03840 456820 456536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 457860 456742 gene locus_tag LOCUS_03850 457860 456742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 459006 458578 gene locus_tag LOCUS_03860 459006 458578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 459655 459221 gene locus_tag LOCUS_03870 459655 459221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 460716 459610 gene locus_tag LOCUS_03880 460716 459610 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679979.1 protein_id gnl|my_center|LOCUS_03880 462474 461398 gene locus_tag LOCUS_03890 462474 461398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 464134 462554 gene locus_tag LOCUS_03900 gene lysS 464134 462554 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_03900 464765 464283 gene locus_tag LOCUS_03910 464765 464283 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922126.1 protein_id gnl|my_center|LOCUS_03910 467102 464952 gene locus_tag LOCUS_03920 467102 464952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 467229 468923 gene locus_tag LOCUS_03930 467229 468923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 469127 468906 gene locus_tag LOCUS_03940 469127 468906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 470299 470758 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcacgccgttgccgttgcagtc 472734 471865 gene locus_tag LOCUS_03950 472734 471865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 474336 472762 gene locus_tag LOCUS_03960 474336 472762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 474500 474772 gene locus_tag LOCUS_03970 474500 474772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 474793 475329 gene locus_tag LOCUS_03980 474793 475329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 475334 475552 gene locus_tag LOCUS_03990 475334 475552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 475595 476044 gene locus_tag LOCUS_04000 475595 476044 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982615.1 protein_id gnl|my_center|LOCUS_04000 478438 476096 gene locus_tag LOCUS_04010 478438 476096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 478611 479765 gene locus_tag LOCUS_04020 478611 479765 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530606.1 protein_id gnl|my_center|LOCUS_04020 480256 480693 gene locus_tag LOCUS_04030 480256 480693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 482407 480707 gene locus_tag LOCUS_04040 482407 480707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 482621 483226 gene locus_tag LOCUS_04050 482621 483226 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_04050 483254 485212 gene locus_tag LOCUS_04060 483254 485212 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_04060 486043 485267 gene locus_tag LOCUS_04070 486043 485267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 486292 487230 gene locus_tag LOCUS_04080 486292 487230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 488855 487350 gene locus_tag LOCUS_04090 488855 487350 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_04090 488996 489238 gene locus_tag LOCUS_04100 488996 489238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 490599 489283 gene locus_tag LOCUS_04110 490599 489283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 493516 490730 gene locus_tag LOCUS_04120 gene ppc 493516 490730 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402879.1 protein_id gnl|my_center|LOCUS_04120 495281 493755 gene locus_tag LOCUS_04130 495281 493755 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816030.1 protein_id gnl|my_center|LOCUS_04130 495445 496401 gene locus_tag LOCUS_04140 495445 496401 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958251.1 protein_id gnl|my_center|LOCUS_04140 496459 496956 gene locus_tag LOCUS_04150 496459 496956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 498361 497057 gene locus_tag LOCUS_04160 498361 497057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 498759 500450 gene locus_tag LOCUS_04170 498759 500450 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080316864.1 protein_id gnl|my_center|LOCUS_04170 501616 500468 gene locus_tag LOCUS_04180 501616 500468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144214.1 protein_id gnl|my_center|LOCUS_04180 502203 501694 gene locus_tag LOCUS_04190 502203 501694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 502563 503183 gene locus_tag LOCUS_04200 502563 503183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 503328 505097 gene locus_tag LOCUS_04210 503328 505097 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_04210 505111 506067 gene locus_tag LOCUS_04220 505111 506067 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463614.1 protein_id gnl|my_center|LOCUS_04220 506123 507994 gene locus_tag LOCUS_04230 506123 507994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 protein_id gnl|my_center|LOCUS_04230 508043 508396 gene locus_tag LOCUS_04240 508043 508396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 508587 509501 gene locus_tag LOCUS_04250 508587 509501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 509521 510684 gene locus_tag LOCUS_04260 509521 510684 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_04260 510855 512648 gene locus_tag LOCUS_04270 510855 512648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 512664 515033 gene locus_tag LOCUS_04280 512664 515033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 515097 516323 gene locus_tag LOCUS_04290 gene rodA 515097 516323 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 protein_id gnl|my_center|LOCUS_04290 516350 517132 gene locus_tag LOCUS_04300 gene rsmG 516350 517132 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258170.1 protein_id gnl|my_center|LOCUS_04300 517738 517139 gene locus_tag LOCUS_04310 517738 517139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 518228 518094 gene locus_tag LOCUS_04320 518228 518094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 519266 518820 gene locus_tag LOCUS_04330 519266 518820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 520571 519693 gene locus_tag LOCUS_04340 520571 519693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 521819 520977 gene locus_tag LOCUS_04350 521819 520977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 522942 522271 gene locus_tag LOCUS_04360 522942 522271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 523497 523042 gene locus_tag LOCUS_04370 523497 523042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 523724 524254 gene locus_tag LOCUS_04380 523724 524254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 524354 525151 gene locus_tag LOCUS_04390 524354 525151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 525853 525116 gene locus_tag LOCUS_04400 525853 525116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 525961 527100 gene locus_tag LOCUS_04410 gene hpnH 525961 527100 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_04410 527384 527815 gene locus_tag LOCUS_04420 527384 527815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 528724 527849 gene locus_tag LOCUS_04430 528724 527849 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888939.1 protein_id gnl|my_center|LOCUS_04430 529186 528767 gene locus_tag LOCUS_04440 529186 528767 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730707.1 protein_id gnl|my_center|LOCUS_04440 529994 529344 gene locus_tag LOCUS_04450 529994 529344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 530088 534110 gene locus_tag LOCUS_04460 gene hrpA 530088 534110 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_04460 534281 534859 gene locus_tag LOCUS_04470 534281 534859 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921582.1 protein_id gnl|my_center|LOCUS_04470 535451 534876 gene locus_tag LOCUS_04480 535451 534876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 536928 535579 gene locus_tag LOCUS_04490 536928 535579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 538058 537063 gene locus_tag LOCUS_04500 538058 537063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 538125 539759 gene locus_tag LOCUS_04510 538125 539759 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_04510 541404 539833 gene locus_tag LOCUS_04520 gene guaA 541404 539833 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_04520 543672 541651 gene locus_tag LOCUS_04530 543672 541651 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_04530 543732 543968 gene locus_tag LOCUS_04540 543732 543968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 545338 544424 gene locus_tag LOCUS_04550 545338 544424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 545482 546165 gene locus_tag LOCUS_04560 545482 546165 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_04560 546424 546158 gene locus_tag LOCUS_04570 546424 546158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 548419 546596 gene locus_tag LOCUS_04580 548419 546596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 548782 548612 gene locus_tag LOCUS_04590 548782 548612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 548829 549497 gene locus_tag LOCUS_04600 548829 549497 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_04600 549494 550675 gene locus_tag LOCUS_04610 549494 550675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 551144 550941 gene locus_tag LOCUS_04620 551144 550941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 551748 551083 gene locus_tag LOCUS_04630 551748 551083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 552094 552321 gene locus_tag LOCUS_04640 552094 552321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 552332 554455 gene locus_tag LOCUS_04650 552332 554455 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_04650 554697 554476 gene locus_tag LOCUS_04660 554697 554476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 554926 556341 gene locus_tag LOCUS_04670 554926 556341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 556435 557775 gene locus_tag LOCUS_04680 556435 557775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 557952 558302 gene locus_tag LOCUS_tm00010 557952 558302 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 559673 558390 gene locus_tag LOCUS_04690 559673 558390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 560110 559670 gene locus_tag LOCUS_04700 560110 559670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 560617 560544 gene locus_tag LOCUS_t00090 560617 560544 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 561015 562736 gene locus_tag LOCUS_04710 561015 562736 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_04710 563358 562756 gene locus_tag LOCUS_04720 563358 562756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 566110 563339 gene locus_tag LOCUS_04730 gene mutS 566110 563339 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_04730 566201 567886 gene locus_tag LOCUS_04740 566201 567886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 568184 568885 gene locus_tag LOCUS_04750 568184 568885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 569583 570263 gene locus_tag LOCUS_04760 569583 570263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 571079 570438 gene locus_tag LOCUS_04770 571079 570438 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921301.1 protein_id gnl|my_center|LOCUS_04770 571078 571527 gene locus_tag LOCUS_04780 571078 571527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 571524 572987 gene locus_tag LOCUS_04790 571524 572987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 573056 574003 gene locus_tag LOCUS_04800 gene mdh 573056 574003 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_04800 574079 575359 gene locus_tag LOCUS_04810 574079 575359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 575486 576487 gene locus_tag LOCUS_04820 575486 576487 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_04820 576699 578174 gene locus_tag LOCUS_04830 576699 578174 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_04830 579501 578134 gene locus_tag LOCUS_04840 579501 578134 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225610.1 protein_id gnl|my_center|LOCUS_04840 579636 580076 gene locus_tag LOCUS_04850 579636 580076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 580118 582004 gene locus_tag LOCUS_04860 gene mnmG 580118 582004 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_04860 582074 582784 gene locus_tag LOCUS_04870 582074 582784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 582794 583756 gene locus_tag LOCUS_04880 582794 583756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 583842 584444 gene locus_tag LOCUS_04890 583842 584444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 584791 585393 gene locus_tag LOCUS_04900 584791 585393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 586351 585542 gene locus_tag LOCUS_04910 586351 585542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 586381 588090 gene locus_tag LOCUS_04920 586381 588090 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391643.1 protein_id gnl|my_center|LOCUS_04920 590176 588113 gene locus_tag LOCUS_04930 590176 588113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 590534 590337 gene locus_tag LOCUS_04940 590534 590337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 590467 592524 gene locus_tag LOCUS_04950 590467 592524 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073033.1 protein_id gnl|my_center|LOCUS_04950 592722 595706 gene locus_tag LOCUS_04960 gene gcvP 592722 595706 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_04960 596282 595863 gene locus_tag LOCUS_04970 596282 595863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 597859 596420 gene locus_tag LOCUS_04980 gene atpD 597859 596420 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_04980 599010 598045 gene locus_tag LOCUS_04990 gene thyX 599010 598045 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_04990 599278 600879 gene locus_tag LOCUS_05000 599278 600879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 601051 601812 gene locus_tag LOCUS_05010 gene lipB 601051 601812 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_05010 602076 601753 gene locus_tag LOCUS_05020 gene sugE 602076 601753 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111167.1 protein_id gnl|my_center|LOCUS_05020 602193 603620 gene locus_tag LOCUS_05030 602193 603620 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_05030 604506 603634 gene locus_tag LOCUS_05040 604506 603634 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 protein_id gnl|my_center|LOCUS_05040 605664 604576 gene locus_tag LOCUS_05050 605664 604576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 606198 605911 gene locus_tag LOCUS_05060 606198 605911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 607875 606625 gene locus_tag LOCUS_05070 607875 606625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 608246 608872 gene locus_tag LOCUS_05080 gene sigW 608246 608872 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_05080 608932 609801 gene locus_tag LOCUS_05090 608932 609801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 609963 611648 gene locus_tag LOCUS_05100 609963 611648 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920632.1 protein_id gnl|my_center|LOCUS_05100 611645 612661 gene locus_tag LOCUS_05110 611645 612661 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_05110 612698 613612 gene locus_tag LOCUS_05120 612698 613612 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_05120 615170 613617 gene locus_tag LOCUS_05130 615170 613617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 615865 615218 gene locus_tag LOCUS_05140 gene purN 615865 615218 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 protein_id gnl|my_center|LOCUS_05140 616261 615908 gene locus_tag LOCUS_05150 616261 615908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 616734 616312 gene locus_tag LOCUS_05160 gene yciA 616734 616312 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210317.1 protein_id gnl|my_center|LOCUS_05160 617321 616779 gene locus_tag LOCUS_05170 617321 616779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 618398 617346 gene locus_tag LOCUS_05180 gene tsaD 618398 617346 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_05180 620196 618475 gene locus_tag LOCUS_05190 620196 618475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 620373 621788 gene locus_tag LOCUS_05200 gene hflX 620373 621788 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_05200 621940 622011 gene locus_tag LOCUS_t00100 621940 622011 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 622769 622197 gene locus_tag LOCUS_05210 622769 622197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 623154 624152 gene locus_tag LOCUS_05220 623154 624152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 624270 626003 gene locus_tag LOCUS_05230 624270 626003 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_05230 626638 626048 gene locus_tag LOCUS_05240 gene wcaF 626638 626048 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_05240 628906 626657 gene locus_tag LOCUS_05250 628906 626657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 630242 629037 gene locus_tag LOCUS_05260 630242 629037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 630409 631065 gene locus_tag LOCUS_05270 630409 631065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 631107 632330 gene locus_tag LOCUS_05280 631107 632330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 632525 633478 gene locus_tag LOCUS_05290 632525 633478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 634831 633530 gene locus_tag LOCUS_05300 gene ispG 634831 633530 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112903303.1 protein_id gnl|my_center|LOCUS_05300 637012 634943 gene locus_tag LOCUS_05310 637012 634943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 637210 637842 gene locus_tag LOCUS_05320 637210 637842 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325155.1 protein_id gnl|my_center|LOCUS_05320 637990 640947 gene locus_tag LOCUS_05330 637990 640947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 641070 643793 gene locus_tag LOCUS_05340 641070 643793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 644768 643803 gene locus_tag LOCUS_05350 644768 643803 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039199.1 protein_id gnl|my_center|LOCUS_05350 644925 646529 gene locus_tag LOCUS_05360 644925 646529 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259695.1 protein_id gnl|my_center|LOCUS_05360 646743 647528 gene locus_tag LOCUS_05370 646743 647528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 648560 647637 gene locus_tag LOCUS_05380 648560 647637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 650076 648676 gene locus_tag LOCUS_05390 gene chrA 650076 648676 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 protein_id gnl|my_center|LOCUS_05390 651154 653967 gene locus_tag LOCUS_05400 651154 653967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 653971 655194 gene locus_tag LOCUS_05410 653971 655194 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392555.1 protein_id gnl|my_center|LOCUS_05410 655198 656976 gene locus_tag LOCUS_05420 655198 656976 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_05420 656969 657373 gene locus_tag LOCUS_05430 656969 657373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 658761 657352 gene locus_tag LOCUS_05440 658761 657352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 659838 658804 gene locus_tag LOCUS_05450 gene galE 659838 658804 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293897.1 protein_id gnl|my_center|LOCUS_05450 660535 659897 gene locus_tag LOCUS_05460 660535 659897 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_05460 660614 662473 gene locus_tag LOCUS_05470 660614 662473 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_05470 663424 662480 gene locus_tag LOCUS_05480 663424 662480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 664264 663521 gene locus_tag LOCUS_05490 664264 663521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 664327 664806 gene locus_tag LOCUS_05500 664327 664806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 664816 666441 gene locus_tag LOCUS_05510 664816 666441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 667222 666461 gene locus_tag LOCUS_05520 667222 666461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 668514 667219 gene locus_tag LOCUS_05530 668514 667219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 669394 668720 gene locus_tag LOCUS_05540 669394 668720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 669393 669617 gene locus_tag LOCUS_05550 669393 669617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 669905 670669 gene locus_tag LOCUS_05560 669905 670669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 671610 670693 gene locus_tag LOCUS_05570 671610 670693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 671597 672538 gene locus_tag LOCUS_05580 671597 672538 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_05580 672559 673122 gene locus_tag LOCUS_05590 672559 673122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 673177 674541 gene locus_tag LOCUS_05600 673177 674541 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_05600 674849 676309 gene locus_tag LOCUS_05610 674849 676309 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454128.1 protein_id gnl|my_center|LOCUS_05610 676343 676639 gene locus_tag LOCUS_05620 676343 676639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 678090 676648 gene locus_tag LOCUS_05630 678090 676648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 680141 678210 gene locus_tag LOCUS_05640 gene mutL 680141 678210 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139982.1 protein_id gnl|my_center|LOCUS_05640 680185 680613 gene locus_tag LOCUS_05650 680185 680613 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983376.1 protein_id gnl|my_center|LOCUS_05650 684613 682628 gene locus_tag LOCUS_05660 684613 682628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 686315 685221 gene locus_tag LOCUS_05670 686315 685221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 687397 686603 gene locus_tag LOCUS_05680 687397 686603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 687544 689166 gene locus_tag LOCUS_05690 687544 689166 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_05690 689423 689268 gene locus_tag LOCUS_05700 689423 689268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 690543 689479 gene locus_tag LOCUS_05710 690543 689479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 690552 691097 gene locus_tag LOCUS_05720 690552 691097 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_05720 692473 691121 gene locus_tag LOCUS_05730 gene rfbH 692473 691121 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_05730 692522 692800 gene locus_tag LOCUS_05740 692522 692800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 693205 692807 gene locus_tag LOCUS_05750 693205 692807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 695446 693257 gene locus_tag LOCUS_05760 gene vgrG1b 695446 693257 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_05760 696224 695544 gene locus_tag LOCUS_05770 696224 695544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 699035 696327 gene locus_tag LOCUS_05780 gene tssH 699035 696327 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_05780 700431 699136 gene locus_tag LOCUS_05790 gene tssG 700431 699136 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064508.1 protein_id gnl|my_center|LOCUS_05790 702380 700458 gene locus_tag LOCUS_05800 gene tssF 702380 700458 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 protein_id gnl|my_center|LOCUS_05800 702978 702466 gene locus_tag LOCUS_05810 gene tssE 702978 702466 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104971.1 protein_id gnl|my_center|LOCUS_05810 703837 702971 gene locus_tag LOCUS_05820 gene tagJ 703837 702971 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_05820 704504 704013 gene locus_tag LOCUS_05830 gene hcp 704504 704013 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_05830 706187 704691 gene locus_tag LOCUS_05840 gene tssC 706187 704691 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_05840 706749 706249 gene locus_tag LOCUS_05850 gene tssB 706749 706249 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_05850 707883 706810 gene locus_tag LOCUS_05860 gene tssA 707883 706810 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 protein_id gnl|my_center|LOCUS_05860 720463 707936 gene locus_tag LOCUS_05870 720463 707936 CDS product autotransporter-associated beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104543246.1 protein_id gnl|my_center|LOCUS_05870 722748 720583 gene locus_tag LOCUS_05880 722748 720583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 726739 722954 gene locus_tag LOCUS_05890 726739 722954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 731512 726854 gene locus_tag LOCUS_05900 731512 726854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 732402 731692 gene locus_tag LOCUS_05910 732402 731692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 733863 732475 gene locus_tag LOCUS_05920 gene tssK 733863 732475 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616050.1 protein_id gnl|my_center|LOCUS_05920 734929 733910 gene locus_tag LOCUS_05930 734929 733910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 735074 735304 gene locus_tag LOCUS_05940 735074 735304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 735441 736373 gene locus_tag LOCUS_05950 gene ispE 735441 736373 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_05950 736370 736759 gene locus_tag LOCUS_05960 736370 736759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 737240 736914 gene locus_tag LOCUS_05970 gene rplU 737240 736914 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726868.1 protein_id gnl|my_center|LOCUS_05970 738538 737681 gene locus_tag LOCUS_05980 738538 737681 CDS product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928850.1 protein_id gnl|my_center|LOCUS_05980 738753 739310 gene locus_tag LOCUS_05990 738753 739310 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027261.1 protein_id gnl|my_center|LOCUS_05990 739307 740125 gene locus_tag LOCUS_06000 739307 740125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 740269 742290 gene locus_tag LOCUS_06010 740269 742290 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120638.1 protein_id gnl|my_center|LOCUS_06010 743153 742365 gene locus_tag LOCUS_06020 743153 742365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 743282 743569 gene locus_tag LOCUS_06030 743282 743569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 744029 744874 gene locus_tag LOCUS_06040 744029 744874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 744881 745663 gene locus_tag LOCUS_06050 744881 745663 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152386036.1 protein_id gnl|my_center|LOCUS_06050 746321 747469 gene locus_tag LOCUS_06060 746321 747469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 748126 747866 gene locus_tag LOCUS_06070 748126 747866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 749196 748414 gene locus_tag LOCUS_06080 749196 748414 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152386036.1 protein_id gnl|my_center|LOCUS_06080 750333 749266 gene locus_tag LOCUS_06090 750333 749266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 750899 751351 gene locus_tag LOCUS_06100 gene tnpA 750899 751351 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_06100 751843 751490 gene locus_tag LOCUS_06110 751843 751490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 752583 752272 gene locus_tag LOCUS_06120 752583 752272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 754046 752844 gene locus_tag LOCUS_06130 754046 752844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 755457 754345 gene locus_tag LOCUS_06140 755457 754345 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_06140 756947 755562 gene locus_tag LOCUS_06150 756947 755562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 759025 757241 gene locus_tag LOCUS_06160 759025 757241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 759435 760442 gene locus_tag LOCUS_06170 759435 760442 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144111.1 protein_id gnl|my_center|LOCUS_06170 760711 761523 gene locus_tag LOCUS_06180 760711 761523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 761587 762462 gene locus_tag LOCUS_06190 761587 762462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 762611 762375 gene locus_tag LOCUS_06200 762611 762375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 762709 763626 gene locus_tag LOCUS_06210 762709 763626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 765555 763627 gene locus_tag LOCUS_06220 gene hscA 765555 763627 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703171.1 protein_id gnl|my_center|LOCUS_06220 766044 765592 gene locus_tag LOCUS_06230 766044 765592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 766641 766045 gene locus_tag LOCUS_06240 766641 766045 CDS product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098411.1 protein_id gnl|my_center|LOCUS_06240 767555 766716 gene locus_tag LOCUS_06250 767555 766716 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 protein_id gnl|my_center|LOCUS_06250 769156 767591 gene locus_tag LOCUS_06260 769156 767591 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838082.1 protein_id gnl|my_center|LOCUS_06260 769476 770120 gene locus_tag LOCUS_06270 769476 770120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 771416 770133 gene locus_tag LOCUS_06280 771416 770133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 771548 772390 gene locus_tag LOCUS_06290 771548 772390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 774887 772590 gene locus_tag LOCUS_06300 774887 772590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 775272 776327 gene locus_tag LOCUS_06310 775272 776327 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_06310 776385 777611 gene locus_tag LOCUS_06320 776385 777611 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_06320 777608 778381 gene locus_tag LOCUS_06330 777608 778381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 778519 781362 gene locus_tag LOCUS_06340 778519 781362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 781350 781970 gene locus_tag LOCUS_06350 781350 781970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 782608 782162 gene locus_tag LOCUS_06360 782608 782162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 785224 782828 gene locus_tag LOCUS_06370 785224 782828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 785910 785221 gene locus_tag LOCUS_06380 gene rpe 785910 785221 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390155.1 protein_id gnl|my_center|LOCUS_06380 786034 787470 gene locus_tag LOCUS_06390 786034 787470 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_06390 787460 788248 gene locus_tag LOCUS_06400 787460 788248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 789835 788276 gene locus_tag LOCUS_06410 789835 788276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 791320 790124 gene locus_tag LOCUS_06420 791320 790124 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_06420 791545 792576 gene locus_tag LOCUS_06430 791545 792576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 792573 793118 gene locus_tag LOCUS_06440 792573 793118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 793218 793709 gene locus_tag LOCUS_06450 793218 793709 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259680.1 protein_id gnl|my_center|LOCUS_06450 793731 794447 gene locus_tag LOCUS_06460 793731 794447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 795268 794456 gene locus_tag LOCUS_06470 795268 794456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 796587 795277 gene locus_tag LOCUS_06480 796587 795277 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_06480 797246 796638 gene locus_tag LOCUS_06490 797246 796638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 797805 799076 gene locus_tag LOCUS_06500 797805 799076 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228554.1 protein_id gnl|my_center|LOCUS_06500 799142 800884 gene locus_tag LOCUS_06510 799142 800884 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930368.1 protein_id gnl|my_center|LOCUS_06510 800950 801813 gene locus_tag LOCUS_06520 800950 801813 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225730.1 protein_id gnl|my_center|LOCUS_06520 802067 804532 gene locus_tag LOCUS_06530 802067 804532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 804529 805275 gene locus_tag LOCUS_06540 804529 805275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 805356 806171 gene locus_tag LOCUS_06550 805356 806171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 806287 807399 gene locus_tag LOCUS_06560 806287 807399 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_06560 807596 809578 gene locus_tag LOCUS_06570 807596 809578 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107693.1 protein_id gnl|my_center|LOCUS_06570 809586 810461 gene locus_tag LOCUS_06580 809586 810461 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944061.1 protein_id gnl|my_center|LOCUS_06580 810535 810828 gene locus_tag LOCUS_06590 810535 810828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 811015 811578 gene locus_tag LOCUS_06600 811015 811578 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_06600 811739 813037 gene locus_tag LOCUS_06610 811739 813037 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_06610 813121 813900 gene locus_tag LOCUS_06620 813121 813900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_06620 813897 815135 gene locus_tag LOCUS_06630 813897 815135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928529.1 protein_id gnl|my_center|LOCUS_06630 816242 815049 gene locus_tag LOCUS_06640 816242 815049 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_06640 818334 816259 gene locus_tag LOCUS_06650 818334 816259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 818481 819101 gene locus_tag LOCUS_06660 818481 819101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 819858 819118 gene locus_tag LOCUS_06670 819858 819118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 820093 820473 gene locus_tag LOCUS_06680 820093 820473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 820677 821543 gene locus_tag LOCUS_06690 820677 821543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 822674 821553 gene locus_tag LOCUS_06700 822674 821553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 824426 822717 gene locus_tag LOCUS_06710 824426 822717 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163445.1 protein_id gnl|my_center|LOCUS_06710 824540 827032 gene locus_tag LOCUS_06720 824540 827032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 827029 828672 gene locus_tag LOCUS_06730 827029 828672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 829175 828681 gene locus_tag LOCUS_06740 829175 828681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 832196 829416 gene locus_tag LOCUS_06750 832196 829416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 832658 833470 gene locus_tag LOCUS_06760 832658 833470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 833689 834414 gene locus_tag LOCUS_06770 833689 834414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 834411 835514 gene locus_tag LOCUS_06780 834411 835514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870187.1 protein_id gnl|my_center|LOCUS_06780 835530 836168 gene locus_tag LOCUS_06790 835530 836168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 836220 838619 gene locus_tag LOCUS_06800 836220 838619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 841024 838805 gene locus_tag LOCUS_06810 841024 838805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 841375 844833 gene locus_tag LOCUS_06820 841375 844833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 845689 844850 gene locus_tag LOCUS_06830 845689 844850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 846300 845836 gene locus_tag LOCUS_06840 gene rpiB 846300 845836 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_06840 847492 846353 gene locus_tag LOCUS_06850 847492 846353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 849054 847522 gene locus_tag LOCUS_06860 849054 847522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 849461 849922 gene locus_tag LOCUS_06870 gene rplM 849461 849922 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870258.1 protein_id gnl|my_center|LOCUS_06870 850022 850546 gene locus_tag LOCUS_06880 gene rpsI 850022 850546 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280533.1 protein_id gnl|my_center|LOCUS_06880 850836 852485 gene locus_tag LOCUS_06890 850836 852485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 852749 853123 gene locus_tag LOCUS_06900 852749 853123 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_06900 853507 854424 gene locus_tag LOCUS_06910 853507 854424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 854475 855509 gene locus_tag LOCUS_06920 854475 855509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 855528 856235 gene locus_tag LOCUS_06930 855528 856235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 857676 856246 gene locus_tag LOCUS_06940 857676 856246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 857830 858624 gene locus_tag LOCUS_06950 gene plsY 857830 858624 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_06950 858910 861957 gene locus_tag LOCUS_06960 858910 861957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 863068 861986 gene locus_tag LOCUS_06970 863068 861986 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_06970 863616 863065 gene locus_tag LOCUS_06980 gene purE 863616 863065 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_06980 863744 864175 gene locus_tag LOCUS_06990 863744 864175 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_06990 864184 864636 gene locus_tag LOCUS_07000 864184 864636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 864633 864914 gene locus_tag LOCUS_07010 864633 864914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 864859 865614 gene locus_tag LOCUS_07020 864859 865614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 867229 865640 gene locus_tag LOCUS_07030 gene trpE 867229 865640 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_07030 868653 867253 gene locus_tag LOCUS_07040 868653 867253 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_07040 872726 868761 gene locus_tag LOCUS_07050 872726 868761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 872992 874752 gene locus_tag LOCUS_07060 872992 874752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 875652 874876 gene locus_tag LOCUS_07070 875652 874876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 877054 878598 gene locus_tag LOCUS_07080 877054 878598 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_07080 878648 880369 gene locus_tag LOCUS_07090 878648 880369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 880639 881391 gene locus_tag LOCUS_07100 880639 881391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 881388 881921 gene locus_tag LOCUS_07110 881388 881921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 882073 883107 gene locus_tag LOCUS_07120 882073 883107 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_07120 883299 887156 gene locus_tag LOCUS_07130 883299 887156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 883475 883382 gene locus_tag LOCUS_t00110 883475 883382 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 887353 888054 gene locus_tag LOCUS_07140 887353 888054 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146517941.1 protein_id gnl|my_center|LOCUS_07140 888452 889117 gene locus_tag LOCUS_07150 888452 889117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 889877 890782 gene locus_tag LOCUS_07160 889877 890782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 891263 891649 gene locus_tag LOCUS_07170 891263 891649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 891685 891900 gene locus_tag LOCUS_07180 891685 891900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 892315 893076 gene locus_tag LOCUS_07190 892315 893076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 893411 894250 gene locus_tag LOCUS_07200 893411 894250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 894530 895210 gene locus_tag LOCUS_07210 894530 895210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 895517 896164 gene locus_tag LOCUS_07220 895517 896164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 896300 896989 gene locus_tag LOCUS_07230 896300 896989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 897112 897894 gene locus_tag LOCUS_07240 897112 897894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 898299 898958 gene locus_tag LOCUS_07250 898299 898958 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268476.1 protein_id gnl|my_center|LOCUS_07250 899119 899676 gene locus_tag LOCUS_07260 899119 899676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 899790 900653 gene locus_tag LOCUS_07270 gene sdhC 899790 900653 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 protein_id gnl|my_center|LOCUS_07270 900798 902768 gene locus_tag LOCUS_07280 gene sdhA 900798 902768 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122818.1 protein_id gnl|my_center|LOCUS_07280 902832 903674 gene locus_tag LOCUS_07290 gene sdhB 902832 903674 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122819.1 protein_id gnl|my_center|LOCUS_07290 903891 905387 gene locus_tag LOCUS_07300 903891 905387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 904442 904525 gene locus_tag LOCUS_t00120 904442 904525 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 905514 907868 gene locus_tag LOCUS_07310 905514 907868 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_07310 908480 907884 gene locus_tag LOCUS_07320 908480 907884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 908699 909145 gene locus_tag LOCUS_07330 908699 909145 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_07330 909145 910527 gene locus_tag LOCUS_07340 gene truD 909145 910527 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_07340 910524 911189 gene locus_tag LOCUS_07350 910524 911189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 911524 911207 gene locus_tag LOCUS_07360 911524 911207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 912272 911517 gene locus_tag LOCUS_07370 912272 911517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 912509 913153 gene locus_tag LOCUS_07380 912509 913153 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_07380 915242 913242 gene locus_tag LOCUS_07390 915242 913242 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_07390 916169 915300 gene locus_tag LOCUS_07400 gene surE 916169 915300 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_07400 916226 917113 gene locus_tag LOCUS_07410 916226 917113 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167728.1 protein_id gnl|my_center|LOCUS_07410 919708 917126 gene locus_tag LOCUS_07420 919708 917126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 919810 921447 gene locus_tag LOCUS_07430 919810 921447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 921478 922392 gene locus_tag LOCUS_07440 921478 922392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 923351 923716 gene locus_tag LOCUS_07450 923351 923716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 926633 923835 gene locus_tag LOCUS_07460 926633 923835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 928840 926708 gene locus_tag LOCUS_07470 928840 926708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 930693 929404 gene locus_tag LOCUS_07480 gene nuoD 930693 929404 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967799.1 protein_id gnl|my_center|LOCUS_07480 931295 930837 gene locus_tag LOCUS_07490 931295 930837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 932060 931359 gene locus_tag LOCUS_07500 932060 931359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 932283 932825 gene locus_tag LOCUS_07510 932283 932825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 933683 932877 gene locus_tag LOCUS_07520 933683 932877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 938282 933705 gene locus_tag LOCUS_07530 938282 933705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 938574 939230 gene locus_tag LOCUS_07540 938574 939230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 941187 939376 gene locus_tag LOCUS_07550 941187 939376 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 protein_id gnl|my_center|LOCUS_07550 941558 943078 gene locus_tag LOCUS_07560 941558 943078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 943149 944381 gene locus_tag LOCUS_07570 943149 944381 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_07570 944438 944851 gene locus_tag LOCUS_07580 944438 944851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 948163 944876 gene locus_tag LOCUS_07590 948163 944876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_07590 948317 949174 gene locus_tag LOCUS_07600 948317 949174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_07600 949291 950217 gene locus_tag LOCUS_07610 gene hpnD 949291 950217 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417954.1 protein_id gnl|my_center|LOCUS_07610 950993 952318 gene locus_tag LOCUS_07620 950993 952318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 952321 953493 gene locus_tag LOCUS_07630 952321 953493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 953597 954289 gene locus_tag LOCUS_07640 953597 954289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 954434 955108 gene locus_tag LOCUS_07650 954434 955108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 955548 955919 gene locus_tag LOCUS_07660 955548 955919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 956429 956836 gene locus_tag LOCUS_07670 956429 956836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 956901 957338 gene locus_tag LOCUS_07680 956901 957338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 957531 958160 gene locus_tag LOCUS_07690 957531 958160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 958147 958623 gene locus_tag LOCUS_07700 958147 958623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 958776 959558 gene locus_tag LOCUS_07710 958776 959558 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152386036.1 protein_id gnl|my_center|LOCUS_07710 960565 959714 gene locus_tag LOCUS_07720 960565 959714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 960751 961317 gene locus_tag LOCUS_07730 960751 961317 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_07730 961376 962482 gene locus_tag LOCUS_07740 961376 962482 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_07740 963677 962502 gene locus_tag LOCUS_07750 gene dnaN 963677 962502 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421522.1 protein_id gnl|my_center|LOCUS_07750 964193 966100 gene locus_tag LOCUS_07760 964193 966100 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_07760 967462 966209 gene locus_tag LOCUS_07770 gene recA 967462 966209 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_07770 968214 967780 gene locus_tag LOCUS_07780 968214 967780 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535633.1 protein_id gnl|my_center|LOCUS_07780 968646 971216 gene locus_tag LOCUS_07790 968646 971216 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_07790 971990 971412 gene locus_tag LOCUS_07800 971990 971412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 971875 972276 gene locus_tag LOCUS_07810 971875 972276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 972724 973680 gene locus_tag LOCUS_07820 972724 973680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 974189 974869 gene locus_tag LOCUS_07830 974189 974869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 975095 976114 gene locus_tag LOCUS_07840 975095 976114 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_07840 978541 976124 gene locus_tag LOCUS_07850 978541 976124 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121841.1 protein_id gnl|my_center|LOCUS_07850 979133 978660 gene locus_tag LOCUS_07860 979133 978660 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941198.1 protein_id gnl|my_center|LOCUS_07860 979346 980692 gene locus_tag LOCUS_07870 979346 980692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 984048 980695 gene locus_tag LOCUS_07880 984048 980695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 984133 984555 gene locus_tag LOCUS_07890 984133 984555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 986172 984574 gene locus_tag LOCUS_07900 986172 984574 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_07900 986684 986454 gene locus_tag LOCUS_07910 986684 986454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 986580 987341 gene locus_tag LOCUS_07920 986580 987341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 988780 987503 gene locus_tag LOCUS_07930 988780 987503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 990260 989355 gene locus_tag LOCUS_07940 990260 989355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 990543 991070 gene locus_tag LOCUS_07950 990543 991070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 991067 991726 gene locus_tag LOCUS_07960 991067 991726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 991723 992493 gene locus_tag LOCUS_07970 991723 992493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 992535 994160 gene locus_tag LOCUS_07980 992535 994160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 994196 994903 gene locus_tag LOCUS_07990 994196 994903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 996296 994917 gene locus_tag LOCUS_08000 996296 994917 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_08000 996410 997204 gene locus_tag LOCUS_08010 996410 997204 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694907.1 protein_id gnl|my_center|LOCUS_08010 997914 997210 gene locus_tag LOCUS_08020 997914 997210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 998087 999571 gene locus_tag LOCUS_08030 998087 999571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 999571 1000521 gene locus_tag LOCUS_08040 999571 1000521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1000721 1001014 gene locus_tag LOCUS_08050 1000721 1001014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1002748 1001222 gene locus_tag LOCUS_08060 1002748 1001222 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_08060 1003572 1003024 gene locus_tag LOCUS_08070 1003572 1003024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1005175 1003607 gene locus_tag LOCUS_08080 1005175 1003607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1005823 1008885 gene locus_tag LOCUS_08090 1005823 1008885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1008917 1009888 gene locus_tag LOCUS_08100 1008917 1009888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1010130 1010669 gene locus_tag LOCUS_08110 1010130 1010669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022055.1 protein_id gnl|my_center|LOCUS_08110 1011710 1010712 gene locus_tag LOCUS_08120 1011710 1010712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975217.1 protein_id gnl|my_center|LOCUS_08120 1013449 1011773 gene locus_tag LOCUS_08130 1013449 1011773 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087657.1 protein_id gnl|my_center|LOCUS_08130 1014421 1013777 gene locus_tag LOCUS_08140 1014421 1013777 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 protein_id gnl|my_center|LOCUS_08140 1015038 1016210 gene locus_tag LOCUS_08150 1015038 1016210 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533480.1 protein_id gnl|my_center|LOCUS_08150 1016378 1017613 gene locus_tag LOCUS_08160 gene nadA 1016378 1017613 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_08160 1017733 1019175 gene locus_tag LOCUS_08170 1017733 1019175 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_08170 1020184 1019195 gene locus_tag LOCUS_08180 1020184 1019195 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_08180 1022128 1021151 gene locus_tag LOCUS_08190 1022128 1021151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1022496 1022269 gene locus_tag LOCUS_08200 1022496 1022269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1025324 1022592 gene locus_tag LOCUS_08210 gene clpB 1025324 1022592 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066720.1 protein_id gnl|my_center|LOCUS_08210 1025576 1025860 gene locus_tag LOCUS_08220 1025576 1025860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1026446 1025934 gene locus_tag LOCUS_08230 1026446 1025934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1027607 1026609 gene locus_tag LOCUS_08240 1027607 1026609 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038925.1 protein_id gnl|my_center|LOCUS_08240 1028834 1027689 gene locus_tag LOCUS_08250 1028834 1027689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761838.1 protein_id gnl|my_center|LOCUS_08250 1028969 1029313 gene locus_tag LOCUS_08260 1028969 1029313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1029352 1030410 gene locus_tag LOCUS_08270 1029352 1030410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1030587 1032173 gene locus_tag LOCUS_08280 1030587 1032173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1032750 1032163 gene locus_tag LOCUS_08290 1032750 1032163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1032892 1033170 gene locus_tag LOCUS_08300 1032892 1033170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1034696 1033152 gene locus_tag LOCUS_08310 1034696 1033152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1035083 1036210 gene locus_tag LOCUS_08320 1035083 1036210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1036891 1037907 gene locus_tag LOCUS_08330 1036891 1037907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1037900 1038799 gene locus_tag LOCUS_08340 1037900 1038799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1039578 1038826 gene locus_tag LOCUS_08350 1039578 1038826 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_08350 1039570 1039848 gene locus_tag LOCUS_08360 1039570 1039848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1040905 1039766 gene locus_tag LOCUS_08370 1040905 1039766 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_08370 1041124 1040945 gene locus_tag LOCUS_08380 1041124 1040945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1041765 1041283 gene locus_tag LOCUS_08390 1041765 1041283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1042093 1042410 gene locus_tag LOCUS_08400 1042093 1042410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1042479 1043033 gene locus_tag LOCUS_08410 1042479 1043033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1043143 1044249 gene locus_tag LOCUS_08420 gene lgt 1043143 1044249 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036022.1 protein_id gnl|my_center|LOCUS_08420 1044363 1045886 gene locus_tag LOCUS_08430 1044363 1045886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1045894 1046532 gene locus_tag LOCUS_08440 1045894 1046532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1047716 1046601 gene locus_tag LOCUS_08450 gene floA 1047716 1046601 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_08450 1047909 1049537 gene locus_tag LOCUS_08460 gene metG 1047909 1049537 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_08460 1049699 1050205 gene locus_tag LOCUS_08470 1049699 1050205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1050240 1051133 gene locus_tag LOCUS_08480 1050240 1051133 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_08480 1051212 1052393 gene locus_tag LOCUS_08490 1051212 1052393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1053321 1052404 gene locus_tag LOCUS_08500 1053321 1052404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1054429 1053425 gene locus_tag LOCUS_08510 1054429 1053425 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039097.1 protein_id gnl|my_center|LOCUS_08510 1054551 1054886 gene locus_tag LOCUS_08520 1054551 1054886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1055556 1055023 gene locus_tag LOCUS_08530 1055556 1055023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1056884 1055553 gene locus_tag LOCUS_08540 1056884 1055553 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_08540 1061191 1056986 gene locus_tag LOCUS_08550 1061191 1056986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 1062576 1061650 gene locus_tag LOCUS_08560 1062576 1061650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1063434 1067495 gene locus_tag LOCUS_08570 1063434 1067495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1068088 1067621 gene locus_tag LOCUS_08580 1068088 1067621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1068455 1071445 gene locus_tag LOCUS_08590 1068455 1071445 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921950.1 protein_id gnl|my_center|LOCUS_08590 1072815 1071979 gene locus_tag LOCUS_08600 gene mutM 1072815 1071979 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 protein_id gnl|my_center|LOCUS_08600 1073385 1072843 gene locus_tag LOCUS_08610 gene tadA 1073385 1072843 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803986.1 protein_id gnl|my_center|LOCUS_08610 1074410 1073403 gene locus_tag LOCUS_08620 1074410 1073403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1074582 1075253 gene locus_tag LOCUS_08630 1074582 1075253 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_08630 1075401 1076063 gene locus_tag LOCUS_08640 1075401 1076063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1076243 1077463 gene locus_tag LOCUS_08650 1076243 1077463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1078145 1080328 gene locus_tag LOCUS_08660 1078145 1080328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1080333 1081499 gene locus_tag LOCUS_08670 1080333 1081499 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_08670 1081716 1082156 gene locus_tag LOCUS_08680 1081716 1082156 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093444.1 protein_id gnl|my_center|LOCUS_08680 1082607 1082101 gene locus_tag LOCUS_08690 1082607 1082101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1083242 1082715 gene locus_tag LOCUS_08700 1083242 1082715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1084244 1083246 gene locus_tag LOCUS_08710 1084244 1083246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1085284 1084487 gene locus_tag LOCUS_08720 1085284 1084487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1085768 1089823 gene locus_tag LOCUS_08730 1085768 1089823 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814652.1 protein_id gnl|my_center|LOCUS_08730 1090006 1093254 gene locus_tag LOCUS_08740 1090006 1093254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1093587 1096850 gene locus_tag LOCUS_08750 1093587 1096850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1097104 1097472 gene locus_tag LOCUS_08760 1097104 1097472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1098349 1097645 gene locus_tag LOCUS_08770 1098349 1097645 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_08770 1098951 1098433 gene locus_tag LOCUS_08780 1098951 1098433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1099198 1099653 gene locus_tag LOCUS_08790 1099198 1099653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1101670 1099667 gene locus_tag LOCUS_08800 1101670 1099667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1102082 1102321 gene locus_tag LOCUS_08810 1102082 1102321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1103448 1102561 gene locus_tag LOCUS_08820 1103448 1102561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1104237 1103479 gene locus_tag LOCUS_08830 1104237 1103479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1105405 1107477 gene locus_tag LOCUS_08840 1105405 1107477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1107631 1107948 gene locus_tag LOCUS_08850 1107631 1107948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1108120 1109583 gene locus_tag LOCUS_08860 1108120 1109583 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_08860 1109694 1110368 gene locus_tag LOCUS_08870 1109694 1110368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1110365 1110850 gene locus_tag LOCUS_08880 1110365 1110850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1110992 1111582 gene locus_tag LOCUS_08890 1110992 1111582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1111665 1112966 gene locus_tag LOCUS_08900 1111665 1112966 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_08900 1112996 1114900 gene locus_tag LOCUS_08910 1112996 1114900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1115048 1115317 gene locus_tag LOCUS_08920 1115048 1115317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1115317 1115988 gene locus_tag LOCUS_08930 1115317 1115988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1116053 1116673 gene locus_tag LOCUS_08940 1116053 1116673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1117032 1119227 gene locus_tag LOCUS_08950 gene ppk1 1117032 1119227 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_08950 1120018 1119329 gene locus_tag LOCUS_08960 1120018 1119329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1120809 1120249 gene locus_tag LOCUS_08970 gene coaD 1120809 1120249 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_08970 1120869 1123364 gene locus_tag LOCUS_08980 1120869 1123364 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073096256.1 protein_id gnl|my_center|LOCUS_08980 1124036 1123365 gene locus_tag LOCUS_08990 1124036 1123365 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831548.1 protein_id gnl|my_center|LOCUS_08990 1124105 1124671 gene locus_tag LOCUS_09000 1124105 1124671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1124783 1126438 gene locus_tag LOCUS_09010 1124783 1126438 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083723.1 protein_id gnl|my_center|LOCUS_09010 1126524 1126441 gene locus_tag LOCUS_t00130 1126524 1126441 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1127247 1126534 gene locus_tag LOCUS_09020 1127247 1126534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1128584 1127244 gene locus_tag LOCUS_09030 1128584 1127244 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_09030 1132494 1128637 gene locus_tag LOCUS_09040 1132494 1128637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1132742 1132993 gene locus_tag LOCUS_09050 1132742 1132993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1134291 1133017 gene locus_tag LOCUS_09060 1134291 1133017 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_09060 1134803 1134432 gene locus_tag LOCUS_09070 1134803 1134432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1135275 1134865 gene locus_tag LOCUS_09080 1135275 1134865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1135967 1135326 gene locus_tag LOCUS_09090 1135967 1135326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1137271 1136099 gene locus_tag LOCUS_09100 1137271 1136099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1137862 1137332 gene locus_tag LOCUS_09110 1137862 1137332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1139424 1137934 gene locus_tag LOCUS_09120 1139424 1137934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1139899 1142220 gene locus_tag LOCUS_09130 1139899 1142220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1142231 1142995 gene locus_tag LOCUS_09140 1142231 1142995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1144656 1143142 gene locus_tag LOCUS_09150 1144656 1143142 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776589.1 protein_id gnl|my_center|LOCUS_09150 1145397 1145837 gene locus_tag LOCUS_09160 1145397 1145837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1145894 1146205 gene locus_tag LOCUS_09170 1145894 1146205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09170 1146202 1147110 gene locus_tag LOCUS_09180 1146202 1147110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09180 1147246 1147674 gene locus_tag LOCUS_09190 1147246 1147674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1148436 1148146 gene locus_tag LOCUS_09200 1148436 1148146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1148648 1149046 gene locus_tag LOCUS_09210 1148648 1149046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1149201 1149656 gene locus_tag LOCUS_09220 1149201 1149656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1149830 1150273 gene locus_tag LOCUS_09230 1149830 1150273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1150581 1151333 gene locus_tag LOCUS_09240 1150581 1151333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1152315 1151335 gene locus_tag LOCUS_09250 gene sucD 1152315 1151335 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_09250 1153977 1152823 gene locus_tag LOCUS_09260 1153977 1152823 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_09260 1155432 1154161 gene locus_tag LOCUS_09270 1155432 1154161 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_09270 1156924 1155473 gene locus_tag LOCUS_09280 1156924 1155473 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_09280 1157927 1157436 gene locus_tag LOCUS_09290 1157927 1157436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1158880 1158518 gene locus_tag LOCUS_09300 1158880 1158518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1160319 1159180 gene locus_tag LOCUS_09310 1160319 1159180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1161940 1161299 gene locus_tag LOCUS_09320 1161940 1161299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1162988 1162080 gene locus_tag LOCUS_09330 1162988 1162080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 1163296 1162985 gene locus_tag LOCUS_09340 1163296 1162985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 1164714 1163560 gene locus_tag LOCUS_09350 1164714 1163560 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533549.1 protein_id gnl|my_center|LOCUS_09350 1165025 1164726 gene locus_tag LOCUS_09360 1165025 1164726 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533548.1 protein_id gnl|my_center|LOCUS_09360 1165349 1165140 gene locus_tag LOCUS_09370 1165349 1165140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1165661 1165398 gene locus_tag LOCUS_09380 1165661 1165398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1166192 1166737 gene locus_tag LOCUS_09390 1166192 1166737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1168024 1166750 gene locus_tag LOCUS_09400 1168024 1166750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1169992 1168082 gene locus_tag LOCUS_09410 1169992 1168082 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_09410 1170777 1170046 gene locus_tag LOCUS_09420 1170777 1170046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_09420 1171881 1170853 gene locus_tag LOCUS_09430 1171881 1170853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_09430 1172133 1172579 gene locus_tag LOCUS_09440 1172133 1172579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1172673 1173095 gene locus_tag LOCUS_09450 1172673 1173095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1173241 1174323 gene locus_tag LOCUS_09460 1173241 1174323 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840501.1 protein_id gnl|my_center|LOCUS_09460 1174415 1176865 gene locus_tag LOCUS_09470 1174415 1176865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1177017 1177703 gene locus_tag LOCUS_09480 1177017 1177703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1178283 1177681 gene locus_tag LOCUS_09490 1178283 1177681 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_09490 1180543 1178312 gene locus_tag LOCUS_09500 1180543 1178312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1180824 1183601 gene locus_tag LOCUS_09510 1180824 1183601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1184060 1183686 gene locus_tag LOCUS_09520 1184060 1183686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1184829 1184161 gene locus_tag LOCUS_09530 1184829 1184161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1185144 1184977 gene locus_tag LOCUS_09540 1185144 1184977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1185638 1185192 gene locus_tag LOCUS_09550 1185638 1185192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1185739 1187073 gene locus_tag LOCUS_09560 1185739 1187073 CDS product ISL3-like element ISEc53 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343765.1 protein_id gnl|my_center|LOCUS_09560 1187310 1187237 gene locus_tag LOCUS_t00140 1187310 1187237 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1188005 1189207 gene locus_tag LOCUS_09570 1188005 1189207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1190523 1191437 gene locus_tag LOCUS_09580 1190523 1191437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1191509 1192939 gene locus_tag LOCUS_09590 gene nuoF 1191509 1192939 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838122.1 protein_id gnl|my_center|LOCUS_09590 1192936 1194519 gene locus_tag LOCUS_09600 1192936 1194519 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_09600 1194616 1195647 gene locus_tag LOCUS_09610 1194616 1195647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1195719 1196783 gene locus_tag LOCUS_09620 1195719 1196783 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09620 1196802 1196954 gene locus_tag LOCUS_09630 1196802 1196954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1197405 1196974 gene locus_tag LOCUS_09640 1197405 1196974 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123285.1 protein_id gnl|my_center|LOCUS_09640 1197620 1198402 gene locus_tag LOCUS_09650 1197620 1198402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1199303 1198608 gene locus_tag LOCUS_09660 1199303 1198608 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_09660 1201119 1199491 gene locus_tag LOCUS_09670 gene purH 1201119 1199491 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122619.1 protein_id gnl|my_center|LOCUS_09670 1201180 1201590 gene locus_tag LOCUS_09680 1201180 1201590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1203198 1201660 gene locus_tag LOCUS_09690 1203198 1201660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1203351 1204478 gene locus_tag LOCUS_09700 1203351 1204478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1204731 1204462 gene locus_tag LOCUS_09710 1204731 1204462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1204819 1205922 gene locus_tag LOCUS_09720 1204819 1205922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1207957 1205954 gene locus_tag LOCUS_09730 1207957 1205954 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940066.1 protein_id gnl|my_center|LOCUS_09730 1208339 1209346 gene locus_tag LOCUS_09740 1208339 1209346 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563288.1 protein_id gnl|my_center|LOCUS_09740 1209410 1210378 gene locus_tag LOCUS_09750 1209410 1210378 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_09750 1211107 1210490 gene locus_tag LOCUS_09760 1211107 1210490 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086430.1 protein_id gnl|my_center|LOCUS_09760 1211430 1211741 gene locus_tag LOCUS_09770 1211430 1211741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 1211738 1212646 gene locus_tag LOCUS_09780 1211738 1212646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 1212943 1214592 gene locus_tag LOCUS_09790 1212943 1214592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1215162 1217837 gene locus_tag LOCUS_09800 1215162 1217837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1218178 1219872 gene locus_tag LOCUS_09810 gene cysS 1218178 1219872 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701980.1 protein_id gnl|my_center|LOCUS_09810 1219950 1221236 gene locus_tag LOCUS_09820 1219950 1221236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1221314 1221757 gene locus_tag LOCUS_09830 1221314 1221757 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 protein_id gnl|my_center|LOCUS_09830 1221786 1222097 gene locus_tag LOCUS_09840 1221786 1222097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1222152 1222454 gene locus_tag LOCUS_09850 1222152 1222454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1223821 1222463 gene locus_tag LOCUS_09860 1223821 1222463 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_09860 1224847 1223960 gene locus_tag LOCUS_09870 gene lpxC 1224847 1223960 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_09870 1225896 1224892 gene locus_tag LOCUS_09880 gene lpxD 1225896 1224892 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963712.1 protein_id gnl|my_center|LOCUS_09880 1226673 1226005 gene locus_tag LOCUS_09890 1226673 1226005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1228395 1227106 gene locus_tag LOCUS_09900 1228395 1227106 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337397.1 protein_id gnl|my_center|LOCUS_09900 1230951 1228510 gene locus_tag LOCUS_09910 1230951 1228510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1231188 1231706 gene locus_tag LOCUS_09920 gene rnhA 1231188 1231706 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968914.1 protein_id gnl|my_center|LOCUS_09920 1232389 1231736 gene locus_tag LOCUS_09930 gene nusG 1232389 1231736 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583728.1 protein_id gnl|my_center|LOCUS_09930 1233446 1232619 gene locus_tag LOCUS_09940 1233446 1232619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1233408 1233334 gene locus_tag LOCUS_t00150 1233408 1233334 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1234085 1233534 gene locus_tag LOCUS_09950 1234085 1233534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1235351 1234149 gene locus_tag LOCUS_09960 gene tuf 1235351 1234149 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_09960 1235710 1235637 gene locus_tag LOCUS_t00160 1235710 1235637 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1236052 1236528 gene locus_tag LOCUS_09970 1236052 1236528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1236996 1237643 gene locus_tag LOCUS_09980 1236996 1237643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1237640 1238281 gene locus_tag LOCUS_09990 1237640 1238281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1238938 1238378 gene locus_tag LOCUS_10000 1238938 1238378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1239687 1238950 gene locus_tag LOCUS_10010 1239687 1238950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1239736 1240047 gene locus_tag LOCUS_10020 1239736 1240047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10020 1240652 1240942 gene locus_tag LOCUS_10030 1240652 1240942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 1242705 1241752 gene locus_tag LOCUS_10040 1242705 1241752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1243315 1242842 gene locus_tag LOCUS_10050 1243315 1242842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1244248 1243601 gene locus_tag LOCUS_10060 1244248 1243601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1244774 1244412 gene locus_tag LOCUS_10070 1244774 1244412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1245249 1244890 gene locus_tag LOCUS_10080 1245249 1244890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1245455 1247698 gene locus_tag LOCUS_10090 1245455 1247698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1247907 1249910 gene locus_tag LOCUS_10100 1247907 1249910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1251429 1249999 gene locus_tag LOCUS_10110 1251429 1249999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1252223 1251501 gene locus_tag LOCUS_10120 1252223 1251501 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_10120 1253101 1254414 gene locus_tag LOCUS_10130 1253101 1254414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1254542 1256563 gene locus_tag LOCUS_10140 1254542 1256563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_10140 1256699 1256992 gene locus_tag LOCUS_10150 1256699 1256992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1257304 1258740 gene locus_tag LOCUS_10160 gene glmM 1257304 1258740 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_10160 1258795 1259049 gene locus_tag LOCUS_10170 1258795 1259049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1259478 1259065 gene locus_tag LOCUS_10180 1259478 1259065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1259747 1259547 gene locus_tag LOCUS_10190 1259747 1259547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1259995 1260447 gene locus_tag LOCUS_10200 1259995 1260447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1260655 1261092 gene locus_tag LOCUS_10210 1260655 1261092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1261089 1261955 gene locus_tag LOCUS_10220 1261089 1261955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1263660 1261969 gene locus_tag LOCUS_10230 gene dnaB 1263660 1261969 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_10230 1264915 1263809 gene locus_tag LOCUS_10240 1264915 1263809 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_10240 1265154 1265723 gene locus_tag LOCUS_10250 1265154 1265723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1266902 1265748 gene locus_tag LOCUS_10260 gene rbsC 1266902 1265748 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_10260 1267610 1266987 gene locus_tag LOCUS_10270 1267610 1266987 CDS product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242455.1 protein_id gnl|my_center|LOCUS_10270 1267697 1268710 gene locus_tag LOCUS_10280 1267697 1268710 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379429.1 protein_id gnl|my_center|LOCUS_10280 1268911 1269762 gene locus_tag LOCUS_10290 1268911 1269762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1270174 1271259 gene locus_tag LOCUS_10300 1270174 1271259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1271285 1271908 gene locus_tag LOCUS_10310 1271285 1271908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1271901 1272383 gene locus_tag LOCUS_10320 1271901 1272383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1272613 1273716 gene locus_tag LOCUS_10330 gene ychF 1272613 1273716 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 protein_id gnl|my_center|LOCUS_10330 1274153 1275211 gene locus_tag LOCUS_10340 1274153 1275211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1275208 1276302 gene locus_tag LOCUS_10350 1275208 1276302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1276302 1277147 gene locus_tag LOCUS_10360 1276302 1277147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1277534 1278595 gene locus_tag LOCUS_10370 1277534 1278595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1278691 1279596 gene locus_tag LOCUS_10380 1278691 1279596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_10380 1279593 1280432 gene locus_tag LOCUS_10390 1279593 1280432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1280446 1280853 gene locus_tag LOCUS_10400 1280446 1280853 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_10400 1281339 1280860 gene locus_tag LOCUS_10410 1281339 1280860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1281528 1283408 gene locus_tag LOCUS_10420 1281528 1283408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1283857 1283486 gene locus_tag LOCUS_10430 1283857 1283486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1284087 1283854 gene locus_tag LOCUS_10440 1284087 1283854 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_10440 1284266 1284904 gene locus_tag LOCUS_10450 1284266 1284904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1285085 1285870 gene locus_tag LOCUS_10460 1285085 1285870 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_10460 1286148 1286549 gene locus_tag LOCUS_10470 1286148 1286549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1286553 1289852 gene locus_tag LOCUS_10480 1286553 1289852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1289977 1291836 gene locus_tag LOCUS_10490 gene polX 1289977 1291836 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880919.1 protein_id gnl|my_center|LOCUS_10490 1292178 1292987 gene locus_tag LOCUS_10500 1292178 1292987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1293253 1296090 gene locus_tag LOCUS_10510 1293253 1296090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1296100 1297809 gene locus_tag LOCUS_10520 gene gspE 1296100 1297809 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_10520 1297824 1299641 gene locus_tag LOCUS_10530 1297824 1299641 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_10530 1301863 1299656 gene locus_tag LOCUS_10540 1301863 1299656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1305460 1302062 gene locus_tag LOCUS_10550 1305460 1302062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1306004 1307164 gene locus_tag LOCUS_10560 1306004 1307164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1307409 1308830 gene locus_tag LOCUS_10570 1307409 1308830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1309799 1308843 gene locus_tag LOCUS_10580 1309799 1308843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1309940 1310923 gene locus_tag LOCUS_10590 1309940 1310923 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403630.1 protein_id gnl|my_center|LOCUS_10590 1310949 1312571 gene locus_tag LOCUS_10600 1310949 1312571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1313017 1312583 gene locus_tag LOCUS_10610 1313017 1312583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1313233 1315113 gene locus_tag LOCUS_10620 gene argS 1313233 1315113 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_10620 1315113 1316540 gene locus_tag LOCUS_10630 1315113 1316540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1317002 1316610 gene locus_tag LOCUS_10640 1317002 1316610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1317005 1317463 gene locus_tag LOCUS_10650 1317005 1317463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1317573 1318511 gene locus_tag LOCUS_10660 1317573 1318511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840171.1 protein_id gnl|my_center|LOCUS_10660 1318675 1320432 gene locus_tag LOCUS_10670 1318675 1320432 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_10670 1320497 1322596 gene locus_tag LOCUS_10680 1320497 1322596 CDS product transferrin receptor-like dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928760.1 protein_id gnl|my_center|LOCUS_10680 1323102 1322707 gene locus_tag LOCUS_10690 1323102 1322707 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_10690 1323990 1323271 gene locus_tag LOCUS_10700 1323990 1323271 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389774.1 protein_id gnl|my_center|LOCUS_10700 1325523 1324159 gene locus_tag LOCUS_10710 1325523 1324159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1325529 1325903 gene locus_tag LOCUS_10720 1325529 1325903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1325900 1328002 gene locus_tag LOCUS_10730 1325900 1328002 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113078.1 protein_id gnl|my_center|LOCUS_10730 1328117 1329151 gene locus_tag LOCUS_10740 gene hflC 1328117 1329151 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_10740 1329148 1330596 gene locus_tag LOCUS_10750 1329148 1330596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1330658 1331905 gene locus_tag LOCUS_10760 1330658 1331905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1331902 1333815 gene locus_tag LOCUS_10770 1331902 1333815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1335286 1333826 gene locus_tag LOCUS_10780 1335286 1333826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1338489 1335301 gene locus_tag LOCUS_10790 1338489 1335301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1339258 1338551 gene locus_tag LOCUS_10800 1339258 1338551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1339465 1339764 gene locus_tag LOCUS_10810 1339465 1339764 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_10810 1339952 1340599 gene locus_tag LOCUS_10820 1339952 1340599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1340638 1341240 gene locus_tag LOCUS_10830 1340638 1341240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1341266 1342885 gene locus_tag LOCUS_10840 1341266 1342885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1343003 1343446 gene locus_tag LOCUS_10850 1343003 1343446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1343501 1345225 gene locus_tag LOCUS_10860 1343501 1345225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1345454 1346686 gene locus_tag LOCUS_10870 1345454 1346686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1347221 1346694 gene locus_tag LOCUS_10880 1347221 1346694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1347820 1347218 gene locus_tag LOCUS_10890 1347820 1347218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1349069 1347954 gene locus_tag LOCUS_10900 1349069 1347954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1349243 1350058 gene locus_tag LOCUS_10910 gene rfbF 1349243 1350058 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648783.1 protein_id gnl|my_center|LOCUS_10910 1350065 1351144 gene locus_tag LOCUS_10920 gene rfbG 1350065 1351144 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_10920 1351304 1353004 gene locus_tag LOCUS_10930 1351304 1353004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1354549 1353026 gene locus_tag LOCUS_10940 1354549 1353026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1355776 1354640 gene locus_tag LOCUS_10950 1355776 1354640 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_10950 1356866 1355889 gene locus_tag LOCUS_10960 1356866 1355889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1357764 1356943 gene locus_tag LOCUS_10970 gene rsmA 1357764 1356943 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819709.1 protein_id gnl|my_center|LOCUS_10970 1358707 1357811 gene locus_tag LOCUS_10980 1358707 1357811 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277403.1 protein_id gnl|my_center|LOCUS_10980 1360259 1358745 gene locus_tag LOCUS_10990 1360259 1358745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1360997 1360452 gene locus_tag LOCUS_11000 1360997 1360452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1362364 1361219 gene locus_tag LOCUS_11010 1362364 1361219 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052550.1 protein_id gnl|my_center|LOCUS_11010 1363548 1362361 gene locus_tag LOCUS_11020 1363548 1362361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1364396 1363623 gene locus_tag LOCUS_11030 1364396 1363623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_11030 1365683 1364445 gene locus_tag LOCUS_11040 1365683 1364445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1366693 1365680 gene locus_tag LOCUS_11050 1366693 1365680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1368086 1366755 gene locus_tag LOCUS_11060 1368086 1366755 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_11060 1369332 1368841 gene locus_tag LOCUS_11070 1369332 1368841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1370625 1369333 gene locus_tag LOCUS_11080 1370625 1369333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1371210 1372259 gene locus_tag LOCUS_11090 1371210 1372259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1372530 1375406 gene locus_tag LOCUS_11100 1372530 1375406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1375667 1376755 gene locus_tag LOCUS_11110 gene pdxA 1375667 1376755 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_11110 1377044 1379107 gene locus_tag LOCUS_11120 1377044 1379107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1379331 1379017 gene locus_tag LOCUS_11130 1379331 1379017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1380492 1379380 gene locus_tag LOCUS_11140 1380492 1379380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1382682 1380511 gene locus_tag LOCUS_11150 1382682 1380511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1383180 1385576 gene locus_tag LOCUS_11160 1383180 1385576 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_11160 1386893 1385739 gene locus_tag LOCUS_11170 1386893 1385739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1387117 1388223 gene locus_tag LOCUS_11180 1387117 1388223 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839930.1 protein_id gnl|my_center|LOCUS_11180 1388333 1388983 gene locus_tag LOCUS_11190 1388333 1388983 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_11190 1389015 1389090 gene locus_tag LOCUS_t00170 1389015 1389090 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1389257 1389598 gene locus_tag LOCUS_11200 1389257 1389598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1389774 1390772 gene locus_tag LOCUS_11210 1389774 1390772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814201.1 protein_id gnl|my_center|LOCUS_11210 1392359 1391262 gene locus_tag LOCUS_11220 1392359 1391262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1393411 1392356 gene locus_tag LOCUS_11230 1393411 1392356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1395949 1394423 gene locus_tag LOCUS_11240 1395949 1394423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1397863 1396328 gene locus_tag LOCUS_11250 1397863 1396328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1397971 1398600 gene locus_tag LOCUS_11260 gene recR 1397971 1398600 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_11260 1398676 1400307 gene locus_tag LOCUS_11270 gene rpoN 1398676 1400307 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_11270 1401176 1400403 gene locus_tag LOCUS_11280 1401176 1400403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1402543 1401173 gene locus_tag LOCUS_11290 1402543 1401173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1404847 1403111 gene locus_tag LOCUS_11300 1404847 1403111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1407134 1405185 gene locus_tag LOCUS_11310 gene typA 1407134 1405185 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790221.1 protein_id gnl|my_center|LOCUS_11310 1407455 1408228 gene locus_tag LOCUS_11320 1407455 1408228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1408968 1408273 gene locus_tag LOCUS_11330 1408968 1408273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1408961 1410337 gene locus_tag LOCUS_11340 1408961 1410337 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_11340 1410493 1411206 gene locus_tag LOCUS_11350 1410493 1411206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_11350 1412582 1411242 gene locus_tag LOCUS_11360 1412582 1411242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1413352 1412759 gene locus_tag LOCUS_11370 1413352 1412759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1414383 1413331 gene locus_tag LOCUS_11380 gene gluQRS 1414383 1413331 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922628.1 protein_id gnl|my_center|LOCUS_11380 1414446 1414793 gene locus_tag LOCUS_11390 1414446 1414793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1415286 1414807 gene locus_tag LOCUS_11400 1415286 1414807 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437081.1 protein_id gnl|my_center|LOCUS_11400 1415790 1415371 gene locus_tag LOCUS_11410 1415790 1415371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1416065 1415787 gene locus_tag LOCUS_11420 1416065 1415787 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404442.1 protein_id gnl|my_center|LOCUS_11420 1416546 1416058 gene locus_tag LOCUS_11430 1416546 1416058 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_11430 1418108 1416543 gene locus_tag LOCUS_11440 1418108 1416543 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_11440 1418452 1418105 gene locus_tag LOCUS_11450 1418452 1418105 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_11450 1418880 1418452 gene locus_tag LOCUS_11460 1418880 1418452 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_11460 1421189 1418877 gene locus_tag LOCUS_11470 1421189 1418877 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_11470 1422074 1421373 gene locus_tag LOCUS_11480 1422074 1421373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1424500 1422365 gene locus_tag LOCUS_11490 1424500 1422365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1425279 1427120 gene locus_tag LOCUS_11500 gene glmS 1425279 1427120 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_11500 1427257 1427658 gene locus_tag LOCUS_11510 1427257 1427658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1427740 1430046 gene locus_tag LOCUS_11520 1427740 1430046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1430635 1430054 gene locus_tag LOCUS_11530 1430635 1430054 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870448.1 protein_id gnl|my_center|LOCUS_11530 1432029 1430644 gene locus_tag LOCUS_11540 1432029 1430644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1433051 1432134 gene locus_tag LOCUS_11550 1433051 1432134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1433267 1435027 gene locus_tag LOCUS_11560 1433267 1435027 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_11560 1436014 1435196 gene locus_tag LOCUS_11570 1436014 1435196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1436312 1438483 gene locus_tag LOCUS_11580 1436312 1438483 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_11580 1439421 1438513 gene locus_tag LOCUS_11590 1439421 1438513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11590 1439729 1439418 gene locus_tag LOCUS_11600 1439729 1439418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11600 1440145 1440708 gene locus_tag LOCUS_11610 1440145 1440708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1440709 1441662 gene locus_tag LOCUS_11620 1440709 1441662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1442094 1442690 gene locus_tag LOCUS_11630 1442094 1442690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1442850 1443161 gene locus_tag LOCUS_11640 1442850 1443161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11640 1443158 1443523 gene locus_tag LOCUS_11650 1443158 1443523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11650 1443566 1443877 gene locus_tag LOCUS_11660 1443566 1443877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 1443874 1444782 gene locus_tag LOCUS_11670 1443874 1444782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 1444831 1445394 gene locus_tag LOCUS_11680 1444831 1445394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1445502 1446260 gene locus_tag LOCUS_11690 1445502 1446260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1446526 1447869 gene locus_tag LOCUS_11700 1446526 1447869 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615609.1 protein_id gnl|my_center|LOCUS_11700 1447869 1449245 gene locus_tag LOCUS_11710 1447869 1449245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1450627 1449338 gene locus_tag LOCUS_11720 1450627 1449338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1451120 1450710 gene locus_tag LOCUS_11730 1451120 1450710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1451947 1451126 gene locus_tag LOCUS_11740 1451947 1451126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1452358 1454040 gene locus_tag LOCUS_11750 1452358 1454040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1454243 1454704 gene locus_tag LOCUS_11760 1454243 1454704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1455022 1455804 gene locus_tag LOCUS_11770 1455022 1455804 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_11770 1455829 1456662 gene locus_tag LOCUS_11780 1455829 1456662 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_11780 1459523 1456677 gene locus_tag LOCUS_11790 1459523 1456677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1459873 1462233 gene locus_tag LOCUS_11800 1459873 1462233 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269243.1 protein_id gnl|my_center|LOCUS_11800 1462403 1462230 gene locus_tag LOCUS_11810 1462403 1462230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1462387 1462845 gene locus_tag LOCUS_11820 1462387 1462845 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_11820 1464044 1462878 gene locus_tag LOCUS_11830 1464044 1462878 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810063.1 protein_id gnl|my_center|LOCUS_11830 1465786 1464116 gene locus_tag LOCUS_11840 1465786 1464116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1466376 1467446 gene locus_tag LOCUS_11850 1466376 1467446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1468332 1467502 gene locus_tag LOCUS_11860 gene pyrF 1468332 1467502 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052226.1 protein_id gnl|my_center|LOCUS_11860 1468592 1469176 gene locus_tag LOCUS_11870 1468592 1469176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1469166 1469543 gene locus_tag LOCUS_11880 1469166 1469543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1469550 1469969 gene locus_tag LOCUS_11890 1469550 1469969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1470034 1470387 gene locus_tag LOCUS_11900 1470034 1470387 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328553.1 protein_id gnl|my_center|LOCUS_11900 1470399 1472534 gene locus_tag LOCUS_11910 gene recG 1470399 1472534 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_11910 1473753 1472560 gene locus_tag LOCUS_11920 gene aroC 1473753 1472560 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_11920 1473752 1475560 gene locus_tag LOCUS_11930 1473752 1475560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1475780 1477432 gene locus_tag LOCUS_11940 1475780 1477432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1477429 1479207 gene locus_tag LOCUS_11950 1477429 1479207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1479498 1479872 gene locus_tag LOCUS_11960 1479498 1479872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1480122 1479883 gene locus_tag LOCUS_11970 1480122 1479883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1480422 1481474 gene locus_tag LOCUS_11980 1480422 1481474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1481579 1483021 gene locus_tag LOCUS_11990 gene icd 1481579 1483021 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_11990 1483031 1483378 gene locus_tag LOCUS_12000 1483031 1483378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1483447 1484904 gene locus_tag LOCUS_12010 1483447 1484904 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_12010 1484894 1485328 gene locus_tag LOCUS_12020 1484894 1485328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1485424 1486428 gene locus_tag LOCUS_12030 1485424 1486428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1487682 1486822 gene locus_tag LOCUS_12040 1487682 1486822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1488436 1488630 gene locus_tag LOCUS_12050 1488436 1488630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1488897 1490051 gene locus_tag LOCUS_12060 1488897 1490051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1490290 1491078 gene locus_tag LOCUS_12070 1490290 1491078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1491322 1492110 gene locus_tag LOCUS_12080 1491322 1492110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1493319 1492222 gene locus_tag LOCUS_12090 1493319 1492222 CDS product DUF4236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097975.1 protein_id gnl|my_center|LOCUS_12090 1494377 1493604 gene locus_tag LOCUS_12100 1494377 1493604 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872115.1 protein_id gnl|my_center|LOCUS_12100 1495282 1494461 gene locus_tag LOCUS_12110 gene lpxA 1495282 1494461 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_12110 1497182 1495341 gene locus_tag LOCUS_12120 gene sulP 1497182 1495341 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_12120 1497494 1501093 gene locus_tag LOCUS_12130 gene carB 1497494 1501093 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_12130 1502113 1501121 gene locus_tag LOCUS_12140 1502113 1501121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1502876 1502136 gene locus_tag LOCUS_12150 1502876 1502136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1503036 1505033 gene locus_tag LOCUS_12160 gene lepA 1503036 1505033 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142757.1 protein_id gnl|my_center|LOCUS_12160 1506405 1505275 gene locus_tag LOCUS_12170 1506405 1505275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1507490 1506402 gene locus_tag LOCUS_12180 1507490 1506402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_12180 1507606 1509417 gene locus_tag LOCUS_12190 1507606 1509417 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_12190 1510320 1510958 gene locus_tag LOCUS_12200 1510320 1510958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1511289 1512377 gene locus_tag LOCUS_12210 1511289 1512377 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128929876.1 protein_id gnl|my_center|LOCUS_12210 1513145 1514809 gene locus_tag LOCUS_12220 1513145 1514809 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727527.1 protein_id gnl|my_center|LOCUS_12220 1515139 1515771 gene locus_tag LOCUS_12230 1515139 1515771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1516782 1515922 gene locus_tag LOCUS_12240 1516782 1515922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1517101 1518024 gene locus_tag LOCUS_12250 1517101 1518024 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_12250 1518357 1519910 gene locus_tag LOCUS_12260 1518357 1519910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1519971 1520948 gene locus_tag LOCUS_12270 gene trxB 1519971 1520948 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940581.1 protein_id gnl|my_center|LOCUS_12270 1521167 1523368 gene locus_tag LOCUS_12280 gene thrS 1521167 1523368 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329329.1 protein_id gnl|my_center|LOCUS_12280 1525294 1523531 gene locus_tag LOCUS_12290 gene ggt 1525294 1523531 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_12290 1525439 1526590 gene locus_tag LOCUS_12300 1525439 1526590 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_12300 1527103 1526603 gene locus_tag LOCUS_12310 1527103 1526603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1527090 1528271 gene locus_tag LOCUS_12320 1527090 1528271 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_12320 1528408 1529829 gene locus_tag LOCUS_12330 1528408 1529829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1529893 1530378 gene locus_tag LOCUS_12340 1529893 1530378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1530458 1530658 gene locus_tag LOCUS_12350 1530458 1530658 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990237.1 protein_id gnl|my_center|LOCUS_12350 1533263 1530663 gene locus_tag LOCUS_12360 1533263 1530663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1533432 1534697 gene locus_tag LOCUS_12370 1533432 1534697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1535980 1534712 gene locus_tag LOCUS_12380 1535980 1534712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1536922 1536029 gene locus_tag LOCUS_12390 1536922 1536029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1537668 1536919 gene locus_tag LOCUS_12400 1537668 1536919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1539292 1537748 gene locus_tag LOCUS_12410 1539292 1537748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1540491 1539289 gene locus_tag LOCUS_12420 1540491 1539289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1541270 1540488 gene locus_tag LOCUS_12430 1541270 1540488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1541913 1541353 gene locus_tag LOCUS_12440 1541913 1541353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1541960 1542127 gene locus_tag LOCUS_12450 1541960 1542127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1542183 1542698 gene locus_tag LOCUS_12460 1542183 1542698 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940002.1 protein_id gnl|my_center|LOCUS_12460 1543966 1542731 gene locus_tag LOCUS_12470 1543966 1542731 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_12470 1544477 1546027 gene locus_tag LOCUS_12480 1544477 1546027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1546114 1546782 gene locus_tag LOCUS_12490 1546114 1546782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1546779 1547924 gene locus_tag LOCUS_12500 1546779 1547924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1548126 1548884 gene locus_tag LOCUS_12510 gene phoU 1548126 1548884 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922357.1 protein_id gnl|my_center|LOCUS_12510 1549090 1549959 gene locus_tag LOCUS_12520 1549090 1549959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1549959 1550384 gene locus_tag LOCUS_12530 1549959 1550384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1551510 1550398 gene locus_tag LOCUS_12540 1551510 1550398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1553195 1551507 gene locus_tag LOCUS_12550 1553195 1551507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1553449 1554558 gene locus_tag LOCUS_12560 1553449 1554558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1554644 1556329 gene locus_tag LOCUS_12570 1554644 1556329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1556420 1557394 gene locus_tag LOCUS_12580 1556420 1557394 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_12580 1557415 1558668 gene locus_tag LOCUS_12590 1557415 1558668 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_12590 1558729 1559043 gene locus_tag LOCUS_12600 1558729 1559043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1560278 1559091 gene locus_tag LOCUS_12610 1560278 1559091 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_12610 1560507 1562117 gene locus_tag LOCUS_12620 1560507 1562117 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_12620 1562114 1563055 gene locus_tag LOCUS_12630 1562114 1563055 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_12630 1563511 1563437 gene locus_tag LOCUS_t00180 1563511 1563437 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1564712 1563750 gene locus_tag LOCUS_12640 1564712 1563750 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_12640 1564772 1565479 gene locus_tag LOCUS_12650 1564772 1565479 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_12650 1565626 1566372 gene locus_tag LOCUS_12660 1565626 1566372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1566696 1566478 gene locus_tag LOCUS_12670 1566696 1566478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1566581 1566967 gene locus_tag LOCUS_12680 1566581 1566967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1567160 1568491 gene locus_tag LOCUS_12690 gene clpX 1567160 1568491 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_12690 1568527 1568826 gene locus_tag LOCUS_12700 1568527 1568826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000236.1 protein_id gnl|my_center|LOCUS_12700 1570628 1569030 gene locus_tag LOCUS_12710 1570628 1569030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1572253 1570625 gene locus_tag LOCUS_12720 1572253 1570625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1573524 1572289 gene locus_tag LOCUS_12730 gene aroB 1573524 1572289 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337780.1 protein_id gnl|my_center|LOCUS_12730 1573976 1573521 gene locus_tag LOCUS_12740 gene rsfS 1573976 1573521 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926804.1 protein_id gnl|my_center|LOCUS_12740 1577001 1575982 gene locus_tag LOCUS_12750 1577001 1575982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1578041 1577601 gene locus_tag LOCUS_12760 1578041 1577601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1580499 1579372 gene locus_tag LOCUS_12770 1580499 1579372 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203205.1 protein_id gnl|my_center|LOCUS_12770 1580739 1581770 gene locus_tag LOCUS_12780 1580739 1581770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919009.1 protein_id gnl|my_center|LOCUS_12780 1581767 1582621 gene locus_tag LOCUS_12790 1581767 1582621 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_12790 1582718 1583602 gene locus_tag LOCUS_12800 gene atpG 1582718 1583602 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_12800 1583648 1584415 gene locus_tag LOCUS_12810 gene lptB 1583648 1584415 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_12810 1584425 1585297 gene locus_tag LOCUS_12820 1584425 1585297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1585915 1585367 gene locus_tag LOCUS_12830 1585915 1585367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1586102 1587820 gene locus_tag LOCUS_12840 1586102 1587820 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_12840 1587934 1588932 gene locus_tag LOCUS_12850 1587934 1588932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1588984 1589439 gene locus_tag LOCUS_12860 1588984 1589439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1590539 1589655 gene locus_tag LOCUS_12870 1590539 1589655 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_12870 1591333 1590725 gene locus_tag LOCUS_12880 1591333 1590725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1591454 1593244 gene locus_tag LOCUS_12890 gene ptsP 1591454 1593244 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_12890 1594846 1593281 gene locus_tag LOCUS_12900 1594846 1593281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1597351 1594925 gene locus_tag LOCUS_12910 1597351 1594925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1597350 1597649 gene locus_tag LOCUS_12920 1597350 1597649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1597723 1599717 gene locus_tag LOCUS_12930 1597723 1599717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1599781 1600701 gene locus_tag LOCUS_12940 1599781 1600701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1602797 1600713 gene locus_tag LOCUS_12950 1602797 1600713 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_12950 1604132 1604416 gene locus_tag LOCUS_12960 1604132 1604416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1604984 1605733 gene locus_tag LOCUS_12970 1604984 1605733 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976054.1 protein_id gnl|my_center|LOCUS_12970 1605743 1606927 gene locus_tag LOCUS_12980 1605743 1606927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1608726 1607047 gene locus_tag LOCUS_12990 gene miaB 1608726 1607047 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_12990 1608849 1610495 gene locus_tag LOCUS_13000 1608849 1610495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1611009 1610512 gene locus_tag LOCUS_13010 1611009 1610512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1612918 1611056 gene locus_tag LOCUS_13020 1612918 1611056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1613030 1614064 gene locus_tag LOCUS_13030 1613030 1614064 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_13030 1614128 1615195 gene locus_tag LOCUS_13040 1614128 1615195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1616318 1615215 gene locus_tag LOCUS_13050 1616318 1615215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1616430 1617212 gene locus_tag LOCUS_13060 1616430 1617212 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152386036.1 protein_id gnl|my_center|LOCUS_13060 1617504 1617334 gene locus_tag LOCUS_13070 1617504 1617334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1621267 1617746 gene locus_tag LOCUS_13080 1621267 1617746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1621158 1621457 gene locus_tag LOCUS_13090 1621158 1621457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1622015 1621686 gene locus_tag LOCUS_13100 1622015 1621686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1622389 1623537 gene locus_tag LOCUS_13110 1622389 1623537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1623676 1624206 gene locus_tag LOCUS_13120 1623676 1624206 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_13120 1625532 1624273 gene locus_tag LOCUS_13130 1625532 1624273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1627410 1625548 gene locus_tag LOCUS_13140 1627410 1625548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1628424 1627579 gene locus_tag LOCUS_13150 1628424 1627579 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_13150 1629684 1628485 gene locus_tag LOCUS_13160 1629684 1628485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1629728 1630933 gene locus_tag LOCUS_13170 1629728 1630933 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526598.1 protein_id gnl|my_center|LOCUS_13170 1631044 1631673 gene locus_tag LOCUS_13180 1631044 1631673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1631673 1634993 gene locus_tag LOCUS_13190 1631673 1634993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1635309 1635043 gene locus_tag LOCUS_13200 1635309 1635043 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_13200 1635881 1635339 gene locus_tag LOCUS_13210 1635881 1635339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1636864 1636151 gene locus_tag LOCUS_13220 1636864 1636151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1636827 1636997 gene locus_tag LOCUS_13230 1636827 1636997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1639176 1637047 gene locus_tag LOCUS_13240 1639176 1637047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1639590 1639661 gene locus_tag LOCUS_t00190 1639590 1639661 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1640300 1640683 gene locus_tag LOCUS_13250 1640300 1640683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1640680 1641954 gene locus_tag LOCUS_13260 1640680 1641954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1643548 1642130 gene locus_tag LOCUS_13270 1643548 1642130 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_13270 1645905 1643668 gene locus_tag LOCUS_13280 1645905 1643668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1646206 1648881 gene locus_tag LOCUS_13290 1646206 1648881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1649231 1648926 gene locus_tag LOCUS_13300 1649231 1648926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1649995 1649363 gene locus_tag LOCUS_13310 1649995 1649363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1649915 1650184 gene locus_tag LOCUS_13320 1649915 1650184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1650656 1651297 gene locus_tag LOCUS_13330 1650656 1651297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1653082 1652780 gene locus_tag LOCUS_13340 1653082 1652780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1654088 1655197 gene locus_tag LOCUS_13350 1654088 1655197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1655493 1655194 gene locus_tag LOCUS_13360 1655493 1655194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1656292 1655510 gene locus_tag LOCUS_13370 1656292 1655510 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152386036.1 protein_id gnl|my_center|LOCUS_13370 1656699 1656412 gene locus_tag LOCUS_13380 1656699 1656412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1657721 1658542 gene locus_tag LOCUS_13390 1657721 1658542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1659797 1659015 gene locus_tag LOCUS_13400 1659797 1659015 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152386036.1 protein_id gnl|my_center|LOCUS_13400 1660687 1661151 gene locus_tag LOCUS_13410 1660687 1661151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1661360 1661998 gene locus_tag LOCUS_13420 1661360 1661998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1662013 1663905 gene locus_tag LOCUS_13430 1662013 1663905 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_13430 1664127 1663912 gene locus_tag LOCUS_13440 1664127 1663912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1664182 1666683 gene locus_tag LOCUS_13450 1664182 1666683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1666769 1667731 gene locus_tag LOCUS_13460 1666769 1667731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_13460 1667777 1668364 gene locus_tag LOCUS_13470 1667777 1668364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1669415 1668306 gene locus_tag LOCUS_13480 1669415 1668306 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875763.1 protein_id gnl|my_center|LOCUS_13480 1669747 1670331 gene locus_tag LOCUS_13490 1669747 1670331 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_13490 1670380 1671465 gene locus_tag LOCUS_13500 1670380 1671465 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_13500 1671520 1671987 gene locus_tag LOCUS_13510 1671520 1671987 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_13510 1672838 1672077 gene locus_tag LOCUS_13520 1672838 1672077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1674190 1672841 gene locus_tag LOCUS_13530 gene accC 1674190 1672841 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_13530 1674717 1674277 gene locus_tag LOCUS_13540 gene accB 1674717 1674277 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_13540 1676064 1674934 gene locus_tag LOCUS_13550 1676064 1674934 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391500.1 protein_id gnl|my_center|LOCUS_13550 1676163 1677758 gene locus_tag LOCUS_13560 1676163 1677758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1677843 1678943 gene locus_tag LOCUS_13570 1677843 1678943 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922368.1 protein_id gnl|my_center|LOCUS_13570 1678940 1681972 gene locus_tag LOCUS_13580 1678940 1681972 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922518.1 protein_id gnl|my_center|LOCUS_13580 1682038 1683114 gene locus_tag LOCUS_13590 1682038 1683114 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_13590 1683220 1683897 gene locus_tag LOCUS_13600 1683220 1683897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1683904 1684827 gene locus_tag LOCUS_13610 1683904 1684827 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_13610 1684853 1686952 gene locus_tag LOCUS_13620 1684853 1686952 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615739.1 protein_id gnl|my_center|LOCUS_13620 1687663 1687109 gene locus_tag LOCUS_13630 gene efp 1687663 1687109 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965394.1 protein_id gnl|my_center|LOCUS_13630 1687804 1688667 gene locus_tag LOCUS_13640 gene map 1687804 1688667 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_13640 1688703 1689494 gene locus_tag LOCUS_13650 gene trpA 1688703 1689494 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_13650 1689696 1691873 gene locus_tag LOCUS_13660 1689696 1691873 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480377.1 protein_id gnl|my_center|LOCUS_13660 1692020 1692093 gene locus_tag LOCUS_t00200 1692020 1692093 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1692764 1692291 gene locus_tag LOCUS_13670 gene greA 1692764 1692291 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262548.1 protein_id gnl|my_center|LOCUS_13670 1693766 1693149 gene locus_tag LOCUS_13680 1693766 1693149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1693998 1696154 gene locus_tag LOCUS_13690 1693998 1696154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1697099 1696596 gene locus_tag LOCUS_13700 1697099 1696596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1698583 1697138 gene locus_tag LOCUS_13710 1698583 1697138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1701207 1698649 gene locus_tag LOCUS_13720 1701207 1698649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1702342 1701419 gene locus_tag LOCUS_13730 1702342 1701419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1703121 1702405 gene locus_tag LOCUS_13740 1703121 1702405 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_13740 1703893 1703213 gene locus_tag LOCUS_13750 1703893 1703213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1704978 1703890 gene locus_tag LOCUS_13760 1704978 1703890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1705026 1706528 gene locus_tag LOCUS_13770 1705026 1706528 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_13770 1708086 1706563 gene locus_tag LOCUS_13780 1708086 1706563 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_13780 1708862 1708128 gene locus_tag LOCUS_13790 1708862 1708128 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444858.1 protein_id gnl|my_center|LOCUS_13790 1710020 1709259 gene locus_tag LOCUS_13800 1710020 1709259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1712016 1710685 gene locus_tag LOCUS_13810 1712016 1710685 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640098.1 protein_id gnl|my_center|LOCUS_13810 1712655 1712119 gene locus_tag LOCUS_13820 1712655 1712119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1713539 1712691 gene locus_tag LOCUS_13830 1713539 1712691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1713762 1715177 gene locus_tag LOCUS_13840 1713762 1715177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1715567 1718056 gene locus_tag LOCUS_13850 1715567 1718056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1719703 1718075 gene locus_tag LOCUS_13860 gene gatB 1719703 1718075 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_13860 1718905 1718989 gene locus_tag LOCUS_t00210 1718905 1718989 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1720480 1719725 gene locus_tag LOCUS_13870 1720480 1719725 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_13870 1721254 1720523 gene locus_tag LOCUS_13880 1721254 1720523 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_13880 1724396 1721289 gene locus_tag LOCUS_13890 gene purL 1724396 1721289 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_13890 1725711 1724464 gene locus_tag LOCUS_13900 1725711 1724464 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_13900 1727141 1725810 gene locus_tag LOCUS_13910 1727141 1725810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1728538 1727348 gene locus_tag LOCUS_13920 gene neuB 1728538 1727348 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066398080.1 protein_id gnl|my_center|LOCUS_13920 1729362 1728556 gene locus_tag LOCUS_13930 1729362 1728556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1732823 1729359 gene locus_tag LOCUS_13940 1732823 1729359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1732982 1733665 gene locus_tag LOCUS_13950 1732982 1733665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1734148 1733693 gene locus_tag LOCUS_13960 gene arfB 1734148 1733693 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_13960 1734229 1735443 gene locus_tag LOCUS_13970 1734229 1735443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1739725 1735454 gene locus_tag LOCUS_13980 1739725 1735454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1739961 1740464 gene locus_tag LOCUS_13990 1739961 1740464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1740586 1740431 gene locus_tag LOCUS_14000 1740586 1740431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1740601 1741728 gene locus_tag LOCUS_14010 1740601 1741728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762111.1 protein_id gnl|my_center|LOCUS_14010 1744540 1741907 gene locus_tag LOCUS_14020 1744540 1741907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1744999 1746786 gene locus_tag LOCUS_14030 1744999 1746786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1746835 1749495 gene locus_tag LOCUS_14040 1746835 1749495 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030755.1 protein_id gnl|my_center|LOCUS_14040 1750623 1749586 gene locus_tag LOCUS_14050 1750623 1749586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1751097 1751675 gene locus_tag LOCUS_14060 1751097 1751675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1751706 1753991 gene locus_tag LOCUS_14070 1751706 1753991 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530050.1 protein_id gnl|my_center|LOCUS_14070 1754023 1755207 gene locus_tag LOCUS_14080 gene neuC 1754023 1755207 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946490.1 protein_id gnl|my_center|LOCUS_14080 1755490 1755248 gene locus_tag LOCUS_14090 1755490 1755248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1756221 1755589 gene locus_tag LOCUS_14100 1756221 1755589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1757918 1756488 gene locus_tag LOCUS_14110 gene murD 1757918 1756488 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337238.1 protein_id gnl|my_center|LOCUS_14110 1760395 1758023 gene locus_tag LOCUS_14120 gene priA 1760395 1758023 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_14120 1760486 1761646 gene locus_tag LOCUS_14130 gene carA 1760486 1761646 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143532.1 protein_id gnl|my_center|LOCUS_14130 1761694 1762062 gene locus_tag LOCUS_14140 1761694 1762062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1762127 1762498 gene locus_tag LOCUS_14150 1762127 1762498 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_14150 1764498 1762513 gene locus_tag LOCUS_14160 1764498 1762513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1765566 1764553 gene locus_tag LOCUS_14170 1765566 1764553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1766344 1765559 gene locus_tag LOCUS_14180 1766344 1765559 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_14180 1766419 1767546 gene locus_tag LOCUS_14190 1766419 1767546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1768125 1767697 gene locus_tag LOCUS_14200 1768125 1767697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1768237 1771548 gene locus_tag LOCUS_14210 1768237 1771548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1771713 1772075 gene locus_tag LOCUS_14220 1771713 1772075 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884017.1 protein_id gnl|my_center|LOCUS_14220 1772131 1772580 gene locus_tag LOCUS_14230 1772131 1772580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1772932 1774182 gene locus_tag LOCUS_14240 1772932 1774182 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_14240 1774288 1774716 gene locus_tag LOCUS_14250 gene iscU 1774288 1774716 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654861.1 protein_id gnl|my_center|LOCUS_14250 1774826 1775197 gene locus_tag LOCUS_14260 1774826 1775197 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986038.1 protein_id gnl|my_center|LOCUS_14260 1775442 1775534 gene locus_tag LOCUS_t00220 1775442 1775534 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1775561 1777198 gene locus_tag LOCUS_14270 1775561 1777198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1777245 1777703 gene locus_tag LOCUS_14280 gene dtd 1777245 1777703 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_14280 1780666 1777712 gene locus_tag LOCUS_14290 1780666 1777712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1782431 1780953 gene locus_tag LOCUS_14300 1782431 1780953 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_14300 1782976 1783350 gene locus_tag LOCUS_14310 1782976 1783350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1783406 1784380 gene locus_tag LOCUS_14320 1783406 1784380 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_14320 1785508 1784387 gene locus_tag LOCUS_14330 1785508 1784387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1785592 1786479 gene locus_tag LOCUS_14340 1785592 1786479 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_14340 1786476 1787843 gene locus_tag LOCUS_14350 1786476 1787843 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_14350 1787892 1788875 gene locus_tag LOCUS_14360 1787892 1788875 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_14360 1791598 1789022 gene locus_tag LOCUS_14370 1791598 1789022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1792461 1792847 gene locus_tag LOCUS_14380 1792461 1792847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1794707 1792872 gene locus_tag LOCUS_14390 1794707 1792872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1795936 1795031 gene locus_tag LOCUS_14400 1795936 1795031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1797031 1796255 gene locus_tag LOCUS_14410 1797031 1796255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1800242 1797576 gene locus_tag LOCUS_14420 1800242 1797576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1802923 1800665 gene locus_tag LOCUS_14430 1802923 1800665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1804191 1803142 gene locus_tag LOCUS_14440 1804191 1803142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1807213 1804331 gene locus_tag LOCUS_14450 1807213 1804331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1809094 1807526 gene locus_tag LOCUS_14460 gene atpA 1809094 1807526 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334261.1 protein_id gnl|my_center|LOCUS_14460 1811680 1809335 gene locus_tag LOCUS_14470 1811680 1809335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1813455 1811728 gene locus_tag LOCUS_14480 1813455 1811728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1815368 1813596 gene locus_tag LOCUS_14490 1815368 1813596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1815985 1816374 gene locus_tag LOCUS_14500 1815985 1816374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1817106 1816453 gene locus_tag LOCUS_14510 gene upp 1817106 1816453 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_14510 1817094 1817666 gene locus_tag LOCUS_14520 1817094 1817666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1817740 1819806 gene locus_tag LOCUS_14530 gene acs 1817740 1819806 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_14530 1821976 1819832 gene locus_tag LOCUS_14540 gene ftsH 1821976 1819832 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_14540 1823467 1822328 gene locus_tag LOCUS_14550 1823467 1822328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1823731 1824645 gene locus_tag LOCUS_14560 1823731 1824645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1824792 1825805 gene locus_tag LOCUS_14570 1824792 1825805 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973390.1 protein_id gnl|my_center|LOCUS_14570 1826327 1825878 gene locus_tag LOCUS_14580 1826327 1825878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1827871 1826432 gene locus_tag LOCUS_14590 1827871 1826432 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_14590 1830509 1827960 gene locus_tag LOCUS_14600 1830509 1827960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1830780 1832354 gene locus_tag LOCUS_14610 1830780 1832354 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_14610 1832522 1832445 gene locus_tag LOCUS_t00230 1832522 1832445 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1833347 1834900 gene locus_tag LOCUS_14620 gene lpdA 1833347 1834900 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830912.1 protein_id gnl|my_center|LOCUS_14620 1835895 1835032 gene locus_tag LOCUS_14630 1835895 1835032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1836608 1835967 gene locus_tag LOCUS_14640 1836608 1835967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1837600 1836824 gene locus_tag LOCUS_14650 1837600 1836824 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538091.1 protein_id gnl|my_center|LOCUS_14650 1839427 1837613 gene locus_tag LOCUS_14660 gene nadB 1839427 1837613 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_14660 1839426 1840949 gene locus_tag LOCUS_14670 1839426 1840949 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_14670 1842250 1841000 gene locus_tag LOCUS_14680 gene apbC 1842250 1841000 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_14680 1842472 1843449 gene locus_tag LOCUS_14690 1842472 1843449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1843880 1844875 gene locus_tag LOCUS_14700 1843880 1844875 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_14700 1845027 1845656 gene locus_tag LOCUS_14710 1845027 1845656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1846781 1845807 gene locus_tag LOCUS_14720 gene folE2 1846781 1845807 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_14720 1847714 1846830 gene locus_tag LOCUS_14730 1847714 1846830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1851713 1847796 gene locus_tag LOCUS_14740 1851713 1847796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1852342 1851791 gene locus_tag LOCUS_14750 1852342 1851791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1854459 1852543 gene locus_tag LOCUS_14760 1854459 1852543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1855798 1854638 gene locus_tag LOCUS_14770 1855798 1854638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_14770 1856477 1857691 gene locus_tag LOCUS_14780 gene ilvA 1856477 1857691 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_14780 1857749 1859152 gene locus_tag LOCUS_14790 gene fahA 1857749 1859152 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100400.1 protein_id gnl|my_center|LOCUS_14790 1859201 1859419 gene locus_tag LOCUS_14800 1859201 1859419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1859969 1859460 gene locus_tag LOCUS_14810 1859969 1859460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1860422 1859973 gene locus_tag LOCUS_14820 1860422 1859973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1860638 1862053 gene locus_tag LOCUS_14830 1860638 1862053 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_14830 1862753 1862058 gene locus_tag LOCUS_14840 1862753 1862058 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333306.1 protein_id gnl|my_center|LOCUS_14840 1863354 1862788 gene locus_tag LOCUS_14850 1863354 1862788 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_14850 1863431 1864405 gene locus_tag LOCUS_14860 1863431 1864405 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_14860 1864516 1865133 gene locus_tag LOCUS_14870 1864516 1865133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1865587 1865225 gene locus_tag LOCUS_14880 1865587 1865225 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_14880 1866961 1865879 gene locus_tag LOCUS_14890 1866961 1865879 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_14890 1868131 1867319 gene locus_tag LOCUS_14900 1868131 1867319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1868331 1869920 gene locus_tag LOCUS_14910 1868331 1869920 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_14910 1870027 1870905 gene locus_tag LOCUS_14920 1870027 1870905 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_14920 1871043 1872614 gene locus_tag LOCUS_14930 gene ffh 1871043 1872614 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_14930 1872726 1874234 gene locus_tag LOCUS_14940 1872726 1874234 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121489.1 protein_id gnl|my_center|LOCUS_14940 1874493 1877294 gene locus_tag LOCUS_14950 gene topA 1874493 1877294 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931749.1 protein_id gnl|my_center|LOCUS_14950 1877975 1877316 gene locus_tag LOCUS_14960 1877975 1877316 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_14960 1880737 1877972 gene locus_tag LOCUS_14970 1880737 1877972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1881303 1880839 gene locus_tag LOCUS_14980 1881303 1880839 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_14980 1884930 1881307 gene locus_tag LOCUS_14990 1884930 1881307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1886211 1884964 gene locus_tag LOCUS_15000 gene nifS 1886211 1884964 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_15000 1886265 1887530 gene locus_tag LOCUS_15010 1886265 1887530 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_15010 1888475 1887549 gene locus_tag LOCUS_15020 1888475 1887549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1889118 1888537 gene locus_tag LOCUS_15030 1889118 1888537 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546804.1 protein_id gnl|my_center|LOCUS_15030 1889754 1889230 gene locus_tag LOCUS_15040 1889754 1889230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1889665 1889901 gene locus_tag LOCUS_15050 1889665 1889901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1890024 1890296 gene locus_tag LOCUS_15060 1890024 1890296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1891646 1890318 gene locus_tag LOCUS_15070 1891646 1890318 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_15070 1892789 1891716 gene locus_tag LOCUS_15080 1892789 1891716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1892985 1893968 gene locus_tag LOCUS_15090 1892985 1893968 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_15090 1893965 1895356 gene locus_tag LOCUS_15100 1893965 1895356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1897280 1895382 gene locus_tag LOCUS_15110 1897280 1895382 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037563.1 protein_id gnl|my_center|LOCUS_15110 1897513 1898136 gene locus_tag LOCUS_15120 1897513 1898136 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088434.1 protein_id gnl|my_center|LOCUS_15120 1898384 1898037 gene locus_tag LOCUS_15130 1898384 1898037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1898599 1900233 gene locus_tag LOCUS_15140 1898599 1900233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1900230 1901396 gene locus_tag LOCUS_15150 1900230 1901396 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_15150 1901427 1902617 gene locus_tag LOCUS_15160 1901427 1902617 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330115.1 protein_id gnl|my_center|LOCUS_15160 1904716 1902887 gene locus_tag LOCUS_15170 1904716 1902887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1905538 1904789 gene locus_tag LOCUS_15180 1905538 1904789 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_15180 1906239 1905535 gene locus_tag LOCUS_15190 gene queC 1906239 1905535 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038130.1 protein_id gnl|my_center|LOCUS_15190 1906592 1908172 gene locus_tag LOCUS_15200 1906592 1908172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1907452 1907539 gene locus_tag LOCUS_t00240 1907452 1907539 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1909180 1908200 gene locus_tag LOCUS_15210 1909180 1908200 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_15210 1909512 1909868 gene locus_tag LOCUS_15220 1909512 1909868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1910851 1911132 gene locus_tag LOCUS_15230 1910851 1911132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1911208 1911660 gene locus_tag LOCUS_15240 1911208 1911660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1912968 1911748 gene locus_tag LOCUS_15250 1912968 1911748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1915084 1913375 gene locus_tag LOCUS_15260 1915084 1913375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1915098 1915186 gene locus_tag LOCUS_t00250 1915098 1915186 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1917685 1915175 gene locus_tag LOCUS_15270 1917685 1915175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1919956 1917887 gene locus_tag LOCUS_15280 1919956 1917887 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269243.1 protein_id gnl|my_center|LOCUS_15280 1920834 1920100 gene locus_tag LOCUS_15290 1920834 1920100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1922101 1921292 gene locus_tag LOCUS_15300 gene ubiE 1922101 1921292 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_15300 1922176 1923156 gene locus_tag LOCUS_15310 1922176 1923156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1923572 1923916 gene locus_tag LOCUS_15320 1923572 1923916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1924065 1925102 gene locus_tag LOCUS_15330 1924065 1925102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1925607 1925092 gene locus_tag LOCUS_15340 1925607 1925092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1925640 1927064 gene locus_tag LOCUS_15350 1925640 1927064 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_15350 1927511 1928602 gene locus_tag LOCUS_15360 1927511 1928602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1928602 1929777 gene locus_tag LOCUS_15370 1928602 1929777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1930195 1933251 gene locus_tag LOCUS_15380 1930195 1933251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence2 1532 90 gene locus_tag LOCUS_15390 gene asnS 1532 90 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211301.1 protein_id gnl|my_center|LOCUS_15390 1731 3404 gene locus_tag LOCUS_15400 1731 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 4474 3539 gene locus_tag LOCUS_15410 4474 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4696 5721 gene locus_tag LOCUS_15420 4696 5721 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_15420 6386 5757 gene locus_tag LOCUS_15430 6386 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 6447 7448 gene locus_tag LOCUS_15440 6447 7448 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460655.1 protein_id gnl|my_center|LOCUS_15440 7491 9650 gene locus_tag LOCUS_15450 7491 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 9692 10675 gene locus_tag LOCUS_15460 9692 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 10679 11668 gene locus_tag LOCUS_15470 gene deoC 10679 11668 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_15470 11738 13153 gene locus_tag LOCUS_15480 11738 13153 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_15480 13681 13190 gene locus_tag LOCUS_15490 13681 13190 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_15490 13806 14297 gene locus_tag LOCUS_15500 13806 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 14526 15962 gene locus_tag LOCUS_15510 gene dacB 14526 15962 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 protein_id gnl|my_center|LOCUS_15510 17225 16035 gene locus_tag LOCUS_15520 gene pdhA 17225 16035 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_15520 19706 17451 gene locus_tag LOCUS_15530 19706 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 21164 19866 gene locus_tag LOCUS_15540 21164 19866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 21046 21270 gene locus_tag LOCUS_15550 21046 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 21334 21408 gene locus_tag LOCUS_t00260 21334 21408 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21488 21901 gene locus_tag LOCUS_15560 21488 21901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 22222 21902 gene locus_tag LOCUS_15570 22222 21902 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_15570 22594 22394 gene locus_tag LOCUS_15580 22594 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15580 23970 22852 gene locus_tag LOCUS_15590 23970 22852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_15590 25201 24089 gene locus_tag LOCUS_15600 25201 24089 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_15600 27089 25386 gene locus_tag LOCUS_15610 gene der 27089 25386 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_15610 27381 28568 gene locus_tag LOCUS_15620 27381 28568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 28724 32308 gene locus_tag LOCUS_15630 28724 32308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 32717 32289 gene locus_tag LOCUS_15640 32717 32289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 33652 32717 gene locus_tag LOCUS_15650 33652 32717 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_15650 35147 33726 gene locus_tag LOCUS_15660 35147 33726 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403045.1 protein_id gnl|my_center|LOCUS_15660 36226 35144 gene locus_tag LOCUS_15670 36226 35144 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_15670 38433 36223 gene locus_tag LOCUS_15680 38433 36223 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 protein_id gnl|my_center|LOCUS_15680 43142 38562 gene locus_tag LOCUS_15690 43142 38562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 44072 43197 gene locus_tag LOCUS_15700 44072 43197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 44956 44069 gene locus_tag LOCUS_15710 44956 44069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 46740 45154 gene locus_tag LOCUS_15720 46740 45154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 46994 48181 gene locus_tag LOCUS_15730 gene lipA 46994 48181 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919603.1 protein_id gnl|my_center|LOCUS_15730 48210 49370 gene locus_tag LOCUS_15740 48210 49370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 49827 49402 gene locus_tag LOCUS_15750 49827 49402 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_15750 50811 49864 gene locus_tag LOCUS_15760 50811 49864 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195077.1 protein_id gnl|my_center|LOCUS_15760 51128 50832 gene locus_tag LOCUS_15770 51128 50832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 51290 53470 gene locus_tag LOCUS_15780 51290 53470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 54400 53594 gene locus_tag LOCUS_15790 54400 53594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 54984 54397 gene locus_tag LOCUS_15800 54984 54397 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_15800 55443 56228 gene locus_tag LOCUS_15810 55443 56228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 56327 58267 gene locus_tag LOCUS_15820 56327 58267 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705871.1 protein_id gnl|my_center|LOCUS_15820 58339 59433 gene locus_tag LOCUS_15830 gene moaA 58339 59433 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_15830 60066 59446 gene locus_tag LOCUS_15840 60066 59446 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 protein_id gnl|my_center|LOCUS_15840 61256 60096 gene locus_tag LOCUS_15850 61256 60096 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958610.1 protein_id gnl|my_center|LOCUS_15850 61556 61469 gene locus_tag LOCUS_t00270 61556 61469 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 62410 61676 gene locus_tag LOCUS_15860 62410 61676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 62496 64151 gene locus_tag LOCUS_15870 62496 64151 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_15870 64148 64927 gene locus_tag LOCUS_15880 64148 64927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 65187 64912 gene locus_tag LOCUS_15890 65187 64912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 66347 65184 gene locus_tag LOCUS_15900 66347 65184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 66669 67367 gene locus_tag LOCUS_15910 66669 67367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 67669 68490 gene locus_tag LOCUS_15920 67669 68490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_15920 68480 69859 gene locus_tag LOCUS_15930 68480 69859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 protein_id gnl|my_center|LOCUS_15930 70181 69936 gene locus_tag LOCUS_15940 70181 69936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 70077 72785 gene locus_tag LOCUS_15950 70077 72785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 72905 73591 gene locus_tag LOCUS_15960 72905 73591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 73700 76270 gene locus_tag LOCUS_15970 73700 76270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 76419 77993 gene locus_tag LOCUS_15980 76419 77993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 78809 78105 gene locus_tag LOCUS_15990 78809 78105 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_15990 80215 78815 gene locus_tag LOCUS_16000 gene dinB 80215 78815 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_16000 80386 81132 gene locus_tag LOCUS_16010 80386 81132 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838205.1 protein_id gnl|my_center|LOCUS_16010 81593 81162 gene locus_tag LOCUS_16020 81593 81162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 81707 82912 gene locus_tag LOCUS_16030 gene pcaF 81707 82912 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035620.1 protein_id gnl|my_center|LOCUS_16030 84394 83072 gene locus_tag LOCUS_16040 84394 83072 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967499.1 protein_id gnl|my_center|LOCUS_16040 85079 84423 gene locus_tag LOCUS_16050 85079 84423 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 protein_id gnl|my_center|LOCUS_16050 85786 85076 gene locus_tag LOCUS_16060 85786 85076 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_16060 87229 85799 gene locus_tag LOCUS_16070 87229 85799 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_16070 88257 89711 gene locus_tag LOCUS_16080 88257 89711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 90194 90913 gene locus_tag LOCUS_16090 90194 90913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 93235 91067 gene locus_tag LOCUS_16100 93235 91067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 96589 93479 gene locus_tag LOCUS_16110 96589 93479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 99333 96880 gene locus_tag LOCUS_16120 99333 96880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 100790 99609 gene locus_tag LOCUS_16130 100790 99609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 101037 103109 gene locus_tag LOCUS_16140 gene pheT 101037 103109 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663007.1 protein_id gnl|my_center|LOCUS_16140 103632 103099 gene locus_tag LOCUS_16150 103632 103099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 104841 103663 gene locus_tag LOCUS_16160 104841 103663 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_16160 105811 104936 gene locus_tag LOCUS_16170 105811 104936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 107296 106007 gene locus_tag LOCUS_16180 107296 106007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400343.1 protein_id gnl|my_center|LOCUS_16180 107991 107293 gene locus_tag LOCUS_16190 107991 107293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_16190 108814 108140 gene locus_tag LOCUS_16200 108814 108140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 109802 109020 gene locus_tag LOCUS_16210 109802 109020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 110573 109839 gene locus_tag LOCUS_16220 110573 109839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 112079 111369 gene locus_tag LOCUS_16230 112079 111369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 112302 113120 gene locus_tag LOCUS_16240 112302 113120 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258173.1 protein_id gnl|my_center|LOCUS_16240 113889 113134 gene locus_tag LOCUS_16250 113889 113134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 114416 113886 gene locus_tag LOCUS_16260 114416 113886 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 protein_id gnl|my_center|LOCUS_16260 116334 114547 gene locus_tag LOCUS_16270 gene murJ 116334 114547 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_16270 116328 116987 gene locus_tag LOCUS_16280 116328 116987 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_16280 118664 116997 gene locus_tag LOCUS_16290 118664 116997 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_16290 119555 118719 gene locus_tag LOCUS_16300 119555 118719 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403300.1 protein_id gnl|my_center|LOCUS_16300 120432 119644 gene locus_tag LOCUS_16310 120432 119644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331945.1 protein_id gnl|my_center|LOCUS_16310 122049 120466 gene locus_tag LOCUS_16320 122049 120466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 122246 123097 gene locus_tag LOCUS_16330 122246 123097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 123196 123645 gene locus_tag LOCUS_16340 gene mscL 123196 123645 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533610.1 protein_id gnl|my_center|LOCUS_16340 124789 123767 gene locus_tag LOCUS_16350 124789 123767 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_16350 124831 125232 gene locus_tag LOCUS_16360 124831 125232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 125276 126223 gene locus_tag LOCUS_16370 125276 126223 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_16370 126399 128864 gene locus_tag LOCUS_16380 126399 128864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 128905 129351 gene locus_tag LOCUS_16390 128905 129351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 129348 130313 gene locus_tag LOCUS_16400 129348 130313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 130346 131839 gene locus_tag LOCUS_16410 130346 131839 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_16410 131920 132357 gene locus_tag LOCUS_16420 gene flgB 131920 132357 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_16420 132388 132807 gene locus_tag LOCUS_16430 gene flgC 132388 132807 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442696.1 protein_id gnl|my_center|LOCUS_16430 132905 133210 gene locus_tag LOCUS_16440 132905 133210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 133535 133245 gene locus_tag LOCUS_16450 133535 133245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 133892 135058 gene locus_tag LOCUS_16460 133892 135058 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_16460 138254 135105 gene locus_tag LOCUS_16470 138254 135105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 138490 139446 gene locus_tag LOCUS_16480 138490 139446 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_16480 139635 139465 gene locus_tag LOCUS_16490 139635 139465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 141106 139763 gene locus_tag LOCUS_16500 141106 139763 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_16500 141638 141234 gene locus_tag LOCUS_16510 141638 141234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 142915 142334 gene locus_tag LOCUS_16520 gene gmhA 142915 142334 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_16520 144947 142965 gene locus_tag LOCUS_16530 144947 142965 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839145.1 protein_id gnl|my_center|LOCUS_16530 145958 145014 gene locus_tag LOCUS_16540 145958 145014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 148069 146006 gene locus_tag LOCUS_16550 148069 146006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 148696 150723 gene locus_tag LOCUS_16560 148696 150723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 151843 150746 gene locus_tag LOCUS_16570 151843 150746 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_16570 154223 152034 gene locus_tag LOCUS_16580 154223 152034 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_16580 158349 154840 gene locus_tag LOCUS_16590 158349 154840 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397623.1 protein_id gnl|my_center|LOCUS_16590 158818 158423 gene locus_tag LOCUS_16600 158818 158423 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_16600 159525 158953 gene locus_tag LOCUS_16610 gene dcd 159525 158953 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546770.1 protein_id gnl|my_center|LOCUS_16610 159949 161949 gene locus_tag LOCUS_16620 159949 161949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 162159 166319 gene locus_tag LOCUS_16630 gene smc 162159 166319 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921931.1 protein_id gnl|my_center|LOCUS_16630 167115 166396 gene locus_tag LOCUS_16640 167115 166396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 168085 167228 gene locus_tag LOCUS_16650 168085 167228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 168298 168717 gene locus_tag LOCUS_16660 168298 168717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 169313 168741 gene locus_tag LOCUS_16670 gene thpR 169313 168741 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_16670 170338 169361 gene locus_tag LOCUS_16680 170338 169361 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921666.1 protein_id gnl|my_center|LOCUS_16680 171350 170484 gene locus_tag LOCUS_16690 171350 170484 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_16690 172579 171347 gene locus_tag LOCUS_16700 172579 171347 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_16700 173289 172576 gene locus_tag LOCUS_16710 173289 172576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 174799 173363 gene locus_tag LOCUS_16720 gene phrB 174799 173363 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_16720 175735 174938 gene locus_tag LOCUS_16730 175735 174938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 177609 175732 gene locus_tag LOCUS_16740 177609 175732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 177676 178395 gene locus_tag LOCUS_16750 177676 178395 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111142.1 protein_id gnl|my_center|LOCUS_16750 178419 179669 gene locus_tag LOCUS_16760 178419 179669 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 protein_id gnl|my_center|LOCUS_16760 179666 182053 gene locus_tag LOCUS_16770 179666 182053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 182163 183713 gene locus_tag LOCUS_16780 182163 183713 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_16780 184174 183743 gene locus_tag LOCUS_16790 184174 183743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 184684 184265 gene locus_tag LOCUS_16800 184684 184265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 184826 185521 gene locus_tag LOCUS_16810 184826 185521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 186733 185543 gene locus_tag LOCUS_16820 gene rlmN 186733 185543 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_16820 187799 186744 gene locus_tag LOCUS_16830 187799 186744 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776295.1 protein_id gnl|my_center|LOCUS_16830 188802 187834 gene locus_tag LOCUS_16840 188802 187834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 190016 188898 gene locus_tag LOCUS_16850 190016 188898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 190865 191494 gene locus_tag LOCUS_16860 gene sodA 190865 191494 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_16860 191647 193167 gene locus_tag LOCUS_16870 191647 193167 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_16870 193320 193946 gene locus_tag LOCUS_16880 193320 193946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 195054 194011 gene locus_tag LOCUS_16890 195054 194011 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_16890 195230 197230 gene locus_tag LOCUS_16900 195230 197230 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_16900 197318 197932 gene locus_tag LOCUS_16910 197318 197932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 197936 200806 gene locus_tag LOCUS_16920 197936 200806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 200890 201216 gene locus_tag LOCUS_16930 200890 201216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 201213 201701 gene locus_tag LOCUS_16940 201213 201701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 201694 202047 gene locus_tag LOCUS_16950 201694 202047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 202061 202939 gene locus_tag LOCUS_16960 202061 202939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921522.1 protein_id gnl|my_center|LOCUS_16960 204085 203057 gene locus_tag LOCUS_16970 gene ilvE 204085 203057 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_16970 204408 204686 gene locus_tag LOCUS_16980 204408 204686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 204939 205640 gene locus_tag LOCUS_16990 204939 205640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 205668 206702 gene locus_tag LOCUS_17000 205668 206702 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_17000 207620 206799 gene locus_tag LOCUS_17010 207620 206799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 207898 209265 gene locus_tag LOCUS_17020 207898 209265 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_17020 209299 210072 gene locus_tag LOCUS_17030 209299 210072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 211323 210136 gene locus_tag LOCUS_17040 gene fabF 211323 210136 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_17040 211776 211528 gene locus_tag LOCUS_17050 211776 211528 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_17050 212616 211966 gene locus_tag LOCUS_17060 gene nadD 212616 211966 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_17060 213428 213504 gene locus_tag LOCUS_t00280 213428 213504 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 213678 214004 gene locus_tag LOCUS_17070 213678 214004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 215027 214017 gene locus_tag LOCUS_17080 gene rtcA 215027 214017 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922229.1 protein_id gnl|my_center|LOCUS_17080 216505 215030 gene locus_tag LOCUS_17090 216505 215030 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122265.1 protein_id gnl|my_center|LOCUS_17090 218516 216939 gene locus_tag LOCUS_17100 218516 216939 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_17100 218717 220342 gene locus_tag LOCUS_17110 gene rtcR 218717 220342 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_17110 220479 220766 gene locus_tag LOCUS_17120 220479 220766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 221764 220739 gene locus_tag LOCUS_17130 221764 220739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 223023 221830 gene locus_tag LOCUS_17140 223023 221830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922784.1 protein_id gnl|my_center|LOCUS_17140 224203 223040 gene locus_tag LOCUS_17150 224203 223040 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922783.1 protein_id gnl|my_center|LOCUS_17150 224997 224200 gene locus_tag LOCUS_17160 224997 224200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_17160 226385 224994 gene locus_tag LOCUS_17170 226385 224994 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_17170 226600 226851 gene locus_tag LOCUS_17180 226600 226851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 229280 227262 gene locus_tag LOCUS_17190 229280 227262 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838414.1 protein_id gnl|my_center|LOCUS_17190 229440 230822 gene locus_tag LOCUS_17200 229440 230822 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_17200 231013 231570 gene locus_tag LOCUS_17210 231013 231570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 232392 231898 gene locus_tag LOCUS_17220 232392 231898 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613918.1 protein_id gnl|my_center|LOCUS_17220 232640 234946 gene locus_tag LOCUS_17230 gene ccoN 232640 234946 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615370.1 protein_id gnl|my_center|LOCUS_17230 234943 235149 gene locus_tag LOCUS_17240 234943 235149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 235146 235757 gene locus_tag LOCUS_17250 235146 235757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 235900 237312 gene locus_tag LOCUS_17260 gene ccoG 235900 237312 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_17260 237309 237830 gene locus_tag LOCUS_17270 237309 237830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 237827 238549 gene locus_tag LOCUS_17280 237827 238549 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615371.1 protein_id gnl|my_center|LOCUS_17280 238866 241214 gene locus_tag LOCUS_17290 238866 241214 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120873.1 protein_id gnl|my_center|LOCUS_17290 241228 241500 gene locus_tag LOCUS_17300 241228 241500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 241546 242103 gene locus_tag LOCUS_17310 241546 242103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 242131 243048 gene locus_tag LOCUS_17320 242131 243048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 243045 244748 gene locus_tag LOCUS_17330 243045 244748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 245781 244831 gene locus_tag LOCUS_17340 245781 244831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 247224 248210 gene locus_tag LOCUS_17350 247224 248210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 248444 250825 gene locus_tag LOCUS_17360 gene pcrA 248444 250825 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_17360 250957 251322 gene locus_tag LOCUS_17370 250957 251322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 251414 253411 gene locus_tag LOCUS_17380 251414 253411 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_17380 255034 253436 gene locus_tag LOCUS_17390 255034 253436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 255602 256000 gene locus_tag LOCUS_17400 255602 256000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 257368 256091 gene locus_tag LOCUS_17410 257368 256091 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_17410 257250 257477 gene locus_tag LOCUS_17420 257250 257477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 257545 258441 gene locus_tag LOCUS_17430 257545 258441 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943444.1 protein_id gnl|my_center|LOCUS_17430 258968 258498 gene locus_tag LOCUS_17440 258968 258498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 259402 258965 gene locus_tag LOCUS_17450 259402 258965 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870252.1 protein_id gnl|my_center|LOCUS_17450 260105 259422 gene locus_tag LOCUS_17460 260105 259422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 260245 261447 gene locus_tag LOCUS_17470 260245 261447 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_17470 262124 261513 gene locus_tag LOCUS_17480 262124 261513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 263060 262128 gene locus_tag LOCUS_17490 gene lpxI 263060 262128 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_17490 263334 263579 gene locus_tag LOCUS_17500 263334 263579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 266591 263586 gene locus_tag LOCUS_17510 266591 263586 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_17510 267523 266648 gene locus_tag LOCUS_17520 267523 266648 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958069.1 protein_id gnl|my_center|LOCUS_17520 267857 268975 gene locus_tag LOCUS_17530 gene preA 267857 268975 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_17530 269017 270390 gene locus_tag LOCUS_17540 gene hydA 269017 270390 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066590.1 protein_id gnl|my_center|LOCUS_17540 271791 270400 gene locus_tag LOCUS_17550 271791 270400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 272082 272660 gene locus_tag LOCUS_17560 272082 272660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 272542 273582 gene locus_tag LOCUS_17570 272542 273582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17570 274483 273614 gene locus_tag LOCUS_17580 274483 273614 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_17580 276021 274510 gene locus_tag LOCUS_17590 276021 274510 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_17590 276840 276100 gene locus_tag LOCUS_17600 276840 276100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 279115 276845 gene locus_tag LOCUS_17610 279115 276845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 279958 279311 gene locus_tag LOCUS_17620 279958 279311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925589.1 protein_id gnl|my_center|LOCUS_17620 280037 280876 gene locus_tag LOCUS_17630 280037 280876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 280925 281875 gene locus_tag LOCUS_17640 280925 281875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 282817 281909 gene locus_tag LOCUS_17650 282817 281909 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_17650 283312 282899 gene locus_tag LOCUS_17660 283312 282899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 283598 284464 gene locus_tag LOCUS_17670 283598 284464 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_17670 284565 285617 gene locus_tag LOCUS_17680 gene queG 284565 285617 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206559.1 protein_id gnl|my_center|LOCUS_17680 285763 286986 gene locus_tag LOCUS_17690 gene astA 285763 286986 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212031.1 protein_id gnl|my_center|LOCUS_17690 287068 288639 gene locus_tag LOCUS_17700 gene astD 287068 288639 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706955.1 protein_id gnl|my_center|LOCUS_17700 289727 288747 gene locus_tag LOCUS_17710 289727 288747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 290271 292385 gene locus_tag LOCUS_17720 290271 292385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 292509 292811 gene locus_tag LOCUS_17730 292509 292811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 293894 292863 gene locus_tag LOCUS_17740 293894 292863 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_17740 293975 295267 gene locus_tag LOCUS_17750 293975 295267 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_17750 295277 295921 gene locus_tag LOCUS_17760 295277 295921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 296002 297135 gene locus_tag LOCUS_17770 gene galK 296002 297135 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_17770 298268 297183 gene locus_tag LOCUS_17780 298268 297183 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_17780 298697 298365 gene locus_tag LOCUS_17790 gene trxA 298697 298365 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_17790 299706 298846 gene locus_tag LOCUS_17800 gene folP 299706 298846 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_17800 301702 299861 gene locus_tag LOCUS_17810 301702 299861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 303044 301896 gene locus_tag LOCUS_17820 gene hemW 303044 301896 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_17820 303199 303789 gene locus_tag LOCUS_17830 303199 303789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 304300 305646 gene locus_tag LOCUS_17840 304300 305646 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_17840 305719 306564 gene locus_tag LOCUS_17850 305719 306564 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_17850 306557 307453 gene locus_tag LOCUS_17860 306557 307453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 307515 308276 gene locus_tag LOCUS_17870 307515 308276 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_17870 309383 308340 gene locus_tag LOCUS_17880 gene ruvB 309383 308340 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_17880 310777 309410 gene locus_tag LOCUS_17890 310777 309410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 311281 311589 gene locus_tag LOCUS_17900 gene rpsJ 311281 311589 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_17900 311681 312376 gene locus_tag LOCUS_17910 gene rplC 311681 312376 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218932.1 protein_id gnl|my_center|LOCUS_17910 312729 313436 gene locus_tag LOCUS_17920 gene rplD 312729 313436 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258232.1 protein_id gnl|my_center|LOCUS_17920 313433 313723 gene locus_tag LOCUS_17930 gene rplW 313433 313723 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_17930 313764 314621 gene locus_tag LOCUS_17940 gene rplB 313764 314621 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_17940 314663 314950 gene locus_tag LOCUS_17950 gene rpsS 314663 314950 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_17950 314947 315498 gene locus_tag LOCUS_17960 314947 315498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 315561 316262 gene locus_tag LOCUS_17970 gene rpsC 315561 316262 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994481.1 protein_id gnl|my_center|LOCUS_17970 316363 316782 gene locus_tag LOCUS_17980 gene rplP 316363 316782 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_17980 316856 317059 gene locus_tag LOCUS_17990 gene rpmC 316856 317059 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536529.1 protein_id gnl|my_center|LOCUS_17990 317127 317459 gene locus_tag LOCUS_18000 317127 317459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 317506 317892 gene locus_tag LOCUS_18010 gene rplN 317506 317892 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_18010 317975 318331 gene locus_tag LOCUS_18020 gene rplX 317975 318331 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_18020 318403 319086 gene locus_tag LOCUS_18030 gene rplE 318403 319086 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919139.1 protein_id gnl|my_center|LOCUS_18030 319159 319344 gene locus_tag LOCUS_18040 319159 319344 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701320.1 protein_id gnl|my_center|LOCUS_18040 319408 319806 gene locus_tag LOCUS_18050 gene rpsH 319408 319806 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_18050 319869 320423 gene locus_tag LOCUS_18060 gene rplF 319869 320423 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_18060 320464 320826 gene locus_tag LOCUS_18070 gene rplR 320464 320826 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_18070 320896 321618 gene locus_tag LOCUS_18080 gene rpsE 320896 321618 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881066.1 protein_id gnl|my_center|LOCUS_18080 321683 322270 gene locus_tag LOCUS_18090 gene rplO 321683 322270 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_18090 322408 323850 gene locus_tag LOCUS_18100 gene secY 322408 323850 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_18100 323862 324662 gene locus_tag LOCUS_18110 gene map 323862 324662 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869907.1 protein_id gnl|my_center|LOCUS_18110 324768 324992 gene locus_tag LOCUS_18120 gene infA 324768 324992 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_18120 325455 325835 gene locus_tag LOCUS_18130 gene rpsM 325455 325835 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_18130 325997 326371 gene locus_tag LOCUS_18140 gene rpsK 325997 326371 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_18140 326552 327574 gene locus_tag LOCUS_18150 326552 327574 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_18150 327680 328312 gene locus_tag LOCUS_18160 327680 328312 CDS product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 protein_id gnl|my_center|LOCUS_18160 328543 328854 gene locus_tag LOCUS_18170 328543 328854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 329015 330055 gene locus_tag LOCUS_18180 gene pheS 329015 330055 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121253.1 protein_id gnl|my_center|LOCUS_18180 330140 330742 gene locus_tag LOCUS_18190 330140 330742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 331330 331401 gene locus_tag LOCUS_t00290 331330 331401 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 333058 331808 gene locus_tag LOCUS_18200 333058 331808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 333395 333183 gene locus_tag LOCUS_18210 333395 333183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 333536 333928 gene locus_tag LOCUS_18220 333536 333928 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123177.1 protein_id gnl|my_center|LOCUS_18220 335025 334276 gene locus_tag LOCUS_18230 335025 334276 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_18230 336274 335042 gene locus_tag LOCUS_18240 gene dinB 336274 335042 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_18240 336721 337353 gene locus_tag LOCUS_18250 336721 337353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 338908 337478 gene locus_tag LOCUS_18260 338908 337478 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_18260 342047 338901 gene locus_tag LOCUS_18270 342047 338901 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_18270 343099 342044 gene locus_tag LOCUS_18280 343099 342044 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_18280 346656 343360 gene locus_tag LOCUS_18290 346656 343360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 346552 346803 gene locus_tag LOCUS_18300 346552 346803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 347765 347016 gene locus_tag LOCUS_18310 gene phoU 347765 347016 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719749.1 protein_id gnl|my_center|LOCUS_18310 347977 349152 gene locus_tag LOCUS_18320 347977 349152 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928723.1 protein_id gnl|my_center|LOCUS_18320 349168 350532 gene locus_tag LOCUS_18330 349168 350532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 350534 351343 gene locus_tag LOCUS_18340 350534 351343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_18340 351367 352086 gene locus_tag LOCUS_18350 351367 352086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_18350 352794 352117 gene locus_tag LOCUS_18360 352794 352117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 353008 354741 gene locus_tag LOCUS_18370 353008 354741 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_18370 354889 356007 gene locus_tag LOCUS_18380 354889 356007 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_18380 356312 358048 gene locus_tag LOCUS_18390 356312 358048 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_18390 358211 359500 gene locus_tag LOCUS_18400 358211 359500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 359544 360596 gene locus_tag LOCUS_18410 359544 360596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 360593 361771 gene locus_tag LOCUS_18420 360593 361771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 361768 362949 gene locus_tag LOCUS_18430 361768 362949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 362983 365175 gene locus_tag LOCUS_18440 362983 365175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 365266 371961 gene locus_tag LOCUS_18450 365266 371961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 372033 372107 gene locus_tag LOCUS_t00300 372033 372107 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 373944 372172 gene locus_tag LOCUS_18460 373944 372172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 374168 375469 gene locus_tag LOCUS_18470 gene eno 374168 375469 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_18470 375668 375961 gene locus_tag LOCUS_18480 375668 375961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 376129 376518 gene locus_tag LOCUS_18490 gene rplT 376129 376518 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_18490 376710 377390 gene locus_tag LOCUS_18500 376710 377390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 378032 377397 gene locus_tag LOCUS_18510 378032 377397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 378973 378011 gene locus_tag LOCUS_18520 gene fmt 378973 378011 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_18520 379407 378982 gene locus_tag LOCUS_18530 379407 378982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 379315 379611 gene locus_tag LOCUS_18540 379315 379611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 379775 381298 gene locus_tag LOCUS_18550 379775 381298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 381295 382086 gene locus_tag LOCUS_18560 gene kdsB 381295 382086 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940373.1 protein_id gnl|my_center|LOCUS_18560 384698 382170 gene locus_tag LOCUS_18570 384698 382170 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_18570 386782 384788 gene locus_tag LOCUS_18580 386782 384788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 386963 388936 gene locus_tag LOCUS_18590 gene pyrG 386963 388936 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_18590 389356 389012 gene locus_tag LOCUS_18600 389356 389012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 390000 390218 gene locus_tag LOCUS_18610 390000 390218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 390286 391155 gene locus_tag LOCUS_18620 gene panC 390286 391155 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064922.1 protein_id gnl|my_center|LOCUS_18620 391204 392328 gene locus_tag LOCUS_18630 gene gcvT 391204 392328 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121468.1 protein_id gnl|my_center|LOCUS_18630 392407 392988 gene locus_tag LOCUS_18640 gene gmhB 392407 392988 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_18640 393010 393333 gene locus_tag LOCUS_18650 393010 393333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 393435 394457 gene locus_tag LOCUS_18660 gene rfaQ 393435 394457 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942892.1 protein_id gnl|my_center|LOCUS_18660 394555 394630 gene locus_tag LOCUS_t00310 394555 394630 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 394745 395512 gene locus_tag LOCUS_18670 394745 395512 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_18670 395662 396756 gene locus_tag LOCUS_18680 gene serC 395662 396756 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_18680 397808 396747 gene locus_tag LOCUS_18690 gene rfaQ 397808 396747 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 protein_id gnl|my_center|LOCUS_18690 399387 397810 gene locus_tag LOCUS_18700 399387 397810 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_18700 400106 399534 gene locus_tag LOCUS_18710 400106 399534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 401257 400130 gene locus_tag LOCUS_18720 gene ugpC 401257 400130 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_18720 401470 401697 gene locus_tag LOCUS_18730 401470 401697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 403366 401843 gene locus_tag LOCUS_18740 403366 401843 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_18740 404747 403449 gene locus_tag LOCUS_18750 404747 403449 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_18750 405503 404778 gene locus_tag LOCUS_18760 405503 404778 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729879.1 protein_id gnl|my_center|LOCUS_18760 405622 406818 gene locus_tag LOCUS_18770 405622 406818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 407628 406858 gene locus_tag LOCUS_18780 407628 406858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 407704 408483 gene locus_tag LOCUS_18790 407704 408483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 408667 409626 gene locus_tag LOCUS_18800 408667 409626 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_18800 409611 410402 gene locus_tag LOCUS_18810 409611 410402 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_18810 411774 410428 gene locus_tag LOCUS_18820 411774 410428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 412027 412725 gene locus_tag LOCUS_18830 412027 412725 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_18830 412867 416499 gene locus_tag LOCUS_18840 412867 416499 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_18840 416496 418118 gene locus_tag LOCUS_18850 gene nrfD 416496 418118 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_18850 418122 418682 gene locus_tag LOCUS_18860 418122 418682 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_18860 418750 419529 gene locus_tag LOCUS_18870 418750 419529 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_18870 419526 420836 gene locus_tag LOCUS_18880 419526 420836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_18880 420995 421393 gene locus_tag LOCUS_18890 420995 421393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 421428 422384 gene locus_tag LOCUS_18900 421428 422384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 422381 423556 gene locus_tag LOCUS_18910 gene coxB 422381 423556 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 protein_id gnl|my_center|LOCUS_18910 423665 425428 gene locus_tag LOCUS_18920 423665 425428 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_18920 425471 426145 gene locus_tag LOCUS_18930 425471 426145 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_18930 426213 427205 gene locus_tag LOCUS_18940 426213 427205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 427320 428108 gene locus_tag LOCUS_18950 427320 428108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 429002 428148 gene locus_tag LOCUS_18960 429002 428148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_18960 430436 429051 gene locus_tag LOCUS_18970 gene murA 430436 429051 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530201.1 protein_id gnl|my_center|LOCUS_18970 430788 431711 gene locus_tag LOCUS_18980 430788 431711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 432391 431969 gene locus_tag LOCUS_18990 432391 431969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 432596 433546 gene locus_tag LOCUS_19000 432596 433546 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_19000 433648 434565 gene locus_tag LOCUS_19010 433648 434565 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_19010 434562 435488 gene locus_tag LOCUS_19020 434562 435488 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646500.1 protein_id gnl|my_center|LOCUS_19020 435485 435676 gene locus_tag LOCUS_19030 435485 435676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 439015 436148 gene locus_tag LOCUS_19040 439015 436148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 439636 439175 gene locus_tag LOCUS_19050 gene dut 439636 439175 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933085.1 protein_id gnl|my_center|LOCUS_19050 439883 439647 gene locus_tag LOCUS_19060 439883 439647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 441614 440016 gene locus_tag LOCUS_19070 441614 440016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 441776 442423 gene locus_tag LOCUS_19080 441776 442423 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_19080 442478 443638 gene locus_tag LOCUS_19090 442478 443638 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_19090 443664 444134 gene locus_tag LOCUS_19100 gene ruvX 443664 444134 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_19100 444271 445206 gene locus_tag LOCUS_19110 444271 445206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 445284 448007 gene locus_tag LOCUS_19120 445284 448007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 448757 447984 gene locus_tag LOCUS_19130 448757 447984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 448904 450274 gene locus_tag LOCUS_19140 448904 450274 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_19140 450451 450885 gene locus_tag LOCUS_19150 450451 450885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 450982 452319 gene locus_tag LOCUS_19160 450982 452319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 452759 455548 gene locus_tag LOCUS_19170 452759 455548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 455734 456897 gene locus_tag LOCUS_19180 455734 456897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 456999 456925 gene locus_tag LOCUS_t00320 456999 456925 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 457205 458815 gene locus_tag LOCUS_19190 gene pckA 457205 458815 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_19190 458899 459780 gene locus_tag LOCUS_19200 458899 459780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 461252 459888 gene locus_tag LOCUS_19210 461252 459888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 461849 463624 gene locus_tag LOCUS_19220 461849 463624 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_19220 464083 465936 gene locus_tag LOCUS_19230 464083 465936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 466283 466357 gene locus_tag LOCUS_t00330 466283 466357 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 468238 466829 gene locus_tag LOCUS_19240 468238 466829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 470894 468468 gene locus_tag LOCUS_19250 470894 468468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 472213 470966 gene locus_tag LOCUS_19260 472213 470966 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141800.1 protein_id gnl|my_center|LOCUS_19260 472300 473304 gene locus_tag LOCUS_19270 472300 473304 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_19270 473525 474451 gene locus_tag LOCUS_19280 473525 474451 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_19280 474692 475750 gene locus_tag LOCUS_19290 474692 475750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 475874 477022 gene locus_tag LOCUS_19300 475874 477022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 477045 477944 gene locus_tag LOCUS_19310 477045 477944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 478067 479464 gene locus_tag LOCUS_19320 478067 479464 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_19320 479457 480338 gene locus_tag LOCUS_19330 479457 480338 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256994.1 protein_id gnl|my_center|LOCUS_19330 480335 481153 gene locus_tag LOCUS_19340 480335 481153 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_19340 481194 482843 gene locus_tag LOCUS_19350 481194 482843 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_19350 486056 482868 gene locus_tag LOCUS_19360 486056 482868 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085775.1 protein_id gnl|my_center|LOCUS_19360 486181 487542 gene locus_tag LOCUS_19370 gene lysA 486181 487542 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880764.1 protein_id gnl|my_center|LOCUS_19370 487539 488789 gene locus_tag LOCUS_19380 487539 488789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 489989 488811 gene locus_tag LOCUS_19390 489989 488811 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888240.1 protein_id gnl|my_center|LOCUS_19390 490909 489989 gene locus_tag LOCUS_19400 490909 489989 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889130.1 protein_id gnl|my_center|LOCUS_19400 491148 492188 gene locus_tag LOCUS_19410 491148 492188 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_19410 492185 493906 gene locus_tag LOCUS_19420 492185 493906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 494840 493923 gene locus_tag LOCUS_19430 gene metF 494840 493923 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_19430 495907 494990 gene locus_tag LOCUS_19440 495907 494990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 497641 496115 gene locus_tag LOCUS_19450 gene ahcY 497641 496115 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229742.1 protein_id gnl|my_center|LOCUS_19450 498689 497733 gene locus_tag LOCUS_19460 498689 497733 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_19460 500232 498724 gene locus_tag LOCUS_19470 gene aroA 500232 498724 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445261.1 protein_id gnl|my_center|LOCUS_19470 500542 500180 gene locus_tag LOCUS_19480 500542 500180 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330019.1 protein_id gnl|my_center|LOCUS_19480 500631 501158 gene locus_tag LOCUS_19490 500631 501158 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_19490 501366 501764 gene locus_tag LOCUS_19500 gene rplS 501366 501764 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 protein_id gnl|my_center|LOCUS_19500 501853 502893 gene locus_tag LOCUS_19510 501853 502893 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_19510 504399 502915 gene locus_tag LOCUS_19520 gene rfaE1 504399 502915 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_19520 505529 504477 gene locus_tag LOCUS_19530 gene lpxK 505529 504477 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_19530 505933 505526 gene locus_tag LOCUS_19540 505933 505526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 506684 505986 gene locus_tag LOCUS_19550 506684 505986 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384802.1 protein_id gnl|my_center|LOCUS_19550 506916 507692 gene locus_tag LOCUS_19560 506916 507692 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_19560 508032 507947 gene locus_tag LOCUS_t00340 508032 507947 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 508831 508124 gene locus_tag LOCUS_19570 gene trmD 508831 508124 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256255.1 protein_id gnl|my_center|LOCUS_19570 509279 508932 gene locus_tag LOCUS_19580 509279 508932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 510850 509696 gene locus_tag LOCUS_19590 510850 509696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 511857 510802 gene locus_tag LOCUS_19600 511857 510802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 513660 512773 gene locus_tag LOCUS_19610 513660 512773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 513755 515431 gene locus_tag LOCUS_19620 513755 515431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 516220 515441 gene locus_tag LOCUS_19630 gene nth 516220 515441 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938289.1 protein_id gnl|my_center|LOCUS_19630 516913 516227 gene locus_tag LOCUS_19640 516913 516227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 516870 517619 gene locus_tag LOCUS_19650 516870 517619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 518364 517624 gene locus_tag LOCUS_19660 518364 517624 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_19660 522050 518439 gene locus_tag LOCUS_19670 522050 518439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 522748 522047 gene locus_tag LOCUS_19680 522748 522047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 523185 522745 gene locus_tag LOCUS_19690 523185 522745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 523580 523182 gene locus_tag LOCUS_19700 523580 523182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 526612 523652 gene locus_tag LOCUS_19710 526612 523652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 528142 526667 gene locus_tag LOCUS_19720 gene nusA 528142 526667 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120487.1 protein_id gnl|my_center|LOCUS_19720 529502 528462 gene locus_tag LOCUS_19730 529502 528462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 529716 531677 gene locus_tag LOCUS_19740 529716 531677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 531753 531824 gene locus_tag LOCUS_t00350 531753 531824 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 531956 532909 gene locus_tag LOCUS_19750 531956 532909 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922180.1 protein_id gnl|my_center|LOCUS_19750 533251 533168 gene locus_tag LOCUS_t00360 533251 533168 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 535086 533320 gene locus_tag LOCUS_19760 535086 533320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 535278 538400 gene locus_tag LOCUS_19770 gene uvrA 535278 538400 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_19770 538457 539290 gene locus_tag LOCUS_19780 538457 539290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 539330 540544 gene locus_tag LOCUS_19790 539330 540544 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_19790 541102 540569 gene locus_tag LOCUS_19800 541102 540569 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_19800 542528 541119 gene locus_tag LOCUS_19810 gene serS 542528 541119 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_19810 542755 544419 gene locus_tag LOCUS_19820 542755 544419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 544424 545980 gene locus_tag LOCUS_19830 gene xseA 544424 545980 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937933.1 protein_id gnl|my_center|LOCUS_19830 545977 546270 gene locus_tag LOCUS_19840 545977 546270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 546286 547668 gene locus_tag LOCUS_19850 546286 547668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 547828 548496 gene locus_tag LOCUS_19860 547828 548496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 548688 549635 gene locus_tag LOCUS_19870 548688 549635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 550033 550554 gene locus_tag LOCUS_19880 550033 550554 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229095.1 protein_id gnl|my_center|LOCUS_19880 550554 551399 gene locus_tag LOCUS_19890 550554 551399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 551543 552577 gene locus_tag LOCUS_19900 gene hpnC 551543 552577 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_19900 552646 553950 gene locus_tag LOCUS_19910 gene hpnE 552646 553950 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_19910 554167 554550 gene locus_tag LOCUS_19920 554167 554550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 554592 555659 gene locus_tag LOCUS_19930 554592 555659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 555777 557210 gene locus_tag LOCUS_19940 555777 557210 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 protein_id gnl|my_center|LOCUS_19940 557237 557800 gene locus_tag LOCUS_19950 557237 557800 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838770.1 protein_id gnl|my_center|LOCUS_19950 557960 559495 gene locus_tag LOCUS_19960 gene hutH 557960 559495 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_19960 559701 561428 gene locus_tag LOCUS_19970 gene hutU 559701 561428 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889411.1 protein_id gnl|my_center|LOCUS_19970 562154 561447 gene locus_tag LOCUS_19980 562154 561447 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_19980 562367 563221 gene locus_tag LOCUS_19990 562367 563221 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925087.1 protein_id gnl|my_center|LOCUS_19990 563228 564484 gene locus_tag LOCUS_20000 gene hutI 563228 564484 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_20000 564949 564641 gene locus_tag LOCUS_20010 564949 564641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 565783 565259 gene locus_tag LOCUS_20020 565783 565259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 566262 566585 gene locus_tag LOCUS_20030 566262 566585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 567202 568230 gene locus_tag LOCUS_20040 gene trpD 567202 568230 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_20040 568298 568849 gene locus_tag LOCUS_20050 568298 568849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 568857 569306 gene locus_tag LOCUS_20060 568857 569306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 570475 569408 gene locus_tag LOCUS_20070 570475 569408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 570959 571849 gene locus_tag LOCUS_20080 570959 571849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 572224 571856 gene locus_tag LOCUS_20090 572224 571856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 573891 572257 gene locus_tag LOCUS_20100 gene rny 573891 572257 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_20100 574630 575277 gene locus_tag LOCUS_20110 574630 575277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 576170 575280 gene locus_tag LOCUS_20120 576170 575280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 578503 576254 gene locus_tag LOCUS_20130 578503 576254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 579627 578500 gene locus_tag LOCUS_20140 579627 578500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 580364 579699 gene locus_tag LOCUS_20150 580364 579699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 581615 580434 gene locus_tag LOCUS_20160 581615 580434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 581708 582613 gene locus_tag LOCUS_20170 581708 582613 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070937.1 protein_id gnl|my_center|LOCUS_20170 582623 583168 gene locus_tag LOCUS_20180 582623 583168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 584759 583203 gene locus_tag LOCUS_20190 584759 583203 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338764.1 protein_id gnl|my_center|LOCUS_20190 585988 584777 gene locus_tag LOCUS_20200 585988 584777 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_20200 587439 586012 gene locus_tag LOCUS_20210 587439 586012 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328834.1 protein_id gnl|my_center|LOCUS_20210 591222 587467 gene locus_tag LOCUS_20220 gene hrpA 591222 587467 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_20220 592735 591407 gene locus_tag LOCUS_20230 592735 591407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 595242 592732 gene locus_tag LOCUS_20240 595242 592732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 595990 595331 gene locus_tag LOCUS_20250 595990 595331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 596595 595987 gene locus_tag LOCUS_20260 596595 595987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 598349 596592 gene locus_tag LOCUS_20270 598349 596592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 599734 598346 gene locus_tag LOCUS_20280 599734 598346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 600705 599731 gene locus_tag LOCUS_20290 600705 599731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 601175 600705 gene locus_tag LOCUS_20300 601175 600705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 601759 601169 gene locus_tag LOCUS_20310 601759 601169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 602149 601766 gene locus_tag LOCUS_20320 gene gspG 602149 601766 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984032.1 protein_id gnl|my_center|LOCUS_20320 603565 602252 gene locus_tag LOCUS_20330 603565 602252 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_20330 605259 603643 gene locus_tag LOCUS_20340 gene gspE 605259 603643 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_20340 606436 605264 gene locus_tag LOCUS_20350 606436 605264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 607822 606635 gene locus_tag LOCUS_20360 607822 606635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 607725 608075 gene locus_tag LOCUS_20370 607725 608075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 609384 608158 gene locus_tag LOCUS_20380 609384 608158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 611075 609603 gene locus_tag LOCUS_20390 611075 609603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 611014 611172 gene locus_tag LOCUS_20400 611014 611172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 611178 611432 gene locus_tag LOCUS_20410 611178 611432 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_20410 611717 611941 gene locus_tag LOCUS_20420 611717 611941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 612500 612030 gene locus_tag LOCUS_20430 gene ndk 612500 612030 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415883.1 protein_id gnl|my_center|LOCUS_20430 615116 612558 gene locus_tag LOCUS_20440 gene otsB 615116 612558 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230393.1 protein_id gnl|my_center|LOCUS_20440 616498 615113 gene locus_tag LOCUS_20450 616498 615113 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062235.1 protein_id gnl|my_center|LOCUS_20450 616666 616968 gene locus_tag LOCUS_20460 616666 616968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 617065 619221 gene locus_tag LOCUS_20470 gene top6B 617065 619221 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867718.1 protein_id gnl|my_center|LOCUS_20470 620548 619346 gene locus_tag LOCUS_20480 gene hppD 620548 619346 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_20480 620698 621510 gene locus_tag LOCUS_20490 620698 621510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 621611 623092 gene locus_tag LOCUS_20500 621611 623092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 623115 624722 gene locus_tag LOCUS_20510 623115 624722 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_20510 624722 626347 gene locus_tag LOCUS_20520 gene xylB 624722 626347 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_20520 626614 626348 gene locus_tag LOCUS_20530 626614 626348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 627643 626666 gene locus_tag LOCUS_20540 627643 626666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 628945 627791 gene locus_tag LOCUS_20550 628945 627791 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867719.1 protein_id gnl|my_center|LOCUS_20550 629448 629161 gene locus_tag LOCUS_20560 629448 629161 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_20560 630263 629661 gene locus_tag LOCUS_20570 630263 629661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 630616 630846 gene locus_tag LOCUS_20580 630616 630846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 630890 631549 gene locus_tag LOCUS_20590 630890 631549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 631591 632277 gene locus_tag LOCUS_20600 631591 632277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 633252 632284 gene locus_tag LOCUS_20610 633252 632284 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_20610 633562 633287 gene locus_tag LOCUS_20620 633562 633287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 633761 634813 gene locus_tag LOCUS_20630 gene argC 633761 634813 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703956.1 protein_id gnl|my_center|LOCUS_20630 634830 635666 gene locus_tag LOCUS_20640 gene argB 634830 635666 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084401.1 protein_id gnl|my_center|LOCUS_20640 635754 636749 gene locus_tag LOCUS_20650 635754 636749 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070649.1 protein_id gnl|my_center|LOCUS_20650 636839 638053 gene locus_tag LOCUS_20660 636839 638053 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049171.1 protein_id gnl|my_center|LOCUS_20660 640360 638177 gene locus_tag LOCUS_20670 640360 638177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 640395 640796 gene locus_tag LOCUS_20680 640395 640796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 640955 642193 gene locus_tag LOCUS_20690 640955 642193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 644150 642180 gene locus_tag LOCUS_20700 644150 642180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 644321 648025 gene locus_tag LOCUS_20710 644321 648025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 648052 648669 gene locus_tag LOCUS_20720 648052 648669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 648767 650161 gene locus_tag LOCUS_20730 gene argH 648767 650161 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099298.1 protein_id gnl|my_center|LOCUS_20730 650161 651096 gene locus_tag LOCUS_20740 650161 651096 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_20740 651161 652249 gene locus_tag LOCUS_20750 651161 652249 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_20750 652273 653151 gene locus_tag LOCUS_20760 652273 653151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 653383 655998 gene locus_tag LOCUS_20770 653383 655998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 657264 656110 gene locus_tag LOCUS_20780 gene mnmA 657264 656110 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_20780 658109 657336 gene locus_tag LOCUS_20790 gene purQ 658109 657336 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_20790 659230 658163 gene locus_tag LOCUS_20800 659230 658163 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874516.1 protein_id gnl|my_center|LOCUS_20800 660549 659227 gene locus_tag LOCUS_20810 660549 659227 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_20810 661102 660569 gene locus_tag LOCUS_20820 661102 660569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 661183 661887 gene locus_tag LOCUS_20830 661183 661887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 662433 670235 gene locus_tag LOCUS_20840 662433 670235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 670845 670360 gene locus_tag LOCUS_20850 670845 670360 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_20850 670986 671900 gene locus_tag LOCUS_20860 670986 671900 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_20860 672599 671913 gene locus_tag LOCUS_20870 672599 671913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 673516 672596 gene locus_tag LOCUS_20880 673516 672596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 674874 673636 gene locus_tag LOCUS_20890 gene lpxB 674874 673636 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_20890 675569 674919 gene locus_tag LOCUS_20900 675569 674919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 677281 675644 gene locus_tag LOCUS_20910 677281 675644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 677471 677205 gene locus_tag LOCUS_20920 677471 677205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 677373 678692 gene locus_tag LOCUS_20930 gene rsmB 677373 678692 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932290.1 protein_id gnl|my_center|LOCUS_20930 678801 679262 gene locus_tag LOCUS_20940 678801 679262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 679412 680194 gene locus_tag LOCUS_20950 679412 680194 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_20950 680357 682336 gene locus_tag LOCUS_20960 gene dxs 680357 682336 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_20960 682441 683310 gene locus_tag LOCUS_20970 682441 683310 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_20970 685282 683315 gene locus_tag LOCUS_20980 685282 683315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 685992 685279 gene locus_tag LOCUS_20990 685992 685279 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124311.1 protein_id gnl|my_center|LOCUS_20990 688373 686097 gene locus_tag LOCUS_21000 688373 686097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 688514 688717 gene locus_tag LOCUS_21010 688514 688717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 688790 690325 gene locus_tag LOCUS_21020 688790 690325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 693059 690330 gene locus_tag LOCUS_21030 693059 690330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 693708 693016 gene locus_tag LOCUS_21040 693708 693016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339558.1 protein_id gnl|my_center|LOCUS_21040 694327 693827 gene locus_tag LOCUS_21050 694327 693827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 694640 695563 gene locus_tag LOCUS_21060 694640 695563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 695610 696407 gene locus_tag LOCUS_21070 gene cmk 695610 696407 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420163.1 protein_id gnl|my_center|LOCUS_21070 696460 697242 gene locus_tag LOCUS_21080 696460 697242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 698084 697218 gene locus_tag LOCUS_21090 gene htpX 698084 697218 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_21090 698544 699287 gene locus_tag LOCUS_21100 698544 699287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 699491 700606 gene locus_tag LOCUS_21110 gene pdhA 699491 700606 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_21110 700688 701740 gene locus_tag LOCUS_21120 700688 701740 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947288.1 protein_id gnl|my_center|LOCUS_21120 701865 703253 gene locus_tag LOCUS_21130 701865 703253 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863439.1 protein_id gnl|my_center|LOCUS_21130 703309 704496 gene locus_tag LOCUS_21140 703309 704496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 704661 707588 gene locus_tag LOCUS_21150 704661 707588 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123442.1 protein_id gnl|my_center|LOCUS_21150 708740 707598 gene locus_tag LOCUS_21160 708740 707598 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_21160 708732 709160 gene locus_tag LOCUS_21170 708732 709160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 710048 709521 gene locus_tag LOCUS_21180 710048 709521 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_21180 711217 710045 gene locus_tag LOCUS_21190 711217 710045 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121452.1 protein_id gnl|my_center|LOCUS_21190 711361 711822 gene locus_tag LOCUS_21200 711361 711822 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531769.1 protein_id gnl|my_center|LOCUS_21200 712473 711826 gene locus_tag LOCUS_21210 gene fsa 712473 711826 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667670.1 protein_id gnl|my_center|LOCUS_21210 712932 714842 gene locus_tag LOCUS_21220 712932 714842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 715492 715010 gene locus_tag LOCUS_21230 715492 715010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 715754 719188 gene locus_tag LOCUS_21240 715754 719188 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073269.1 protein_id gnl|my_center|LOCUS_21240 719939 719202 gene locus_tag LOCUS_21250 719939 719202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 720583 719936 gene locus_tag LOCUS_21260 720583 719936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 721286 720684 gene locus_tag LOCUS_21270 721286 720684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 722035 721283 gene locus_tag LOCUS_21280 722035 721283 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_21280 722186 722584 gene locus_tag LOCUS_21290 722186 722584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 722614 722853 gene locus_tag LOCUS_21300 722614 722853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 722879 723514 gene locus_tag LOCUS_21310 722879 723514 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_21310 723511 725493 gene locus_tag LOCUS_21320 723511 725493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 726485 725490 gene locus_tag LOCUS_21330 726485 725490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 726670 727728 gene locus_tag LOCUS_21340 726670 727728 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_21340 727817 729151 gene locus_tag LOCUS_21350 727817 729151 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975254.1 protein_id gnl|my_center|LOCUS_21350 730255 729167 gene locus_tag LOCUS_21360 730255 729167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 730465 731472 gene locus_tag LOCUS_21370 gene prfB 730465 731472 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141233.1 protein_id gnl|my_center|LOCUS_21370 731782 733659 gene locus_tag LOCUS_21380 731782 733659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 733974 733663 gene locus_tag LOCUS_21390 733974 733663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 734071 734937 gene locus_tag LOCUS_21400 734071 734937 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887711.1 protein_id gnl|my_center|LOCUS_21400 735751 734945 gene locus_tag LOCUS_21410 735751 734945 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258788.1 protein_id gnl|my_center|LOCUS_21410 737053 735761 gene locus_tag LOCUS_21420 737053 735761 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_21420 738008 737148 gene locus_tag LOCUS_21430 738008 737148 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 protein_id gnl|my_center|LOCUS_21430 740215 738005 gene locus_tag LOCUS_21440 740215 738005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 740291 740485 gene locus_tag LOCUS_21450 740291 740485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 744329 740841 gene locus_tag LOCUS_21460 744329 740841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 745000 744440 gene locus_tag LOCUS_21470 745000 744440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 746292 745018 gene locus_tag LOCUS_21480 gene tgt 746292 745018 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_21480 747245 746292 gene locus_tag LOCUS_21490 747245 746292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 747961 747347 gene locus_tag LOCUS_21500 747961 747347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 748063 748821 gene locus_tag LOCUS_21510 748063 748821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_21510 748818 749858 gene locus_tag LOCUS_21520 748818 749858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 751249 749918 gene locus_tag LOCUS_21530 751249 749918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_21530 751370 751684 gene locus_tag LOCUS_21540 751370 751684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 753178 751697 gene locus_tag LOCUS_21550 gene lcfB 753178 751697 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_21550 753267 754100 gene locus_tag LOCUS_21560 753267 754100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 754201 755256 gene locus_tag LOCUS_21570 754201 755256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 755674 755273 gene locus_tag LOCUS_21580 gene acpS 755674 755273 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324752.1 protein_id gnl|my_center|LOCUS_21580 756057 755680 gene locus_tag LOCUS_21590 756057 755680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 756718 756107 gene locus_tag LOCUS_21600 756718 756107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 757889 756741 gene locus_tag LOCUS_21610 gene dnaJ 757889 756741 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122091.1 protein_id gnl|my_center|LOCUS_21610 758693 757899 gene locus_tag LOCUS_21620 758693 757899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 760690 759074 gene locus_tag LOCUS_21630 gene groL 760690 759074 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_21630 761095 760805 gene locus_tag LOCUS_21640 gene groES 761095 760805 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939263.1 protein_id gnl|my_center|LOCUS_21640 761872 761183 gene locus_tag LOCUS_21650 761872 761183 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039152.1 protein_id gnl|my_center|LOCUS_21650 763666 761924 gene locus_tag LOCUS_21660 gene groL 763666 761924 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_21660 764352 765023 gene locus_tag LOCUS_21670 764352 765023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 765020 765355 gene locus_tag LOCUS_21680 765020 765355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 765568 767094 gene locus_tag LOCUS_21690 765568 767094 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_21690 767136 767606 gene locus_tag LOCUS_21700 767136 767606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 767635 767850 gene locus_tag LOCUS_21710 767635 767850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 767879 768988 gene locus_tag LOCUS_21720 767879 768988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 768992 769780 gene locus_tag LOCUS_21730 768992 769780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 769777 770829 gene locus_tag LOCUS_21740 769777 770829 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_21740 770881 771828 gene locus_tag LOCUS_21750 770881 771828 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 protein_id gnl|my_center|LOCUS_21750 772998 771880 gene locus_tag LOCUS_21760 772998 771880 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_21760 773779 773186 gene locus_tag LOCUS_21770 773779 773186 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_21770 773902 775641 gene locus_tag LOCUS_21780 773902 775641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 776878 775658 gene locus_tag LOCUS_21790 776878 775658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 779127 777010 gene locus_tag LOCUS_21800 779127 777010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 780371 779706 gene locus_tag LOCUS_21810 780371 779706 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_21810 780881 781849 gene locus_tag LOCUS_21820 780881 781849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 781877 782431 gene locus_tag LOCUS_21830 gene ribE 781877 782431 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_21830 782428 783012 gene locus_tag LOCUS_21840 782428 783012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 783009 783941 gene locus_tag LOCUS_21850 gene ftsY 783009 783941 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_21850 784898 783963 gene locus_tag LOCUS_21860 784898 783963 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922490.1 protein_id gnl|my_center|LOCUS_21860 784803 785126 gene locus_tag LOCUS_21870 784803 785126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 785633 785139 gene locus_tag LOCUS_21880 gene rpsG 785633 785139 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_21880 786313 785846 gene locus_tag LOCUS_21890 gene rpsL 786313 785846 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 protein_id gnl|my_center|LOCUS_21890 786579 787661 gene locus_tag LOCUS_21900 786579 787661 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_21900 787867 787583 gene locus_tag LOCUS_21910 787867 787583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 787794 788735 gene locus_tag LOCUS_21920 gene pstC 787794 788735 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941759.1 protein_id gnl|my_center|LOCUS_21920 788735 790039 gene locus_tag LOCUS_21930 788735 790039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 790033 790926 gene locus_tag LOCUS_21940 gene pstB 790033 790926 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941757.1 protein_id gnl|my_center|LOCUS_21940 791451 790939 gene locus_tag LOCUS_21950 791451 790939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 804698 791448 gene locus_tag LOCUS_21960 804698 791448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 805862 804858 gene locus_tag LOCUS_21970 805862 804858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 807424 805859 gene locus_tag LOCUS_21980 807424 805859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 808975 807500 gene locus_tag LOCUS_21990 808975 807500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 809613 808972 gene locus_tag LOCUS_22000 809613 808972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 810087 809617 gene locus_tag LOCUS_22010 810087 809617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 810863 810084 gene locus_tag LOCUS_22020 810863 810084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 811451 810960 gene locus_tag LOCUS_22030 gene gspG 811451 810960 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202879.1 protein_id gnl|my_center|LOCUS_22030 812812 811622 gene locus_tag LOCUS_22040 812812 811622 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_22040 813615 812935 gene locus_tag LOCUS_22050 813615 812935 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_22050 813795 813882 gene locus_tag LOCUS_t00370 813795 813882 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 814872 813988 gene locus_tag LOCUS_22060 814872 813988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 814965 816281 gene locus_tag LOCUS_22070 gene tyrS 814965 816281 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_22070 816633 817448 gene locus_tag LOCUS_22080 816633 817448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123328.1 protein_id gnl|my_center|LOCUS_22080 820821 817558 gene locus_tag LOCUS_22090 820821 817558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 821063 821827 gene locus_tag LOCUS_22100 821063 821827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 821885 823048 gene locus_tag LOCUS_22110 821885 823048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144331.1 protein_id gnl|my_center|LOCUS_22110 823972 823070 gene locus_tag LOCUS_22120 823972 823070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 824721 823969 gene locus_tag LOCUS_22130 824721 823969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 824824 825894 gene locus_tag LOCUS_22140 824824 825894 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120858.1 protein_id gnl|my_center|LOCUS_22140 825907 827127 gene locus_tag LOCUS_22150 825907 827127 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_22150 827352 827552 gene locus_tag LOCUS_22160 827352 827552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 827698 828756 gene locus_tag LOCUS_22170 gene plsX 827698 828756 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_22170 828753 829796 gene locus_tag LOCUS_22180 828753 829796 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_22180 829842 830177 gene locus_tag LOCUS_22190 829842 830177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 830246 830650 gene locus_tag LOCUS_22200 830246 830650 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_22200 830705 831136 gene locus_tag LOCUS_22210 830705 831136 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615711.1 protein_id gnl|my_center|LOCUS_22210 831164 831874 gene locus_tag LOCUS_22220 831164 831874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 831931 832602 gene locus_tag LOCUS_22230 831931 832602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 833127 833672 gene locus_tag LOCUS_22240 833127 833672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 833665 834174 gene locus_tag LOCUS_22250 833665 834174 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_22250 835492 834221 gene locus_tag LOCUS_22260 gene odhB 835492 834221 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918229.1 protein_id gnl|my_center|LOCUS_22260 838422 835561 gene locus_tag LOCUS_22270 838422 835561 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_22270 838635 838985 gene locus_tag LOCUS_22280 838635 838985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 840462 838975 gene locus_tag LOCUS_22290 840462 838975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 840728 840480 gene locus_tag LOCUS_22300 840728 840480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 841311 840754 gene locus_tag LOCUS_22310 841311 840754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 841724 841362 gene locus_tag LOCUS_22320 841724 841362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 842283 841855 gene locus_tag LOCUS_22330 842283 841855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 842923 842489 gene locus_tag LOCUS_22340 842923 842489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 845558 843312 gene locus_tag LOCUS_22350 845558 843312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 845971 846549 gene locus_tag LOCUS_22360 845971 846549 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_22360 847202 846618 gene locus_tag LOCUS_22370 847202 846618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 848471 847287 gene locus_tag LOCUS_22380 848471 847287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 848675 848749 gene locus_tag LOCUS_t00380 848675 848749 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 848856 850136 gene locus_tag LOCUS_22390 848856 850136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 852512 850332 gene locus_tag LOCUS_22400 gene uvrB 852512 850332 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_22400 853599 852547 gene locus_tag LOCUS_22410 gene obgE 853599 852547 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_22410 854092 853697 gene locus_tag LOCUS_22420 854092 853697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 854713 854261 gene locus_tag LOCUS_22430 854713 854261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 854817 855647 gene locus_tag LOCUS_22440 854817 855647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 855707 856840 gene locus_tag LOCUS_22450 855707 856840 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_22450 856868 857146 gene locus_tag LOCUS_22460 856868 857146 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434762.1 protein_id gnl|my_center|LOCUS_22460 857212 858600 gene locus_tag LOCUS_22470 857212 858600 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_22470 860631 858610 gene locus_tag LOCUS_22480 860631 858610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 861030 862577 gene locus_tag LOCUS_22490 861030 862577 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_22490 862616 863959 gene locus_tag LOCUS_22500 862616 863959 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_22500 864803 863970 gene locus_tag LOCUS_22510 864803 863970 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_22510 864879 866762 gene locus_tag LOCUS_22520 864879 866762 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524104.1 protein_id gnl|my_center|LOCUS_22520 868112 866787 gene locus_tag LOCUS_22530 868112 866787 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_22530 868228 869463 gene locus_tag LOCUS_22540 gene guaD 868228 869463 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140073.1 protein_id gnl|my_center|LOCUS_22540 869603 871210 gene locus_tag LOCUS_22550 869603 871210 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816066.1 protein_id gnl|my_center|LOCUS_22550 871232 872329 gene locus_tag LOCUS_22560 871232 872329 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_22560 872339 873409 gene locus_tag LOCUS_22570 872339 873409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 873438 873818 gene locus_tag LOCUS_22580 873438 873818 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_22580 873927 874979 gene locus_tag LOCUS_22590 873927 874979 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_22590 875018 875737 gene locus_tag LOCUS_22600 875018 875737 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_22600 875882 876157 gene locus_tag LOCUS_22610 875882 876157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 876611 876255 gene locus_tag LOCUS_22620 876611 876255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 878728 876608 gene locus_tag LOCUS_22630 878728 876608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 878902 879441 gene locus_tag LOCUS_22640 878902 879441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 879677 882775 gene locus_tag LOCUS_22650 gene ileS 879677 882775 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939213.1 protein_id gnl|my_center|LOCUS_22650 882809 883801 gene locus_tag LOCUS_22660 882809 883801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 883893 885335 gene locus_tag LOCUS_22670 883893 885335 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_22670 885383 886603 gene locus_tag LOCUS_22680 gene truD 885383 886603 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393246.1 protein_id gnl|my_center|LOCUS_22680 887296 886550 gene locus_tag LOCUS_22690 gene mntR 887296 886550 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414136.1 protein_id gnl|my_center|LOCUS_22690 887596 887381 gene locus_tag LOCUS_22700 887596 887381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 887538 888428 gene locus_tag LOCUS_22710 887538 888428 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_22710 888425 889252 gene locus_tag LOCUS_22720 888425 889252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_22720 889249 890628 gene locus_tag LOCUS_22730 889249 890628 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_22730 890628 891935 gene locus_tag LOCUS_22740 890628 891935 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_22740 893151 891955 gene locus_tag LOCUS_22750 893151 891955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 893259 893885 gene locus_tag LOCUS_22760 893259 893885 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211011.1 protein_id gnl|my_center|LOCUS_22760 893994 894944 gene locus_tag LOCUS_22770 893994 894944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 896454 894970 gene locus_tag LOCUS_22780 896454 894970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 897471 896521 gene locus_tag LOCUS_22790 gene trpC 897471 896521 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_22790 897392 898348 gene locus_tag LOCUS_22800 897392 898348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 898384 899430 gene locus_tag LOCUS_22810 898384 899430 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_22810 899489 900097 gene locus_tag LOCUS_22820 899489 900097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 900166 902172 gene locus_tag LOCUS_22830 gene asnB 900166 902172 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_22830 902310 903092 gene locus_tag LOCUS_22840 902310 903092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 903767 903111 gene locus_tag LOCUS_22850 903767 903111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 904946 903861 gene locus_tag LOCUS_22860 904946 903861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 905829 905026 gene locus_tag LOCUS_22870 gene flgG 905829 905026 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329888.1 protein_id gnl|my_center|LOCUS_22870 906704 905922 gene locus_tag LOCUS_22880 gene flgF 906704 905922 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_22880 906985 906755 gene locus_tag LOCUS_22890 906985 906755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 907064 909925 gene locus_tag LOCUS_22900 907064 909925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 910952 909939 gene locus_tag LOCUS_22910 910952 909939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 911064 912464 gene locus_tag LOCUS_22920 911064 912464 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_22920 912582 913922 gene locus_tag LOCUS_22930 912582 913922 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_22930 914053 914322 gene locus_tag LOCUS_22940 gene rpsO 914053 914322 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354983.1 protein_id gnl|my_center|LOCUS_22940 914675 916852 gene locus_tag LOCUS_22950 gene pnp 914675 916852 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_22950 918226 917003 gene locus_tag LOCUS_22960 918226 917003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 918870 918223 gene locus_tag LOCUS_22970 918870 918223 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_22970 919236 918871 gene locus_tag LOCUS_22980 919236 918871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 919350 919973 gene locus_tag LOCUS_22990 919350 919973 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_22990 919982 920482 gene locus_tag LOCUS_23000 919982 920482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 920479 921438 gene locus_tag LOCUS_23010 920479 921438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 921843 921442 gene locus_tag LOCUS_23020 921843 921442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 922886 921840 gene locus_tag LOCUS_23030 922886 921840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 925807 922883 gene locus_tag LOCUS_23040 925807 922883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 928470 925804 gene locus_tag LOCUS_23050 928470 925804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 928918 928499 gene locus_tag LOCUS_23060 928918 928499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 929340 928915 gene locus_tag LOCUS_23070 929340 928915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 930128 929337 gene locus_tag LOCUS_23080 930128 929337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 931291 930128 gene locus_tag LOCUS_23090 931291 930128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 932263 931295 gene locus_tag LOCUS_23100 932263 931295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 932352 933155 gene locus_tag LOCUS_23110 gene pyrH 932352 933155 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_23110 933253 933825 gene locus_tag LOCUS_23120 gene frr 933253 933825 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_23120 935714 933909 gene locus_tag LOCUS_23130 gene sppA 935714 933909 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898564.1 protein_id gnl|my_center|LOCUS_23130 936171 935761 gene locus_tag LOCUS_23140 936171 935761 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862613.1 protein_id gnl|my_center|LOCUS_23140 937058 936168 gene locus_tag LOCUS_23150 937058 936168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 937282 938277 gene locus_tag LOCUS_23160 937282 938277 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_23160 938313 938576 gene locus_tag LOCUS_23170 938313 938576 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_23170 939430 938585 gene locus_tag LOCUS_23180 939430 938585 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_23180 940907 939519 gene locus_tag LOCUS_23190 gene tig 940907 939519 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930702.1 protein_id gnl|my_center|LOCUS_23190 941186 942868 gene locus_tag LOCUS_23200 941186 942868 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_23200 943041 944435 gene locus_tag LOCUS_23210 943041 944435 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366353.1 protein_id gnl|my_center|LOCUS_23210 945423 944548 gene locus_tag LOCUS_23220 945423 944548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 945683 946882 gene locus_tag LOCUS_23230 945683 946882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141728.1 protein_id gnl|my_center|LOCUS_23230 947318 946926 gene locus_tag LOCUS_23240 947318 946926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 948151 947315 gene locus_tag LOCUS_23250 948151 947315 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530055.1 protein_id gnl|my_center|LOCUS_23250 949474 948188 gene locus_tag LOCUS_23260 gene gcvT 949474 948188 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404363.1 protein_id gnl|my_center|LOCUS_23260 949550 951583 gene locus_tag LOCUS_23270 949550 951583 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946450.1 protein_id gnl|my_center|LOCUS_23270 951691 952017 gene locus_tag LOCUS_23280 951691 952017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 952112 954406 gene locus_tag LOCUS_23290 952112 954406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 954518 955951 gene locus_tag LOCUS_23300 954518 955951 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_23300 955986 956243 gene locus_tag LOCUS_23310 955986 956243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 956436 956720 gene locus_tag LOCUS_23320 956436 956720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 956720 957070 gene locus_tag LOCUS_23330 956720 957070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 957212 957523 gene locus_tag LOCUS_23340 957212 957523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23340 958152 957688 gene locus_tag LOCUS_23350 958152 957688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 959354 958455 gene locus_tag LOCUS_23360 959354 958455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 960519 959347 gene locus_tag LOCUS_23370 960519 959347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 962895 960592 gene locus_tag LOCUS_23380 962895 960592 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047777.1 protein_id gnl|my_center|LOCUS_23380 964009 962804 gene locus_tag LOCUS_23390 964009 962804 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047778.1 protein_id gnl|my_center|LOCUS_23390 965268 964153 gene locus_tag LOCUS_23400 965268 964153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 965555 968419 gene locus_tag LOCUS_23410 965555 968419 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_23410 968423 970336 gene locus_tag LOCUS_23420 968423 970336 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921779.1 protein_id gnl|my_center|LOCUS_23420 970333 972093 gene locus_tag LOCUS_23430 970333 972093 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_23430 972090 974777 gene locus_tag LOCUS_23440 972090 974777 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_23440 975433 974801 gene locus_tag LOCUS_23450 975433 974801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 975459 976019 gene locus_tag LOCUS_23460 975459 976019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 976950 976045 gene locus_tag LOCUS_23470 976950 976045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 977530 976943 gene locus_tag LOCUS_23480 977530 976943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 978554 977523 gene locus_tag LOCUS_23490 978554 977523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 979691 978873 gene locus_tag LOCUS_23500 979691 978873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 981704 979704 gene locus_tag LOCUS_23510 981704 979704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 982163 981708 gene locus_tag LOCUS_23520 982163 981708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 982417 982145 gene locus_tag LOCUS_23530 982417 982145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 982915 982448 gene locus_tag LOCUS_23540 982915 982448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 983148 982912 gene locus_tag LOCUS_23550 983148 982912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 983696 983163 gene locus_tag LOCUS_23560 983696 983163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 984160 983732 gene locus_tag LOCUS_23570 984160 983732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 984466 984212 gene locus_tag LOCUS_23580 984466 984212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 984901 984470 gene locus_tag LOCUS_23590 984901 984470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 985161 984898 gene locus_tag LOCUS_23600 985161 984898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 985559 985161 gene locus_tag LOCUS_23610 985559 985161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 985995 985585 gene locus_tag LOCUS_23620 985995 985585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 988128 986002 gene locus_tag LOCUS_23630 988128 986002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 989623 988121 gene locus_tag LOCUS_23640 989623 988121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 989835 989623 gene locus_tag LOCUS_23650 989835 989623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 992555 990270 gene locus_tag LOCUS_23660 992555 990270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 992805 992545 gene locus_tag LOCUS_23670 992805 992545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 993004 992783 gene locus_tag LOCUS_23680 993004 992783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 992985 993314 gene locus_tag LOCUS_23690 992985 993314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 993327 993692 gene locus_tag LOCUS_23700 993327 993692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 993762 994016 gene locus_tag LOCUS_23710 993762 994016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 994110 994727 gene locus_tag LOCUS_23720 994110 994727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 994731 994994 gene locus_tag LOCUS_23730 994731 994994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 996379 995003 gene locus_tag LOCUS_23740 996379 995003 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_23740 996459 996534 gene locus_tag LOCUS_t00390 996459 996534 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 996782 996537 gene locus_tag LOCUS_23750 996782 996537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 999123 996943 gene locus_tag LOCUS_23760 999123 996943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 999519 999127 gene locus_tag LOCUS_23770 999519 999127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1001225 999534 gene locus_tag LOCUS_23780 1001225 999534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 1001503 1001225 gene locus_tag LOCUS_23790 1001503 1001225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 1001880 1001500 gene locus_tag LOCUS_23800 1001880 1001500 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140020.1 protein_id gnl|my_center|LOCUS_23800 1002353 1001877 gene locus_tag LOCUS_23810 1002353 1001877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1003300 1002368 gene locus_tag LOCUS_23820 1003300 1002368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1003710 1003297 gene locus_tag LOCUS_23830 1003710 1003297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1004848 1003931 gene locus_tag LOCUS_23840 1004848 1003931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1006227 1004872 gene locus_tag LOCUS_23850 1006227 1004872 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921303.1 protein_id gnl|my_center|LOCUS_23850 1006418 1006344 gene locus_tag LOCUS_t00400 1006418 1006344 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1007215 1007030 gene locus_tag LOCUS_23860 1007215 1007030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 1007617 1007408 gene locus_tag LOCUS_23870 1007617 1007408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1008625 1007771 gene locus_tag LOCUS_23880 1008625 1007771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1010044 1008968 gene locus_tag LOCUS_23890 1010044 1008968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1011699 1010044 gene locus_tag LOCUS_23900 1011699 1010044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1011795 1011983 gene locus_tag LOCUS_23910 1011795 1011983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1012628 1011885 gene locus_tag LOCUS_23920 gene accD 1012628 1011885 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_23920 1013290 1012961 gene locus_tag LOCUS_23930 1013290 1012961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 1013426 1014097 gene locus_tag LOCUS_23940 1013426 1014097 CDS product DUF1956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792895.1 protein_id gnl|my_center|LOCUS_23940 1014094 1015248 gene locus_tag LOCUS_23950 1014094 1015248 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_23950 1015344 1016183 gene locus_tag LOCUS_23960 1015344 1016183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_23960 1016180 1017283 gene locus_tag LOCUS_23970 1016180 1017283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1017280 1018893 gene locus_tag LOCUS_23980 1017280 1018893 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_23980 1020073 1018883 gene locus_tag LOCUS_23990 1020073 1018883 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189302.1 protein_id gnl|my_center|LOCUS_23990 1020604 1021602 gene locus_tag LOCUS_24000 gene cyoE 1020604 1021602 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_24000 1021618 1022655 gene locus_tag LOCUS_24010 1021618 1022655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405088.1 protein_id gnl|my_center|LOCUS_24010 1022652 1023419 gene locus_tag LOCUS_24020 1022652 1023419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_24020 1024460 1023429 gene locus_tag LOCUS_24030 1024460 1023429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 1025458 1024472 gene locus_tag LOCUS_24040 gene speB 1025458 1024472 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_24040 1027602 1025572 gene locus_tag LOCUS_24050 1027602 1025572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1029884 1027956 gene locus_tag LOCUS_24060 1029884 1027956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1032431 1030503 gene locus_tag LOCUS_24070 1032431 1030503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1034492 1033494 gene locus_tag LOCUS_24080 1034492 1033494 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_24080 1034577 1035419 gene locus_tag LOCUS_24090 1034577 1035419 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339141.1 protein_id gnl|my_center|LOCUS_24090 1035435 1036337 gene locus_tag LOCUS_24100 1035435 1036337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1036802 1036395 gene locus_tag LOCUS_24110 1036802 1036395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 1036847 1037977 gene locus_tag LOCUS_24120 gene queA 1036847 1037977 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143576.1 protein_id gnl|my_center|LOCUS_24120 1038030 1038191 gene locus_tag LOCUS_24130 1038030 1038191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 1038405 1039568 gene locus_tag LOCUS_24140 1038405 1039568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1039650 1040420 gene locus_tag LOCUS_24150 1039650 1040420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1040749 1041738 gene locus_tag LOCUS_24160 gene xerC 1040749 1041738 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_24160 1043136 1041799 gene locus_tag LOCUS_24170 1043136 1041799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1043680 1043186 gene locus_tag LOCUS_24180 gene folK 1043680 1043186 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_24180 1044693 1043794 gene locus_tag LOCUS_24190 1044693 1043794 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_24190 1045183 1044848 gene locus_tag LOCUS_24200 1045183 1044848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 1047859 1045688 gene locus_tag LOCUS_24210 gene flhA 1047859 1045688 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_24210 1049015 1047903 gene locus_tag LOCUS_24220 gene flhB 1049015 1047903 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_24220 1049836 1049015 gene locus_tag LOCUS_24230 gene fliR 1049836 1049015 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462790.1 protein_id gnl|my_center|LOCUS_24230 1050133 1049876 gene locus_tag LOCUS_24240 gene fliQ 1050133 1049876 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655982.1 protein_id gnl|my_center|LOCUS_24240 1051134 1050148 gene locus_tag LOCUS_24250 gene fliP 1051134 1050148 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118329.1 protein_id gnl|my_center|LOCUS_24250 1051907 1051131 gene locus_tag LOCUS_24260 1051907 1051131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 1052384 1051977 gene locus_tag LOCUS_24270 1052384 1051977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1053065 1052547 gene locus_tag LOCUS_24280 1053065 1052547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1053557 1053222 gene locus_tag LOCUS_24290 1053557 1053222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1055318 1053567 gene locus_tag LOCUS_24300 1055318 1053567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1055944 1055477 gene locus_tag LOCUS_24310 1055944 1055477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 1056372 1055941 gene locus_tag LOCUS_24320 1056372 1055941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 1057689 1056403 gene locus_tag LOCUS_24330 1057689 1056403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1058453 1057701 gene locus_tag LOCUS_24340 1058453 1057701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1058917 1058450 gene locus_tag LOCUS_24350 1058917 1058450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1060324 1058966 gene locus_tag LOCUS_24360 gene fliI 1060324 1058966 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_24360 1061079 1060321 gene locus_tag LOCUS_24370 1061079 1060321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1062167 1061127 gene locus_tag LOCUS_24380 gene fliG 1062167 1061127 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_24380 1063913 1062204 gene locus_tag LOCUS_24390 1063913 1062204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1064819 1064208 gene locus_tag LOCUS_24400 1064819 1064208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1065576 1065501 gene locus_tag LOCUS_t00410 1065576 1065501 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1066067 1066345 gene locus_tag LOCUS_24410 gene rpsT 1066067 1066345 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 protein_id gnl|my_center|LOCUS_24410 1066578 1067342 gene locus_tag LOCUS_24420 1066578 1067342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1068419 1067541 gene locus_tag LOCUS_24430 1068419 1067541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 1069151 1069453 gene locus_tag LOCUS_24440 1069151 1069453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 1069833 1069909 gene locus_tag LOCUS_t00420 1069833 1069909 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1071661 1070465 gene locus_tag LOCUS_24450 1071661 1070465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1072658 1071654 gene locus_tag LOCUS_24460 1072658 1071654 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376717.1 protein_id gnl|my_center|LOCUS_24460 1073659 1072661 gene locus_tag LOCUS_24470 1073659 1072661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1074297 1073809 gene locus_tag LOCUS_24480 1074297 1073809 CDS product DUF1579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169262433.1 protein_id gnl|my_center|LOCUS_24480 1075318 1074593 gene locus_tag LOCUS_24490 1075318 1074593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1076106 1075315 gene locus_tag LOCUS_24500 1076106 1075315 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776940.1 protein_id gnl|my_center|LOCUS_24500 1077086 1076106 gene locus_tag LOCUS_24510 1077086 1076106 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197226.1 protein_id gnl|my_center|LOCUS_24510 1077779 1077087 gene locus_tag LOCUS_24520 gene pxpB 1077779 1077087 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266314.1 protein_id gnl|my_center|LOCUS_24520 1081179 1077787 gene locus_tag LOCUS_24530 1081179 1077787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1083025 1081307 gene locus_tag LOCUS_24540 1083025 1081307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1086164 1083162 gene locus_tag LOCUS_24550 1086164 1083162 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_24550 1086529 1086179 gene locus_tag LOCUS_24560 1086529 1086179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1086465 1086623 gene locus_tag LOCUS_24570 1086465 1086623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1086814 1087890 gene locus_tag LOCUS_24580 1086814 1087890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1087953 1088963 gene locus_tag LOCUS_24590 1087953 1088963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 1088989 1090008 gene locus_tag LOCUS_24600 1088989 1090008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1090102 1090440 gene locus_tag LOCUS_24610 gene trxA 1090102 1090440 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693835.1 protein_id gnl|my_center|LOCUS_24610 1091342 1090431 gene locus_tag LOCUS_24620 1091342 1090431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1091580 1093124 gene locus_tag LOCUS_24630 1091580 1093124 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023258.1 protein_id gnl|my_center|LOCUS_24630 1093117 1093821 gene locus_tag LOCUS_24640 gene rpiA 1093117 1093821 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259045.1 protein_id gnl|my_center|LOCUS_24640 1095347 1093842 gene locus_tag LOCUS_24650 1095347 1093842 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228743.1 protein_id gnl|my_center|LOCUS_24650 1095695 1096345 gene locus_tag LOCUS_24660 1095695 1096345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1096409 1097629 gene locus_tag LOCUS_24670 1096409 1097629 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404674.1 protein_id gnl|my_center|LOCUS_24670 1097657 1100602 gene locus_tag LOCUS_24680 gene polA 1097657 1100602 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933331.1 protein_id gnl|my_center|LOCUS_24680 1101610 1100615 gene locus_tag LOCUS_24690 1101610 1100615 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_24690 1102920 1101616 gene locus_tag LOCUS_24700 gene purF 1102920 1101616 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_24700 1103724 1103242 gene locus_tag LOCUS_24710 1103724 1103242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 1104425 1103853 gene locus_tag LOCUS_24720 1104425 1103853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1105033 1104476 gene locus_tag LOCUS_24730 1105033 1104476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1105635 1105030 gene locus_tag LOCUS_24740 1105635 1105030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1106684 1105632 gene locus_tag LOCUS_24750 1106684 1105632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1107907 1106681 gene locus_tag LOCUS_24760 1107907 1106681 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_24760 1109661 1107904 gene locus_tag LOCUS_24770 gene pilB 1109661 1107904 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_24770 1109993 1109658 gene locus_tag LOCUS_24780 1109993 1109658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1111823 1110006 gene locus_tag LOCUS_24790 1111823 1110006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1113414 1111921 gene locus_tag LOCUS_24800 1113414 1111921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 1113846 1113430 gene locus_tag LOCUS_24810 1113846 1113430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1114055 1114537 gene locus_tag LOCUS_24820 1114055 1114537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 1114597 1115595 gene locus_tag LOCUS_24830 1114597 1115595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 1115613 1116113 gene locus_tag LOCUS_24840 1115613 1116113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1116110 1117384 gene locus_tag LOCUS_24850 1116110 1117384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1117441 1118586 gene locus_tag LOCUS_24860 1117441 1118586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1119819 1118599 gene locus_tag LOCUS_24870 1119819 1118599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1120641 1119961 gene locus_tag LOCUS_24880 gene pdxH 1120641 1119961 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_24880 1120776 1121468 gene locus_tag LOCUS_24890 1120776 1121468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 1121502 1122560 gene locus_tag LOCUS_24900 1121502 1122560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1123374 1122571 gene locus_tag LOCUS_24910 gene tpiA 1123374 1122571 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_24910 1124130 1123552 gene locus_tag LOCUS_24920 gene ispF 1124130 1123552 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_24920 1124516 1124127 gene locus_tag LOCUS_24930 1124516 1124127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 1128487 1124645 gene locus_tag LOCUS_24940 1128487 1124645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1129669 1128494 gene locus_tag LOCUS_24950 1129669 1128494 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040570.1 protein_id gnl|my_center|LOCUS_24950 1131214 1129685 gene locus_tag LOCUS_24960 1131214 1129685 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_24960 1131461 1131775 gene locus_tag LOCUS_24970 gene gatC 1131461 1131775 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_24970 1131772 1133280 gene locus_tag LOCUS_24980 gene gatA 1131772 1133280 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888491.1 protein_id gnl|my_center|LOCUS_24980 1136706 1133296 gene locus_tag LOCUS_24990 gene mfd 1136706 1133296 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_24990 1136781 1138031 gene locus_tag LOCUS_25000 1136781 1138031 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_25000 1138240 1139109 gene locus_tag LOCUS_25010 1138240 1139109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1139870 1139220 gene locus_tag LOCUS_25020 1139870 1139220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1140063 1141310 gene locus_tag LOCUS_25030 1140063 1141310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 1141423 1144392 gene locus_tag LOCUS_25040 1141423 1144392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1145947 1144403 gene locus_tag LOCUS_25050 gene pyk 1145947 1144403 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_25050 1146139 1147236 gene locus_tag LOCUS_25060 1146139 1147236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 1148579 1147257 gene locus_tag LOCUS_25070 1148579 1147257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 1148649 1149371 gene locus_tag LOCUS_25080 1148649 1149371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1149403 1150344 gene locus_tag LOCUS_25090 1149403 1150344 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840050.1 protein_id gnl|my_center|LOCUS_25090 1159993 1150436 gene locus_tag LOCUS_25100 1159993 1150436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1161919 1160660 gene locus_tag LOCUS_25110 gene pheA 1161919 1160660 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_25110 1163723 1162041 gene locus_tag LOCUS_25120 1163723 1162041 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_25120 1165492 1163720 gene locus_tag LOCUS_25130 1165492 1163720 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061939.1 protein_id gnl|my_center|LOCUS_25130 1167803 1165566 gene locus_tag LOCUS_25140 1167803 1165566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 1168238 1167879 gene locus_tag LOCUS_25150 gene nuoK 1168238 1167879 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813920.1 protein_id gnl|my_center|LOCUS_25150 1169251 1168235 gene locus_tag LOCUS_25160 1169251 1168235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1169490 1170116 gene locus_tag LOCUS_25170 gene pgsA 1169490 1170116 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_25170 1170120 1170626 gene locus_tag LOCUS_25180 1170120 1170626 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389622.1 protein_id gnl|my_center|LOCUS_25180 1171039 1170635 gene locus_tag LOCUS_25190 1171039 1170635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1171938 1171162 gene locus_tag LOCUS_25200 1171938 1171162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1173773 1171956 gene locus_tag LOCUS_25210 1173773 1171956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1176376 1173770 gene locus_tag LOCUS_25220 1176376 1173770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 1177964 1176525 gene locus_tag LOCUS_25230 1177964 1176525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1178344 1179450 gene locus_tag LOCUS_25240 1178344 1179450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 1180997 1179540 gene locus_tag LOCUS_25250 gene hisS 1180997 1179540 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_25250 1181293 1182720 gene locus_tag LOCUS_25260 1181293 1182720 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080843.1 protein_id gnl|my_center|LOCUS_25260 1182764 1184314 gene locus_tag LOCUS_25270 1182764 1184314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324153.1 protein_id gnl|my_center|LOCUS_25270 1184443 1184994 gene locus_tag LOCUS_25280 1184443 1184994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1186240 1185011 gene locus_tag LOCUS_25290 gene sucC 1186240 1185011 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_25290 1186297 1186866 gene locus_tag LOCUS_25300 gene aroL 1186297 1186866 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938191.1 protein_id gnl|my_center|LOCUS_25300 1187510 1186878 gene locus_tag LOCUS_25310 1187510 1186878 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392851.1 protein_id gnl|my_center|LOCUS_25310 1187723 1188856 gene locus_tag LOCUS_25320 1187723 1188856 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479989.1 protein_id gnl|my_center|LOCUS_25320 1189076 1189582 gene locus_tag LOCUS_25330 1189076 1189582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 1189676 1189885 gene locus_tag LOCUS_25340 1189676 1189885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 1191544 1189829 gene locus_tag LOCUS_25350 gene aroE 1191544 1189829 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_25350 1191668 1193338 gene locus_tag LOCUS_25360 1191668 1193338 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931733.1 protein_id gnl|my_center|LOCUS_25360 1193335 1194867 gene locus_tag LOCUS_25370 gene murF 1193335 1194867 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_25370 1194904 1196070 gene locus_tag LOCUS_25380 gene mraY 1194904 1196070 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_25380 1197360 1196074 gene locus_tag LOCUS_25390 1197360 1196074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 1198457 1197357 gene locus_tag LOCUS_25400 1198457 1197357 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_25400 1199206 1198454 gene locus_tag LOCUS_25410 1199206 1198454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1202796 1199206 gene locus_tag LOCUS_25420 1202796 1199206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1202783 1203004 gene locus_tag LOCUS_25430 1202783 1203004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1205663 1203234 gene locus_tag LOCUS_25440 1205663 1203234 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921971.1 protein_id gnl|my_center|LOCUS_25440 1208083 1205660 gene locus_tag LOCUS_25450 1208083 1205660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1209181 1208159 gene locus_tag LOCUS_25460 1209181 1208159 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_25460 1209317 1211185 gene locus_tag LOCUS_25470 gene aspS 1209317 1211185 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940622.1 protein_id gnl|my_center|LOCUS_25470 1211389 1212294 gene locus_tag LOCUS_25480 1211389 1212294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1212740 1212306 gene locus_tag LOCUS_25490 1212740 1212306 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_25490 1213586 1212906 gene locus_tag LOCUS_25500 1213586 1212906 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_25500 1214403 1213618 gene locus_tag LOCUS_25510 1214403 1213618 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807573.1 protein_id gnl|my_center|LOCUS_25510 1215004 1214459 gene locus_tag LOCUS_25520 1215004 1214459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1215504 1215001 gene locus_tag LOCUS_25530 gene nrdR 1215504 1215001 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259262.1 protein_id gnl|my_center|LOCUS_25530 1217516 1215585 gene locus_tag LOCUS_25540 1217516 1215585 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_25540 1220709 1217626 gene locus_tag LOCUS_25550 gene pruA 1220709 1217626 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940575.1 protein_id gnl|my_center|LOCUS_25550 1221446 1220781 gene locus_tag LOCUS_25560 1221446 1220781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 1222440 1221637 gene locus_tag LOCUS_25570 1222440 1221637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1222325 1223572 gene locus_tag LOCUS_25580 1222325 1223572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 1223983 1223792 gene locus_tag LOCUS_25590 1223983 1223792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 1224593 1225546 gene locus_tag LOCUS_25600 1224593 1225546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1226712 1225552 gene locus_tag LOCUS_25610 1226712 1225552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 1226702 1227895 gene locus_tag LOCUS_25620 1226702 1227895 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_25620 1228364 1227918 gene locus_tag LOCUS_25630 1228364 1227918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1228719 1229183 gene locus_tag LOCUS_25640 gene mraZ 1228719 1229183 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830185.1 protein_id gnl|my_center|LOCUS_25640 1231128 1229674 gene locus_tag LOCUS_25650 1231128 1229674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1231630 1231145 gene locus_tag LOCUS_25660 1231630 1231145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1231798 1231881 gene locus_tag LOCUS_t00430 1231798 1231881 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1232202 1234265 gene locus_tag LOCUS_25670 1232202 1234265 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_25670 1234488 1237301 gene locus_tag LOCUS_25680 1234488 1237301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1238133 1237276 gene locus_tag LOCUS_25690 1238133 1237276 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616226.1 protein_id gnl|my_center|LOCUS_25690 1238177 1238686 gene locus_tag LOCUS_25700 1238177 1238686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1240715 1238697 gene locus_tag LOCUS_25710 1240715 1238697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1242967 1240769 gene locus_tag LOCUS_25720 1242967 1240769 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 protein_id gnl|my_center|LOCUS_25720 1245079 1243010 gene locus_tag LOCUS_25730 1245079 1243010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1246122 1245268 gene locus_tag LOCUS_25740 1246122 1245268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 1246477 1247568 gene locus_tag LOCUS_25750 1246477 1247568 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_25750 1248681 1247617 gene locus_tag LOCUS_25760 1248681 1247617 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_25760 1249773 1248766 gene locus_tag LOCUS_25770 1249773 1248766 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257709.1 protein_id gnl|my_center|LOCUS_25770 1250361 1249831 gene locus_tag LOCUS_25780 gene fabZ 1250361 1249831 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087619.1 protein_id gnl|my_center|LOCUS_25780 1250524 1250339 gene locus_tag LOCUS_25790 1250524 1250339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1250966 1251604 gene locus_tag LOCUS_25800 1250966 1251604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1252595 1251729 gene locus_tag LOCUS_25810 1252595 1251729 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_25810 1252833 1254116 gene locus_tag LOCUS_25820 1252833 1254116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1254650 1254213 gene locus_tag LOCUS_25830 1254650 1254213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1254896 1255951 gene locus_tag LOCUS_25840 1254896 1255951 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_25840 1256953 1256003 gene locus_tag LOCUS_25850 1256953 1256003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 1257421 1257035 gene locus_tag LOCUS_25860 1257421 1257035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1257661 1258257 gene locus_tag LOCUS_25870 1257661 1258257 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_25870 1260273 1258318 gene locus_tag LOCUS_25880 1260273 1258318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1261094 1260495 gene locus_tag LOCUS_25890 gene rpsD 1261094 1260495 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869903.1 protein_id gnl|my_center|LOCUS_25890 1262048 1261392 gene locus_tag LOCUS_25900 1262048 1261392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1263851 1262375 gene locus_tag LOCUS_r00010 1263851 1262375 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1265474 1264530 gene locus_tag LOCUS_25910 1265474 1264530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1265604 1266557 gene locus_tag LOCUS_25920 1265604 1266557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1267533 1266574 gene locus_tag LOCUS_25930 1267533 1266574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1269599 1267530 gene locus_tag LOCUS_25940 1269599 1267530 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_25940 1269733 1271316 gene locus_tag LOCUS_25950 gene guaB 1269733 1271316 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_25950 1272034 1271342 gene locus_tag LOCUS_25960 1272034 1271342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1272274 1273521 gene locus_tag LOCUS_25970 1272274 1273521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1274014 1273529 gene locus_tag LOCUS_25980 1274014 1273529 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930868.1 protein_id gnl|my_center|LOCUS_25980 1274164 1276419 gene locus_tag LOCUS_25990 1274164 1276419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1276416 1277534 gene locus_tag LOCUS_26000 1276416 1277534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1277562 1279364 gene locus_tag LOCUS_26010 1277562 1279364 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_26010 1280122 1279400 gene locus_tag LOCUS_26020 1280122 1279400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1280249 1280950 gene locus_tag LOCUS_26030 gene mqnB 1280249 1280950 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_26030 1281151 1282422 gene locus_tag LOCUS_26040 1281151 1282422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 1282474 1283316 gene locus_tag LOCUS_26050 1282474 1283316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 1283313 1283870 gene locus_tag LOCUS_26060 1283313 1283870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1283867 1284547 gene locus_tag LOCUS_26070 1283867 1284547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1284607 1286664 gene locus_tag LOCUS_26080 1284607 1286664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 1289296 1286699 gene locus_tag LOCUS_26090 1289296 1286699 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_26090 1289813 1289592 gene locus_tag LOCUS_26100 1289813 1289592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1290139 1290567 gene locus_tag LOCUS_26110 1290139 1290567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1290661 1292433 gene locus_tag LOCUS_26120 1290661 1292433 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_26120 1293714 1292536 gene locus_tag LOCUS_26130 gene metK 1293714 1292536 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_26130 1293841 1294995 gene locus_tag LOCUS_26140 gene purM 1293841 1294995 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_26140 1297499 1295010 gene locus_tag LOCUS_26150 1297499 1295010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 1299735 1297813 gene locus_tag LOCUS_26160 1299735 1297813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1301689 1300031 gene locus_tag LOCUS_26170 1301689 1300031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1303417 1301879 gene locus_tag LOCUS_26180 1303417 1301879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1304255 1303314 gene locus_tag LOCUS_26190 1304255 1303314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1305326 1306660 gene locus_tag LOCUS_26200 1305326 1306660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1308439 1306835 gene locus_tag LOCUS_26210 1308439 1306835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1309059 1309883 gene locus_tag LOCUS_26220 gene rpsB 1309059 1309883 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_26220 1310022 1310834 gene locus_tag LOCUS_26230 gene tsf 1310022 1310834 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808106.1 protein_id gnl|my_center|LOCUS_26230 1311272 1311342 gene locus_tag LOCUS_t00440 1311272 1311342 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1311418 1312203 gene locus_tag LOCUS_26240 1311418 1312203 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121125.1 protein_id gnl|my_center|LOCUS_26240 1312200 1313183 gene locus_tag LOCUS_26250 1312200 1313183 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_26250 1313251 1313943 gene locus_tag LOCUS_26260 1313251 1313943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1313974 1314660 gene locus_tag LOCUS_26270 gene pth 1313974 1314660 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_26270 1314725 1315162 gene locus_tag LOCUS_26280 gene rpsF 1314725 1315162 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552273.1 protein_id gnl|my_center|LOCUS_26280 1315347 1315802 gene locus_tag LOCUS_26290 1315347 1315802 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_26290 1316073 1316765 gene locus_tag LOCUS_26300 1316073 1316765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 1318821 1316965 gene locus_tag LOCUS_26310 1318821 1316965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 1320619 1318874 gene locus_tag LOCUS_26320 1320619 1318874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 1322033 1320876 gene locus_tag LOCUS_26330 1322033 1320876 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_26330 1323394 1322324 gene locus_tag LOCUS_26340 1323394 1322324 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_26340 1326930 1323448 gene locus_tag LOCUS_26350 1326930 1323448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1327104 1327032 gene locus_tag LOCUS_t00450 1327104 1327032 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1332757 1327307 gene locus_tag LOCUS_26360 1332757 1327307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 1334331 1333117 gene locus_tag LOCUS_26370 gene waaA 1334331 1333117 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_26370 1334457 1334385 gene locus_tag LOCUS_t00460 1334457 1334385 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1335800 1334502 gene locus_tag LOCUS_26380 1335800 1334502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1336645 1335800 gene locus_tag LOCUS_26390 1336645 1335800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_26390 1338232 1336754 gene locus_tag LOCUS_26400 1338232 1336754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 1339797 1338766 gene locus_tag LOCUS_26410 1339797 1338766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1339962 1340603 gene locus_tag LOCUS_26420 1339962 1340603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 1340774 1341058 gene locus_tag LOCUS_26430 gene rpmA 1340774 1341058 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_26430 1341971 1341147 gene locus_tag LOCUS_26440 gene kdsA 1341971 1341147 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_26440 1342679 1342038 gene locus_tag LOCUS_26450 1342679 1342038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1344080 1342743 gene locus_tag LOCUS_26460 1344080 1342743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1345339 1344143 gene locus_tag LOCUS_26470 1345339 1344143 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521284.1 protein_id gnl|my_center|LOCUS_26470 1347526 1345721 gene locus_tag LOCUS_26480 1347526 1345721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1347955 1347746 gene locus_tag LOCUS_26490 1347955 1347746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1347893 1348732 gene locus_tag LOCUS_26500 1347893 1348732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1348797 1349447 gene locus_tag LOCUS_26510 1348797 1349447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 1349462 1350220 gene locus_tag LOCUS_26520 1349462 1350220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 1352779 1350269 gene locus_tag LOCUS_26530 1352779 1350269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1353381 1352776 gene locus_tag LOCUS_26540 1353381 1352776 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_26540 1354122 1353412 gene locus_tag LOCUS_26550 1354122 1353412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1354541 1357417 gene locus_tag LOCUS_26560 gene fliD 1354541 1357417 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119371.1 protein_id gnl|my_center|LOCUS_26560 1357469 1357966 gene locus_tag LOCUS_26570 1357469 1357966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1358390 1358064 gene locus_tag LOCUS_26580 1358390 1358064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1360315 1358588 gene locus_tag LOCUS_26590 gene asnB 1360315 1358588 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114665.1 protein_id gnl|my_center|LOCUS_26590 1360965 1360441 gene locus_tag LOCUS_26600 1360965 1360441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_26600 1362132 1360990 gene locus_tag LOCUS_26610 1362132 1360990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1362214 1362861 gene locus_tag LOCUS_26620 1362214 1362861 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_26620 1363612 1362848 gene locus_tag LOCUS_26630 1363612 1362848 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_26630 1365489 1363654 gene locus_tag LOCUS_26640 1365489 1363654 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_26640 1367286 1365574 gene locus_tag LOCUS_26650 gene mtrF 1367286 1365574 CDS product AbgT family antimetabolite efflux transporter MtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951251.1 protein_id gnl|my_center|LOCUS_26650 1367667 1369370 gene locus_tag LOCUS_26660 1367667 1369370 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267236.1 protein_id gnl|my_center|LOCUS_26660 1369563 1369937 gene locus_tag LOCUS_26670 1369563 1369937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1372500 1370011 gene locus_tag LOCUS_26680 gene ppsA 1372500 1370011 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 protein_id gnl|my_center|LOCUS_26680 1372810 1372553 gene locus_tag LOCUS_26690 1372810 1372553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1373335 1372874 gene locus_tag LOCUS_26700 1373335 1372874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26700 1373800 1374480 gene locus_tag LOCUS_26710 1373800 1374480 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140230840.1 protein_id gnl|my_center|LOCUS_26710 1374565 1375077 gene locus_tag LOCUS_26720 1374565 1375077 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405077.1 protein_id gnl|my_center|LOCUS_26720 1375149 1375337 gene locus_tag LOCUS_26730 1375149 1375337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1376143 1375703 gene locus_tag LOCUS_26740 1376143 1375703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 1377112 1377864 gene locus_tag LOCUS_26750 1377112 1377864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 1379126 1378095 gene locus_tag LOCUS_26760 1379126 1378095 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_26760 1379789 1379175 gene locus_tag LOCUS_26770 1379789 1379175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 1380101 1379811 gene locus_tag LOCUS_26780 1380101 1379811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 1379994 1380233 gene locus_tag LOCUS_26790 1379994 1380233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1380616 1380323 gene locus_tag LOCUS_26800 1380616 1380323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1381109 1380522 gene locus_tag LOCUS_26810 1381109 1380522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1381550 1381242 gene locus_tag LOCUS_26820 1381550 1381242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1382082 1381603 gene locus_tag LOCUS_26830 1382082 1381603 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 protein_id gnl|my_center|LOCUS_26830 1382341 1382114 gene locus_tag LOCUS_26840 1382341 1382114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 1382754 1383098 gene locus_tag LOCUS_26850 1382754 1383098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1383569 1383186 gene locus_tag LOCUS_26860 1383569 1383186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1383825 1383637 gene locus_tag LOCUS_26870 1383825 1383637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1383834 1386413 gene locus_tag LOCUS_26880 1383834 1386413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1386428 1387204 gene locus_tag LOCUS_26890 1386428 1387204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_26890 1387778 1387440 gene locus_tag LOCUS_26900 1387778 1387440 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242640.1 protein_id gnl|my_center|LOCUS_26900 1387846 1388781 gene locus_tag LOCUS_26910 1387846 1388781 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809962.1 protein_id gnl|my_center|LOCUS_26910 1388801 1389418 gene locus_tag LOCUS_26920 gene ycaC 1388801 1389418 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366381.1 protein_id gnl|my_center|LOCUS_26920 1389525 1389938 gene locus_tag LOCUS_26930 1389525 1389938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 1390007 1390339 gene locus_tag LOCUS_26940 1390007 1390339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1390575 1390354 gene locus_tag LOCUS_26950 1390575 1390354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1391053 1391532 gene locus_tag LOCUS_26960 1391053 1391532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1391677 1392375 gene locus_tag LOCUS_26970 1391677 1392375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1392417 1393781 gene locus_tag LOCUS_26980 1392417 1393781 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_26980 1393778 1395481 gene locus_tag LOCUS_26990 1393778 1395481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1395497 1399183 gene locus_tag LOCUS_27000 1395497 1399183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1399322 1399597 gene locus_tag LOCUS_27010 1399322 1399597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1399649 1400074 gene locus_tag LOCUS_27020 1399649 1400074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 1400107 1402599 gene locus_tag LOCUS_27030 1400107 1402599 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005309.1 protein_id gnl|my_center|LOCUS_27030 1403898 1403233 gene locus_tag LOCUS_27040 1403898 1403233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 1404286 1404017 gene locus_tag LOCUS_27050 1404286 1404017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1406915 1404708 gene locus_tag LOCUS_27060 1406915 1404708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1409665 1408514 gene locus_tag LOCUS_27070 1409665 1408514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1411551 1409662 gene locus_tag LOCUS_27080 1411551 1409662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1412678 1411548 gene locus_tag LOCUS_27090 1412678 1411548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 1413883 1412675 gene locus_tag LOCUS_27100 1413883 1412675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 1416763 1414715 gene locus_tag LOCUS_27110 gene brxL 1416763 1414715 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_27110 1419117 1416769 gene locus_tag LOCUS_27120 gene pglZ 1419117 1416769 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_27120 1419662 1419114 gene locus_tag LOCUS_27130 1419662 1419114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1420162 1419659 gene locus_tag LOCUS_27140 1420162 1419659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 1423818 1420159 gene locus_tag LOCUS_27150 1423818 1420159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 1427351 1423896 gene locus_tag LOCUS_27160 gene brxC 1427351 1423896 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_27160 1427911 1427348 gene locus_tag LOCUS_27170 1427911 1427348 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_27170 1428722 1427898 gene locus_tag LOCUS_27180 1428722 1427898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_27180 1429432 1428809 gene locus_tag LOCUS_27190 1429432 1428809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1429707 1430024 gene locus_tag LOCUS_27200 1429707 1430024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 1430964 1430050 gene locus_tag LOCUS_27210 1430964 1430050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1431544 1430957 gene locus_tag LOCUS_27220 1431544 1430957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1432571 1431537 gene locus_tag LOCUS_27230 1432571 1431537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 1433420 1432596 gene locus_tag LOCUS_27240 1433420 1432596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1435433 1433433 gene locus_tag LOCUS_27250 1435433 1433433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 1435877 1435437 gene locus_tag LOCUS_27260 1435877 1435437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1436146 1435874 gene locus_tag LOCUS_27270 1436146 1435874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1436644 1436177 gene locus_tag LOCUS_27280 1436644 1436177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1436877 1436641 gene locus_tag LOCUS_27290 1436877 1436641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1437425 1436892 gene locus_tag LOCUS_27300 1437425 1436892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1437889 1437461 gene locus_tag LOCUS_27310 1437889 1437461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1438195 1437941 gene locus_tag LOCUS_27320 1438195 1437941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1438639 1438208 gene locus_tag LOCUS_27330 1438639 1438208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1438899 1438636 gene locus_tag LOCUS_27340 1438899 1438636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1439297 1438899 gene locus_tag LOCUS_27350 1439297 1438899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 1439733 1439323 gene locus_tag LOCUS_27360 1439733 1439323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1441791 1439740 gene locus_tag LOCUS_27370 1441791 1439740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 1443325 1441781 gene locus_tag LOCUS_27380 1443325 1441781 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_27380 1443573 1443358 gene locus_tag LOCUS_27390 1443573 1443358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 1443793 1443563 gene locus_tag LOCUS_27400 1443793 1443563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1446361 1444070 gene locus_tag LOCUS_27410 1446361 1444070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 1446611 1446351 gene locus_tag LOCUS_27420 1446611 1446351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1446782 1447111 gene locus_tag LOCUS_27430 1446782 1447111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1447124 1447489 gene locus_tag LOCUS_27440 1447124 1447489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 1447559 1447813 gene locus_tag LOCUS_27450 1447559 1447813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1447916 1448533 gene locus_tag LOCUS_27460 1447916 1448533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 1448537 1448797 gene locus_tag LOCUS_27470 1448537 1448797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 1448945 1449172 gene locus_tag LOCUS_27480 1448945 1449172 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932024.1 protein_id gnl|my_center|LOCUS_27480 1449179 1449565 gene locus_tag LOCUS_27490 1449179 1449565 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_27490 1450080 1449574 gene locus_tag LOCUS_27500 1450080 1449574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1450262 1451224 gene locus_tag LOCUS_27510 1450262 1451224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 1452615 1451230 gene locus_tag LOCUS_27520 1452615 1451230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1455265 1453154 gene locus_tag LOCUS_27530 1455265 1453154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 1456962 1455265 gene locus_tag LOCUS_27540 1456962 1455265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 1457311 1456967 gene locus_tag LOCUS_27550 1457311 1456967 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904106.1 protein_id gnl|my_center|LOCUS_27550 1457966 1457496 gene locus_tag LOCUS_27560 1457966 1457496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1458923 1457970 gene locus_tag LOCUS_27570 1458923 1457970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1459267 1458920 gene locus_tag LOCUS_27580 1459267 1458920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1459841 1459320 gene locus_tag LOCUS_27590 1459841 1459320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 1460176 1459970 gene locus_tag LOCUS_27600 1460176 1459970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1460325 1460972 gene locus_tag LOCUS_27610 1460325 1460972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1460992 1461441 gene locus_tag LOCUS_27620 1460992 1461441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1461835 1461350 gene locus_tag LOCUS_27630 1461835 1461350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1463397 1461832 gene locus_tag LOCUS_27640 1463397 1461832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1463912 1463394 gene locus_tag LOCUS_27650 1463912 1463394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1464152 1463937 gene locus_tag LOCUS_27660 1464152 1463937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 1464306 1465781 gene locus_tag LOCUS_27670 1464306 1465781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 1466879 1466151 gene locus_tag LOCUS_27680 1466879 1466151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1466878 1468401 gene locus_tag LOCUS_27690 1466878 1468401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1468426 1469847 gene locus_tag LOCUS_27700 1468426 1469847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 1469851 1473102 gene locus_tag LOCUS_27710 1469851 1473102 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_27710 1473121 1473663 gene locus_tag LOCUS_27720 1473121 1473663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1473767 1474411 gene locus_tag LOCUS_27730 1473767 1474411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 1474566 1475021 gene locus_tag LOCUS_27740 1474566 1475021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1475048 1477201 gene locus_tag LOCUS_27750 1475048 1477201 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269255.1 protein_id gnl|my_center|LOCUS_27750 1477235 1477756 gene locus_tag LOCUS_27760 1477235 1477756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1477907 1479469 gene locus_tag LOCUS_27770 1477907 1479469 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_27770 1479524 1480285 gene locus_tag LOCUS_27780 1479524 1480285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_27780 1480289 1481473 gene locus_tag LOCUS_27790 1480289 1481473 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922783.1 protein_id gnl|my_center|LOCUS_27790 1481485 1482735 gene locus_tag LOCUS_27800 1481485 1482735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922784.1 protein_id gnl|my_center|LOCUS_27800 1482811 1483791 gene locus_tag LOCUS_27810 1482811 1483791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1484465 1483785 gene locus_tag LOCUS_27820 1484465 1483785 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324116.1 protein_id gnl|my_center|LOCUS_27820 1485085 1484462 gene locus_tag LOCUS_27830 1485085 1484462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 1485918 1485082 gene locus_tag LOCUS_27840 1485918 1485082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1485875 1486384 gene locus_tag LOCUS_27850 1485875 1486384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1487516 1486602 gene locus_tag LOCUS_27860 1487516 1486602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1488099 1487509 gene locus_tag LOCUS_27870 1488099 1487509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 1489136 1488096 gene locus_tag LOCUS_27880 1489136 1488096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 1489966 1489148 gene locus_tag LOCUS_27890 1489966 1489148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 1491997 1489997 gene locus_tag LOCUS_27900 1491997 1489997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 1492435 1491998 gene locus_tag LOCUS_27910 1492435 1491998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 1492923 1492432 gene locus_tag LOCUS_27920 1492923 1492432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 1493141 1492920 gene locus_tag LOCUS_27930 1493141 1492920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 1493668 1493162 gene locus_tag LOCUS_27940 1493668 1493162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 1494111 1493683 gene locus_tag LOCUS_27950 1494111 1493683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1494381 1494124 gene locus_tag LOCUS_27960 1494381 1494124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1494815 1494384 gene locus_tag LOCUS_27970 1494815 1494384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1495105 1494812 gene locus_tag LOCUS_27980 1495105 1494812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1495557 1495108 gene locus_tag LOCUS_27990 1495557 1495108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 1495936 1495520 gene locus_tag LOCUS_28000 1495936 1495520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1497969 1495936 gene locus_tag LOCUS_28010 1497969 1495936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1499512 1497959 gene locus_tag LOCUS_28020 1499512 1497959 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_28020 1499734 1499528 gene locus_tag LOCUS_28030 1499734 1499528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1502308 1500008 gene locus_tag LOCUS_28040 1502308 1500008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 1502540 1502292 gene locus_tag LOCUS_28050 1502540 1502292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1502699 1503019 gene locus_tag LOCUS_28060 1502699 1503019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 1503089 1503352 gene locus_tag LOCUS_28070 1503089 1503352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1503374 1503658 gene locus_tag LOCUS_28080 1503374 1503658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1503758 1504282 gene locus_tag LOCUS_28090 1503758 1504282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1504286 1504543 gene locus_tag LOCUS_28100 1504286 1504543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 1505928 1504552 gene locus_tag LOCUS_28110 1505928 1504552 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_28110 1508694 1506361 gene locus_tag LOCUS_28120 1508694 1506361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 1510388 1508694 gene locus_tag LOCUS_28130 1510388 1508694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1510737 1510393 gene locus_tag LOCUS_28140 1510737 1510393 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904166.1 protein_id gnl|my_center|LOCUS_28140 1511259 1510792 gene locus_tag LOCUS_28150 1511259 1510792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1512191 1511265 gene locus_tag LOCUS_28160 1512191 1511265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1512523 1512188 gene locus_tag LOCUS_28170 1512523 1512188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1513141 1512626 gene locus_tag LOCUS_28180 1513141 1512626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 1513459 1514307 gene locus_tag LOCUS_28190 1513459 1514307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 1515358 1514318 gene locus_tag LOCUS_28200 1515358 1514318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1516502 1515336 gene locus_tag LOCUS_28210 1516502 1515336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1517123 1516659 gene locus_tag LOCUS_28220 1517123 1516659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1518658 1517096 gene locus_tag LOCUS_28230 1518658 1517096 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_28230 1519155 1518655 gene locus_tag LOCUS_28240 1519155 1518655 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870236.1 protein_id gnl|my_center|LOCUS_28240 1521120 1519585 gene locus_tag LOCUS_28250 1521120 1519585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 1521536 1521117 gene locus_tag LOCUS_28260 1521536 1521117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1523513 1521660 gene locus_tag LOCUS_28270 1523513 1521660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1524537 1524313 gene locus_tag LOCUS_28280 1524537 1524313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1524813 1526330 gene locus_tag LOCUS_28290 1524813 1526330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1526355 1527776 gene locus_tag LOCUS_28300 1526355 1527776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1527780 1531016 gene locus_tag LOCUS_28310 1527780 1531016 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_28310 1531035 1531547 gene locus_tag LOCUS_28320 1531035 1531547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1531650 1532303 gene locus_tag LOCUS_28330 1531650 1532303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1532433 1534697 gene locus_tag LOCUS_28340 1532433 1534697 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901093.1 protein_id gnl|my_center|LOCUS_28340 1534740 1535198 gene locus_tag LOCUS_28350 1534740 1535198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1535472 1536881 gene locus_tag LOCUS_28360 1535472 1536881 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_28360 1536936 1537697 gene locus_tag LOCUS_28370 1536936 1537697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_28370 1537701 1538396 gene locus_tag LOCUS_28380 1537701 1538396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1538739 1539233 gene locus_tag LOCUS_28390 1538739 1539233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 1539258 1540325 gene locus_tag LOCUS_28400 1539258 1540325 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135690060.1 protein_id gnl|my_center|LOCUS_28400 1541658 1540363 gene locus_tag LOCUS_28410 1541658 1540363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1541744 1542904 gene locus_tag LOCUS_28420 1541744 1542904 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 protein_id gnl|my_center|LOCUS_28420 1544033 1542966 gene locus_tag LOCUS_28430 1544033 1542966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 1548755 1544106 gene locus_tag LOCUS_28440 1548755 1544106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1549409 1548798 gene locus_tag LOCUS_28450 1549409 1548798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1551478 1549595 gene locus_tag LOCUS_28460 1551478 1549595 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_28460 1555056 1551475 gene locus_tag LOCUS_28470 gene drmA 1555056 1551475 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_28470 1555295 1556395 gene locus_tag LOCUS_28480 1555295 1556395 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929488.1 protein_id gnl|my_center|LOCUS_28480 1556367 1556927 gene locus_tag LOCUS_28490 1556367 1556927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1556981 1557979 gene locus_tag LOCUS_28500 1556981 1557979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1558038 1558913 gene locus_tag LOCUS_28510 1558038 1558913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1559794 1558904 gene locus_tag LOCUS_28520 1559794 1558904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 1561707 1559791 gene locus_tag LOCUS_28530 1561707 1559791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 1566211 1561685 gene locus_tag LOCUS_28540 1566211 1561685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_28540 1569345 1566208 gene locus_tag LOCUS_28550 gene drmD 1569345 1566208 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_28550 1570010 1569744 gene locus_tag LOCUS_28560 1570010 1569744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 1570487 1570014 gene locus_tag LOCUS_28570 1570487 1570014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 1570865 1570581 gene locus_tag LOCUS_28580 1570865 1570581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 1571159 1570896 gene locus_tag LOCUS_28590 1571159 1570896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 1571570 1571220 gene locus_tag LOCUS_28600 1571570 1571220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 1574686 1572347 gene locus_tag LOCUS_28610 1574686 1572347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 1575267 1574683 gene locus_tag LOCUS_28620 1575267 1574683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1575812 1575264 gene locus_tag LOCUS_28630 1575812 1575264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 1576074 1575805 gene locus_tag LOCUS_28640 1576074 1575805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1576394 1576140 gene locus_tag LOCUS_28650 1576394 1576140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 1577674 1576535 gene locus_tag LOCUS_28660 1577674 1576535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 1577844 1578173 gene locus_tag LOCUS_28670 1577844 1578173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1578661 1578227 gene locus_tag LOCUS_28680 1578661 1578227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1580250 1578658 gene locus_tag LOCUS_28690 1580250 1578658 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_28690 1580768 1580247 gene locus_tag LOCUS_28700 1580768 1580247 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870236.1 protein_id gnl|my_center|LOCUS_28700 1581052 1580792 gene locus_tag LOCUS_28710 1581052 1580792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 1581494 1581423 gene locus_tag LOCUS_t00470 1581494 1581423 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1582387 1582184 gene locus_tag LOCUS_28720 1582387 1582184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1582532 1582750 gene locus_tag LOCUS_28730 1582532 1582750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 1586368 1582865 gene locus_tag LOCUS_28740 1586368 1582865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1587049 1586417 gene locus_tag LOCUS_28750 1587049 1586417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1587273 1590893 gene locus_tag LOCUS_28760 gene metH 1587273 1590893 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_28760 1590988 1592070 gene locus_tag LOCUS_28770 1590988 1592070 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 protein_id gnl|my_center|LOCUS_28770 1592086 1593231 gene locus_tag LOCUS_28780 1592086 1593231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 1593228 1594256 gene locus_tag LOCUS_28790 1593228 1594256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 1594339 1595514 gene locus_tag LOCUS_28800 1594339 1595514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1595735 1596508 gene locus_tag LOCUS_28810 1595735 1596508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1597249 1596527 gene locus_tag LOCUS_28820 1597249 1596527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 1597355 1598119 gene locus_tag LOCUS_28830 1597355 1598119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1598301 1599566 gene locus_tag LOCUS_28840 1598301 1599566 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_28840 1599670 1600539 gene locus_tag LOCUS_28850 1599670 1600539 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_28850 1600723 1601049 gene locus_tag LOCUS_28860 1600723 1601049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1601875 1601114 gene locus_tag LOCUS_28870 1601875 1601114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1603149 1602247 gene locus_tag LOCUS_28880 1603149 1602247 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_28880 1603222 1605978 gene locus_tag LOCUS_28890 1603222 1605978 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_28890 1606335 1607189 gene locus_tag LOCUS_28900 1606335 1607189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1608089 1607262 gene locus_tag LOCUS_28910 1608089 1607262 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 protein_id gnl|my_center|LOCUS_28910 1608433 1608140 gene locus_tag LOCUS_28920 1608433 1608140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1608652 1609221 gene locus_tag LOCUS_28930 1608652 1609221 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510041.1 protein_id gnl|my_center|LOCUS_28930 1609527 1609336 gene locus_tag LOCUS_28940 1609527 1609336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1609484 1610017 gene locus_tag LOCUS_28950 1609484 1610017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 1611166 1610114 gene locus_tag LOCUS_28960 1611166 1610114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1612364 1611231 gene locus_tag LOCUS_28970 1612364 1611231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_28970 1613169 1612408 gene locus_tag LOCUS_28980 1613169 1612408 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_28980 1614325 1613174 gene locus_tag LOCUS_28990 1614325 1613174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 1614599 1614315 gene locus_tag LOCUS_29000 1614599 1614315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 1614832 1615761 gene locus_tag LOCUS_29010 1614832 1615761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 1615837 1616874 gene locus_tag LOCUS_29020 1615837 1616874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1617391 1616882 gene locus_tag LOCUS_29030 1617391 1616882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1617894 1617415 gene locus_tag LOCUS_29040 1617894 1617415 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_29040 1617942 1618271 gene locus_tag LOCUS_29050 1617942 1618271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 1619590 1618310 gene locus_tag LOCUS_29060 gene hisD 1619590 1618310 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537892.1 protein_id gnl|my_center|LOCUS_29060 1620930 1619587 gene locus_tag LOCUS_29070 1620930 1619587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1621703 1620927 gene locus_tag LOCUS_29080 gene hisF 1621703 1620927 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_29080 1622365 1621694 gene locus_tag LOCUS_29090 gene hisH 1622365 1621694 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887071.1 protein_id gnl|my_center|LOCUS_29090 1622967 1622362 gene locus_tag LOCUS_29100 gene hisB 1622967 1622362 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404306.1 protein_id gnl|my_center|LOCUS_29100 1624871 1623048 gene locus_tag LOCUS_29110 1624871 1623048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1625746 1624868 gene locus_tag LOCUS_29120 gene hisG 1625746 1624868 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131788.1 protein_id gnl|my_center|LOCUS_29120 1627054 1626044 gene locus_tag LOCUS_29130 1627054 1626044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 1627387 1627088 gene locus_tag LOCUS_29140 1627387 1627088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 1627635 1629923 gene locus_tag LOCUS_29150 1627635 1629923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 1630064 1632673 gene locus_tag LOCUS_29160 1630064 1632673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1633911 1632679 gene locus_tag LOCUS_29170 1633911 1632679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 1635830 1634067 gene locus_tag LOCUS_29180 1635830 1634067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 1636939 1635971 gene locus_tag LOCUS_29190 1636939 1635971 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121715.1 protein_id gnl|my_center|LOCUS_29190 1637303 1638352 gene locus_tag LOCUS_29200 1637303 1638352 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_29200 1639720 1638383 gene locus_tag LOCUS_29210 1639720 1638383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 1640039 1639803 gene locus_tag LOCUS_29220 1640039 1639803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1639942 1640655 gene locus_tag LOCUS_29230 1639942 1640655 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037937.1 protein_id gnl|my_center|LOCUS_29230 1640949 1640674 gene locus_tag LOCUS_29240 1640949 1640674 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771768.1 protein_id gnl|my_center|LOCUS_29240 1641526 1641047 gene locus_tag LOCUS_29250 1641526 1641047 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_29250 1641896 1641597 gene locus_tag LOCUS_29260 1641896 1641597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 1642383 1642310 gene locus_tag LOCUS_t00480 1642383 1642310 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1643777 1642389 gene locus_tag LOCUS_29270 1643777 1642389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 1644601 1643798 gene locus_tag LOCUS_29280 1644601 1643798 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_29280 1646300 1644750 gene locus_tag LOCUS_29290 1646300 1644750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1647689 1646406 gene locus_tag LOCUS_29300 1647689 1646406 CDS product Glu/Leu/Phe/Val dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937682.1 protein_id gnl|my_center|LOCUS_29300 1648796 1647897 gene locus_tag LOCUS_29310 1648796 1647897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1649098 1651656 gene locus_tag LOCUS_29320 1649098 1651656 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259686.1 protein_id gnl|my_center|LOCUS_29320 1651751 1652620 gene locus_tag LOCUS_29330 1651751 1652620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1652646 1653098 gene locus_tag LOCUS_29340 1652646 1653098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 1653189 1654562 gene locus_tag LOCUS_29350 1653189 1654562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 1654559 1655458 gene locus_tag LOCUS_29360 1654559 1655458 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067530.1 protein_id gnl|my_center|LOCUS_29360 1655470 1656333 gene locus_tag LOCUS_29370 1655470 1656333 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_29370 1656572 1657069 gene locus_tag LOCUS_29380 1656572 1657069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 1657199 1657582 gene locus_tag LOCUS_29390 1657199 1657582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 1657725 1659305 gene locus_tag LOCUS_29400 1657725 1659305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1660665 1659319 gene locus_tag LOCUS_29410 1660665 1659319 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_29410 1660823 1662118 gene locus_tag LOCUS_29420 1660823 1662118 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_29420 1662727 1662149 gene locus_tag LOCUS_29430 1662727 1662149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 1663545 1663108 gene locus_tag LOCUS_29440 1663545 1663108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 1664174 1665217 gene locus_tag LOCUS_29450 gene gap 1664174 1665217 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055898.1 protein_id gnl|my_center|LOCUS_29450 1666589 1665324 gene locus_tag LOCUS_29460 1666589 1665324 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838600.1 protein_id gnl|my_center|LOCUS_29460 1668038 1666665 gene locus_tag LOCUS_29470 1668038 1666665 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_29470 1669111 1668110 gene locus_tag LOCUS_29480 1669111 1668110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082933.1 protein_id gnl|my_center|LOCUS_29480 1669904 1669152 gene locus_tag LOCUS_29490 gene fabG 1669904 1669152 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_29490 1671070 1669985 gene locus_tag LOCUS_29500 1671070 1669985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 1672016 1671057 gene locus_tag LOCUS_29510 gene fabD 1672016 1671057 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_29510 1672743 1672072 gene locus_tag LOCUS_29520 1672743 1672072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1672872 1674506 gene locus_tag LOCUS_29530 1672872 1674506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1674503 1676134 gene locus_tag LOCUS_29540 1674503 1676134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1677345 1676152 gene locus_tag LOCUS_29550 1677345 1676152 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_29550 1678368 1677436 gene locus_tag LOCUS_29560 gene prpB 1678368 1677436 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013822.1 protein_id gnl|my_center|LOCUS_29560 1678440 1679882 gene locus_tag LOCUS_29570 1678440 1679882 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_29570 1682684 1679943 gene locus_tag LOCUS_29580 1682684 1679943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1682865 1683584 gene locus_tag LOCUS_29590 1682865 1683584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1683763 1685019 gene locus_tag LOCUS_29600 1683763 1685019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494046.1 protein_id gnl|my_center|LOCUS_29600 1685065 1685967 gene locus_tag LOCUS_29610 1685065 1685967 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067998.1 protein_id gnl|my_center|LOCUS_29610 1686169 1687701 gene locus_tag LOCUS_29620 1686169 1687701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 1690059 1687828 gene locus_tag LOCUS_29630 1690059 1687828 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_29630 1690207 1691439 gene locus_tag LOCUS_29640 1690207 1691439 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838418.1 protein_id gnl|my_center|LOCUS_29640 1691553 1691984 gene locus_tag LOCUS_29650 gene apaG 1691553 1691984 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_29650 1692022 1692222 gene locus_tag LOCUS_29660 gene thiS 1692022 1692222 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326948.1 protein_id gnl|my_center|LOCUS_29660 1692276 1693133 gene locus_tag LOCUS_29670 1692276 1693133 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_29670 1694423 1693146 gene locus_tag LOCUS_29680 1694423 1693146 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_29680 1695351 1695425 gene locus_tag LOCUS_t00490 1695351 1695425 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1695960 1696271 gene locus_tag LOCUS_29690 1695960 1696271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29690 1696268 1697176 gene locus_tag LOCUS_29700 1696268 1697176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29700 1697760 1697667 gene locus_tag LOCUS_r00020 1697760 1697667 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA 1700709 1697975 gene locus_tag LOCUS_r00030 1700709 1697975 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1703498 1701315 gene locus_tag LOCUS_29710 1703498 1701315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 1705080 1703599 gene locus_tag LOCUS_29720 1705080 1703599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 1707179 1705077 gene locus_tag LOCUS_29730 1707179 1705077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 1707769 1707395 gene locus_tag LOCUS_29740 1707769 1707395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1709082 1707778 gene locus_tag LOCUS_29750 gene amrB 1709082 1707778 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173000.1 protein_id gnl|my_center|LOCUS_29750 1710509 1709247 gene locus_tag LOCUS_29760 1710509 1709247 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_29760 1711494 1710559 gene locus_tag LOCUS_29770 gene folD 1711494 1710559 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_29770 1711578 1713761 gene locus_tag LOCUS_29780 gene ligA 1711578 1713761 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098195.1 protein_id gnl|my_center|LOCUS_29780 1714423 1713830 gene locus_tag LOCUS_29790 1714423 1713830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 1715911 1714487 gene locus_tag LOCUS_29800 1715911 1714487 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_29800 1716073 1716612 gene locus_tag LOCUS_29810 1716073 1716612 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_29810 1717209 1717769 gene locus_tag LOCUS_29820 gene hpt 1717209 1717769 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_29820 1717778 1718971 gene locus_tag LOCUS_29830 1717778 1718971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1719374 1721362 gene locus_tag LOCUS_29840 1719374 1721362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 1721444 1724182 gene locus_tag LOCUS_29850 1721444 1724182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 1724193 1725128 gene locus_tag LOCUS_29860 1724193 1725128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 1725159 1726184 gene locus_tag LOCUS_29870 1725159 1726184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_29870 1726216 1727358 gene locus_tag LOCUS_29880 gene ribD 1726216 1727358 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921938.1 protein_id gnl|my_center|LOCUS_29880 1727436 1730393 gene locus_tag LOCUS_29890 gene leuS 1727436 1730393 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_29890 1730390 1731481 gene locus_tag LOCUS_29900 1730390 1731481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 1731481 1731960 gene locus_tag LOCUS_29910 1731481 1731960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 1732033 1732671 gene locus_tag LOCUS_29920 gene bscR 1732033 1732671 CDS product SctR family type III secretion system export apparatus subunit BscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568087.1 protein_id gnl|my_center|LOCUS_29920 1732718 1732984 gene locus_tag LOCUS_29930 1732718 1732984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1732974 1733744 gene locus_tag LOCUS_29940 1732974 1733744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 1733741 1734763 gene locus_tag LOCUS_29950 1733741 1734763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 1734818 1736038 gene locus_tag LOCUS_29960 1734818 1736038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 1736225 1737934 gene locus_tag LOCUS_29970 1736225 1737934 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529339.1 protein_id gnl|my_center|LOCUS_29970 1738464 1737952 gene locus_tag LOCUS_29980 1738464 1737952 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_29980 1738843 1738496 gene locus_tag LOCUS_29990 1738843 1738496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1741784 1738989 gene locus_tag LOCUS_30000 gene gyrA 1741784 1738989 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 protein_id gnl|my_center|LOCUS_30000 1743434 1741998 gene locus_tag LOCUS_30010 1743434 1741998 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_30010 1744385 1743450 gene locus_tag LOCUS_30020 gene truA 1744385 1743450 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_30020 1746027 1744396 gene locus_tag LOCUS_30030 1746027 1744396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 1746378 1746136 gene locus_tag LOCUS_30040 1746378 1746136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 1747373 1746375 gene locus_tag LOCUS_30050 1747373 1746375 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_30050 1749493 1747370 gene locus_tag LOCUS_30060 1749493 1747370 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061665.1 protein_id gnl|my_center|LOCUS_30060 1750223 1749546 gene locus_tag LOCUS_30070 1750223 1749546 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157890372.1 protein_id gnl|my_center|LOCUS_30070 1750430 1751068 gene locus_tag LOCUS_30080 1750430 1751068 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_30080 1752037 1751063 gene locus_tag LOCUS_30090 1752037 1751063 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826360.1 protein_id gnl|my_center|LOCUS_30090 1752301 1752374 gene locus_tag LOCUS_t00500 1752301 1752374 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1752793 1753302 gene locus_tag LOCUS_30100 1752793 1753302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1753302 1753874 gene locus_tag LOCUS_30110 1753302 1753874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1753951 1754454 gene locus_tag LOCUS_30120 1753951 1754454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 1754581 1755201 gene locus_tag LOCUS_30130 1754581 1755201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 1755198 1755566 gene locus_tag LOCUS_30140 1755198 1755566 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_30140 1756088 1755561 gene locus_tag LOCUS_30150 1756088 1755561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 1756480 1756085 gene locus_tag LOCUS_30160 1756480 1756085 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_30160 1757034 1756477 gene locus_tag LOCUS_30170 1757034 1756477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 1756958 1757407 gene locus_tag LOCUS_30180 1756958 1757407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 1757633 1757560 gene locus_tag LOCUS_t00510 1757633 1757560 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1757826 1758899 gene locus_tag LOCUS_30190 1757826 1758899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 1760329 1758998 gene locus_tag LOCUS_30200 gene nuoH 1760329 1758998 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_30200 1760482 1762764 gene locus_tag LOCUS_30210 1760482 1762764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 1762987 1762817 gene locus_tag LOCUS_30220 1762987 1762817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1763903 1763373 gene locus_tag LOCUS_30230 gene trmL 1763903 1763373 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_30230 1765220 1763925 gene locus_tag LOCUS_30240 1765220 1763925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 1766237 1765362 gene locus_tag LOCUS_30250 1766237 1765362 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862361.1 protein_id gnl|my_center|LOCUS_30250 1766367 1767359 gene locus_tag LOCUS_30260 1766367 1767359 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357212.1 protein_id gnl|my_center|LOCUS_30260 1767356 1768624 gene locus_tag LOCUS_30270 gene serA 1767356 1768624 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693698.1 protein_id gnl|my_center|LOCUS_30270 1769315 1768635 gene locus_tag LOCUS_30280 1769315 1768635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 1769990 1769364 gene locus_tag LOCUS_30290 gene clpP 1769990 1769364 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 protein_id gnl|my_center|LOCUS_30290 1770666 1770064 gene locus_tag LOCUS_30300 1770666 1770064 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_30300 1771027 1771854 gene locus_tag LOCUS_30310 1771027 1771854 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327495.1 protein_id gnl|my_center|LOCUS_30310 1773613 1771958 gene locus_tag LOCUS_30320 1773613 1771958 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_30320 1774108 1773653 gene locus_tag LOCUS_30330 gene nrfH 1774108 1773653 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_30330 1777174 1774241 gene locus_tag LOCUS_30340 gene ccsA 1777174 1774241 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922162.1 protein_id gnl|my_center|LOCUS_30340 1777719 1777198 gene locus_tag LOCUS_30350 1777719 1777198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 1778051 1778998 gene locus_tag LOCUS_30360 1778051 1778998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1779064 1781166 gene locus_tag LOCUS_30370 gene nosZ 1779064 1781166 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_30370 1781251 1781931 gene locus_tag LOCUS_30380 1781251 1781931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_30380 1781928 1783388 gene locus_tag LOCUS_30390 1781928 1783388 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_30390 1783385 1784278 gene locus_tag LOCUS_30400 1783385 1784278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808204.1 protein_id gnl|my_center|LOCUS_30400 1784275 1785168 gene locus_tag LOCUS_30410 1784275 1785168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 1785162 1785662 gene locus_tag LOCUS_30420 1785162 1785662 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458975.1 protein_id gnl|my_center|LOCUS_30420 1785712 1786515 gene locus_tag LOCUS_30430 gene ric 1785712 1786515 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_30430 1786515 1786973 gene locus_tag LOCUS_30440 1786515 1786973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 1787011 1787496 gene locus_tag LOCUS_30450 1787011 1787496 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922126.1 protein_id gnl|my_center|LOCUS_30450 1787527 1788183 gene locus_tag LOCUS_30460 gene pdxH 1787527 1788183 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_30460 1789615 1788194 gene locus_tag LOCUS_30470 1789615 1788194 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123069.1 protein_id gnl|my_center|LOCUS_30470 1789536 1789979 gene locus_tag LOCUS_30480 1789536 1789979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 1789952 1792285 gene locus_tag LOCUS_30490 1789952 1792285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 1793077 1792385 gene locus_tag LOCUS_30500 1793077 1792385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 1793566 1793162 gene locus_tag LOCUS_30510 1793566 1793162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 1793456 1794937 gene locus_tag LOCUS_30520 1793456 1794937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1794989 1796680 gene locus_tag LOCUS_30530 gene rmuC 1794989 1796680 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527474.1 protein_id gnl|my_center|LOCUS_30530 1799304 1796707 gene locus_tag LOCUS_30540 1799304 1796707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1800222 1799356 gene locus_tag LOCUS_30550 1800222 1799356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1800379 1801368 gene locus_tag LOCUS_30560 1800379 1801368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1801608 1802657 gene locus_tag LOCUS_30570 1801608 1802657 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_30570 1802689 1803558 gene locus_tag LOCUS_30580 1802689 1803558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 1803555 1804124 gene locus_tag LOCUS_30590 1803555 1804124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 1804836 1804174 gene locus_tag LOCUS_30600 1804836 1804174 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_30600 1805271 1806509 gene locus_tag LOCUS_30610 1805271 1806509 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_30610 1806599 1808392 gene locus_tag LOCUS_30620 1806599 1808392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 1808389 1809609 gene locus_tag LOCUS_30630 1808389 1809609 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941613.1 protein_id gnl|my_center|LOCUS_30630 1809606 1810649 gene locus_tag LOCUS_30640 1809606 1810649 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087456.1 protein_id gnl|my_center|LOCUS_30640 1810843 1811478 gene locus_tag LOCUS_30650 1810843 1811478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1811514 1812581 gene locus_tag LOCUS_30660 1811514 1812581 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881111.1 protein_id gnl|my_center|LOCUS_30660 1812626 1813024 gene locus_tag LOCUS_30670 1812626 1813024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1813021 1813563 gene locus_tag LOCUS_30680 1813021 1813563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1813641 1815377 gene locus_tag LOCUS_30690 gene flgK 1813641 1815377 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616092.1 protein_id gnl|my_center|LOCUS_30690 1815505 1817562 gene locus_tag LOCUS_30700 1815505 1817562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 1817814 1818263 gene locus_tag LOCUS_30710 1817814 1818263 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_30710 1818422 1818772 gene locus_tag LOCUS_30720 1818422 1818772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1818887 1820443 gene locus_tag LOCUS_30730 1818887 1820443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 1820768 1822315 gene locus_tag LOCUS_30740 1820768 1822315 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921668.1 protein_id gnl|my_center|LOCUS_30740 1823653 1822457 gene locus_tag LOCUS_30750 1823653 1822457 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_30750 1825863 1823875 gene locus_tag LOCUS_30760 1825863 1823875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 1827812 1825950 gene locus_tag LOCUS_30770 1827812 1825950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1828278 1828592 gene locus_tag LOCUS_30780 1828278 1828592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 1828622 1829563 gene locus_tag LOCUS_30790 1828622 1829563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 1829588 1830574 gene locus_tag LOCUS_30800 1829588 1830574 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_30800 1830652 1831353 gene locus_tag LOCUS_30810 1830652 1831353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 1832278 1831364 gene locus_tag LOCUS_30820 1832278 1831364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 1833309 1832377 gene locus_tag LOCUS_30830 1833309 1832377 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_30830 1833534 1833606 gene locus_tag LOCUS_t00520 1833534 1833606 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1834734 1833721 gene locus_tag LOCUS_30840 1834734 1833721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 1835645 1835977 gene locus_tag LOCUS_30850 1835645 1835977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1836446 1836216 gene locus_tag LOCUS_30860 1836446 1836216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 1836624 1837166 gene locus_tag LOCUS_30870 gene smpB 1836624 1837166 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_30870 1837933 1838634 gene locus_tag LOCUS_30880 1837933 1838634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 1838837 1840375 gene locus_tag LOCUS_30890 1838837 1840375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 1840372 1841223 gene locus_tag LOCUS_30900 1840372 1841223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1841766 1841242 gene locus_tag LOCUS_30910 1841766 1841242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 1842371 1841763 gene locus_tag LOCUS_30920 1842371 1841763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 1843522 1842494 gene locus_tag LOCUS_30930 1843522 1842494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1843767 1844036 gene locus_tag LOCUS_30940 1843767 1844036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1848449 1844088 gene locus_tag LOCUS_30950 gene rpoC 1848449 1844088 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333812.1 protein_id gnl|my_center|LOCUS_30950 1848786 1848442 gene locus_tag LOCUS_30960 1848786 1848442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 1852633 1848797 gene locus_tag LOCUS_30970 gene rpoB 1852633 1848797 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_30970 1853385 1852990 gene locus_tag LOCUS_30980 gene rplL 1853385 1852990 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_30980 1854166 1853612 gene locus_tag LOCUS_30990 gene rplJ 1854166 1853612 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946071.1 protein_id gnl|my_center|LOCUS_30990 1854985 1854284 gene locus_tag LOCUS_31000 gene rplA 1854985 1854284 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324457.1 protein_id gnl|my_center|LOCUS_31000 1855497 1855069 gene locus_tag LOCUS_31010 gene rplK 1855497 1855069 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870243.1 protein_id gnl|my_center|LOCUS_31010 1856184 1855744 gene locus_tag LOCUS_31020 1856184 1855744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 1856490 1856846 gene locus_tag LOCUS_31030 1856490 1856846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 1857248 1861213 gene locus_tag LOCUS_31040 1857248 1861213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1861263 1862204 gene locus_tag LOCUS_31050 1861263 1862204 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_31050 1862642 1862259 gene locus_tag LOCUS_31060 1862642 1862259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1863001 1862684 gene locus_tag LOCUS_31070 1863001 1862684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 1864318 1863077 gene locus_tag LOCUS_31080 1864318 1863077 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143746.1 protein_id gnl|my_center|LOCUS_31080 1864433 1865200 gene locus_tag LOCUS_31090 gene pdxJ 1864433 1865200 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370292.1 protein_id gnl|my_center|LOCUS_31090 1865310 1865828 gene locus_tag LOCUS_31100 1865310 1865828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 1865866 1866480 gene locus_tag LOCUS_31110 1865866 1866480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 1866631 1867806 gene locus_tag LOCUS_31120 1866631 1867806 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957761.1 protein_id gnl|my_center|LOCUS_31120 1870494 1868281 gene locus_tag LOCUS_31130 1870494 1868281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 1872322 1871951 gene locus_tag LOCUS_31140 1872322 1871951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 1873482 1872868 gene locus_tag LOCUS_31150 1873482 1872868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1874875 1873538 gene locus_tag LOCUS_31160 1874875 1873538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1875303 1876217 gene locus_tag LOCUS_31170 1875303 1876217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1876292 1876471 gene locus_tag LOCUS_31180 1876292 1876471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 1878570 1876489 gene locus_tag LOCUS_31190 gene fusA 1878570 1876489 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_31190 1878835 1879722 gene locus_tag LOCUS_31200 1878835 1879722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 1879852 1881240 gene locus_tag LOCUS_31210 gene kynU 1879852 1881240 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_31210 1881891 1881247 gene locus_tag LOCUS_31220 1881891 1881247 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729327.1 protein_id gnl|my_center|LOCUS_31220 1882031 1881947 gene locus_tag LOCUS_t00530 1882031 1881947 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1885311 1882072 gene locus_tag LOCUS_31230 1885311 1882072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 1885925 1885311 gene locus_tag LOCUS_31240 1885925 1885311 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_31240 1886096 1886575 gene locus_tag LOCUS_31250 1886096 1886575 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_31250 1887880 1886588 gene locus_tag LOCUS_31260 1887880 1886588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813072.1 protein_id gnl|my_center|LOCUS_31260 1889360 1888005 gene locus_tag LOCUS_31270 1889360 1888005 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_31270 1890569 1889376 gene locus_tag LOCUS_31280 1890569 1889376 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257764.1 protein_id gnl|my_center|LOCUS_31280 1890609 1891076 gene locus_tag LOCUS_31290 1890609 1891076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1891914 1891096 gene locus_tag LOCUS_31300 gene pssA 1891914 1891096 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_31300 1892679 1891921 gene locus_tag LOCUS_31310 1892679 1891921 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_31310 1894295 1892721 gene locus_tag LOCUS_31320 1894295 1892721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 1894920 1894516 gene locus_tag LOCUS_31330 1894920 1894516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 1895460 1896104 gene locus_tag LOCUS_31340 1895460 1896104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 1896796 1896167 gene locus_tag LOCUS_31350 1896796 1896167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 1896702 1897295 gene locus_tag LOCUS_31360 1896702 1897295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 1897966 1897352 gene locus_tag LOCUS_31370 1897966 1897352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1899773 1898379 gene locus_tag LOCUS_31380 1899773 1898379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 1900963 1899971 gene locus_tag LOCUS_31390 gene panB 1900963 1899971 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_31390 1900956 1903031 gene locus_tag LOCUS_31400 1900956 1903031 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_31400 1904247 1903033 gene locus_tag LOCUS_31410 1904247 1903033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 1905306 1904554 gene locus_tag LOCUS_31420 1905306 1904554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420