>Feature sequence001 1180 104 gene locus_tag LOCUS_00010 1180 104 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_00010 2550 1261 gene locus_tag LOCUS_00020 2550 1261 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_00020 2847 3539 gene locus_tag LOCUS_00030 2847 3539 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027885.1 protein_id gnl|my_center|LOCUS_00030 3867 4892 gene locus_tag LOCUS_00040 3867 4892 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013404.1 protein_id gnl|my_center|LOCUS_00040 4889 5680 gene locus_tag LOCUS_00050 4889 5680 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807577.1 protein_id gnl|my_center|LOCUS_00050 6920 5739 gene locus_tag LOCUS_00060 6920 5739 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877710.1 protein_id gnl|my_center|LOCUS_00060 7559 6969 gene locus_tag LOCUS_00070 7559 6969 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_00070 7735 9438 gene locus_tag LOCUS_00080 7735 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9435 10124 gene locus_tag LOCUS_00090 9435 10124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_00090 10135 10701 gene locus_tag LOCUS_00100 10135 10701 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_00100 10705 13209 gene locus_tag LOCUS_00110 10705 13209 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_00110 13688 14191 gene locus_tag LOCUS_00120 13688 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14211 14867 gene locus_tag LOCUS_00130 14211 14867 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_00130 14944 15414 gene locus_tag LOCUS_00140 14944 15414 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_00140 15570 16187 gene locus_tag LOCUS_00150 15570 16187 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_00150 16581 19406 gene locus_tag LOCUS_00160 gene gcvP 16581 19406 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_00160 19579 20121 gene locus_tag LOCUS_00170 19579 20121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20575 20171 gene locus_tag LOCUS_00180 20575 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20666 21262 gene locus_tag LOCUS_00190 20666 21262 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 protein_id gnl|my_center|LOCUS_00190 21449 21249 gene locus_tag LOCUS_00200 21449 21249 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_00200 22395 21820 gene locus_tag LOCUS_00210 22395 21820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22556 23008 gene locus_tag LOCUS_00220 22556 23008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24566 23211 gene locus_tag LOCUS_00230 24566 23211 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728563.1 protein_id gnl|my_center|LOCUS_00230 25106 24723 gene locus_tag LOCUS_00240 25106 24723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26309 25167 gene locus_tag LOCUS_00250 gene menE 26309 25167 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_00250 26419 27249 gene locus_tag LOCUS_00260 gene menB 26419 27249 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_00260 27367 29016 gene locus_tag LOCUS_00270 gene menD 27367 29016 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_00270 29145 29786 gene locus_tag LOCUS_00280 29145 29786 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977513.1 protein_id gnl|my_center|LOCUS_00280 29842 30336 gene locus_tag LOCUS_00290 29842 30336 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028474.1 protein_id gnl|my_center|LOCUS_00290 30992 30369 gene locus_tag LOCUS_00300 30992 30369 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085561.1 protein_id gnl|my_center|LOCUS_00300 31105 31491 gene locus_tag LOCUS_00310 31105 31491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31543 32163 gene locus_tag LOCUS_00320 31543 32163 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_00320 33370 32174 gene locus_tag LOCUS_00330 33370 32174 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_00330 33571 34389 gene locus_tag LOCUS_00340 33571 34389 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_00340 35087 34395 gene locus_tag LOCUS_00350 35087 34395 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775986.1 protein_id gnl|my_center|LOCUS_00350 35258 37006 gene locus_tag LOCUS_00360 gene leuA 35258 37006 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_00360 37077 37292 gene locus_tag LOCUS_00370 37077 37292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37289 37777 gene locus_tag LOCUS_00380 37289 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38444 37839 gene locus_tag LOCUS_00390 38444 37839 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_00390 39595 38441 gene locus_tag LOCUS_00400 39595 38441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40341 39616 gene locus_tag LOCUS_00410 40341 39616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028267.1 protein_id gnl|my_center|LOCUS_00410 41300 40341 gene locus_tag LOCUS_00420 41300 40341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028266.1 protein_id gnl|my_center|LOCUS_00420 42854 41757 gene locus_tag LOCUS_00430 42854 41757 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109955.1 protein_id gnl|my_center|LOCUS_00430 43001 43603 gene locus_tag LOCUS_00440 43001 43603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45186 43858 gene locus_tag LOCUS_00450 45186 43858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 46004 45357 gene locus_tag LOCUS_00460 46004 45357 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970388.1 protein_id gnl|my_center|LOCUS_00460 47448 46387 gene locus_tag LOCUS_00470 47448 46387 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_00470 47533 47838 gene locus_tag LOCUS_00480 47533 47838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 48043 47798 gene locus_tag LOCUS_00490 48043 47798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49732 48146 gene locus_tag LOCUS_00500 49732 48146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50490 49828 gene locus_tag LOCUS_00510 50490 49828 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908001.1 protein_id gnl|my_center|LOCUS_00510 50619 51185 gene locus_tag LOCUS_00520 50619 51185 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228192.1 protein_id gnl|my_center|LOCUS_00520 51561 52094 gene locus_tag LOCUS_00530 51561 52094 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_00530 52112 52840 gene locus_tag LOCUS_00540 52112 52840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 52837 53589 gene locus_tag LOCUS_00550 52837 53589 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673939.1 protein_id gnl|my_center|LOCUS_00550 54385 53630 gene locus_tag LOCUS_00560 54385 53630 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_00560 54783 54382 gene locus_tag LOCUS_00570 54783 54382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 55427 54780 gene locus_tag LOCUS_00580 55427 54780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 55640 55795 gene locus_tag LOCUS_00590 55640 55795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 56809 55856 gene locus_tag LOCUS_00600 56809 55856 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370754.1 protein_id gnl|my_center|LOCUS_00600 57244 56888 gene locus_tag LOCUS_00610 57244 56888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 57384 57926 gene locus_tag LOCUS_00620 57384 57926 CDS product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311089.1 protein_id gnl|my_center|LOCUS_00620 57923 58711 gene locus_tag LOCUS_00630 57923 58711 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063502.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence002 1379 2485 gene locus_tag LOCUS_00640 1379 2485 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_00640 4509 2524 gene locus_tag LOCUS_00650 4509 2524 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_00650 4651 5817 gene locus_tag LOCUS_00660 4651 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 5965 6159 gene locus_tag LOCUS_00670 5965 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 6452 7627 gene locus_tag LOCUS_00680 6452 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 7624 9279 gene locus_tag LOCUS_00690 7624 9279 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970036.1 protein_id gnl|my_center|LOCUS_00690 9276 10304 gene locus_tag LOCUS_00700 9276 10304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 protein_id gnl|my_center|LOCUS_00700 10361 11152 gene locus_tag LOCUS_00710 10361 11152 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082773.1 protein_id gnl|my_center|LOCUS_00710 11250 12335 gene locus_tag LOCUS_00720 11250 12335 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503693.1 protein_id gnl|my_center|LOCUS_00720 12339 13406 gene locus_tag LOCUS_00730 12339 13406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531509.1 protein_id gnl|my_center|LOCUS_00730 13403 14242 gene locus_tag LOCUS_00740 13403 14242 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027035860.1 protein_id gnl|my_center|LOCUS_00740 14321 15253 gene locus_tag LOCUS_00750 14321 15253 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_00750 15250 15948 gene locus_tag LOCUS_00760 15250 15948 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379148.1 protein_id gnl|my_center|LOCUS_00760 15958 16794 gene locus_tag LOCUS_00770 15958 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 16804 17895 gene locus_tag LOCUS_00780 16804 17895 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728808.1 protein_id gnl|my_center|LOCUS_00780 17892 18956 gene locus_tag LOCUS_00790 17892 18956 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_00790 18953 20485 gene locus_tag LOCUS_00800 gene glpK 18953 20485 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_00800 20618 21595 gene locus_tag LOCUS_00810 20618 21595 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_00810 21597 22181 gene locus_tag LOCUS_00820 gene pgiA 21597 22181 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147196.1 protein_id gnl|my_center|LOCUS_00820 22181 23155 gene locus_tag LOCUS_00830 22181 23155 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970028.1 protein_id gnl|my_center|LOCUS_00830 23169 24131 gene locus_tag LOCUS_00840 23169 24131 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_00840 24568 24251 gene locus_tag LOCUS_00850 24568 24251 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_00850 24732 24565 gene locus_tag LOCUS_00860 24732 24565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 25623 24742 gene locus_tag LOCUS_00870 gene mca 25623 24742 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_00870 25778 26203 gene locus_tag LOCUS_00880 25778 26203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 26279 26779 gene locus_tag LOCUS_00890 gene greA 26279 26779 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_00890 27096 28349 gene locus_tag LOCUS_00900 27096 28349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 28949 28368 gene locus_tag LOCUS_00910 28949 28368 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_00910 30483 28972 gene locus_tag LOCUS_00920 30483 28972 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091320726.1 protein_id gnl|my_center|LOCUS_00920 30575 31093 gene locus_tag LOCUS_00930 30575 31093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_00930 31374 33170 gene locus_tag LOCUS_00940 31374 33170 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_00940 33385 34146 gene locus_tag LOCUS_00950 33385 34146 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_00950 34402 35706 gene locus_tag LOCUS_00960 34402 35706 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_00960 36279 35722 gene locus_tag LOCUS_00970 36279 35722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 37721 36276 gene locus_tag LOCUS_00980 37721 36276 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224878.1 protein_id gnl|my_center|LOCUS_00980 38392 37718 gene locus_tag LOCUS_00990 gene afsQ1 38392 37718 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_00990 38664 39347 gene locus_tag LOCUS_01000 38664 39347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 39510 41468 gene locus_tag LOCUS_01010 39510 41468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence003 166 498 gene locus_tag LOCUS_01020 166 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 503 862 gene locus_tag LOCUS_01030 503 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 867 1808 gene locus_tag LOCUS_01040 867 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 1960 1790 gene locus_tag LOCUS_01050 1960 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 1962 3671 gene locus_tag LOCUS_01060 1962 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3668 4024 gene locus_tag LOCUS_01070 3668 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 4027 4536 gene locus_tag LOCUS_01080 4027 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 4536 5096 gene locus_tag LOCUS_01090 4536 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5099 6037 gene locus_tag LOCUS_01100 5099 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 6039 7499 gene locus_tag LOCUS_01110 6039 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 7499 9640 gene locus_tag LOCUS_01120 7499 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 9715 10965 gene locus_tag LOCUS_01130 9715 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 10966 13020 gene locus_tag LOCUS_01140 10966 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 13017 13223 gene locus_tag LOCUS_01150 13017 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 13220 13690 gene locus_tag LOCUS_01160 13220 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 13687 13923 gene locus_tag LOCUS_01170 13687 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 13898 14260 gene locus_tag LOCUS_01180 13898 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 14257 14436 gene locus_tag LOCUS_01190 14257 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 15966 14830 gene locus_tag LOCUS_01200 15966 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 16198 15956 gene locus_tag LOCUS_01210 16198 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 16842 16195 gene locus_tag LOCUS_01220 16842 16195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 17120 16920 gene locus_tag LOCUS_01230 17120 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 17286 17113 gene locus_tag LOCUS_01240 17286 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 17755 17468 gene locus_tag LOCUS_01250 17755 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 18354 17752 gene locus_tag LOCUS_01260 18354 17752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 18614 18351 gene locus_tag LOCUS_01270 18614 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 18968 18699 gene locus_tag LOCUS_01280 18968 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 19273 18965 gene locus_tag LOCUS_01290 19273 18965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 19598 19263 gene locus_tag LOCUS_01300 19598 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 19909 19595 gene locus_tag LOCUS_01310 19909 19595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 20991 19906 gene locus_tag LOCUS_01320 20991 19906 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049826.1 protein_id gnl|my_center|LOCUS_01320 21127 20918 gene locus_tag LOCUS_01330 21127 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 21308 21102 gene locus_tag LOCUS_01340 21308 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 21490 21305 gene locus_tag LOCUS_01350 21490 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 21811 21506 gene locus_tag LOCUS_01360 21811 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 22001 21852 gene locus_tag LOCUS_01370 22001 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 22214 22020 gene locus_tag LOCUS_01380 22214 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 22479 22225 gene locus_tag LOCUS_01390 22479 22225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 22564 22749 gene locus_tag LOCUS_01400 22564 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 23079 22804 gene locus_tag LOCUS_01410 23079 22804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 23363 23076 gene locus_tag LOCUS_01420 23363 23076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 23539 23360 gene locus_tag LOCUS_01430 23539 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 23755 23552 gene locus_tag LOCUS_01440 23755 23552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 24410 23901 gene locus_tag LOCUS_01450 24410 23901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 24910 25176 gene locus_tag LOCUS_01460 24910 25176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 25199 25552 gene locus_tag LOCUS_01470 25199 25552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 25641 25874 gene locus_tag LOCUS_01480 25641 25874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 25882 26115 gene locus_tag LOCUS_01490 25882 26115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 26112 26300 gene locus_tag LOCUS_01500 26112 26300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 26456 26803 gene locus_tag LOCUS_01510 26456 26803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 26803 27588 gene locus_tag LOCUS_01520 26803 27588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 27585 27926 gene locus_tag LOCUS_01530 27585 27926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 27923 28840 gene locus_tag LOCUS_01540 27923 28840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 28837 29067 gene locus_tag LOCUS_01550 28837 29067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 29064 30107 gene locus_tag LOCUS_01560 29064 30107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 30104 30421 gene locus_tag LOCUS_01570 30104 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 30418 30900 gene locus_tag LOCUS_01580 30418 30900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 30894 31238 gene locus_tag LOCUS_01590 30894 31238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 31235 31621 gene locus_tag LOCUS_01600 31235 31621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 31813 32223 gene locus_tag LOCUS_01610 31813 32223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 32220 32411 gene locus_tag LOCUS_01620 32220 32411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 32424 32795 gene locus_tag LOCUS_01630 32424 32795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 32692 34161 gene locus_tag LOCUS_01640 32692 34161 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975977.1 protein_id gnl|my_center|LOCUS_01640 34158 34379 gene locus_tag LOCUS_01650 34158 34379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 34379 36553 gene locus_tag LOCUS_01660 34379 36553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 36558 37574 gene locus_tag LOCUS_01670 36558 37574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 37621 38967 gene locus_tag LOCUS_01680 37621 38967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence004 1697 2167 gene locus_tag LOCUS_01690 1697 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 2521 3105 gene locus_tag LOCUS_01700 2521 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 3110 4135 gene locus_tag LOCUS_01710 3110 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4214 4795 gene locus_tag LOCUS_01720 4214 4795 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_01720 5108 6583 gene locus_tag LOCUS_01730 5108 6583 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224359.1 protein_id gnl|my_center|LOCUS_01730 6628 7731 gene locus_tag LOCUS_01740 6628 7731 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_01740 7728 8537 gene locus_tag LOCUS_01750 7728 8537 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_01750 8537 9319 gene locus_tag LOCUS_01760 8537 9319 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_01760 9316 10605 gene locus_tag LOCUS_01770 9316 10605 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_01770 10595 11044 gene locus_tag LOCUS_01780 10595 11044 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 protein_id gnl|my_center|LOCUS_01780 12400 11060 gene locus_tag LOCUS_01790 12400 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 13541 12672 gene locus_tag LOCUS_01800 13541 12672 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978710.1 protein_id gnl|my_center|LOCUS_01800 15283 13682 gene locus_tag LOCUS_01810 15283 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 16221 15280 gene locus_tag LOCUS_01820 16221 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 16488 16234 gene locus_tag LOCUS_01830 16488 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 17024 16518 gene locus_tag LOCUS_01840 17024 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 17878 17171 gene locus_tag LOCUS_01850 17878 17171 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_01850 18948 17848 gene locus_tag LOCUS_01860 18948 17848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 20102 18945 gene locus_tag LOCUS_01870 20102 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 20433 21545 gene locus_tag LOCUS_01880 20433 21545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 23159 21756 gene locus_tag LOCUS_01890 23159 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 24323 23529 gene locus_tag LOCUS_01900 gene trpA 24323 23529 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_01900 25582 24320 gene locus_tag LOCUS_01910 gene trpB 25582 24320 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_01910 26190 27029 gene locus_tag LOCUS_01920 26190 27029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 27023 27781 gene locus_tag LOCUS_01930 27023 27781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 27824 28279 gene locus_tag LOCUS_01940 27824 28279 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326890.1 protein_id gnl|my_center|LOCUS_01940 28590 31319 gene locus_tag LOCUS_01950 28590 31319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01950 31258 32703 gene locus_tag LOCUS_01960 31258 32703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01960 35380 32975 gene locus_tag LOCUS_01970 35380 32975 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026380.1 protein_id gnl|my_center|LOCUS_01970 36055 35441 gene locus_tag LOCUS_01980 36055 35441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026379.1 protein_id gnl|my_center|LOCUS_01980 36317 36048 gene locus_tag LOCUS_01990 36317 36048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228535.1 protein_id gnl|my_center|LOCUS_01990 36811 36377 gene locus_tag LOCUS_02000 36811 36377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 37691 37350 gene locus_tag LOCUS_02010 37691 37350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 38107 37859 gene locus_tag LOCUS_02020 38107 37859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence005 53 991 gene locus_tag LOCUS_02030 gene deoC 53 991 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_02030 1001 2428 gene locus_tag LOCUS_02040 1001 2428 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_02040 2418 2657 gene locus_tag LOCUS_02050 2418 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2650 3516 gene locus_tag LOCUS_02060 2650 3516 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_02060 4655 3513 gene locus_tag LOCUS_02070 4655 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5452 4874 gene locus_tag LOCUS_02080 5452 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 5639 5830 gene locus_tag LOCUS_02090 5639 5830 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 protein_id gnl|my_center|LOCUS_02090 5894 6532 gene locus_tag LOCUS_02100 gene lipB 5894 6532 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618236.1 protein_id gnl|my_center|LOCUS_02100 8092 6545 gene locus_tag LOCUS_02110 8092 6545 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_02110 8346 8104 gene locus_tag LOCUS_02120 8346 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 9404 8526 gene locus_tag LOCUS_02130 9404 8526 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_02130 9504 10268 gene locus_tag LOCUS_02140 9504 10268 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_02140 10403 11416 gene locus_tag LOCUS_02150 10403 11416 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_02150 11459 12499 gene locus_tag LOCUS_02160 11459 12499 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_02160 12630 13556 gene locus_tag LOCUS_02170 12630 13556 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267627.1 protein_id gnl|my_center|LOCUS_02170 13553 14314 gene locus_tag LOCUS_02180 13553 14314 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_02180 14311 15204 gene locus_tag LOCUS_02190 gene aztB 14311 15204 CDS product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_02190 15201 16040 gene locus_tag LOCUS_02200 15201 16040 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_02200 16865 16047 gene locus_tag LOCUS_02210 16865 16047 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_02210 16998 17498 gene locus_tag LOCUS_02220 16998 17498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 18563 17505 gene locus_tag LOCUS_02230 18563 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 18761 18600 gene locus_tag LOCUS_02240 18761 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 19194 18859 gene locus_tag LOCUS_02250 19194 18859 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977724.1 protein_id gnl|my_center|LOCUS_02250 19289 20386 gene locus_tag LOCUS_02260 19289 20386 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977723.1 protein_id gnl|my_center|LOCUS_02260 21169 20393 gene locus_tag LOCUS_02270 21169 20393 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 protein_id gnl|my_center|LOCUS_02270 21223 22188 gene locus_tag LOCUS_02280 21223 22188 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_02280 23176 22196 gene locus_tag LOCUS_02290 23176 22196 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_02290 23297 25519 gene locus_tag LOCUS_02300 gene hypF 23297 25519 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225635.1 protein_id gnl|my_center|LOCUS_02300 26616 25528 gene locus_tag LOCUS_02310 gene hypE 26616 25528 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_02310 27737 26613 gene locus_tag LOCUS_02320 gene hypD 27737 26613 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 protein_id gnl|my_center|LOCUS_02320 28020 27745 gene locus_tag LOCUS_02330 28020 27745 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225640.1 protein_id gnl|my_center|LOCUS_02330 28375 27968 gene locus_tag LOCUS_02340 gene hypA 28375 27968 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939567.1 protein_id gnl|my_center|LOCUS_02340 28955 28479 gene locus_tag LOCUS_02350 28955 28479 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225641.1 protein_id gnl|my_center|LOCUS_02350 30229 28952 gene locus_tag LOCUS_02360 30229 28952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225642.1 protein_id gnl|my_center|LOCUS_02360 30855 30226 gene locus_tag LOCUS_02370 30855 30226 CDS product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225643.1 protein_id gnl|my_center|LOCUS_02370 31502 30858 gene locus_tag LOCUS_02380 31502 30858 CDS product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467021.1 protein_id gnl|my_center|LOCUS_02380 32041 31499 gene locus_tag LOCUS_02390 32041 31499 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225645.1 protein_id gnl|my_center|LOCUS_02390 33813 32038 gene locus_tag LOCUS_02400 33813 32038 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225646.1 protein_id gnl|my_center|LOCUS_02400 34826 33816 gene locus_tag LOCUS_02410 34826 33816 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_02410 35532 34855 gene locus_tag LOCUS_02420 35532 34855 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225648.1 protein_id gnl|my_center|LOCUS_02420 35753 35529 gene locus_tag LOCUS_02430 35753 35529 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086673634.1 protein_id gnl|my_center|LOCUS_02430 36367 35750 gene locus_tag LOCUS_02440 36367 35750 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225650.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence006 <1 1101 gene locus_tag LOCUS_02450 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223822.1:allantoinase AllB 1098 2063 gene locus_tag LOCUS_02460 gene alc 1098 2063 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730744.1 protein_id gnl|my_center|LOCUS_02460 4184 2190 gene locus_tag LOCUS_02470 gene pknB 4184 2190 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_02470 5205 4441 gene locus_tag LOCUS_02480 5205 4441 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_02480 5408 5208 gene locus_tag LOCUS_02490 gene thiS 5408 5208 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_02490 6541 5405 gene locus_tag LOCUS_02500 gene thiO 6541 5405 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_02500 7010 8176 gene locus_tag LOCUS_02510 7010 8176 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_02510 8220 8597 gene locus_tag LOCUS_02520 8220 8597 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_02520 8626 9279 gene locus_tag LOCUS_02530 gene thiE 8626 9279 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_02530 10475 9408 gene locus_tag LOCUS_02540 10475 9408 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_02540 10616 11545 gene locus_tag LOCUS_02550 gene metF 10616 11545 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_02550 12187 11615 gene locus_tag LOCUS_02560 12187 11615 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_02560 12713 12249 gene locus_tag LOCUS_02570 12713 12249 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104384.1 protein_id gnl|my_center|LOCUS_02570 13085 12837 gene locus_tag LOCUS_02580 13085 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 12973 13695 gene locus_tag LOCUS_02590 12973 13695 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776667.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02590 14702 13821 gene locus_tag LOCUS_02600 14702 13821 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 protein_id gnl|my_center|LOCUS_02600 15561 14983 gene locus_tag LOCUS_02610 15561 14983 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_02610 16051 16488 gene locus_tag LOCUS_02620 16051 16488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 17764 16520 gene locus_tag LOCUS_02630 17764 16520 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_02630 18398 17904 gene locus_tag LOCUS_02640 gene bldD 18398 17904 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_02640 18807 19379 gene locus_tag LOCUS_02650 gene pyrR 18807 19379 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_02650 19376 20311 gene locus_tag LOCUS_02660 19376 20311 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_02660 20338 21639 gene locus_tag LOCUS_02670 20338 21639 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_02670 21636 22751 gene locus_tag LOCUS_02680 gene carA 21636 22751 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_02680 22744 26022 gene locus_tag LOCUS_02690 gene carB 22744 26022 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_02690 26142 26999 gene locus_tag LOCUS_02700 26142 26999 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_02700 27018 27992 gene locus_tag LOCUS_02710 27018 27992 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02710 27989 28702 gene locus_tag LOCUS_02720 gene pyrF 27989 28702 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_02720 28976 29299 gene locus_tag LOCUS_02730 28976 29299 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_02730 29421 29981 gene locus_tag LOCUS_02740 gene gmk 29421 29981 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_02740 29995 30258 gene locus_tag LOCUS_02750 gene rpoZ 29995 30258 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_02750 30421 31641 gene locus_tag LOCUS_02760 gene coaBC 30421 31641 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_02760 31712 32080 gene locus_tag LOCUS_02770 31712 32080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 32268 33455 gene locus_tag LOCUS_02780 gene metK 32268 33455 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_02780 >Feature sequence007 1022 639 gene locus_tag LOCUS_02790 1022 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 1148 1783 gene locus_tag LOCUS_02800 1148 1783 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_02800 1801 2880 gene locus_tag LOCUS_02810 1801 2880 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_02810 3532 2954 gene locus_tag LOCUS_02820 gene idi 3532 2954 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898999.1 protein_id gnl|my_center|LOCUS_02820 3654 4952 gene locus_tag LOCUS_02830 3654 4952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_02830 6251 4986 gene locus_tag LOCUS_02840 6251 4986 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224093.1 protein_id gnl|my_center|LOCUS_02840 7688 6252 gene locus_tag LOCUS_02850 7688 6252 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_02850 7830 8366 gene locus_tag LOCUS_02860 7830 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 8413 10620 gene locus_tag LOCUS_02870 8413 10620 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930082.1 protein_id gnl|my_center|LOCUS_02870 10736 10551 gene locus_tag LOCUS_02880 10736 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 10720 12273 gene locus_tag LOCUS_02890 10720 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02890 12690 14174 gene locus_tag LOCUS_02900 12690 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 14184 14825 gene locus_tag LOCUS_02910 gene sigM 14184 14825 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_02910 14815 15774 gene locus_tag LOCUS_02920 14815 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 15926 16855 gene locus_tag LOCUS_02930 gene trxB 15926 16855 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_02930 16933 17256 gene locus_tag LOCUS_02940 gene trxA 16933 17256 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_02940 17659 17249 gene locus_tag LOCUS_02950 17659 17249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 18331 17699 gene locus_tag LOCUS_02960 18331 17699 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_02960 18724 19905 gene locus_tag LOCUS_02970 18724 19905 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_02970 20357 21307 gene locus_tag LOCUS_02980 20357 21307 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_02980 24583 23597 gene locus_tag LOCUS_02990 24583 23597 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_02990 26300 25362 gene locus_tag LOCUS_03000 26300 25362 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_03000 27135 26455 gene locus_tag LOCUS_03010 gene rsmG 27135 26455 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_03010 27829 27335 gene locus_tag LOCUS_03020 27829 27335 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_03020 28798 27848 gene locus_tag LOCUS_03030 28798 27848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 29117 28803 gene locus_tag LOCUS_03040 29117 28803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 29491 29114 gene locus_tag LOCUS_03050 gene rnpA 29491 29114 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_03050 29692 29555 gene locus_tag LOCUS_03060 gene rpmH 29692 29555 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_03060 30129 31799 gene locus_tag LOCUS_03070 gene dnaA 30129 31799 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221955.1 protein_id gnl|my_center|LOCUS_03070 32324 33463 gene locus_tag LOCUS_03080 gene dnaN 32324 33463 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_03080 33571 34515 gene locus_tag LOCUS_03090 gene gnd 33571 34515 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_03090 >Feature sequence008 <1 939 gene locus_tag LOCUS_03100 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224839.1:fumarylacetoacetase 1110 2321 gene locus_tag LOCUS_03110 1110 2321 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727602.1 protein_id gnl|my_center|LOCUS_03110 3023 4450 gene locus_tag LOCUS_03120 gene thiO 3023 4450 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_03120 4447 5124 gene locus_tag LOCUS_03130 4447 5124 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222559.1 protein_id gnl|my_center|LOCUS_03130 5187 5567 gene locus_tag LOCUS_03140 5187 5567 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222584.1 protein_id gnl|my_center|LOCUS_03140 5570 6403 gene locus_tag LOCUS_03150 5570 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 6408 7685 gene locus_tag LOCUS_03160 6408 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7682 8200 gene locus_tag LOCUS_03170 7682 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 8190 9362 gene locus_tag LOCUS_03180 gene rifK 8190 9362 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_03180 9359 10420 gene locus_tag LOCUS_03190 9359 10420 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222558.1 protein_id gnl|my_center|LOCUS_03190 10420 11397 gene locus_tag LOCUS_03200 10420 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 11451 12623 gene locus_tag LOCUS_03210 11451 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 12624 13559 gene locus_tag LOCUS_03220 12624 13559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 13570 15522 gene locus_tag LOCUS_03230 13570 15522 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 protein_id gnl|my_center|LOCUS_03230 15523 16650 gene locus_tag LOCUS_03240 15523 16650 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919112.1 protein_id gnl|my_center|LOCUS_03240 16749 18056 gene locus_tag LOCUS_03250 gene aroA 16749 18056 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229519.1 protein_id gnl|my_center|LOCUS_03250 18188 18619 gene locus_tag LOCUS_03260 18188 18619 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223826.1 protein_id gnl|my_center|LOCUS_03260 19086 19517 gene locus_tag LOCUS_03270 19086 19517 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_03270 19520 20614 gene locus_tag LOCUS_03280 19520 20614 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_03280 22323 20641 gene locus_tag LOCUS_03290 22323 20641 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_03290 24035 22320 gene locus_tag LOCUS_03300 24035 22320 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_03300 24813 24295 gene locus_tag LOCUS_03310 24813 24295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 26303 24819 gene locus_tag LOCUS_03320 26303 24819 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085588.1 protein_id gnl|my_center|LOCUS_03320 27066 26377 gene locus_tag LOCUS_03330 gene phoP 27066 26377 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_03330 27665 27063 gene locus_tag LOCUS_03340 27665 27063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 28983 27709 gene locus_tag LOCUS_03350 28983 27709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_03350 29720 28980 gene locus_tag LOCUS_03360 29720 28980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_03360 30871 29717 gene locus_tag LOCUS_03370 30871 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 31199 30969 gene locus_tag LOCUS_03380 31199 30969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence009 1069 119 gene locus_tag LOCUS_03390 1069 119 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_03390 1949 1170 gene locus_tag LOCUS_03400 1949 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2422 1946 gene locus_tag LOCUS_03410 gene divIC 2422 1946 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975716.1 protein_id gnl|my_center|LOCUS_03410 3870 2581 gene locus_tag LOCUS_03420 gene eno 3870 2581 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_03420 5021 4005 gene locus_tag LOCUS_03430 5021 4005 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_03430 5869 5243 gene locus_tag LOCUS_03440 5869 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9420 5923 gene locus_tag LOCUS_03450 gene mfd 9420 5923 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_03450 9689 10381 gene locus_tag LOCUS_03460 9689 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10778 10386 gene locus_tag LOCUS_03470 10778 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 11175 10753 gene locus_tag LOCUS_03480 11175 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 11290 12507 gene locus_tag LOCUS_03490 11290 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 13596 12565 gene locus_tag LOCUS_03500 13596 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 13895 15148 gene locus_tag LOCUS_03510 13895 15148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 15145 16491 gene locus_tag LOCUS_03520 15145 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 16488 17477 gene locus_tag LOCUS_03530 16488 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 17474 18403 gene locus_tag LOCUS_03540 17474 18403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 18391 19734 gene locus_tag LOCUS_03550 18391 19734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 19920 20825 gene locus_tag LOCUS_03560 19920 20825 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122763.1 protein_id gnl|my_center|LOCUS_03560 21662 21432 gene locus_tag LOCUS_03570 21662 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 22967 21723 gene locus_tag LOCUS_03580 22967 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 23214 23744 gene locus_tag LOCUS_03590 23214 23744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 23764 24483 gene locus_tag LOCUS_03600 23764 24483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 24750 24493 gene locus_tag LOCUS_03610 24750 24493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 25046 24747 gene locus_tag LOCUS_03620 25046 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 26479 25184 gene locus_tag LOCUS_03630 26479 25184 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804192.1 protein_id gnl|my_center|LOCUS_03630 27319 26819 gene locus_tag LOCUS_03640 27319 26819 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_03640 27424 28401 gene locus_tag LOCUS_03650 27424 28401 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028478.1 protein_id gnl|my_center|LOCUS_03650 28544 29164 gene locus_tag LOCUS_03660 28544 29164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 29161 30006 gene locus_tag LOCUS_03670 gene folD 29161 30006 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_03670 30041 30415 gene locus_tag LOCUS_03680 30041 30415 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_03680 <31172 30412 gene locus_tag LOCUS_03690 <31172 30412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393842.1:WecB/TagA/CpsF family glycosyltransferase >Feature sequence010 725 39 gene locus_tag LOCUS_03700 gene grpE 725 39 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_03700 2587 722 gene locus_tag LOCUS_03710 gene dnaK 2587 722 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_03710 3460 2780 gene locus_tag LOCUS_03720 3460 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3562 4278 gene locus_tag LOCUS_03730 3562 4278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229141.1 protein_id gnl|my_center|LOCUS_03730 4275 5009 gene locus_tag LOCUS_03740 4275 5009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229140.1 protein_id gnl|my_center|LOCUS_03740 6040 5051 gene locus_tag LOCUS_03750 6040 5051 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229112.1 protein_id gnl|my_center|LOCUS_03750 6076 6924 gene locus_tag LOCUS_03760 6076 6924 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229113.1 protein_id gnl|my_center|LOCUS_03760 7016 7810 gene locus_tag LOCUS_03770 gene proC 7016 7810 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_03770 7900 9306 gene locus_tag LOCUS_03780 7900 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 9303 10004 gene locus_tag LOCUS_03790 9303 10004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_03790 10001 11185 gene locus_tag LOCUS_03800 10001 11185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_03800 11262 12425 gene locus_tag LOCUS_03810 11262 12425 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_03810 12469 13248 gene locus_tag LOCUS_03820 12469 13248 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_03820 13561 13764 gene locus_tag LOCUS_03830 13561 13764 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_03830 14102 15139 gene locus_tag LOCUS_03840 14102 15139 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_03840 15150 16028 gene locus_tag LOCUS_03850 15150 16028 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_03850 16122 17168 gene locus_tag LOCUS_03860 16122 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 18215 17358 gene locus_tag LOCUS_03870 18215 17358 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878084.1 protein_id gnl|my_center|LOCUS_03870 19074 18292 gene locus_tag LOCUS_03880 19074 18292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 19860 19213 gene locus_tag LOCUS_03890 19860 19213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 20041 21600 gene locus_tag LOCUS_03900 20041 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 21864 21616 gene locus_tag LOCUS_03910 21864 21616 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_03910 22071 22769 gene locus_tag LOCUS_03920 22071 22769 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_03920 22795 24093 gene locus_tag LOCUS_03930 22795 24093 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061882.1 protein_id gnl|my_center|LOCUS_03930 24090 25001 gene locus_tag LOCUS_03940 gene hemC 24090 25001 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_03940 24998 26587 gene locus_tag LOCUS_03950 24998 26587 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_03950 26667 27656 gene locus_tag LOCUS_03960 gene hemB 26667 27656 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_03960 27905 28480 gene locus_tag LOCUS_03970 27905 28480 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_03970 28553 29848 gene locus_tag LOCUS_03980 gene hemL 28553 29848 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_03980 30482 29853 gene locus_tag LOCUS_03990 30482 29853 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence011 541 1476 gene locus_tag LOCUS_04000 gene eboE 541 1476 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028848.1 protein_id gnl|my_center|LOCUS_04000 2206 1544 gene locus_tag LOCUS_04010 2206 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 2816 2091 gene locus_tag LOCUS_04020 2816 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 3756 2890 gene locus_tag LOCUS_04030 3756 2890 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_04030 3898 4593 gene locus_tag LOCUS_04040 3898 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085390.1 protein_id gnl|my_center|LOCUS_04040 5727 4633 gene locus_tag LOCUS_04050 gene disA 5727 4633 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_04050 7379 5922 gene locus_tag LOCUS_04060 gene radA 7379 5922 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_04060 8030 7392 gene locus_tag LOCUS_04070 8030 7392 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 protein_id gnl|my_center|LOCUS_04070 8358 8083 gene locus_tag LOCUS_04080 8358 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 9117 8419 gene locus_tag LOCUS_04090 9117 8419 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_04090 9279 10094 gene locus_tag LOCUS_04100 9279 10094 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_04100 10091 10861 gene locus_tag LOCUS_04110 10091 10861 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028920.1 protein_id gnl|my_center|LOCUS_04110 10880 11497 gene locus_tag LOCUS_04120 10880 11497 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_04120 11736 13853 gene locus_tag LOCUS_04130 11736 13853 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_04130 14013 14867 gene locus_tag LOCUS_04140 14013 14867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 14864 15943 gene locus_tag LOCUS_04150 14864 15943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 17123 15948 gene locus_tag LOCUS_04160 17123 15948 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029660.1 protein_id gnl|my_center|LOCUS_04160 17239 17520 gene locus_tag LOCUS_04170 17239 17520 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228661.1 protein_id gnl|my_center|LOCUS_04170 17838 17644 gene locus_tag LOCUS_04180 17838 17644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 19427 17982 gene locus_tag LOCUS_04190 19427 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 19745 20992 gene locus_tag LOCUS_04200 19745 20992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 21019 21996 gene locus_tag LOCUS_04210 21019 21996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 22432 21902 gene locus_tag LOCUS_04220 22432 21902 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_04220 22573 23652 gene locus_tag LOCUS_04230 22573 23652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 24078 23866 gene locus_tag LOCUS_04240 24078 23866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 24946 24191 gene locus_tag LOCUS_04250 24946 24191 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_04250 25210 26448 gene locus_tag LOCUS_04260 gene kynU 25210 26448 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338098.1 protein_id gnl|my_center|LOCUS_04260 26874 26455 gene locus_tag LOCUS_04270 26874 26455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 26954 27409 gene locus_tag LOCUS_04280 26954 27409 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence012 1254 3161 gene locus_tag LOCUS_04290 1254 3161 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230654.1 protein_id gnl|my_center|LOCUS_04290 3304 4170 gene locus_tag LOCUS_04300 3304 4170 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 protein_id gnl|my_center|LOCUS_04300 8066 4173 gene locus_tag LOCUS_04310 8066 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 9282 8071 gene locus_tag LOCUS_04320 9282 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 11677 9374 gene locus_tag LOCUS_04330 11677 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 11861 11691 gene locus_tag LOCUS_04340 11861 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 13099 12140 gene locus_tag LOCUS_04350 13099 12140 CDS product DUF4231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030354.1 protein_id gnl|my_center|LOCUS_04350 14517 13255 gene locus_tag LOCUS_04360 14517 13255 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285939.1 protein_id gnl|my_center|LOCUS_04360 15125 14673 gene locus_tag LOCUS_04370 15125 14673 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_04370 15120 16232 gene locus_tag LOCUS_04380 15120 16232 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966651.1 protein_id gnl|my_center|LOCUS_04380 16313 17713 gene locus_tag LOCUS_04390 16313 17713 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704269.1 protein_id gnl|my_center|LOCUS_04390 17710 18720 gene locus_tag LOCUS_04400 17710 18720 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_04400 18852 20570 gene locus_tag LOCUS_04410 gene polX 18852 20570 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_04410 21923 20583 gene locus_tag LOCUS_04420 21923 20583 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_04420 22852 21920 gene locus_tag LOCUS_04430 22852 21920 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_04430 23211 22849 gene locus_tag LOCUS_04440 gene pcaC 23211 22849 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462297.1 protein_id gnl|my_center|LOCUS_04440 24421 23282 gene locus_tag LOCUS_04450 gene pcaB 24421 23282 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031114.1 protein_id gnl|my_center|LOCUS_04450 24932 24441 gene locus_tag LOCUS_04460 gene pcaG 24932 24441 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728463.1 protein_id gnl|my_center|LOCUS_04460 25597 24929 gene locus_tag LOCUS_04470 gene pcaH 25597 24929 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965195.1 protein_id gnl|my_center|LOCUS_04470 26631 25594 gene locus_tag LOCUS_04480 26631 25594 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441295.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence013 1064 1669 gene locus_tag LOCUS_04490 1064 1669 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_04490 1974 1585 gene locus_tag LOCUS_04500 1974 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2391 3512 gene locus_tag LOCUS_04510 2391 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4543 3563 gene locus_tag LOCUS_04520 4543 3563 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966803.1 protein_id gnl|my_center|LOCUS_04520 4648 4929 gene locus_tag LOCUS_04530 4648 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5012 5737 gene locus_tag LOCUS_04540 5012 5737 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_04540 5833 7452 gene locus_tag LOCUS_04550 5833 7452 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920649.1 protein_id gnl|my_center|LOCUS_04550 7560 8423 gene locus_tag LOCUS_04560 7560 8423 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_04560 8719 13281 gene locus_tag LOCUS_04570 8719 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 13278 17624 gene locus_tag LOCUS_04580 13278 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04580 17621 18703 gene locus_tag LOCUS_04590 17621 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 18893 20653 gene locus_tag LOCUS_04600 18893 20653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485997.1 protein_id gnl|my_center|LOCUS_04600 20650 22365 gene locus_tag LOCUS_04610 20650 22365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031834.1 protein_id gnl|my_center|LOCUS_04610 22372 23172 gene locus_tag LOCUS_04620 gene pchC 22372 23172 CDS product pyochelin biosynthesis editing thioesterase PchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114687.1 protein_id gnl|my_center|LOCUS_04620 23871 23176 gene locus_tag LOCUS_04630 23871 23176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 24527 26371 gene locus_tag LOCUS_04640 gene asnB 24527 26371 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence014 262 86 gene locus_tag LOCUS_04650 262 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 1338 370 gene locus_tag LOCUS_04660 gene dapD 1338 370 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 protein_id gnl|my_center|LOCUS_04660 1553 2671 gene locus_tag LOCUS_04670 gene egtA 1553 2671 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_04670 2668 3978 gene locus_tag LOCUS_04680 gene egtB 2668 3978 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_04680 3983 4702 gene locus_tag LOCUS_04690 gene egtC 3983 4702 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419806.1 protein_id gnl|my_center|LOCUS_04690 4712 5710 gene locus_tag LOCUS_04700 gene egtD 4712 5710 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_04700 7106 5700 gene locus_tag LOCUS_04710 7106 5700 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_04710 8051 7530 gene locus_tag LOCUS_04720 8051 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 8322 8173 gene locus_tag LOCUS_04730 8322 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 8728 8417 gene locus_tag LOCUS_04740 8728 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 9769 8825 gene locus_tag LOCUS_04750 9769 8825 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_04750 10409 9831 gene locus_tag LOCUS_04760 10409 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 10596 12236 gene locus_tag LOCUS_04770 10596 12236 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_04770 12233 13195 gene locus_tag LOCUS_04780 12233 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 13192 14256 gene locus_tag LOCUS_04790 13192 14256 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226109.1 protein_id gnl|my_center|LOCUS_04790 14253 15446 gene locus_tag LOCUS_04800 14253 15446 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_04800 15450 16001 gene locus_tag LOCUS_04810 15450 16001 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226119.1 protein_id gnl|my_center|LOCUS_04810 16050 16730 gene locus_tag LOCUS_04820 16050 16730 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 protein_id gnl|my_center|LOCUS_04820 16721 17662 gene locus_tag LOCUS_04830 16721 17662 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_04830 17659 18621 gene locus_tag LOCUS_04840 17659 18621 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_04840 19390 18644 gene locus_tag LOCUS_04850 19390 18644 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 protein_id gnl|my_center|LOCUS_04850 20951 19494 gene locus_tag LOCUS_04860 20951 19494 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224487.1 protein_id gnl|my_center|LOCUS_04860 22590 20953 gene locus_tag LOCUS_04870 gene betA 22590 20953 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_04870 22620 23459 gene locus_tag LOCUS_04880 22620 23459 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_04880 24681 23512 gene locus_tag LOCUS_04890 24681 23512 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_04890 25046 24699 gene locus_tag LOCUS_04900 25046 24699 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_04900 25583 25239 gene locus_tag LOCUS_04910 25583 25239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence015 <1 1560 gene locus_tag LOCUS_04920 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976982.1:ABC-F family ATP-binding cassette domain-containing protein 2324 1533 gene locus_tag LOCUS_04930 2324 1533 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_04930 2922 2335 gene locus_tag LOCUS_04940 2922 2335 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_04940 2983 4848 gene locus_tag LOCUS_04950 2983 4848 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_04950 5793 4984 gene locus_tag LOCUS_04960 5793 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 6640 5978 gene locus_tag LOCUS_04970 6640 5978 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030616.1 protein_id gnl|my_center|LOCUS_04970 7896 6637 gene locus_tag LOCUS_04980 7896 6637 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_04980 7968 8954 gene locus_tag LOCUS_04990 7968 8954 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974569.1 protein_id gnl|my_center|LOCUS_04990 9215 9000 gene locus_tag LOCUS_05000 9215 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 9248 9496 gene locus_tag LOCUS_05010 9248 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 9512 9637 gene locus_tag LOCUS_05020 9512 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 9756 9682 gene locus_tag LOCUS_t00010 9756 9682 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11415 9949 gene locus_tag LOCUS_05030 11415 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 12105 11428 gene locus_tag LOCUS_05040 12105 11428 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970812.1 protein_id gnl|my_center|LOCUS_05040 12304 12543 gene locus_tag LOCUS_05050 12304 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 13205 12552 gene locus_tag LOCUS_05060 13205 12552 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230683.1 protein_id gnl|my_center|LOCUS_05060 13552 14706 gene locus_tag LOCUS_05070 13552 14706 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967206.1 protein_id gnl|my_center|LOCUS_05070 15266 14703 gene locus_tag LOCUS_05080 15266 14703 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 protein_id gnl|my_center|LOCUS_05080 15317 16153 gene locus_tag LOCUS_05090 15317 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 16153 16461 gene locus_tag LOCUS_05100 16153 16461 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227128.1 protein_id gnl|my_center|LOCUS_05100 16926 17381 gene locus_tag LOCUS_05110 16926 17381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 17368 17874 gene locus_tag LOCUS_05120 17368 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 18219 18144 gene locus_tag LOCUS_t00020 18219 18144 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18314 19228 gene locus_tag LOCUS_05130 18314 19228 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_05130 19225 20388 gene locus_tag LOCUS_05140 19225 20388 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974708.1 protein_id gnl|my_center|LOCUS_05140 21915 20434 gene locus_tag LOCUS_05150 gene araA 21915 20434 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_05150 22571 21912 gene locus_tag LOCUS_05160 22571 21912 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 protein_id gnl|my_center|LOCUS_05160 24217 22568 gene locus_tag LOCUS_05170 gene araB 24217 22568 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_05170 <25566 24309 gene locus_tag LOCUS_05180 <25566 24309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226250.1:sugar ABC transporter permease >Feature sequence016 2130 1417 gene locus_tag LOCUS_05190 2130 1417 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013614293.1 protein_id gnl|my_center|LOCUS_05190 2927 2187 gene locus_tag LOCUS_05200 2927 2187 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172331.1 protein_id gnl|my_center|LOCUS_05200 3887 2937 gene locus_tag LOCUS_05210 3887 2937 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_05210 4707 3874 gene locus_tag LOCUS_05220 4707 3874 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776970.1 protein_id gnl|my_center|LOCUS_05220 5348 4704 gene locus_tag LOCUS_05230 5348 4704 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_05230 6274 5348 gene locus_tag LOCUS_05240 6274 5348 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_05240 7025 6297 gene locus_tag LOCUS_05250 7025 6297 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466810.1 protein_id gnl|my_center|LOCUS_05250 7154 8296 gene locus_tag LOCUS_05260 7154 8296 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030660.1 protein_id gnl|my_center|LOCUS_05260 8293 8967 gene locus_tag LOCUS_05270 8293 8967 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729723.1 protein_id gnl|my_center|LOCUS_05270 11494 8945 gene locus_tag LOCUS_05280 11494 8945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_05280 12201 11491 gene locus_tag LOCUS_05290 12201 11491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027531.1 protein_id gnl|my_center|LOCUS_05290 12442 12224 gene locus_tag LOCUS_05300 12442 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 12544 12753 gene locus_tag LOCUS_05310 12544 12753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 15699 12754 gene locus_tag LOCUS_05320 15699 12754 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170213355.1 protein_id gnl|my_center|LOCUS_05320 16815 15742 gene locus_tag LOCUS_05330 16815 15742 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653868.1 protein_id gnl|my_center|LOCUS_05330 17024 16812 gene locus_tag LOCUS_05340 17024 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 17192 20395 gene locus_tag LOCUS_05350 17192 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 22098 20392 gene locus_tag LOCUS_05360 gene glpD 22098 20392 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_05360 23649 22132 gene locus_tag LOCUS_05370 gene glpK 23649 22132 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226257.1 protein_id gnl|my_center|LOCUS_05370 24516 23692 gene locus_tag LOCUS_05380 24516 23692 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109004014.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence017 404 1831 gene locus_tag LOCUS_05390 404 1831 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143420.1 protein_id gnl|my_center|LOCUS_05390 2170 3513 gene locus_tag LOCUS_05400 2170 3513 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_05400 3598 4572 gene locus_tag LOCUS_05410 3598 4572 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_05410 4569 5465 gene locus_tag LOCUS_05420 4569 5465 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_05420 5462 6898 gene locus_tag LOCUS_05430 5462 6898 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_05430 6927 7946 gene locus_tag LOCUS_05440 6927 7946 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_05440 11174 8022 gene locus_tag LOCUS_05450 11174 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05450 13063 11171 gene locus_tag LOCUS_05460 13063 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 14513 13098 gene locus_tag LOCUS_05470 14513 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05470 14695 14510 gene locus_tag LOCUS_05480 14695 14510 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228022.1 protein_id gnl|my_center|LOCUS_05480 16463 14697 gene locus_tag LOCUS_05490 16463 14697 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225487.1 protein_id gnl|my_center|LOCUS_05490 16693 16460 gene locus_tag LOCUS_05500 16693 16460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 18237 16687 gene locus_tag LOCUS_05510 18237 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 19762 18239 gene locus_tag LOCUS_05520 19762 18239 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_05520 <25161 19759 gene locus_tag LOCUS_05530 <25161 19759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950382.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase >Feature sequence018 1252 551 gene locus_tag LOCUS_05540 1252 551 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978707.1 protein_id gnl|my_center|LOCUS_05540 1487 2122 gene locus_tag LOCUS_05550 1487 2122 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978707.1 protein_id gnl|my_center|LOCUS_05550 2155 3144 gene locus_tag LOCUS_05560 2155 3144 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 protein_id gnl|my_center|LOCUS_05560 3533 4093 gene locus_tag LOCUS_05570 3533 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4012 6222 gene locus_tag LOCUS_05580 4012 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 6522 6166 gene locus_tag LOCUS_05590 6522 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 7030 6533 gene locus_tag LOCUS_05600 7030 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 7264 8250 gene locus_tag LOCUS_05610 7264 8250 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977714.1 protein_id gnl|my_center|LOCUS_05610 9082 8252 gene locus_tag LOCUS_05620 9082 8252 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228551.1 protein_id gnl|my_center|LOCUS_05620 9926 9141 gene locus_tag LOCUS_05630 9926 9141 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230274.1 protein_id gnl|my_center|LOCUS_05630 10977 10006 gene locus_tag LOCUS_05640 10977 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 11146 12693 gene locus_tag LOCUS_05650 11146 12693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086928.1 protein_id gnl|my_center|LOCUS_05650 12701 13630 gene locus_tag LOCUS_05660 12701 13630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419701.1 protein_id gnl|my_center|LOCUS_05660 13617 14456 gene locus_tag LOCUS_05670 13617 14456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 protein_id gnl|my_center|LOCUS_05670 15816 14464 gene locus_tag LOCUS_05680 15816 14464 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_05680 17647 15809 gene locus_tag LOCUS_05690 17647 15809 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226499.1 protein_id gnl|my_center|LOCUS_05690 18801 17644 gene locus_tag LOCUS_05700 18801 17644 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742198.1 protein_id gnl|my_center|LOCUS_05700 20061 18937 gene locus_tag LOCUS_05710 20061 18937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 20215 21963 gene locus_tag LOCUS_05720 20215 21963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 23725 21968 gene locus_tag LOCUS_05730 23725 21968 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975838.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence019 1054 461 gene locus_tag LOCUS_05740 gene sigR 1054 461 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_05740 1358 2386 gene locus_tag LOCUS_05750 1358 2386 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222439.1 protein_id gnl|my_center|LOCUS_05750 3636 2461 gene locus_tag LOCUS_05760 gene ftsY 3636 2461 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_05760 7452 3730 gene locus_tag LOCUS_05770 gene smc 7452 3730 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_05770 7400 7618 gene locus_tag LOCUS_05780 7400 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 7906 7712 gene locus_tag LOCUS_05790 7906 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 8365 8096 gene locus_tag LOCUS_05800 8365 8096 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_05800 9335 8442 gene locus_tag LOCUS_05810 gene mutM 9335 8442 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_05810 10100 9351 gene locus_tag LOCUS_05820 gene rnc 10100 9351 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_05820 10576 10397 gene locus_tag LOCUS_05830 gene rpmF 10576 10397 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_05830 11132 10578 gene locus_tag LOCUS_05840 11132 10578 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_05840 11679 11203 gene locus_tag LOCUS_05850 gene coaD 11679 11203 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_05850 12266 11697 gene locus_tag LOCUS_05860 gene rsmD 12266 11697 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_05860 14785 12623 gene locus_tag LOCUS_05870 gene recG 14785 12623 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_05870 15464 14835 gene locus_tag LOCUS_05880 15464 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 15815 16000 gene locus_tag LOCUS_05890 gene rpmB 15815 16000 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_05890 16104 16658 gene locus_tag LOCUS_05900 16104 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 16652 16963 gene locus_tag LOCUS_05910 16652 16963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05910 17782 16976 gene locus_tag LOCUS_05920 gene thiD 17782 16976 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 protein_id gnl|my_center|LOCUS_05920 19145 17808 gene locus_tag LOCUS_05930 19145 17808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 20184 19216 gene locus_tag LOCUS_05940 20184 19216 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_05940 20232 20465 gene locus_tag LOCUS_05950 20232 20465 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_05950 20489 20941 gene locus_tag LOCUS_05960 20489 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 22057 20942 gene locus_tag LOCUS_05970 22057 20942 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_05970 23141 22134 gene locus_tag LOCUS_05980 23141 22134 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_05980 23976 23194 gene locus_tag LOCUS_05990 23976 23194 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_05990 24079 24696 gene locus_tag LOCUS_06000 gene cofC 24079 24696 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence020 1566 2528 gene locus_tag LOCUS_06010 1566 2528 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_06010 2587 3114 gene locus_tag LOCUS_06020 2587 3114 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_06020 3913 3116 gene locus_tag LOCUS_06030 3913 3116 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_06030 4155 4358 gene locus_tag LOCUS_06040 4155 4358 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_06040 5852 4587 gene locus_tag LOCUS_06050 gene serS 5852 4587 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 protein_id gnl|my_center|LOCUS_06050 6811 5891 gene locus_tag LOCUS_06060 gene pheA 6811 5891 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_06060 7358 6939 gene locus_tag LOCUS_06070 7358 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8667 7381 gene locus_tag LOCUS_06080 8667 7381 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_06080 8788 10866 gene locus_tag LOCUS_06090 8788 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 11601 11828 gene locus_tag LOCUS_06100 11601 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12982 12236 gene locus_tag LOCUS_06110 12982 12236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 13373 12987 gene locus_tag LOCUS_06120 gene bldG 13373 12987 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_06120 13561 13998 gene locus_tag LOCUS_06130 13561 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 15150 14035 gene locus_tag LOCUS_06140 15150 14035 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_06140 15860 15147 gene locus_tag LOCUS_06150 15860 15147 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_06150 15952 16179 gene locus_tag LOCUS_06160 15952 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 16665 16213 gene locus_tag LOCUS_06170 16665 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 18773 16818 gene locus_tag LOCUS_06180 18773 16818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 18878 19438 gene locus_tag LOCUS_06190 18878 19438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 20801 19461 gene locus_tag LOCUS_06200 gene cytX 20801 19461 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256688.1 protein_id gnl|my_center|LOCUS_06200 21276 20953 gene locus_tag LOCUS_06210 21276 20953 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_06210 22230 21352 gene locus_tag LOCUS_06220 22230 21352 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_06220 22858 22253 gene locus_tag LOCUS_06230 gene tenA 22858 22253 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877712.1 protein_id gnl|my_center|LOCUS_06230 22902 23549 gene locus_tag LOCUS_06240 22902 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 <24702 23587 gene locus_tag LOCUS_06250 <24702 23587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235624060.1:LCP family protein >Feature sequence021 607 143 gene locus_tag LOCUS_06260 607 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1472 696 gene locus_tag LOCUS_06270 gene pstB 1472 696 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_06270 2378 1476 gene locus_tag LOCUS_06280 gene pstA 2378 1476 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_06280 3229 2375 gene locus_tag LOCUS_06290 gene pstC 3229 2375 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_06290 4474 3359 gene locus_tag LOCUS_06300 gene pstS 4474 3359 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_06300 4639 5097 gene locus_tag LOCUS_06310 4639 5097 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_06310 5084 5890 gene locus_tag LOCUS_06320 5084 5890 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_06320 6721 5921 gene locus_tag LOCUS_06330 gene hisN 6721 5921 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_06330 6802 7245 gene locus_tag LOCUS_06340 6802 7245 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_06340 8608 7271 gene locus_tag LOCUS_06350 8608 7271 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466721.1 protein_id gnl|my_center|LOCUS_06350 8766 9452 gene locus_tag LOCUS_06360 8766 9452 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254113.1 protein_id gnl|my_center|LOCUS_06360 10482 9562 gene locus_tag LOCUS_06370 gene rsgA 10482 9562 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_06370 11945 10587 gene locus_tag LOCUS_06380 gene aroA 11945 10587 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_06380 12065 12814 gene locus_tag LOCUS_06390 12065 12814 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_06390 13039 13371 gene locus_tag LOCUS_06400 13039 13371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14130 13390 gene locus_tag LOCUS_06410 14130 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 14306 15022 gene locus_tag LOCUS_06420 gene sigR 14306 15022 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_06420 15019 15285 gene locus_tag LOCUS_06430 gene rsrA 15019 15285 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_06430 15369 16286 gene locus_tag LOCUS_06440 gene galE1 15369 16286 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419610.1 protein_id gnl|my_center|LOCUS_06440 16438 17394 gene locus_tag LOCUS_06450 16438 17394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 17705 19060 gene locus_tag LOCUS_06460 17705 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 19057 20346 gene locus_tag LOCUS_06470 19057 20346 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_06470 20509 21843 gene locus_tag LOCUS_06480 20509 21843 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179728959.1 protein_id gnl|my_center|LOCUS_06480 21874 22086 gene locus_tag LOCUS_06490 21874 22086 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877243.1 protein_id gnl|my_center|LOCUS_06490 22475 22098 gene locus_tag LOCUS_06500 22475 22098 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357588.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence022 130 1059 gene locus_tag LOCUS_06510 130 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1193 2797 gene locus_tag LOCUS_06520 1193 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3002 4363 gene locus_tag LOCUS_06530 3002 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 4452 4697 gene locus_tag LOCUS_06540 4452 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4694 5260 gene locus_tag LOCUS_06550 4694 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5866 5270 gene locus_tag LOCUS_06560 5866 5270 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 protein_id gnl|my_center|LOCUS_06560 6698 5913 gene locus_tag LOCUS_06570 6698 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7151 6741 gene locus_tag LOCUS_06580 7151 6741 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_06580 7226 8077 gene locus_tag LOCUS_06590 gene sigJ 7226 8077 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_06590 9275 8106 gene locus_tag LOCUS_06600 9275 8106 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876734.1 protein_id gnl|my_center|LOCUS_06600 9488 11317 gene locus_tag LOCUS_06610 gene edd 9488 11317 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284323.1 protein_id gnl|my_center|LOCUS_06610 11314 12273 gene locus_tag LOCUS_06620 11314 12273 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951113.1 protein_id gnl|my_center|LOCUS_06620 12270 12887 gene locus_tag LOCUS_06630 gene eda 12270 12887 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_06630 14076 13054 gene locus_tag LOCUS_06640 14076 13054 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_06640 15703 14087 gene locus_tag LOCUS_06650 15703 14087 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_06650 16590 15730 gene locus_tag LOCUS_06660 16590 15730 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_06660 17546 16584 gene locus_tag LOCUS_06670 17546 16584 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_06670 18845 17550 gene locus_tag LOCUS_06680 18845 17550 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_06680 19263 20531 gene locus_tag LOCUS_06690 19263 20531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 protein_id gnl|my_center|LOCUS_06690 21155 20538 gene locus_tag LOCUS_06700 21155 20538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 21067 21381 gene locus_tag LOCUS_06710 21067 21381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 21463 22887 gene locus_tag LOCUS_06720 21463 22887 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_06720 23269 23093 gene locus_tag LOCUS_06730 23269 23093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 23545 23276 gene locus_tag LOCUS_06740 23545 23276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence023 120 641 gene locus_tag LOCUS_06750 120 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 707 1126 gene locus_tag LOCUS_06760 707 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1181 2067 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acatccccgcgtgcgcggggccgac 2307 2945 gene locus_tag LOCUS_06770 2307 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2942 3454 gene locus_tag LOCUS_06780 2942 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3794 3531 gene locus_tag LOCUS_06790 3794 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4645 3932 gene locus_tag LOCUS_06800 4645 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4999 4655 gene locus_tag LOCUS_06810 4999 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5095 5229 gene locus_tag LOCUS_06820 5095 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 8192 5226 gene locus_tag LOCUS_06830 8192 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 8652 8203 gene locus_tag LOCUS_06840 8652 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 10057 8660 gene locus_tag LOCUS_06850 10057 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 12573 10057 gene locus_tag LOCUS_06860 12573 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 12727 12557 gene locus_tag LOCUS_06870 12727 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 13191 12796 gene locus_tag LOCUS_06880 13191 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 13451 13188 gene locus_tag LOCUS_06890 13451 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 13939 13448 gene locus_tag LOCUS_06900 13939 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 14124 13939 gene locus_tag LOCUS_06910 14124 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14462 14121 gene locus_tag LOCUS_06920 14462 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 14917 14495 gene locus_tag LOCUS_06930 14917 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 15380 14919 gene locus_tag LOCUS_06940 15380 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 15616 15377 gene locus_tag LOCUS_06950 15616 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 16200 15613 gene locus_tag LOCUS_06960 16200 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 16462 16208 gene locus_tag LOCUS_06970 16462 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 16753 16463 gene locus_tag LOCUS_06980 16753 16463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 17456 16863 gene locus_tag LOCUS_06990 17456 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 18995 17502 gene locus_tag LOCUS_07000 18995 17502 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900703.1 protein_id gnl|my_center|LOCUS_07000 19945 18995 gene locus_tag LOCUS_07010 19945 18995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 20148 19942 gene locus_tag LOCUS_07020 20148 19942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 21539 20145 gene locus_tag LOCUS_07030 21539 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 21769 21539 gene locus_tag LOCUS_07040 21769 21539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 23325 21766 gene locus_tag LOCUS_07050 23325 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 23594 23322 gene locus_tag LOCUS_07060 23594 23322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence024 2761 299 gene locus_tag LOCUS_07070 gene leuS 2761 299 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_07070 3227 4660 gene locus_tag LOCUS_07080 3227 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 5954 4680 gene locus_tag LOCUS_07090 5954 4680 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_07090 6475 8001 gene locus_tag LOCUS_07100 6475 8001 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_07100 9264 8008 gene locus_tag LOCUS_07110 9264 8008 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_07110 10660 9290 gene locus_tag LOCUS_07120 10660 9290 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_07120 11835 10849 gene locus_tag LOCUS_07130 11835 10849 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_07130 11912 13030 gene locus_tag LOCUS_07140 11912 13030 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224352.1 protein_id gnl|my_center|LOCUS_07140 13207 13854 gene locus_tag LOCUS_07150 13207 13854 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_07150 13951 14793 gene locus_tag LOCUS_07160 13951 14793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_07160 14790 15578 gene locus_tag LOCUS_07170 14790 15578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_07170 15609 15842 gene locus_tag LOCUS_07180 15609 15842 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_07180 15839 16399 gene locus_tag LOCUS_07190 15839 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 16890 16381 gene locus_tag LOCUS_07200 16890 16381 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606669.1 protein_id gnl|my_center|LOCUS_07200 16995 18434 gene locus_tag LOCUS_07210 16995 18434 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_07210 18554 18928 gene locus_tag LOCUS_07220 18554 18928 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 protein_id gnl|my_center|LOCUS_07220 19063 20589 gene locus_tag LOCUS_07230 19063 20589 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877353.1 protein_id gnl|my_center|LOCUS_07230 21192 20653 gene locus_tag LOCUS_07240 21192 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 21441 21743 gene locus_tag LOCUS_07250 21441 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_07250 23058 21670 gene locus_tag LOCUS_07260 23058 21670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence025 2259 1447 gene locus_tag LOCUS_07270 2259 1447 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228650.1 protein_id gnl|my_center|LOCUS_07270 2840 2547 gene locus_tag LOCUS_07280 2840 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3267 2995 gene locus_tag LOCUS_07290 3267 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3868 3236 gene locus_tag LOCUS_07300 3868 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4168 3962 gene locus_tag LOCUS_07310 4168 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4167 4955 gene locus_tag LOCUS_07320 4167 4955 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_07320 5290 6690 gene locus_tag LOCUS_07330 5290 6690 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976065.1 protein_id gnl|my_center|LOCUS_07330 7115 6591 gene locus_tag LOCUS_07340 7115 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 7108 9474 gene locus_tag LOCUS_07350 7108 9474 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_07350 9496 9882 gene locus_tag LOCUS_07360 9496 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 10042 10776 gene locus_tag LOCUS_07370 10042 10776 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_07370 10807 12219 gene locus_tag LOCUS_07380 gene rimO 10807 12219 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_07380 12562 12203 gene locus_tag LOCUS_07390 12562 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 12459 13094 gene locus_tag LOCUS_07400 gene pgsA 12459 13094 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_07400 13091 13585 gene locus_tag LOCUS_07410 13091 13585 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_07410 13839 14195 gene locus_tag LOCUS_07420 13839 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 15367 14582 gene locus_tag LOCUS_07430 15367 14582 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_07430 16118 15402 gene locus_tag LOCUS_07440 16118 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 16398 17558 gene locus_tag LOCUS_07450 16398 17558 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_07450 19224 17728 gene locus_tag LOCUS_07460 19224 17728 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030127.1 protein_id gnl|my_center|LOCUS_07460 20241 19390 gene locus_tag LOCUS_07470 20241 19390 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028676.1 protein_id gnl|my_center|LOCUS_07470 21251 20238 gene locus_tag LOCUS_07480 21251 20238 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776529.1 protein_id gnl|my_center|LOCUS_07480 22587 21256 gene locus_tag LOCUS_07490 22587 21256 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975864.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence026 858 595 gene locus_tag LOCUS_07500 858 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1230 862 gene locus_tag LOCUS_07510 1230 862 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208855.1 protein_id gnl|my_center|LOCUS_07510 2724 1237 gene locus_tag LOCUS_07520 2724 1237 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208856.1 protein_id gnl|my_center|LOCUS_07520 2888 2724 gene locus_tag LOCUS_07530 2888 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 3449 2898 gene locus_tag LOCUS_07540 3449 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3769 3446 gene locus_tag LOCUS_07550 3769 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3943 3773 gene locus_tag LOCUS_07560 3943 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4974 3943 gene locus_tag LOCUS_07570 4974 3943 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975797.1 protein_id gnl|my_center|LOCUS_07570 5400 5005 gene locus_tag LOCUS_07580 5400 5005 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975798.1 protein_id gnl|my_center|LOCUS_07580 5992 5414 gene locus_tag LOCUS_07590 5992 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 6935 6042 gene locus_tag LOCUS_07600 6935 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8584 6935 gene locus_tag LOCUS_07610 8584 6935 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975801.1 protein_id gnl|my_center|LOCUS_07610 8808 8584 gene locus_tag LOCUS_07620 8808 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 10767 8818 gene locus_tag LOCUS_07630 10767 8818 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027223.1 protein_id gnl|my_center|LOCUS_07630 11230 10670 gene locus_tag LOCUS_07640 11230 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 12492 11230 gene locus_tag LOCUS_07650 12492 11230 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_07650 13226 12606 gene locus_tag LOCUS_07660 13226 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384017.1 protein_id gnl|my_center|LOCUS_07660 13989 13303 gene locus_tag LOCUS_07670 13989 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 14505 14314 gene locus_tag LOCUS_07680 14505 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 14891 14502 gene locus_tag LOCUS_07690 14891 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 16123 14888 gene locus_tag LOCUS_07700 16123 14888 CDS product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338072.1 protein_id gnl|my_center|LOCUS_07700 16532 16113 gene locus_tag LOCUS_07710 16532 16113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 16813 16550 gene locus_tag LOCUS_07720 16813 16550 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388797.1 protein_id gnl|my_center|LOCUS_07720 17000 16800 gene locus_tag LOCUS_07730 17000 16800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 17227 16985 gene locus_tag LOCUS_07740 17227 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 17679 17224 gene locus_tag LOCUS_07750 17679 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 17870 17676 gene locus_tag LOCUS_07760 17870 17676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 18523 17867 gene locus_tag LOCUS_07770 18523 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 19206 18520 gene locus_tag LOCUS_07780 19206 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 19635 19375 gene locus_tag LOCUS_07790 19635 19375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 19794 19639 gene locus_tag LOCUS_07800 19794 19639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 20209 19808 gene locus_tag LOCUS_07810 20209 19808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 20236 20394 gene locus_tag LOCUS_07820 20236 20394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 20497 20784 gene locus_tag LOCUS_07830 20497 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 21054 20818 gene locus_tag LOCUS_07840 21054 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 21035 21319 gene locus_tag LOCUS_07850 21035 21319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 21564 21328 gene locus_tag LOCUS_07860 21564 21328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 21722 22042 gene locus_tag LOCUS_07870 21722 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 22422 22234 gene locus_tag LOCUS_07880 22422 22234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence027 934 101 gene locus_tag LOCUS_07890 934 101 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_07890 2323 1004 gene locus_tag LOCUS_07900 2323 1004 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228500.1 protein_id gnl|my_center|LOCUS_07900 2894 2454 gene locus_tag LOCUS_07910 2894 2454 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 protein_id gnl|my_center|LOCUS_07910 4296 3124 gene locus_tag LOCUS_07920 4296 3124 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_07920 4924 4334 gene locus_tag LOCUS_07930 4924 4334 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_07930 7679 5004 gene locus_tag LOCUS_07940 7679 5004 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_07940 7895 8788 gene locus_tag LOCUS_07950 7895 8788 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_07950 9897 8986 gene locus_tag LOCUS_07960 9897 8986 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763296.1 protein_id gnl|my_center|LOCUS_07960 11113 9890 gene locus_tag LOCUS_07970 11113 9890 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571116.1 protein_id gnl|my_center|LOCUS_07970 12094 11117 gene locus_tag LOCUS_07980 12094 11117 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312440.1 protein_id gnl|my_center|LOCUS_07980 15179 12138 gene locus_tag LOCUS_07990 15179 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 16295 15402 gene locus_tag LOCUS_08000 16295 15402 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729360.1 protein_id gnl|my_center|LOCUS_08000 18445 16349 gene locus_tag LOCUS_08010 18445 16349 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_08010 18766 19341 gene locus_tag LOCUS_08020 18766 19341 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_08020 19647 22175 gene locus_tag LOCUS_08030 19647 22175 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_08030 <22996 22263 gene locus_tag LOCUS_08040 <22996 22263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027239.1:AraC family transcriptional regulator >Feature sequence028 327 1004 gene locus_tag LOCUS_08050 gene mtrA 327 1004 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_08050 1165 2829 gene locus_tag LOCUS_08060 gene mtrB 1165 2829 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_08060 2819 4585 gene locus_tag LOCUS_08070 2819 4585 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_08070 4630 5379 gene locus_tag LOCUS_08080 4630 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5904 6575 gene locus_tag LOCUS_08090 gene raiA 5904 6575 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229726.1 protein_id gnl|my_center|LOCUS_08090 7418 6942 gene locus_tag LOCUS_08100 7418 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9024 7435 gene locus_tag LOCUS_08110 9024 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 9146 9553 gene locus_tag LOCUS_08120 9146 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9726 10376 gene locus_tag LOCUS_08130 9726 10376 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_08130 11592 10369 gene locus_tag LOCUS_08140 11592 10369 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_08140 11934 11662 gene locus_tag LOCUS_08150 11934 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 12154 14961 gene locus_tag LOCUS_08160 gene secA 12154 14961 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_08160 15494 15015 gene locus_tag LOCUS_08170 15494 15015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 17095 15761 gene locus_tag LOCUS_08180 17095 15761 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028657.1 protein_id gnl|my_center|LOCUS_08180 17864 17124 gene locus_tag LOCUS_08190 17864 17124 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_08190 18019 19053 gene locus_tag LOCUS_08200 18019 19053 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_08200 19088 19324 gene locus_tag LOCUS_08210 19088 19324 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_08210 19417 19863 gene locus_tag LOCUS_08220 19417 19863 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977435.1 protein_id gnl|my_center|LOCUS_08220 19871 20509 gene locus_tag LOCUS_08230 19871 20509 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027849.1 protein_id gnl|my_center|LOCUS_08230 20531 20788 gene locus_tag LOCUS_08240 20531 20788 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224593.1 protein_id gnl|my_center|LOCUS_08240 20842 22524 gene locus_tag LOCUS_08250 gene ptsP 20842 22524 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence029 450 4 gene locus_tag LOCUS_08260 450 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1450 461 gene locus_tag LOCUS_08270 1450 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1661 1452 gene locus_tag LOCUS_08280 1661 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1910 1698 gene locus_tag LOCUS_08290 1910 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2494 1910 gene locus_tag LOCUS_08300 2494 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 5481 2494 gene locus_tag LOCUS_08310 5481 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6638 5478 gene locus_tag LOCUS_08320 6638 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 9679 6650 gene locus_tag LOCUS_08330 9679 6650 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382239.1 protein_id gnl|my_center|LOCUS_08330 9666 9920 gene locus_tag LOCUS_08340 9666 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 10330 9917 gene locus_tag LOCUS_08350 10330 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10827 10339 gene locus_tag LOCUS_08360 10827 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 11573 11067 gene locus_tag LOCUS_08370 11573 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 12015 11587 gene locus_tag LOCUS_08380 12015 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 12392 12015 gene locus_tag LOCUS_08390 12392 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 13054 12473 gene locus_tag LOCUS_08400 13054 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 13363 13064 gene locus_tag LOCUS_08410 13363 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 14493 13372 gene locus_tag LOCUS_08420 14493 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 15929 14493 gene locus_tag LOCUS_08430 15929 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 16498 15941 gene locus_tag LOCUS_08440 16498 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 16764 16498 gene locus_tag LOCUS_08450 16764 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 18101 16821 gene locus_tag LOCUS_08460 18101 16821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 19213 18113 gene locus_tag LOCUS_08470 19213 18113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 20565 19213 gene locus_tag LOCUS_08480 20565 19213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 20783 20565 gene locus_tag LOCUS_08490 20783 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 22138 20798 gene locus_tag LOCUS_08500 22138 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072725739.1 protein_id gnl|my_center|LOCUS_08500 22508 22167 gene locus_tag LOCUS_08510 22508 22167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence030 645 400 gene locus_tag LOCUS_08520 645 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 865 638 gene locus_tag LOCUS_08530 865 638 CDS product DUF6158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030977.1 protein_id gnl|my_center|LOCUS_08530 1024 878 gene locus_tag LOCUS_08540 1024 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1363 1142 gene locus_tag LOCUS_08550 1363 1142 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_08550 2211 1360 gene locus_tag LOCUS_08560 2211 1360 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_08560 2363 2806 gene locus_tag LOCUS_08570 2363 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2935 4374 gene locus_tag LOCUS_08580 2935 4374 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028648.1 protein_id gnl|my_center|LOCUS_08580 4475 4606 gene locus_tag LOCUS_08590 4475 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4735 5280 gene locus_tag LOCUS_08600 4735 5280 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_08600 5277 6830 gene locus_tag LOCUS_08610 5277 6830 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_08610 6872 7885 gene locus_tag LOCUS_08620 gene speB 6872 7885 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_08620 9067 7898 gene locus_tag LOCUS_08630 9067 7898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 protein_id gnl|my_center|LOCUS_08630 9613 9161 gene locus_tag LOCUS_08640 9613 9161 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_08640 9647 11146 gene locus_tag LOCUS_08650 9647 11146 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229297.1 protein_id gnl|my_center|LOCUS_08650 11178 12353 gene locus_tag LOCUS_08660 11178 12353 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_08660 12350 13162 gene locus_tag LOCUS_08670 12350 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 13162 13686 gene locus_tag LOCUS_08680 13162 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 13679 15247 gene locus_tag LOCUS_08690 13679 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 15459 15214 gene locus_tag LOCUS_08700 15459 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 16091 15543 gene locus_tag LOCUS_08710 16091 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 16715 16524 gene locus_tag LOCUS_08720 16715 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 16648 16881 gene locus_tag LOCUS_08730 16648 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 16878 17555 gene locus_tag LOCUS_08740 16878 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 17571 18614 gene locus_tag LOCUS_08750 17571 18614 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414172.1 protein_id gnl|my_center|LOCUS_08750 19564 18662 gene locus_tag LOCUS_08760 19564 18662 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230653.1 protein_id gnl|my_center|LOCUS_08760 21774 19687 gene locus_tag LOCUS_08770 21774 19687 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230654.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence031 848 84 gene locus_tag LOCUS_08780 848 84 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_08780 1046 2353 gene locus_tag LOCUS_08790 gene hisD 1046 2353 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_08790 2350 3426 gene locus_tag LOCUS_08800 2350 3426 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_08800 3423 4028 gene locus_tag LOCUS_08810 gene hisB 3423 4028 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_08810 4028 4180 gene locus_tag LOCUS_08820 4028 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 4177 4809 gene locus_tag LOCUS_08830 gene hisH 4177 4809 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_08830 4956 5327 gene locus_tag LOCUS_08840 4956 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 5333 6058 gene locus_tag LOCUS_08850 gene priA 5333 6058 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_08850 6067 6474 gene locus_tag LOCUS_08860 6067 6474 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_08860 6478 7248 gene locus_tag LOCUS_08870 gene hisF 6478 7248 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_08870 7520 7296 gene locus_tag LOCUS_08880 7520 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8217 8056 gene locus_tag LOCUS_08890 8217 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8633 8442 gene locus_tag LOCUS_08900 8633 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9340 8708 gene locus_tag LOCUS_08910 9340 8708 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_08910 9561 11384 gene locus_tag LOCUS_08920 9561 11384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_08920 11422 13227 gene locus_tag LOCUS_08930 11422 13227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_08930 13424 14812 gene locus_tag LOCUS_08940 13424 14812 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_08940 15695 14895 gene locus_tag LOCUS_08950 15695 14895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223109.1 protein_id gnl|my_center|LOCUS_08950 16620 15751 gene locus_tag LOCUS_08960 16620 15751 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223108.1 protein_id gnl|my_center|LOCUS_08960 17927 16692 gene locus_tag LOCUS_08970 17927 16692 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223107.1 protein_id gnl|my_center|LOCUS_08970 19039 17975 gene locus_tag LOCUS_08980 19039 17975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 protein_id gnl|my_center|LOCUS_08980 19232 19978 gene locus_tag LOCUS_08990 19232 19978 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223104.1 protein_id gnl|my_center|LOCUS_08990 19984 20739 gene locus_tag LOCUS_09000 19984 20739 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223103.1 protein_id gnl|my_center|LOCUS_09000 20781 21131 gene locus_tag LOCUS_09010 gene hisI 20781 21131 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_09010 21128 21754 gene locus_tag LOCUS_09020 21128 21754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence032 81 1181 gene locus_tag LOCUS_09030 81 1181 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_09030 1178 2029 gene locus_tag LOCUS_09040 1178 2029 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776904.1 protein_id gnl|my_center|LOCUS_09040 2534 2079 gene locus_tag LOCUS_09050 2534 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2929 2531 gene locus_tag LOCUS_09060 2929 2531 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228426.1 protein_id gnl|my_center|LOCUS_09060 3718 3119 gene locus_tag LOCUS_09070 3718 3119 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223522.1 protein_id gnl|my_center|LOCUS_09070 4203 3865 gene locus_tag LOCUS_09080 4203 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4300 5640 gene locus_tag LOCUS_09090 4300 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 6161 5700 gene locus_tag LOCUS_09100 6161 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 6435 6572 gene locus_tag LOCUS_09110 6435 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 7229 6576 gene locus_tag LOCUS_09120 7229 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7255 7560 gene locus_tag LOCUS_09130 7255 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 8852 7455 gene locus_tag LOCUS_09140 8852 7455 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027188.1 protein_id gnl|my_center|LOCUS_09140 10159 8888 gene locus_tag LOCUS_09150 10159 8888 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225175.1 protein_id gnl|my_center|LOCUS_09150 11001 10165 gene locus_tag LOCUS_09160 11001 10165 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027186.1 protein_id gnl|my_center|LOCUS_09160 11963 11016 gene locus_tag LOCUS_09170 11963 11016 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978331.1 protein_id gnl|my_center|LOCUS_09170 13218 11965 gene locus_tag LOCUS_09180 13218 11965 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027184.1 protein_id gnl|my_center|LOCUS_09180 13359 14087 gene locus_tag LOCUS_09190 13359 14087 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225174.1 protein_id gnl|my_center|LOCUS_09190 14259 14783 gene locus_tag LOCUS_09200 14259 14783 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224813.1 protein_id gnl|my_center|LOCUS_09200 17523 15025 gene locus_tag LOCUS_09210 17523 15025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 18241 17525 gene locus_tag LOCUS_09220 18241 17525 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224862.1 protein_id gnl|my_center|LOCUS_09220 18963 19169 gene locus_tag LOCUS_09230 18963 19169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 19793 19200 gene locus_tag LOCUS_09240 19793 19200 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 protein_id gnl|my_center|LOCUS_09240 20031 20807 gene locus_tag LOCUS_09250 20031 20807 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085699.1 protein_id gnl|my_center|LOCUS_09250 20809 21180 gene locus_tag LOCUS_09260 20809 21180 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_09260 21444 21368 gene locus_tag LOCUS_t00030 21444 21368 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 21607 21969 gene locus_tag LOCUS_09270 21607 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence033 147 767 gene locus_tag LOCUS_09280 gene ruvA 147 767 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_09280 850 1896 gene locus_tag LOCUS_09290 gene ruvB 850 1896 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_09290 2142 2507 gene locus_tag LOCUS_09300 2142 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2549 4309 gene locus_tag LOCUS_09310 gene secD 2549 4309 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_09310 4309 5352 gene locus_tag LOCUS_09320 gene secF 4309 5352 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_09320 5435 5941 gene locus_tag LOCUS_09330 5435 5941 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_09330 6037 8406 gene locus_tag LOCUS_09340 gene relA 6037 8406 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_09340 9823 8579 gene locus_tag LOCUS_09350 9823 8579 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_09350 10713 9868 gene locus_tag LOCUS_09360 10713 9868 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 protein_id gnl|my_center|LOCUS_09360 10983 11666 gene locus_tag LOCUS_09370 10983 11666 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_09370 11666 12922 gene locus_tag LOCUS_09380 gene hisS 11666 12922 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325801.1 protein_id gnl|my_center|LOCUS_09380 12919 14670 gene locus_tag LOCUS_09390 gene aspS 12919 14670 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027660890.1 protein_id gnl|my_center|LOCUS_09390 15655 14738 gene locus_tag LOCUS_09400 15655 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 15871 16338 gene locus_tag LOCUS_09410 15871 16338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 16355 17662 gene locus_tag LOCUS_09420 16355 17662 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_09420 17767 18237 gene locus_tag LOCUS_09430 17767 18237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 18234 18503 gene locus_tag LOCUS_09440 18234 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 18505 21177 gene locus_tag LOCUS_09450 gene alaS 18505 21177 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_09450 21185 21673 gene locus_tag LOCUS_09460 gene ruvX 21185 21673 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence034 1998 1030 gene locus_tag LOCUS_09470 1998 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2774 1995 gene locus_tag LOCUS_09480 2774 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 3249 2767 gene locus_tag LOCUS_09490 3249 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4132 3233 gene locus_tag LOCUS_09500 gene cmr4 4132 3233 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082339.1 protein_id gnl|my_center|LOCUS_09500 5306 4236 gene locus_tag LOCUS_09510 gene cmr3 5306 4236 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879359.1 protein_id gnl|my_center|LOCUS_09510 6946 5306 gene locus_tag LOCUS_09520 gene cas10 6946 5306 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 protein_id gnl|my_center|LOCUS_09520 7239 7982 gene locus_tag LOCUS_09530 7239 7982 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_09530 8186 8803 gene locus_tag LOCUS_09540 8186 8803 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223255.1 protein_id gnl|my_center|LOCUS_09540 10044 9049 gene locus_tag LOCUS_09550 gene serC 10044 9049 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_09550 10382 13060 gene locus_tag LOCUS_09560 10382 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 14347 13241 gene locus_tag LOCUS_09570 14347 13241 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_09570 14517 15161 gene locus_tag LOCUS_09580 gene pdxH 14517 15161 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_09580 15778 15167 gene locus_tag LOCUS_09590 15778 15167 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227026.1 protein_id gnl|my_center|LOCUS_09590 15854 16558 gene locus_tag LOCUS_09600 15854 16558 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_09600 16679 18907 gene locus_tag LOCUS_09610 16679 18907 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161102907.1 protein_id gnl|my_center|LOCUS_09610 19130 19906 gene locus_tag LOCUS_09620 19130 19906 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_09620 20159 20320 gene locus_tag LOCUS_09630 20159 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 <21601 20429 gene locus_tag LOCUS_09640 <21601 20429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896599.1:acyl-CoA dehydrogenase family protein >Feature sequence035 229 1134 gene locus_tag LOCUS_09650 229 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1251 1565 gene locus_tag LOCUS_09660 1251 1565 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_09660 2990 1860 gene locus_tag LOCUS_09670 gene rsgA 2990 1860 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_09670 4522 3263 gene locus_tag LOCUS_09680 4522 3263 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_09680 6145 4688 gene locus_tag LOCUS_09690 6145 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 7146 6178 gene locus_tag LOCUS_09700 7146 6178 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_09700 7777 9459 gene locus_tag LOCUS_09710 gene sirA 7777 9459 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_09710 9456 9608 gene locus_tag LOCUS_09720 9456 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_09720 9668 10396 gene locus_tag LOCUS_09730 9668 10396 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_09730 10378 11139 gene locus_tag LOCUS_09740 10378 11139 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_09740 11389 11862 gene locus_tag LOCUS_09750 11389 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 12011 13519 gene locus_tag LOCUS_09760 12011 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 13679 15289 gene locus_tag LOCUS_09770 13679 15289 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_09770 15379 15807 gene locus_tag LOCUS_09780 15379 15807 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_09780 15926 18043 gene locus_tag LOCUS_09790 gene glgX 15926 18043 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224925.1 protein_id gnl|my_center|LOCUS_09790 19313 18204 gene locus_tag LOCUS_09800 19313 18204 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121850.1 protein_id gnl|my_center|LOCUS_09800 20034 19297 gene locus_tag LOCUS_09810 20034 19297 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_09810 20354 21196 gene locus_tag LOCUS_09820 20354 21196 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence036 135 1409 gene locus_tag LOCUS_09830 135 1409 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_09830 1399 2106 gene locus_tag LOCUS_09840 1399 2106 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_09840 2660 2298 gene locus_tag LOCUS_09850 2660 2298 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_09850 2776 3270 gene locus_tag LOCUS_09860 2776 3270 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_09860 3620 4030 gene locus_tag LOCUS_09870 3620 4030 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_09870 4377 5951 gene locus_tag LOCUS_09880 4377 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6102 7259 gene locus_tag LOCUS_09890 6102 7259 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_09890 8085 7699 gene locus_tag LOCUS_09900 gene dtd 8085 7699 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_09900 8170 9111 gene locus_tag LOCUS_09910 8170 9111 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_09910 10872 9232 gene locus_tag LOCUS_09920 10872 9232 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_09920 11433 11095 gene locus_tag LOCUS_09930 11433 11095 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 protein_id gnl|my_center|LOCUS_09930 12222 11854 gene locus_tag LOCUS_09940 12222 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 12662 12219 gene locus_tag LOCUS_09950 12662 12219 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222362.1 protein_id gnl|my_center|LOCUS_09950 13645 12731 gene locus_tag LOCUS_09960 13645 12731 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729216.1 protein_id gnl|my_center|LOCUS_09960 13965 13642 gene locus_tag LOCUS_09970 gene blaI 13965 13642 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950618.1 protein_id gnl|my_center|LOCUS_09970 14050 14568 gene locus_tag LOCUS_09980 14050 14568 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_09980 15113 14586 gene locus_tag LOCUS_09990 15113 14586 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 protein_id gnl|my_center|LOCUS_09990 15961 15143 gene locus_tag LOCUS_10000 15961 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_10000 16752 16018 gene locus_tag LOCUS_10010 16752 16018 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031214.1 protein_id gnl|my_center|LOCUS_10010 16918 18201 gene locus_tag LOCUS_10020 gene mshA 16918 18201 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_10020 18464 18949 gene locus_tag LOCUS_10030 18464 18949 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 protein_id gnl|my_center|LOCUS_10030 18989 19732 gene locus_tag LOCUS_10040 18989 19732 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_10040 21192 19786 gene locus_tag LOCUS_10050 21192 19786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence037 1168 1368 gene locus_tag LOCUS_10060 1168 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1998 1714 gene locus_tag LOCUS_10070 1998 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2594 2163 gene locus_tag LOCUS_10080 2594 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3350 2697 gene locus_tag LOCUS_10090 3350 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4825 3446 gene locus_tag LOCUS_10100 4825 3446 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950232.1 protein_id gnl|my_center|LOCUS_10100 5625 4894 gene locus_tag LOCUS_10110 5625 4894 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974725.1 protein_id gnl|my_center|LOCUS_10110 9679 5645 gene locus_tag LOCUS_10120 9679 5645 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061962207.1 protein_id gnl|my_center|LOCUS_10120 10352 9927 gene locus_tag LOCUS_10130 10352 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 10433 11326 gene locus_tag LOCUS_10140 10433 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 11323 12066 gene locus_tag LOCUS_10150 11323 12066 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033260715.1 protein_id gnl|my_center|LOCUS_10150 13350 12076 gene locus_tag LOCUS_10160 13350 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 13856 13392 gene locus_tag LOCUS_10170 13856 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 14987 13974 gene locus_tag LOCUS_10180 14987 13974 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_10180 15390 16826 gene locus_tag LOCUS_10190 15390 16826 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224317.1 protein_id gnl|my_center|LOCUS_10190 16952 17749 gene locus_tag LOCUS_10200 16952 17749 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_10200 18946 17762 gene locus_tag LOCUS_10210 18946 17762 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_10210 19444 19022 gene locus_tag LOCUS_10220 gene nsrR 19444 19022 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_10220 19574 20131 gene locus_tag LOCUS_10230 19574 20131 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226947.1 protein_id gnl|my_center|LOCUS_10230 20263 20904 gene locus_tag LOCUS_10240 20263 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence038 1379 24 gene locus_tag LOCUS_10250 1379 24 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031641.1 protein_id gnl|my_center|LOCUS_10250 2391 1465 gene locus_tag LOCUS_10260 2391 1465 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_10260 3297 2395 gene locus_tag LOCUS_10270 3297 2395 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031643.1 protein_id gnl|my_center|LOCUS_10270 3542 4639 gene locus_tag LOCUS_10280 3542 4639 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051005886.1 protein_id gnl|my_center|LOCUS_10280 4860 4660 gene locus_tag LOCUS_10290 4860 4660 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 protein_id gnl|my_center|LOCUS_10290 6104 4893 gene locus_tag LOCUS_10300 6104 4893 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467629.1 protein_id gnl|my_center|LOCUS_10300 6384 6938 gene locus_tag LOCUS_10310 6384 6938 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978564.1 protein_id gnl|my_center|LOCUS_10310 7033 7665 gene locus_tag LOCUS_10320 7033 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 7765 8178 gene locus_tag LOCUS_10330 7765 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 8657 8175 gene locus_tag LOCUS_10340 8657 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 9363 8620 gene locus_tag LOCUS_10350 9363 8620 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819086.1 protein_id gnl|my_center|LOCUS_10350 10037 9360 gene locus_tag LOCUS_10360 10037 9360 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_10360 11215 10034 gene locus_tag LOCUS_10370 11215 10034 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223752.1 protein_id gnl|my_center|LOCUS_10370 13428 11326 gene locus_tag LOCUS_10380 13428 11326 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031066.1 protein_id gnl|my_center|LOCUS_10380 14750 13425 gene locus_tag LOCUS_10390 gene brxD 14750 13425 CDS product BREX system ATP-binding protein BrxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031065.1 protein_id gnl|my_center|LOCUS_10390 16273 14747 gene locus_tag LOCUS_10400 16273 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 17155 16274 gene locus_tag LOCUS_10410 17155 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 17852 17184 gene locus_tag LOCUS_10420 17852 17184 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210395.1 protein_id gnl|my_center|LOCUS_10420 18398 17862 gene locus_tag LOCUS_10430 18398 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 20128 18395 gene locus_tag LOCUS_10440 20128 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence039 348 1871 gene locus_tag LOCUS_10450 348 1871 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_10450 2813 1977 gene locus_tag LOCUS_10460 2813 1977 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567937.1 protein_id gnl|my_center|LOCUS_10460 4192 2942 gene locus_tag LOCUS_10470 4192 2942 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_10470 4472 5338 gene locus_tag LOCUS_10480 4472 5338 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_10480 5331 7211 gene locus_tag LOCUS_10490 5331 7211 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530467.1 protein_id gnl|my_center|LOCUS_10490 7198 7959 gene locus_tag LOCUS_10500 7198 7959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812846.1 protein_id gnl|my_center|LOCUS_10500 7995 8621 gene locus_tag LOCUS_10510 7995 8621 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532606.1 protein_id gnl|my_center|LOCUS_10510 8860 10626 gene locus_tag LOCUS_10520 gene accC 8860 10626 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_10520 10675 11427 gene locus_tag LOCUS_10530 10675 11427 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203813331.1 protein_id gnl|my_center|LOCUS_10530 12359 11412 gene locus_tag LOCUS_10540 12359 11412 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_10540 12962 12468 gene locus_tag LOCUS_10550 12962 12468 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_10550 13296 12964 gene locus_tag LOCUS_10560 13296 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 13392 14942 gene locus_tag LOCUS_10570 13392 14942 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 protein_id gnl|my_center|LOCUS_10570 15020 15781 gene locus_tag LOCUS_10580 15020 15781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971996.1 protein_id gnl|my_center|LOCUS_10580 16699 15818 gene locus_tag LOCUS_10590 16699 15818 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_10590 17941 16748 gene locus_tag LOCUS_10600 17941 16748 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_10600 18375 17938 gene locus_tag LOCUS_10610 18375 17938 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061809.1 protein_id gnl|my_center|LOCUS_10610 18472 19368 gene locus_tag LOCUS_10620 18472 19368 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926995.1 protein_id gnl|my_center|LOCUS_10620 19365 19826 gene locus_tag LOCUS_10630 19365 19826 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_10630 19986 19795 gene locus_tag LOCUS_10640 19986 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 19995 20459 gene locus_tag LOCUS_10650 19995 20459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence040 204 1391 gene locus_tag LOCUS_10660 gene recF 204 1391 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_10660 1381 1914 gene locus_tag LOCUS_10670 1381 1914 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_10670 2558 4504 gene locus_tag LOCUS_10680 gene gyrB 2558 4504 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221960.1 protein_id gnl|my_center|LOCUS_10680 4533 7034 gene locus_tag LOCUS_10690 gene gyrA 4533 7034 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_10690 7249 7947 gene locus_tag LOCUS_10700 7249 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 8108 8184 gene locus_tag LOCUS_t00040 8108 8184 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 8526 9674 gene locus_tag LOCUS_10710 gene murG 8526 9674 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_10710 10447 9842 gene locus_tag LOCUS_10720 10447 9842 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 protein_id gnl|my_center|LOCUS_10720 10885 10643 gene locus_tag LOCUS_10730 10885 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 11761 11105 gene locus_tag LOCUS_10740 11761 11105 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_10740 12178 13377 gene locus_tag LOCUS_10750 12178 13377 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_10750 14443 13364 gene locus_tag LOCUS_10760 14443 13364 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_10760 14498 14968 gene locus_tag LOCUS_10770 14498 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 15410 15165 gene locus_tag LOCUS_10780 15410 15165 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_10780 15571 15407 gene locus_tag LOCUS_10790 gene rpmG 15571 15407 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889348.1 protein_id gnl|my_center|LOCUS_10790 15652 16587 gene locus_tag LOCUS_10800 15652 16587 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230420.1 protein_id gnl|my_center|LOCUS_10800 16584 17450 gene locus_tag LOCUS_10810 16584 17450 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_10810 17447 18322 gene locus_tag LOCUS_10820 17447 18322 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230418.1 protein_id gnl|my_center|LOCUS_10820 19822 18542 gene locus_tag LOCUS_10830 19822 18542 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209648948.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence041 2558 1668 gene locus_tag LOCUS_10840 gene truA 2558 1668 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_10840 3204 2641 gene locus_tag LOCUS_10850 3204 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4368 3352 gene locus_tag LOCUS_10860 4368 3352 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_10860 4361 4537 gene locus_tag LOCUS_10870 4361 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5151 4525 gene locus_tag LOCUS_10880 gene rpsD 5151 4525 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_10880 5576 5172 gene locus_tag LOCUS_10890 gene rpsK 5576 5172 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_10890 6051 5671 gene locus_tag LOCUS_10900 gene rpsM 6051 5671 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105472.1 protein_id gnl|my_center|LOCUS_10900 6696 6475 gene locus_tag LOCUS_10910 gene infA 6696 6475 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_10910 7403 6960 gene locus_tag LOCUS_10920 7403 6960 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 protein_id gnl|my_center|LOCUS_10920 8300 7473 gene locus_tag LOCUS_10930 gene map 8300 7473 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_10930 9040 8387 gene locus_tag LOCUS_10940 9040 8387 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_10940 10347 9040 gene locus_tag LOCUS_10950 gene secY 10347 9040 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_10950 10984 10529 gene locus_tag LOCUS_10960 gene rplO 10984 10529 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_10960 11168 10986 gene locus_tag LOCUS_10970 gene rpmD 11168 10986 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_10970 11803 11171 gene locus_tag LOCUS_10980 gene rpsE 11803 11171 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_10980 12251 11868 gene locus_tag LOCUS_10990 gene rplR 12251 11868 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053041.1 protein_id gnl|my_center|LOCUS_10990 12796 12254 gene locus_tag LOCUS_11000 gene rplF 12796 12254 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_11000 13213 12815 gene locus_tag LOCUS_11010 gene rpsH 13213 12815 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_11010 13512 13327 gene locus_tag LOCUS_11020 13512 13327 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_11020 14088 13519 gene locus_tag LOCUS_11030 gene rplE 14088 13519 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_11030 14396 14088 gene locus_tag LOCUS_11040 14396 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 14764 14396 gene locus_tag LOCUS_11050 gene rplN 14764 14396 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_11050 15245 14958 gene locus_tag LOCUS_11060 gene rpsQ 15245 14958 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_11060 15474 15238 gene locus_tag LOCUS_11070 gene rpmC 15474 15238 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_11070 15893 15474 gene locus_tag LOCUS_11080 gene rplP 15893 15474 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 protein_id gnl|my_center|LOCUS_11080 16738 15896 gene locus_tag LOCUS_11090 16738 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 17091 16738 gene locus_tag LOCUS_11100 gene rplV 17091 16738 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_11100 17404 17126 gene locus_tag LOCUS_11110 gene rpsS 17404 17126 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814508.1 protein_id gnl|my_center|LOCUS_11110 18252 17416 gene locus_tag LOCUS_11120 gene rplB 18252 17416 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_11120 18681 18379 gene locus_tag LOCUS_11130 18681 18379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 19331 18681 gene locus_tag LOCUS_11140 gene rplD 19331 18681 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_11140 19984 19328 gene locus_tag LOCUS_11150 gene rplC 19984 19328 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_11150 20366 19998 gene locus_tag LOCUS_11160 gene rpsJ 20366 19998 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence042 354 863 gene locus_tag LOCUS_11170 354 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1092 883 gene locus_tag LOCUS_11180 1092 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1686 1141 gene locus_tag LOCUS_11190 1686 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2625 1786 gene locus_tag LOCUS_11200 2625 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2697 3473 gene locus_tag LOCUS_11210 2697 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3735 4523 gene locus_tag LOCUS_11220 3735 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5169 4798 gene locus_tag LOCUS_11230 5169 4798 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529398.1 protein_id gnl|my_center|LOCUS_11230 5281 5514 gene locus_tag LOCUS_11240 5281 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 7035 5488 gene locus_tag LOCUS_11250 7035 5488 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 protein_id gnl|my_center|LOCUS_11250 7166 7546 gene locus_tag LOCUS_11260 7166 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 7950 7786 gene locus_tag LOCUS_11270 7950 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 8114 8737 gene locus_tag LOCUS_11280 8114 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 8741 10705 gene locus_tag LOCUS_11290 8741 10705 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189214254.1 protein_id gnl|my_center|LOCUS_11290 10730 11596 gene locus_tag LOCUS_11300 10730 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 11597 11878 gene locus_tag LOCUS_11310 11597 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 11875 12165 gene locus_tag LOCUS_11320 11875 12165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 13183 12116 gene locus_tag LOCUS_11330 13183 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11330 13609 13214 gene locus_tag LOCUS_11340 13609 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11340 14912 13899 gene locus_tag LOCUS_11350 14912 13899 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967305.1 protein_id gnl|my_center|LOCUS_11350 16054 14888 gene locus_tag LOCUS_11360 16054 14888 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967304.1 protein_id gnl|my_center|LOCUS_11360 16924 16556 gene locus_tag LOCUS_11370 16924 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 17407 17649 gene locus_tag LOCUS_11380 17407 17649 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920053.1 protein_id gnl|my_center|LOCUS_11380 17841 18818 gene locus_tag LOCUS_11390 17841 18818 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815063.1 protein_id gnl|my_center|LOCUS_11390 19085 19507 gene locus_tag LOCUS_11400 19085 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence043 225 947 gene locus_tag LOCUS_11410 225 947 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028771.1 protein_id gnl|my_center|LOCUS_11410 1197 958 gene locus_tag LOCUS_11420 1197 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1800 1225 gene locus_tag LOCUS_11430 1800 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2255 1962 gene locus_tag LOCUS_11440 2255 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3454 2420 gene locus_tag LOCUS_11450 3454 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4170 3451 gene locus_tag LOCUS_11460 4170 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4443 4676 gene locus_tag LOCUS_11470 4443 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4673 5002 gene locus_tag LOCUS_11480 4673 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5449 5153 gene locus_tag LOCUS_11490 5449 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 5824 5606 gene locus_tag LOCUS_11500 5824 5606 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 protein_id gnl|my_center|LOCUS_11500 6588 5854 gene locus_tag LOCUS_11510 gene allR 6588 5854 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_11510 7867 6617 gene locus_tag LOCUS_11520 7867 6617 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_11520 9144 7867 gene locus_tag LOCUS_11530 9144 7867 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_11530 10595 9144 gene locus_tag LOCUS_11540 10595 9144 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_11540 12209 10620 gene locus_tag LOCUS_11550 gene aceB 12209 10620 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_11550 12382 13050 gene locus_tag LOCUS_11560 12382 13050 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976449.1 protein_id gnl|my_center|LOCUS_11560 13384 14709 gene locus_tag LOCUS_11570 13384 14709 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_11570 14860 16263 gene locus_tag LOCUS_11580 gene hflX 14860 16263 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_11580 16711 17919 gene locus_tag LOCUS_11590 gene hutI 16711 17919 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068174090.1 protein_id gnl|my_center|LOCUS_11590 18095 18622 gene locus_tag LOCUS_11600 18095 18622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11600 18574 18945 gene locus_tag LOCUS_11610 18574 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11610 >Feature sequence044 2633 426 gene locus_tag LOCUS_11620 2633 426 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727059.1 protein_id gnl|my_center|LOCUS_11620 2803 3879 gene locus_tag LOCUS_11630 2803 3879 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 protein_id gnl|my_center|LOCUS_11630 3973 5013 gene locus_tag LOCUS_11640 3973 5013 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_11640 5144 4986 gene locus_tag LOCUS_11650 5144 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5529 5107 gene locus_tag LOCUS_11660 5529 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 5813 5526 gene locus_tag LOCUS_11670 5813 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6607 6035 gene locus_tag LOCUS_11680 6607 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7132 6752 gene locus_tag LOCUS_tm00010 7132 6752 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9331 7427 gene locus_tag LOCUS_11690 9331 7427 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081656.1 protein_id gnl|my_center|LOCUS_11690 9817 9335 gene locus_tag LOCUS_11700 gene smpB 9817 9335 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_11700 10774 9875 gene locus_tag LOCUS_11710 gene ftsX 10774 9875 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_11710 11478 10789 gene locus_tag LOCUS_11720 gene ftsE 11478 10789 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_11720 11658 11846 gene locus_tag LOCUS_11730 11658 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 12958 11840 gene locus_tag LOCUS_11740 gene prfB 12958 11840 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_11740 13042 14106 gene locus_tag LOCUS_11750 13042 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 19056 14113 gene locus_tag LOCUS_11760 19056 14113 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_11760 19904 19083 gene locus_tag LOCUS_11770 19904 19083 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence045 539 880 gene locus_tag LOCUS_11780 539 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 989 1759 gene locus_tag LOCUS_11790 989 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2562 1843 gene locus_tag LOCUS_11800 2562 1843 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_11800 5817 2569 gene locus_tag LOCUS_11810 5817 2569 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_11810 7095 6619 gene locus_tag LOCUS_11820 7095 6619 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918009.1 protein_id gnl|my_center|LOCUS_11820 8515 7127 gene locus_tag LOCUS_11830 8515 7127 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199314899.1 protein_id gnl|my_center|LOCUS_11830 8982 10025 gene locus_tag LOCUS_11840 8982 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 10046 10870 gene locus_tag LOCUS_11850 10046 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 10867 11652 gene locus_tag LOCUS_11860 10867 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 11642 12520 gene locus_tag LOCUS_11870 11642 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 12525 13238 gene locus_tag LOCUS_11880 12525 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 13256 15421 gene locus_tag LOCUS_11890 13256 15421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 15418 18108 gene locus_tag LOCUS_11900 15418 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 18577 18344 gene locus_tag LOCUS_11910 18577 18344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 18867 18655 gene locus_tag LOCUS_11920 18867 18655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 19075 19854 gene locus_tag LOCUS_11930 19075 19854 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029777.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence046 233 655 gene locus_tag LOCUS_11940 233 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 652 2247 gene locus_tag LOCUS_11950 652 2247 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 protein_id gnl|my_center|LOCUS_11950 2264 3592 gene locus_tag LOCUS_11960 2264 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3579 4385 gene locus_tag LOCUS_11970 3579 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4426 4680 gene locus_tag LOCUS_11980 4426 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4728 5276 gene locus_tag LOCUS_11990 4728 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5321 6190 gene locus_tag LOCUS_12000 5321 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 6195 6617 gene locus_tag LOCUS_12010 6195 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 6624 6956 gene locus_tag LOCUS_12020 6624 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6960 7307 gene locus_tag LOCUS_12030 6960 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7410 8342 gene locus_tag LOCUS_12040 7410 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 8333 8974 gene locus_tag LOCUS_12050 8333 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 8986 9642 gene locus_tag LOCUS_12060 8986 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 9645 10016 gene locus_tag LOCUS_12070 9645 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 10013 10429 gene locus_tag LOCUS_12080 10013 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 10476 10892 gene locus_tag LOCUS_12090 10476 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10894 11295 gene locus_tag LOCUS_12100 10894 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 11379 11714 gene locus_tag LOCUS_12110 11379 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 11614 14115 gene locus_tag LOCUS_12120 11614 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 14115 18668 gene locus_tag LOCUS_12130 14115 18668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 18681 19229 gene locus_tag LOCUS_12140 18681 19229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 19229 19555 gene locus_tag LOCUS_12150 19229 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence047 135 500 gene locus_tag LOCUS_12160 135 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 991 1500 gene locus_tag LOCUS_12170 991 1500 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_12170 2947 1625 gene locus_tag LOCUS_12180 2947 1625 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_12180 4402 3290 gene locus_tag LOCUS_12190 4402 3290 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_12190 4496 5755 gene locus_tag LOCUS_12200 4496 5755 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 protein_id gnl|my_center|LOCUS_12200 5800 5982 gene locus_tag LOCUS_12210 5800 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6449 5979 gene locus_tag LOCUS_12220 6449 5979 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_12220 6558 7046 gene locus_tag LOCUS_12230 gene def 6558 7046 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_12230 8599 7193 gene locus_tag LOCUS_12240 8599 7193 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 protein_id gnl|my_center|LOCUS_12240 9303 8695 gene locus_tag LOCUS_12250 9303 8695 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_12250 9485 12049 gene locus_tag LOCUS_12260 gene pepN 9485 12049 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_12260 12913 12620 gene locus_tag LOCUS_12270 12913 12620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 13018 13458 gene locus_tag LOCUS_12280 13018 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 13476 14450 gene locus_tag LOCUS_12290 13476 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 15881 14454 gene locus_tag LOCUS_12300 15881 14454 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_12300 16077 16859 gene locus_tag LOCUS_12310 16077 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 16958 18796 gene locus_tag LOCUS_12320 gene ilvD 16958 18796 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028925.1 protein_id gnl|my_center|LOCUS_12320 19158 19652 gene locus_tag LOCUS_12330 19158 19652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence048 <1 1012 gene locus_tag LOCUS_12340 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140460.1:oligosaccharide flippase family protein 1038 1934 gene locus_tag LOCUS_12350 1038 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3116 1941 gene locus_tag LOCUS_12360 3116 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3269 4195 gene locus_tag LOCUS_12370 3269 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4211 4966 gene locus_tag LOCUS_12380 4211 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4968 6476 gene locus_tag LOCUS_12390 4968 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6689 7159 gene locus_tag LOCUS_12400 6689 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 8126 7230 gene locus_tag LOCUS_12410 8126 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 8684 8139 gene locus_tag LOCUS_12420 gene rfbC 8684 8139 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730941.1 protein_id gnl|my_center|LOCUS_12420 8707 9564 gene locus_tag LOCUS_12430 8707 9564 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043607342.1 protein_id gnl|my_center|LOCUS_12430 10747 9569 gene locus_tag LOCUS_12440 10747 9569 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466568.1 protein_id gnl|my_center|LOCUS_12440 12053 10737 gene locus_tag LOCUS_12450 12053 10737 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_12450 13320 12235 gene locus_tag LOCUS_12460 13320 12235 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_12460 14237 13317 gene locus_tag LOCUS_12470 14237 13317 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730926.1 protein_id gnl|my_center|LOCUS_12470 14942 14268 gene locus_tag LOCUS_12480 14942 14268 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199864955.1 protein_id gnl|my_center|LOCUS_12480 16136 15078 gene locus_tag LOCUS_12490 16136 15078 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_12490 17976 16129 gene locus_tag LOCUS_12500 17976 16129 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_12500 18559 19038 gene locus_tag LOCUS_12510 18559 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12510 19035 19568 gene locus_tag LOCUS_12520 19035 19568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12520 >Feature sequence049 2127 1060 gene locus_tag LOCUS_12530 2127 1060 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_12530 2534 2124 gene locus_tag LOCUS_12540 2534 2124 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815550.1 protein_id gnl|my_center|LOCUS_12540 2962 2531 gene locus_tag LOCUS_12550 2962 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3111 3887 gene locus_tag LOCUS_12560 3111 3887 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970110.1 protein_id gnl|my_center|LOCUS_12560 4934 4062 gene locus_tag LOCUS_12570 4934 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 5700 4927 gene locus_tag LOCUS_12580 5700 4927 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085471.1 protein_id gnl|my_center|LOCUS_12580 6601 5702 gene locus_tag LOCUS_12590 6601 5702 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419318.1 protein_id gnl|my_center|LOCUS_12590 7953 6598 gene locus_tag LOCUS_12600 7953 6598 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665507.1 protein_id gnl|my_center|LOCUS_12600 9914 7950 gene locus_tag LOCUS_12610 9914 7950 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969352.1 protein_id gnl|my_center|LOCUS_12610 12049 9911 gene locus_tag LOCUS_12620 12049 9911 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 protein_id gnl|my_center|LOCUS_12620 12360 12052 gene locus_tag LOCUS_12630 12360 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 13162 12386 gene locus_tag LOCUS_12640 13162 12386 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970110.1 protein_id gnl|my_center|LOCUS_12640 14331 13162 gene locus_tag LOCUS_12650 14331 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 14995 14333 gene locus_tag LOCUS_12660 14995 14333 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087440.1 protein_id gnl|my_center|LOCUS_12660 15221 16843 gene locus_tag LOCUS_12670 15221 16843 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_12670 18386 16854 gene locus_tag LOCUS_12680 18386 16854 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 protein_id gnl|my_center|LOCUS_12680 <19362 18383 gene locus_tag LOCUS_12690 <19362 18383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383769.1:ABC transporter permease >Feature sequence050 2307 1291 gene locus_tag LOCUS_12700 2307 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2448 4805 gene locus_tag LOCUS_12710 2448 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 4843 6348 gene locus_tag LOCUS_12720 4843 6348 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_12720 9516 6559 gene locus_tag LOCUS_12730 9516 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 10231 9530 gene locus_tag LOCUS_12740 10231 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 10606 10932 gene locus_tag LOCUS_12750 10606 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 10987 11889 gene locus_tag LOCUS_12760 10987 11889 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_12760 13114 11891 gene locus_tag LOCUS_12770 13114 11891 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_12770 13280 14449 gene locus_tag LOCUS_12780 13280 14449 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_12780 15293 14541 gene locus_tag LOCUS_12790 15293 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 16804 15584 gene locus_tag LOCUS_12800 16804 15584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_12800 16926 17930 gene locus_tag LOCUS_12810 16926 17930 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_12810 18408 17920 gene locus_tag LOCUS_12820 18408 17920 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 protein_id gnl|my_center|LOCUS_12820 18729 19232 gene locus_tag LOCUS_12830 18729 19232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence051 945 109 gene locus_tag LOCUS_12840 945 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1436 945 gene locus_tag LOCUS_12850 1436 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1783 1436 gene locus_tag LOCUS_12860 1783 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2431 1811 gene locus_tag LOCUS_12870 2431 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3455 2487 gene locus_tag LOCUS_12880 3455 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4647 3415 gene locus_tag LOCUS_12890 4647 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4976 5491 gene locus_tag LOCUS_12900 4976 5491 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_12900 5488 6837 gene locus_tag LOCUS_12910 5488 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6834 7235 gene locus_tag LOCUS_12920 6834 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 7887 7294 gene locus_tag LOCUS_12930 7887 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 14269 7904 gene locus_tag LOCUS_12940 14269 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 14878 14802 gene locus_tag LOCUS_t00050 14878 14802 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15000 15509 gene locus_tag LOCUS_12950 15000 15509 CDS product DUF892 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525107.1 protein_id gnl|my_center|LOCUS_12950 16736 15534 gene locus_tag LOCUS_12960 16736 15534 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085545.1 protein_id gnl|my_center|LOCUS_12960 17104 16901 gene locus_tag LOCUS_12970 17104 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 17720 17091 gene locus_tag LOCUS_12980 17720 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence052 793 95 gene locus_tag LOCUS_12990 793 95 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978258.1 protein_id gnl|my_center|LOCUS_12990 927 1568 gene locus_tag LOCUS_13000 927 1568 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706361.1 protein_id gnl|my_center|LOCUS_13000 1766 5443 gene locus_tag LOCUS_13010 1766 5443 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_13010 5527 5700 gene locus_tag LOCUS_13020 5527 5700 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_13020 6100 6921 gene locus_tag LOCUS_13030 6100 6921 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_13030 6986 7726 gene locus_tag LOCUS_13040 6986 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8779 7817 gene locus_tag LOCUS_13050 8779 7817 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228445.1 protein_id gnl|my_center|LOCUS_13050 9636 9028 gene locus_tag LOCUS_13060 9636 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9763 10977 gene locus_tag LOCUS_13070 9763 10977 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390074.1 protein_id gnl|my_center|LOCUS_13070 11068 11352 gene locus_tag LOCUS_13080 11068 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 11516 12610 gene locus_tag LOCUS_13090 11516 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 14113 12722 gene locus_tag LOCUS_13100 14113 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_13100 15452 14289 gene locus_tag LOCUS_13110 15452 14289 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_13110 15745 16272 gene locus_tag LOCUS_13120 15745 16272 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_13120 16740 16426 gene locus_tag LOCUS_13130 16740 16426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 16825 17226 gene locus_tag LOCUS_13140 gene sodN 16825 17226 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_13140 17440 17865 gene locus_tag LOCUS_13150 17440 17865 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_13150 17886 18665 gene locus_tag LOCUS_13160 17886 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence053 <1 529 gene locus_tag LOCUS_13170 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029739.1:Uma2 family endonuclease 779 567 gene locus_tag LOCUS_13180 779 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1499 966 gene locus_tag LOCUS_13190 1499 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1580 1873 gene locus_tag LOCUS_13200 1580 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4286 2175 gene locus_tag LOCUS_13210 gene uvrB 4286 2175 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_13210 5090 4485 gene locus_tag LOCUS_13220 5090 4485 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 protein_id gnl|my_center|LOCUS_13220 5761 5087 gene locus_tag LOCUS_13230 5761 5087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889094.1 protein_id gnl|my_center|LOCUS_13230 6916 5762 gene locus_tag LOCUS_13240 6916 5762 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241160.1 protein_id gnl|my_center|LOCUS_13240 8291 6918 gene locus_tag LOCUS_13250 8291 6918 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244910.1 protein_id gnl|my_center|LOCUS_13250 8910 8299 gene locus_tag LOCUS_13260 8910 8299 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626155.1 protein_id gnl|my_center|LOCUS_13260 10284 9046 gene locus_tag LOCUS_13270 10284 9046 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_13270 11028 10468 gene locus_tag LOCUS_13280 11028 10468 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222749.1 protein_id gnl|my_center|LOCUS_13280 11857 11021 gene locus_tag LOCUS_13290 11857 11021 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_13290 12028 12759 gene locus_tag LOCUS_13300 12028 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 12850 14013 gene locus_tag LOCUS_13310 gene yeaW 12850 14013 CDS product carnitine monooxygenase subunit YeaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067835.1 protein_id gnl|my_center|LOCUS_13310 14696 14091 gene locus_tag LOCUS_13320 gene coaE 14696 14091 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_13320 15200 14721 gene locus_tag LOCUS_13330 15200 14721 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230160.1 protein_id gnl|my_center|LOCUS_13330 16819 15353 gene locus_tag LOCUS_13340 gene rpsA 16819 15353 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_13340 18090 17026 gene locus_tag LOCUS_13350 18090 17026 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_13350 18148 18945 gene locus_tag LOCUS_13360 18148 18945 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082127.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence054 2673 2341 gene locus_tag LOCUS_13370 2673 2341 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230629.1 protein_id gnl|my_center|LOCUS_13370 2758 3591 gene locus_tag LOCUS_13380 2758 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 3600 4466 gene locus_tag LOCUS_13390 3600 4466 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786554.1 protein_id gnl|my_center|LOCUS_13390 5449 4592 gene locus_tag LOCUS_13400 5449 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 6784 5612 gene locus_tag LOCUS_13410 6784 5612 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_13410 8939 6876 gene locus_tag LOCUS_13420 8939 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13420 10589 9270 gene locus_tag LOCUS_13430 10589 9270 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029904.1 protein_id gnl|my_center|LOCUS_13430 13394 10719 gene locus_tag LOCUS_13440 gene topA 13394 10719 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_13440 13660 13851 gene locus_tag LOCUS_13450 13660 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 13848 14111 gene locus_tag LOCUS_13460 13848 14111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 16190 14208 gene locus_tag LOCUS_13470 16190 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 17021 16395 gene locus_tag LOCUS_13480 17021 16395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 18426 17131 gene locus_tag LOCUS_13490 18426 17131 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_13490 18637 18723 gene locus_tag LOCUS_t00060 18637 18723 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence055 637 14 gene locus_tag LOCUS_13500 637 14 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_13500 4852 641 gene locus_tag LOCUS_13510 4852 641 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228557.1 protein_id gnl|my_center|LOCUS_13510 5007 6542 gene locus_tag LOCUS_13520 5007 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 8333 6552 gene locus_tag LOCUS_13530 8333 6552 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142567766.1 protein_id gnl|my_center|LOCUS_13530 9269 8454 gene locus_tag LOCUS_13540 9269 8454 CDS product rRNA (guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223831.1 protein_id gnl|my_center|LOCUS_13540 9177 9539 gene locus_tag LOCUS_13550 9177 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 9563 10297 gene locus_tag LOCUS_13560 9563 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 10489 10962 gene locus_tag LOCUS_13570 10489 10962 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_13570 11030 11254 gene locus_tag LOCUS_13580 11030 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 11303 13783 gene locus_tag LOCUS_13590 11303 13783 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_13590 14288 13746 gene locus_tag LOCUS_13600 14288 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 14476 14285 gene locus_tag LOCUS_13610 14476 14285 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198276085.1 protein_id gnl|my_center|LOCUS_13610 14875 15336 gene locus_tag LOCUS_13620 14875 15336 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_13620 16348 15521 gene locus_tag LOCUS_13630 16348 15521 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_13630 16446 16856 gene locus_tag LOCUS_13640 16446 16856 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_13640 17891 17607 gene locus_tag LOCUS_13650 17891 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence056 2862 550 gene locus_tag LOCUS_13660 2862 550 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_13660 3117 3467 gene locus_tag LOCUS_13670 gene bldG 3117 3467 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_13670 3487 3915 gene locus_tag LOCUS_13680 3487 3915 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_13680 4377 6668 gene locus_tag LOCUS_13690 4377 6668 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_13690 6832 7305 gene locus_tag LOCUS_13700 6832 7305 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222279.1 protein_id gnl|my_center|LOCUS_13700 8534 7311 gene locus_tag LOCUS_13710 gene serB 8534 7311 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_13710 9480 8863 gene locus_tag LOCUS_13720 9480 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 10547 9504 gene locus_tag LOCUS_13730 10547 9504 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_13730 11230 10544 gene locus_tag LOCUS_13740 11230 10544 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_13740 11674 11318 gene locus_tag LOCUS_13750 11674 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 11637 12737 gene locus_tag LOCUS_13760 11637 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 12734 13354 gene locus_tag LOCUS_13770 12734 13354 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_13770 14186 13446 gene locus_tag LOCUS_13780 14186 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_13780 14242 15030 gene locus_tag LOCUS_13790 14242 15030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_13790 15084 15839 gene locus_tag LOCUS_13800 15084 15839 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_13800 15846 16097 gene locus_tag LOCUS_13810 15846 16097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 17030 16122 gene locus_tag LOCUS_13820 17030 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 17744 17142 gene locus_tag LOCUS_13830 17744 17142 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence057 1980 139 gene locus_tag LOCUS_13840 1980 139 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_13840 2163 3668 gene locus_tag LOCUS_13850 2163 3668 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_13850 5009 3675 gene locus_tag LOCUS_13860 5009 3675 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727370.1 protein_id gnl|my_center|LOCUS_13860 5266 5901 gene locus_tag LOCUS_13870 5266 5901 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_13870 6638 6051 gene locus_tag LOCUS_13880 6638 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6919 8895 gene locus_tag LOCUS_13890 6919 8895 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_13890 9910 9023 gene locus_tag LOCUS_13900 9910 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 10936 9974 gene locus_tag LOCUS_13910 10936 9974 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226498.1 protein_id gnl|my_center|LOCUS_13910 10968 11846 gene locus_tag LOCUS_13920 10968 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 13853 11967 gene locus_tag LOCUS_13930 13853 11967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_13930 14885 14034 gene locus_tag LOCUS_13940 14885 14034 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_13940 15299 15084 gene locus_tag LOCUS_13950 15299 15084 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 protein_id gnl|my_center|LOCUS_13950 17013 15415 gene locus_tag LOCUS_13960 17013 15415 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_13960 <17820 17280 gene locus_tag LOCUS_13970 <17820 17280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224727.1:acVLRF1 family peptidyl-tRNA hydrolase >Feature sequence058 1161 409 gene locus_tag LOCUS_13980 1161 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222106.1 protein_id gnl|my_center|LOCUS_13980 3020 1176 gene locus_tag LOCUS_13990 3020 1176 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222107.1 protein_id gnl|my_center|LOCUS_13990 3168 4133 gene locus_tag LOCUS_14000 3168 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974288.1 protein_id gnl|my_center|LOCUS_14000 4811 4197 gene locus_tag LOCUS_14010 4811 4197 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 protein_id gnl|my_center|LOCUS_14010 7156 4808 gene locus_tag LOCUS_14020 7156 4808 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440634.1 protein_id gnl|my_center|LOCUS_14020 8019 7153 gene locus_tag LOCUS_14030 8019 7153 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897054.1 protein_id gnl|my_center|LOCUS_14030 8611 10077 gene locus_tag LOCUS_14040 8611 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 10524 10144 gene locus_tag LOCUS_14050 10524 10144 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027643.1 protein_id gnl|my_center|LOCUS_14050 12152 10524 gene locus_tag LOCUS_14060 12152 10524 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 protein_id gnl|my_center|LOCUS_14060 13516 12221 gene locus_tag LOCUS_14070 13516 12221 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027627.1 protein_id gnl|my_center|LOCUS_14070 14166 13585 gene locus_tag LOCUS_14080 14166 13585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027527.1 protein_id gnl|my_center|LOCUS_14080 14581 14204 gene locus_tag LOCUS_14090 14581 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 15652 14666 gene locus_tag LOCUS_14100 15652 14666 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260258.1 protein_id gnl|my_center|LOCUS_14100 15897 17351 gene locus_tag LOCUS_14110 15897 17351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence059 <1 878 gene locus_tag LOCUS_14120 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262573.1:alpha/beta hydrolase 956 1195 gene locus_tag LOCUS_14130 gene mrx1 956 1195 CDS product mycoredoxin Mrx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416827.1 protein_id gnl|my_center|LOCUS_14130 2117 1197 gene locus_tag LOCUS_14140 gene nudC 2117 1197 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_14140 2353 3516 gene locus_tag LOCUS_14150 2353 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477486.1 protein_id gnl|my_center|LOCUS_14150 3513 5120 gene locus_tag LOCUS_14160 3513 5120 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038167.1 protein_id gnl|my_center|LOCUS_14160 5124 6758 gene locus_tag LOCUS_14170 5124 6758 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030750.1 protein_id gnl|my_center|LOCUS_14170 6755 7858 gene locus_tag LOCUS_14180 6755 7858 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038170.1 protein_id gnl|my_center|LOCUS_14180 8628 7867 gene locus_tag LOCUS_14190 8628 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 9487 8615 gene locus_tag LOCUS_14200 9487 8615 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_14200 9532 10203 gene locus_tag LOCUS_14210 9532 10203 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133116.1 protein_id gnl|my_center|LOCUS_14210 10546 11277 gene locus_tag LOCUS_14220 10546 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 14509 11252 gene locus_tag LOCUS_14230 14509 11252 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 protein_id gnl|my_center|LOCUS_14230 <17703 14503 gene locus_tag LOCUS_14240 <17703 14503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223038.1:ATP-dependent DNA helicase >Feature sequence060 <1 1478 gene locus_tag LOCUS_14250 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973157.1:HAMP domain-containing sensor histidine kinase 1737 2036 gene locus_tag LOCUS_14260 1737 2036 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_14260 2101 2811 gene locus_tag LOCUS_14270 2101 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14270 3101 4498 gene locus_tag LOCUS_14280 3101 4498 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_14280 4811 4488 gene locus_tag LOCUS_14290 4811 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4908 7397 gene locus_tag LOCUS_14300 gene valS 4908 7397 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_14300 7579 8958 gene locus_tag LOCUS_14310 7579 8958 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 protein_id gnl|my_center|LOCUS_14310 9112 9549 gene locus_tag LOCUS_14320 gene dut 9112 9549 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_14320 9596 10273 gene locus_tag LOCUS_14330 9596 10273 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_14330 10450 10842 gene locus_tag LOCUS_14340 10450 10842 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_14340 10859 11539 gene locus_tag LOCUS_14350 10859 11539 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_14350 12245 11577 gene locus_tag LOCUS_14360 12245 11577 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_14360 12913 12245 gene locus_tag LOCUS_14370 12913 12245 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_14370 13030 15063 gene locus_tag LOCUS_14380 13030 15063 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_14380 15214 16485 gene locus_tag LOCUS_14390 15214 16485 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_14390 <17430 16504 gene locus_tag LOCUS_14400 <17430 16504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029728.1:chitinase >Feature sequence061 411 2246 gene locus_tag LOCUS_14410 411 2246 CDS product SCO2524 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028405.1 protein_id gnl|my_center|LOCUS_14410 2248 3165 gene locus_tag LOCUS_14420 2248 3165 CDS product SCO2523 family variant P-loop protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976280.1 protein_id gnl|my_center|LOCUS_14420 3162 4133 gene locus_tag LOCUS_14430 3162 4133 CDS product SCO2522 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485045.1 protein_id gnl|my_center|LOCUS_14430 4161 5081 gene locus_tag LOCUS_14440 4161 5081 CDS product SCO2521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028403.1 protein_id gnl|my_center|LOCUS_14440 5084 6061 gene locus_tag LOCUS_14450 5084 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 7229 6024 gene locus_tag LOCUS_14460 gene thiO 7229 6024 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_14460 7464 8459 gene locus_tag LOCUS_14470 7464 8459 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065932.1 protein_id gnl|my_center|LOCUS_14470 8456 9247 gene locus_tag LOCUS_14480 8456 9247 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_14480 10787 9237 gene locus_tag LOCUS_14490 10787 9237 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_14490 14066 11058 gene locus_tag LOCUS_14500 14066 11058 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584062.1 protein_id gnl|my_center|LOCUS_14500 15507 14092 gene locus_tag LOCUS_14510 15507 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 15760 16752 gene locus_tag LOCUS_14520 15760 16752 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence062 117 1124 gene locus_tag LOCUS_14530 117 1124 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726798.1 protein_id gnl|my_center|LOCUS_14530 1216 2403 gene locus_tag LOCUS_14540 1216 2403 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876812.1 protein_id gnl|my_center|LOCUS_14540 4940 2379 gene locus_tag LOCUS_14550 4940 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 6086 4962 gene locus_tag LOCUS_14560 6086 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 9090 6187 gene locus_tag LOCUS_14570 9090 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 9319 11790 gene locus_tag LOCUS_14580 9319 11790 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728610.1 protein_id gnl|my_center|LOCUS_14580 11908 12801 gene locus_tag LOCUS_14590 11908 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 13631 13269 gene locus_tag LOCUS_14600 13631 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 13922 13848 gene locus_tag LOCUS_t00070 13922 13848 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14019 13947 gene locus_tag LOCUS_t00080 14019 13947 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14144 14770 gene locus_tag LOCUS_14610 14144 14770 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328160.1 protein_id gnl|my_center|LOCUS_14610 14927 15565 gene locus_tag LOCUS_14620 14927 15565 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222336.1 protein_id gnl|my_center|LOCUS_14620 15652 16023 gene locus_tag LOCUS_14630 15652 16023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence063 298 735 gene locus_tag LOCUS_14640 298 735 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_14640 880 1704 gene locus_tag LOCUS_14650 gene trpC 880 1704 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_14650 1733 2977 gene locus_tag LOCUS_14660 gene trpB 1733 2977 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_14660 3000 3794 gene locus_tag LOCUS_14670 gene trpA 3000 3794 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_14670 3971 4540 gene locus_tag LOCUS_14680 3971 4540 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_14680 4592 5338 gene locus_tag LOCUS_14690 4592 5338 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_14690 5335 5961 gene locus_tag LOCUS_14700 5335 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 6206 7201 gene locus_tag LOCUS_14710 gene lgt 6206 7201 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_14710 7198 7917 gene locus_tag LOCUS_14720 7198 7917 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_14720 7914 8837 gene locus_tag LOCUS_14730 7914 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 10451 8907 gene locus_tag LOCUS_14740 10451 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 10603 15129 gene locus_tag LOCUS_14750 gene gltB 10603 15129 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742213.1 protein_id gnl|my_center|LOCUS_14750 15194 16678 gene locus_tag LOCUS_14760 15194 16678 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence064 979 137 gene locus_tag LOCUS_14770 979 137 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030957.1 protein_id gnl|my_center|LOCUS_14770 2202 976 gene locus_tag LOCUS_14780 2202 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2568 2209 gene locus_tag LOCUS_14790 2568 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3429 2656 gene locus_tag LOCUS_14800 3429 2656 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_14800 4510 3452 gene locus_tag LOCUS_14810 4510 3452 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_14810 7117 4577 gene locus_tag LOCUS_14820 7117 4577 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_14820 7641 9686 gene locus_tag LOCUS_14830 7641 9686 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_14830 9718 11484 gene locus_tag LOCUS_14840 gene treS 9718 11484 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_14840 11481 12830 gene locus_tag LOCUS_14850 11481 12830 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_14850 12878 15082 gene locus_tag LOCUS_14860 gene glgB 12878 15082 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_14860 16410 15091 gene locus_tag LOCUS_14870 16410 15091 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027428.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence065 1583 69 gene locus_tag LOCUS_14880 1583 69 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_14880 2565 1792 gene locus_tag LOCUS_14890 2565 1792 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226396.1 protein_id gnl|my_center|LOCUS_14890 5557 4037 gene locus_tag LOCUS_14900 5557 4037 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_14900 7747 5669 gene locus_tag LOCUS_14910 7747 5669 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776746.1 protein_id gnl|my_center|LOCUS_14910 8945 7818 gene locus_tag LOCUS_14920 gene wecB 8945 7818 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_14920 9033 10715 gene locus_tag LOCUS_14930 9033 10715 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776768.1 protein_id gnl|my_center|LOCUS_14930 10790 12088 gene locus_tag LOCUS_14940 10790 12088 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_14940 12103 13191 gene locus_tag LOCUS_14950 12103 13191 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_14950 13279 15126 gene locus_tag LOCUS_14960 13279 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 15176 15841 gene locus_tag LOCUS_14970 15176 15841 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_14970 15982 16458 gene locus_tag LOCUS_14980 15982 16458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence066 <1 1536 gene locus_tag LOCUS_14990 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270333.1:CDP-alcohol phosphatidyltransferase family protein 1533 2246 gene locus_tag LOCUS_15000 1533 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2831 2337 gene locus_tag LOCUS_15010 2831 2337 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_15010 3056 3955 gene locus_tag LOCUS_15020 3056 3955 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_15020 4865 3957 gene locus_tag LOCUS_15030 4865 3957 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727817.1 protein_id gnl|my_center|LOCUS_15030 5663 4935 gene locus_tag LOCUS_15040 5663 4935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973615.1 protein_id gnl|my_center|LOCUS_15040 6403 5660 gene locus_tag LOCUS_15050 6403 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 6468 7103 gene locus_tag LOCUS_15060 6468 7103 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973613.1 protein_id gnl|my_center|LOCUS_15060 7251 7646 gene locus_tag LOCUS_15070 7251 7646 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704186.1 protein_id gnl|my_center|LOCUS_15070 7955 8557 gene locus_tag LOCUS_15080 7955 8557 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742128.1 protein_id gnl|my_center|LOCUS_15080 8794 10347 gene locus_tag LOCUS_15090 8794 10347 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930306.1 protein_id gnl|my_center|LOCUS_15090 10344 11351 gene locus_tag LOCUS_15100 10344 11351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776750.1 protein_id gnl|my_center|LOCUS_15100 11348 12265 gene locus_tag LOCUS_15110 11348 12265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049776499.1 protein_id gnl|my_center|LOCUS_15110 12258 13076 gene locus_tag LOCUS_15120 12258 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15120 13073 14083 gene locus_tag LOCUS_15130 13073 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15130 14086 15159 gene locus_tag LOCUS_15140 14086 15159 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113362.1 protein_id gnl|my_center|LOCUS_15140 15183 16286 gene locus_tag LOCUS_15150 15183 16286 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776753.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence067 175 846 gene locus_tag LOCUS_15160 175 846 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227864.1 protein_id gnl|my_center|LOCUS_15160 995 1270 gene locus_tag LOCUS_15170 995 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2644 1493 gene locus_tag LOCUS_15180 2644 1493 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_15180 3534 2647 gene locus_tag LOCUS_15190 3534 2647 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_15190 5474 3531 gene locus_tag LOCUS_15200 5474 3531 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_15200 7103 5550 gene locus_tag LOCUS_15210 7103 5550 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_15210 7163 7762 gene locus_tag LOCUS_15220 7163 7762 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 protein_id gnl|my_center|LOCUS_15220 10158 7867 gene locus_tag LOCUS_15230 10158 7867 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_15230 10290 11606 gene locus_tag LOCUS_15240 10290 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 12577 11804 gene locus_tag LOCUS_15250 12577 11804 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_15250 13800 12709 gene locus_tag LOCUS_15260 gene corA 13800 12709 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_15260 13961 14689 gene locus_tag LOCUS_15270 13961 14689 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_15270 14929 16212 gene locus_tag LOCUS_15280 14929 16212 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence068 1435 68 gene locus_tag LOCUS_15290 1435 68 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084957161.1 protein_id gnl|my_center|LOCUS_15290 2457 1483 gene locus_tag LOCUS_15300 2457 1483 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_15300 2566 3948 gene locus_tag LOCUS_15310 2566 3948 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_15310 3972 5156 gene locus_tag LOCUS_15320 3972 5156 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_15320 6374 5163 gene locus_tag LOCUS_15330 6374 5163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929725.1 protein_id gnl|my_center|LOCUS_15330 6873 6442 gene locus_tag LOCUS_15340 6873 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 7731 7327 gene locus_tag LOCUS_15350 7731 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 9728 7785 gene locus_tag LOCUS_15360 9728 7785 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_15360 11145 9736 gene locus_tag LOCUS_15370 11145 9736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_15370 11306 12550 gene locus_tag LOCUS_15380 11306 12550 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_15380 12547 13515 gene locus_tag LOCUS_15390 12547 13515 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_15390 13691 14905 gene locus_tag LOCUS_15400 gene ilvA 13691 14905 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_15400 <16360 15044 gene locus_tag LOCUS_15410 <16360 15044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029546.1:M1 family metallopeptidase >Feature sequence069 2620 1523 gene locus_tag LOCUS_15420 2620 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3459 2668 gene locus_tag LOCUS_15430 3459 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3634 4503 gene locus_tag LOCUS_15440 3634 4503 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029811.1 protein_id gnl|my_center|LOCUS_15440 4578 5588 gene locus_tag LOCUS_15450 4578 5588 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_15450 7275 5665 gene locus_tag LOCUS_15460 7275 5665 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_15460 7427 8542 gene locus_tag LOCUS_15470 7427 8542 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804986.1 protein_id gnl|my_center|LOCUS_15470 8928 9584 gene locus_tag LOCUS_15480 8928 9584 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977095.1 protein_id gnl|my_center|LOCUS_15480 9833 10942 gene locus_tag LOCUS_15490 9833 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 11767 11072 gene locus_tag LOCUS_15500 11767 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 14100 11821 gene locus_tag LOCUS_15510 14100 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 14268 14732 gene locus_tag LOCUS_15520 14268 14732 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_15520 14770 15210 gene locus_tag LOCUS_15530 14770 15210 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_15530 <16319 15329 gene locus_tag LOCUS_15540 <16319 15329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097761.1:serine hydrolase >Feature sequence070 475 356 gene locus_tag LOCUS_15550 475 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 706 563 gene locus_tag LOCUS_15560 706 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1837 1040 gene locus_tag LOCUS_15570 1837 1040 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_15570 2632 1853 gene locus_tag LOCUS_15580 2632 1853 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063198.1 protein_id gnl|my_center|LOCUS_15580 3010 2666 gene locus_tag LOCUS_15590 gene spoIIAA 3010 2666 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965605.1 protein_id gnl|my_center|LOCUS_15590 3803 3051 gene locus_tag LOCUS_15600 3803 3051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_15600 4564 3800 gene locus_tag LOCUS_15610 gene cbiQ 4564 3800 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_15610 5938 4889 gene locus_tag LOCUS_15620 5938 4889 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_15620 8358 6304 gene locus_tag LOCUS_15630 8358 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8603 10957 gene locus_tag LOCUS_15640 8603 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 11033 11662 gene locus_tag LOCUS_15650 11033 11662 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226512.1 protein_id gnl|my_center|LOCUS_15650 11932 13473 gene locus_tag LOCUS_15660 11932 13473 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226513.1 protein_id gnl|my_center|LOCUS_15660 13745 13512 gene locus_tag LOCUS_15670 13745 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 14176 14748 gene locus_tag LOCUS_15680 14176 14748 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_15680 15393 15746 gene locus_tag LOCUS_15690 15393 15746 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878745.1 protein_id gnl|my_center|LOCUS_15690 15749 16234 gene locus_tag LOCUS_15700 15749 16234 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898141.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence071 191 1078 gene locus_tag LOCUS_15710 gene fdhD 191 1078 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_15710 3825 1399 gene locus_tag LOCUS_15720 3825 1399 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 protein_id gnl|my_center|LOCUS_15720 3739 3960 gene locus_tag LOCUS_15730 3739 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5750 4194 gene locus_tag LOCUS_15740 5750 4194 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_15740 6508 5747 gene locus_tag LOCUS_15750 6508 5747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_15750 6721 8310 gene locus_tag LOCUS_15760 6721 8310 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_15760 8307 8525 gene locus_tag LOCUS_15770 8307 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8657 9592 gene locus_tag LOCUS_15780 8657 9592 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469674.1 protein_id gnl|my_center|LOCUS_15780 9778 11445 gene locus_tag LOCUS_15790 9778 11445 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_15790 11532 12026 gene locus_tag LOCUS_15800 11532 12026 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 protein_id gnl|my_center|LOCUS_15800 13177 12230 gene locus_tag LOCUS_15810 13177 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973954.1 protein_id gnl|my_center|LOCUS_15810 13821 13174 gene locus_tag LOCUS_15820 13821 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 <16242 13956 gene locus_tag LOCUS_15830 <16242 13956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189749554.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence072 112 2592 gene locus_tag LOCUS_15840 112 2592 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943963.1 protein_id gnl|my_center|LOCUS_15840 2693 4051 gene locus_tag LOCUS_15850 2693 4051 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_15850 4171 5403 gene locus_tag LOCUS_15860 4171 5403 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_15860 6239 5448 gene locus_tag LOCUS_15870 6239 5448 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_15870 6839 6507 gene locus_tag LOCUS_15880 6839 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 7042 7314 gene locus_tag LOCUS_15890 gene rpsF 7042 7314 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_15890 7416 7934 gene locus_tag LOCUS_15900 7416 7934 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029303.1 protein_id gnl|my_center|LOCUS_15900 8020 8256 gene locus_tag LOCUS_15910 gene rpsR 8020 8256 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_15910 8276 8722 gene locus_tag LOCUS_15920 gene rplI 8276 8722 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_15920 9028 9897 gene locus_tag LOCUS_15930 9028 9897 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_15930 9894 10910 gene locus_tag LOCUS_15940 9894 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 10907 11650 gene locus_tag LOCUS_15950 10907 11650 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_15950 12980 11652 gene locus_tag LOCUS_15960 12980 11652 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_15960 13272 14639 gene locus_tag LOCUS_15970 gene dnaB 13272 14639 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_15970 15331 14906 gene locus_tag LOCUS_15980 15331 14906 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 protein_id gnl|my_center|LOCUS_15980 15408 16037 gene locus_tag LOCUS_15990 15408 16037 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894739.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence073 385 1713 gene locus_tag LOCUS_16000 385 1713 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 protein_id gnl|my_center|LOCUS_16000 1781 2611 gene locus_tag LOCUS_16010 1781 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_16010 2608 3006 gene locus_tag LOCUS_16020 2608 3006 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_16020 3923 3105 gene locus_tag LOCUS_16030 3923 3105 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_16030 5698 4004 gene locus_tag LOCUS_16040 5698 4004 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030952.1 protein_id gnl|my_center|LOCUS_16040 6991 5828 gene locus_tag LOCUS_16050 gene ispG 6991 5828 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_16050 7358 8452 gene locus_tag LOCUS_16060 7358 8452 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227012.1 protein_id gnl|my_center|LOCUS_16060 9657 8509 gene locus_tag LOCUS_16070 gene dxr 9657 8509 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_16070 9904 10971 gene locus_tag LOCUS_16080 9904 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 11462 11148 gene locus_tag LOCUS_16090 11462 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 11401 12096 gene locus_tag LOCUS_16100 11401 12096 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_16100 13700 12255 gene locus_tag LOCUS_16110 13700 12255 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_16110 13917 14546 gene locus_tag LOCUS_16120 13917 14546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 <15979 14554 gene locus_tag LOCUS_16130 <15979 14554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030383.1:PucR family transcriptional regulator >Feature sequence074 502 1167 gene locus_tag LOCUS_16140 502 1167 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_16140 1681 1190 gene locus_tag LOCUS_16150 1681 1190 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_16150 1907 3340 gene locus_tag LOCUS_16160 1907 3340 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_16160 3392 4540 gene locus_tag LOCUS_16170 3392 4540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_16170 4635 5894 gene locus_tag LOCUS_16180 4635 5894 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_16180 5891 6754 gene locus_tag LOCUS_16190 5891 6754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 protein_id gnl|my_center|LOCUS_16190 6751 7542 gene locus_tag LOCUS_16200 6751 7542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_16200 7592 8986 gene locus_tag LOCUS_16210 7592 8986 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_16210 10184 9312 gene locus_tag LOCUS_16220 10184 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 10989 10264 gene locus_tag LOCUS_16230 10989 10264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612370.1 protein_id gnl|my_center|LOCUS_16230 11680 11039 gene locus_tag LOCUS_16240 11680 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 12661 11984 gene locus_tag LOCUS_16250 gene leuE 12661 11984 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_16250 12759 14147 gene locus_tag LOCUS_16260 12759 14147 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392113.1 protein_id gnl|my_center|LOCUS_16260 14144 14746 gene locus_tag LOCUS_16270 14144 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256632.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence075 <1 742 gene locus_tag LOCUS_16280 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223940.1:MFS transporter 1333 743 gene locus_tag LOCUS_16290 1333 743 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230158.1 protein_id gnl|my_center|LOCUS_16290 1923 1384 gene locus_tag LOCUS_16300 1923 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2819 1920 gene locus_tag LOCUS_16310 2819 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3296 2922 gene locus_tag LOCUS_16320 3296 2922 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_16320 3479 3754 gene locus_tag LOCUS_16330 3479 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 3874 4683 gene locus_tag LOCUS_16340 gene mprA 3874 4683 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_16340 4683 5774 gene locus_tag LOCUS_16350 4683 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5779 6165 gene locus_tag LOCUS_16360 5779 6165 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_16360 6299 6559 gene locus_tag LOCUS_16370 6299 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 8020 8622 gene locus_tag LOCUS_16380 8020 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 8691 8765 gene locus_tag LOCUS_t00090 8691 8765 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8967 9281 gene locus_tag LOCUS_16390 8967 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 9862 9620 gene locus_tag LOCUS_16400 9862 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 10389 10024 gene locus_tag LOCUS_16410 10389 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 10450 13206 gene locus_tag LOCUS_16420 10450 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 15057 13882 gene locus_tag LOCUS_16430 15057 13882 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043778558.1 protein_id gnl|my_center|LOCUS_16430 15418 15654 gene locus_tag LOCUS_16440 15418 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence076 288 1766 gene locus_tag LOCUS_16450 288 1766 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_16450 1778 2689 gene locus_tag LOCUS_16460 gene cydB 1778 2689 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_16460 2747 3007 gene locus_tag LOCUS_16470 2747 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3004 3396 gene locus_tag LOCUS_16480 3004 3396 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403187.1 protein_id gnl|my_center|LOCUS_16480 5865 3403 gene locus_tag LOCUS_16490 5865 3403 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929962.1 protein_id gnl|my_center|LOCUS_16490 6275 5784 gene locus_tag LOCUS_16500 6275 5784 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_16500 7147 6272 gene locus_tag LOCUS_16510 7147 6272 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_16510 8614 7232 gene locus_tag LOCUS_16520 8614 7232 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_16520 8991 8764 gene locus_tag LOCUS_16530 8991 8764 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189709.1 protein_id gnl|my_center|LOCUS_16530 10612 9014 gene locus_tag LOCUS_16540 10612 9014 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393615.1 protein_id gnl|my_center|LOCUS_16540 10779 11684 gene locus_tag LOCUS_16550 10779 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 11681 13048 gene locus_tag LOCUS_16560 gene fdrA 11681 13048 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865648.1 protein_id gnl|my_center|LOCUS_16560 13083 14489 gene locus_tag LOCUS_16570 13083 14489 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_16570 14840 14577 gene locus_tag LOCUS_16580 14840 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence077 634 353 gene locus_tag LOCUS_16590 634 353 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230291.1 protein_id gnl|my_center|LOCUS_16590 741 1547 gene locus_tag LOCUS_16600 741 1547 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_16600 2574 1558 gene locus_tag LOCUS_16610 2574 1558 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_16610 3589 2558 gene locus_tag LOCUS_16620 3589 2558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_16620 4550 3603 gene locus_tag LOCUS_16630 4550 3603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_16630 5469 4543 gene locus_tag LOCUS_16640 5469 4543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_16640 7284 5608 gene locus_tag LOCUS_16650 7284 5608 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949626.1 protein_id gnl|my_center|LOCUS_16650 7675 8580 gene locus_tag LOCUS_16660 7675 8580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_16660 8573 9400 gene locus_tag LOCUS_16670 8573 9400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_16670 9420 9956 gene locus_tag LOCUS_16680 9420 9956 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_16680 10017 10187 gene locus_tag LOCUS_16690 10017 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 10384 10184 gene locus_tag LOCUS_16700 10384 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 11527 10568 gene locus_tag LOCUS_16710 11527 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 11918 12487 gene locus_tag LOCUS_16720 11918 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 12505 13533 gene locus_tag LOCUS_16730 gene plsX 12505 13533 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080328.1 protein_id gnl|my_center|LOCUS_16730 13709 15430 gene locus_tag LOCUS_16740 gene argS 13709 15430 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence078 1927 257 gene locus_tag LOCUS_16750 1927 257 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_16750 2354 3808 gene locus_tag LOCUS_16760 2354 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3863 6481 gene locus_tag LOCUS_16770 3863 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 7651 6461 gene locus_tag LOCUS_16780 7651 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 9036 7840 gene locus_tag LOCUS_16790 9036 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 10031 9099 gene locus_tag LOCUS_16800 10031 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 10572 10129 gene locus_tag LOCUS_16810 10572 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 14591 10608 gene locus_tag LOCUS_16820 14591 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 14775 14608 gene locus_tag LOCUS_16830 14775 14608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 14714 15022 gene locus_tag LOCUS_16840 14714 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 15412 15023 gene locus_tag LOCUS_16850 15412 15023 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence079 1 726 gene locus_tag LOCUS_16860 1 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 796 1788 gene locus_tag LOCUS_16870 gene tilS 796 1788 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_16870 1801 2358 gene locus_tag LOCUS_16880 gene hpt 1801 2358 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_16880 2626 4632 gene locus_tag LOCUS_16890 gene ftsH 2626 4632 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_16890 4635 5234 gene locus_tag LOCUS_16900 gene folE 4635 5234 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_16900 5330 6178 gene locus_tag LOCUS_16910 gene folP 5330 6178 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_16910 6183 6629 gene locus_tag LOCUS_16920 6183 6629 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_16920 6626 7006 gene locus_tag LOCUS_16930 gene folB 6626 7006 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_16930 7003 7503 gene locus_tag LOCUS_16940 gene folK 7003 7503 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_16940 7521 7970 gene locus_tag LOCUS_16950 7521 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 9167 7974 gene locus_tag LOCUS_16960 9167 7974 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_16960 10514 9237 gene locus_tag LOCUS_16970 10514 9237 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028165.1 protein_id gnl|my_center|LOCUS_16970 10637 10545 gene locus_tag LOCUS_t00100 10637 10545 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10833 12032 gene locus_tag LOCUS_16980 10833 12032 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_16980 13017 12043 gene locus_tag LOCUS_16990 13017 12043 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_16990 13179 14069 gene locus_tag LOCUS_17000 13179 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17000 14060 14989 gene locus_tag LOCUS_17010 gene panC 14060 14989 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence080 315 37 gene locus_tag LOCUS_17020 315 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 449 799 gene locus_tag LOCUS_17030 449 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3091 860 gene locus_tag LOCUS_17040 3091 860 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_17040 4046 3120 gene locus_tag LOCUS_17050 4046 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_17050 4252 4043 gene locus_tag LOCUS_17060 4252 4043 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_17060 5642 4353 gene locus_tag LOCUS_17070 5642 4353 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_17070 6076 5639 gene locus_tag LOCUS_17080 6076 5639 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227557.1 protein_id gnl|my_center|LOCUS_17080 7605 6196 gene locus_tag LOCUS_17090 7605 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7716 8651 gene locus_tag LOCUS_17100 7716 8651 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_17100 8698 9018 gene locus_tag LOCUS_17110 8698 9018 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_17110 9015 9866 gene locus_tag LOCUS_17120 9015 9866 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222862.1 protein_id gnl|my_center|LOCUS_17120 10424 10029 gene locus_tag LOCUS_17130 10424 10029 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_17130 10719 10997 gene locus_tag LOCUS_17140 10719 10997 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_17140 11036 11944 gene locus_tag LOCUS_17150 11036 11944 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_17150 12074 12469 gene locus_tag LOCUS_17160 12074 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 12771 12935 gene locus_tag LOCUS_17170 12771 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 12948 13688 gene locus_tag LOCUS_17180 12948 13688 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_17180 13829 13904 gene locus_tag LOCUS_t00110 13829 13904 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 15097 13961 gene locus_tag LOCUS_17190 15097 13961 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_17190 15342 15097 gene locus_tag LOCUS_17200 15342 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence081 505 134 gene locus_tag LOCUS_17210 505 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1439 825 gene locus_tag LOCUS_17220 1439 825 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463762.1 protein_id gnl|my_center|LOCUS_17220 2377 1436 gene locus_tag LOCUS_17230 2377 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2552 4651 gene locus_tag LOCUS_17240 2552 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 4648 5001 gene locus_tag LOCUS_17250 4648 5001 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_17250 5460 5038 gene locus_tag LOCUS_17260 5460 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 5951 5517 gene locus_tag LOCUS_17270 5951 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 6297 6112 gene locus_tag LOCUS_17280 6297 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6326 6778 gene locus_tag LOCUS_17290 6326 6778 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971366.1 protein_id gnl|my_center|LOCUS_17290 6800 7351 gene locus_tag LOCUS_17300 6800 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 7415 7852 gene locus_tag LOCUS_17310 7415 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 8032 9801 gene locus_tag LOCUS_17320 8032 9801 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742058.1 protein_id gnl|my_center|LOCUS_17320 10743 9808 gene locus_tag LOCUS_17330 10743 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 10913 12040 gene locus_tag LOCUS_17340 10913 12040 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364967.1 protein_id gnl|my_center|LOCUS_17340 12366 13037 gene locus_tag LOCUS_17350 12366 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026379.1 protein_id gnl|my_center|LOCUS_17350 13078 14286 gene locus_tag LOCUS_17360 13078 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 15188 14271 gene locus_tag LOCUS_17370 15188 14271 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225947.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence082 962 495 gene locus_tag LOCUS_17380 962 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1522 1226 gene locus_tag LOCUS_17390 1522 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1836 1576 gene locus_tag LOCUS_17400 1836 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2402 1815 gene locus_tag LOCUS_17410 gene leuD 2402 1815 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_17410 3816 2431 gene locus_tag LOCUS_17420 gene leuC 3816 2431 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_17420 3955 4671 gene locus_tag LOCUS_17430 gene ndgR 3955 4671 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_17430 4780 6483 gene locus_tag LOCUS_17440 4780 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 6558 7262 gene locus_tag LOCUS_17450 6558 7262 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062896.1 protein_id gnl|my_center|LOCUS_17450 7394 7321 gene locus_tag LOCUS_t00120 7394 7321 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7480 7407 gene locus_tag LOCUS_t00130 7480 7407 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7594 7522 gene locus_tag LOCUS_t00140 7594 7522 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7780 9762 gene locus_tag LOCUS_17460 7780 9762 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_17460 10305 9766 gene locus_tag LOCUS_17470 10305 9766 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078653187.1 protein_id gnl|my_center|LOCUS_17470 10363 11700 gene locus_tag LOCUS_17480 10363 11700 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405015.1 protein_id gnl|my_center|LOCUS_17480 12961 11597 gene locus_tag LOCUS_17490 gene gltX 12961 11597 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_17490 13703 12954 gene locus_tag LOCUS_17500 13703 12954 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056890.1 protein_id gnl|my_center|LOCUS_17500 13804 14202 gene locus_tag LOCUS_17510 gene mhuD 13804 14202 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065009.1 protein_id gnl|my_center|LOCUS_17510 14704 15201 gene locus_tag LOCUS_17520 14704 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence083 756 289 gene locus_tag LOCUS_17530 756 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1633 842 gene locus_tag LOCUS_17540 1633 842 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226808.1 protein_id gnl|my_center|LOCUS_17540 2448 1699 gene locus_tag LOCUS_17550 2448 1699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221994.1 protein_id gnl|my_center|LOCUS_17550 3359 2445 gene locus_tag LOCUS_17560 3359 2445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_17560 3492 4991 gene locus_tag LOCUS_17570 3492 4991 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_17570 4991 5629 gene locus_tag LOCUS_17580 4991 5629 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221997.1 protein_id gnl|my_center|LOCUS_17580 6013 7104 gene locus_tag LOCUS_17590 gene dnaN 6013 7104 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_17590 7814 7125 gene locus_tag LOCUS_17600 7814 7125 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 protein_id gnl|my_center|LOCUS_17600 9181 7913 gene locus_tag LOCUS_17610 9181 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 9901 9380 gene locus_tag LOCUS_17620 9901 9380 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095467.1 protein_id gnl|my_center|LOCUS_17620 10089 9907 gene locus_tag LOCUS_17630 10089 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 10375 10157 gene locus_tag LOCUS_17640 10375 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 11227 10589 gene locus_tag LOCUS_17650 gene upp 11227 10589 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_17650 11366 11854 gene locus_tag LOCUS_17660 11366 11854 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112944.1 protein_id gnl|my_center|LOCUS_17660 11870 12352 gene locus_tag LOCUS_17670 11870 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 12349 12843 gene locus_tag LOCUS_17680 gene tadA 12349 12843 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_17680 12906 12993 gene locus_tag LOCUS_t00150 12906 12993 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13827 13075 gene locus_tag LOCUS_17690 13827 13075 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028876.1 protein_id gnl|my_center|LOCUS_17690 14574 14278 gene locus_tag LOCUS_17700 14574 14278 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_17700 <15413 14630 gene locus_tag LOCUS_17710 <15413 14630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728749.1:neutral zinc metallopeptidase >Feature sequence084 <1 821 gene locus_tag LOCUS_17720 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975109.1:ABC transporter permease 3939 829 gene locus_tag LOCUS_17730 3939 829 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_17730 4113 5582 gene locus_tag LOCUS_17740 gene iniC 4113 5582 CDS product isoniazid-induced dynamin-like GTPase IniC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401747.1 protein_id gnl|my_center|LOCUS_17740 5637 7535 gene locus_tag LOCUS_17750 5637 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 9517 7601 gene locus_tag LOCUS_17760 9517 7601 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_17760 11051 9585 gene locus_tag LOCUS_17770 11051 9585 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085677.1 protein_id gnl|my_center|LOCUS_17770 11201 12415 gene locus_tag LOCUS_17780 11201 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 12431 13333 gene locus_tag LOCUS_17790 12431 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 13356 14408 gene locus_tag LOCUS_17800 13356 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence085 3 299 gene locus_tag LOCUS_17810 3 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 942 475 gene locus_tag LOCUS_17820 942 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2416 992 gene locus_tag LOCUS_17830 2416 992 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_17830 2520 3071 gene locus_tag LOCUS_17840 2520 3071 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_17840 3368 4642 gene locus_tag LOCUS_17850 gene thrC 3368 4642 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_17850 4688 4963 gene locus_tag LOCUS_17860 4688 4963 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_17860 5220 5420 gene locus_tag LOCUS_17870 5220 5420 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_17870 6458 8080 gene locus_tag LOCUS_17880 gene groL 6458 8080 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_17880 8583 8155 gene locus_tag LOCUS_17890 8583 8155 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027669.1 protein_id gnl|my_center|LOCUS_17890 10565 8580 gene locus_tag LOCUS_17900 10565 8580 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_17900 10668 11012 gene locus_tag LOCUS_17910 10668 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 13035 11380 gene locus_tag LOCUS_17920 13035 11380 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_17920 13625 13152 gene locus_tag LOCUS_17930 13625 13152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 <15226 13673 gene locus_tag LOCUS_17940 <15226 13673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230251.1:helicase-associated domain-containing protein >Feature sequence086 305 1399 gene locus_tag LOCUS_17950 305 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1728 1483 gene locus_tag LOCUS_17960 1728 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1821 2759 gene locus_tag LOCUS_17970 1821 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 3663 2812 gene locus_tag LOCUS_17980 3663 2812 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978631.1 protein_id gnl|my_center|LOCUS_17980 3839 4600 gene locus_tag LOCUS_17990 3839 4600 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978630.1 protein_id gnl|my_center|LOCUS_17990 5119 6930 gene locus_tag LOCUS_18000 5119 6930 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_18000 11951 7323 gene locus_tag LOCUS_18010 11951 7323 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230035.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence087 578 1192 gene locus_tag LOCUS_18020 578 1192 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 protein_id gnl|my_center|LOCUS_18020 1314 1619 gene locus_tag LOCUS_18030 1314 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1655 2473 gene locus_tag LOCUS_18040 1655 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2470 3993 gene locus_tag LOCUS_18050 2470 3993 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_18050 4052 4681 gene locus_tag LOCUS_18060 4052 4681 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_18060 5331 4696 gene locus_tag LOCUS_18070 5331 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 7402 5555 gene locus_tag LOCUS_18080 gene typA 7402 5555 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_18080 7687 8415 gene locus_tag LOCUS_18090 7687 8415 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_18090 8425 8658 gene locus_tag LOCUS_18100 8425 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 8850 9740 gene locus_tag LOCUS_18110 8850 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 11002 9722 gene locus_tag LOCUS_18120 11002 9722 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 protein_id gnl|my_center|LOCUS_18120 11145 11723 gene locus_tag LOCUS_18130 11145 11723 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_18130 12180 11857 gene locus_tag LOCUS_18140 12180 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 12398 12177 gene locus_tag LOCUS_18150 12398 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 12888 13880 gene locus_tag LOCUS_18160 12888 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence088 86 442 gene locus_tag LOCUS_18170 86 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2719 452 gene locus_tag LOCUS_18180 gene secA2 2719 452 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_18180 2827 3204 gene locus_tag LOCUS_18190 2827 3204 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226395.1 protein_id gnl|my_center|LOCUS_18190 3329 4216 gene locus_tag LOCUS_18200 3329 4216 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 protein_id gnl|my_center|LOCUS_18200 5141 4227 gene locus_tag LOCUS_18210 5141 4227 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_18210 5041 5586 gene locus_tag LOCUS_18220 5041 5586 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977488.1 protein_id gnl|my_center|LOCUS_18220 6315 5734 gene locus_tag LOCUS_18230 6315 5734 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_18230 6581 7378 gene locus_tag LOCUS_18240 6581 7378 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_18240 7378 8595 gene locus_tag LOCUS_18250 7378 8595 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_18250 8600 9772 gene locus_tag LOCUS_18260 8600 9772 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_18260 9769 10938 gene locus_tag LOCUS_18270 9769 10938 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027646.1 protein_id gnl|my_center|LOCUS_18270 11568 10939 gene locus_tag LOCUS_18280 11568 10939 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_18280 11721 12488 gene locus_tag LOCUS_18290 11721 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 13892 12537 gene locus_tag LOCUS_18300 13892 12537 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224866.1 protein_id gnl|my_center|LOCUS_18300 14737 13889 gene locus_tag LOCUS_18310 14737 13889 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412514.1 protein_id gnl|my_center|LOCUS_18310 14841 14917 gene locus_tag LOCUS_t00160 14841 14917 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence089 295 717 gene locus_tag LOCUS_18320 295 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973631.1 protein_id gnl|my_center|LOCUS_18320 754 996 gene locus_tag LOCUS_18330 754 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1129 1920 gene locus_tag LOCUS_18340 gene atpB 1129 1920 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_18340 2005 2229 gene locus_tag LOCUS_18350 gene atpE 2005 2229 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_18350 2259 2804 gene locus_tag LOCUS_18360 2259 2804 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_18360 2804 3613 gene locus_tag LOCUS_18370 2804 3613 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_18370 3638 5287 gene locus_tag LOCUS_18380 gene atpA 3638 5287 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_18380 5291 6190 gene locus_tag LOCUS_18390 5291 6190 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_18390 6192 7619 gene locus_tag LOCUS_18400 gene atpD 6192 7619 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973624.1 protein_id gnl|my_center|LOCUS_18400 7690 8091 gene locus_tag LOCUS_18410 7690 8091 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_18410 8113 8514 gene locus_tag LOCUS_18420 8113 8514 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_18420 9117 8527 gene locus_tag LOCUS_18430 9117 8527 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_18430 9226 10113 gene locus_tag LOCUS_18440 9226 10113 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_18440 10110 11225 gene locus_tag LOCUS_18450 10110 11225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_18450 11255 12553 gene locus_tag LOCUS_18460 11255 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 12550 13143 gene locus_tag LOCUS_18470 12550 13143 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_18470 13804 13172 gene locus_tag LOCUS_18480 13804 13172 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230170.1 protein_id gnl|my_center|LOCUS_18480 14313 13951 gene locus_tag LOCUS_18490 14313 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 <15166 14360 gene locus_tag LOCUS_18500 <15166 14360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227225.1:ABC transporter permease >Feature sequence090 261 1820 gene locus_tag LOCUS_18510 261 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2467 2255 gene locus_tag LOCUS_18520 2467 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2641 3144 gene locus_tag LOCUS_18530 2641 3144 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_18530 3422 4273 gene locus_tag LOCUS_18540 3422 4273 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027090.1 protein_id gnl|my_center|LOCUS_18540 4485 4835 gene locus_tag LOCUS_18550 4485 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 5031 5216 gene locus_tag LOCUS_18560 5031 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 5213 9613 gene locus_tag LOCUS_18570 5213 9613 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909023.1 protein_id gnl|my_center|LOCUS_18570 10428 9925 gene locus_tag LOCUS_18580 10428 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 12129 10699 gene locus_tag LOCUS_18590 12129 10699 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226111.1 protein_id gnl|my_center|LOCUS_18590 12239 12760 gene locus_tag LOCUS_18600 12239 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 13085 12900 gene locus_tag LOCUS_18610 13085 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 12997 14091 gene locus_tag LOCUS_18620 12997 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 14529 14978 gene locus_tag LOCUS_18630 14529 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence091 239 895 gene locus_tag LOCUS_18640 239 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1569 1108 gene locus_tag LOCUS_18650 1569 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2267 1698 gene locus_tag LOCUS_18660 2267 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3104 2274 gene locus_tag LOCUS_18670 3104 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4453 3122 gene locus_tag LOCUS_18680 4453 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4589 4843 gene locus_tag LOCUS_18690 4589 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6533 5688 gene locus_tag LOCUS_18700 6533 5688 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_18700 6726 6559 gene locus_tag LOCUS_18710 6726 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 8408 6867 gene locus_tag LOCUS_18720 gene purH 8408 6867 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_18720 8965 8405 gene locus_tag LOCUS_18730 gene purN 8965 8405 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_18730 9228 9632 gene locus_tag LOCUS_18740 9228 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 11483 9828 gene locus_tag LOCUS_18750 11483 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 12816 11941 gene locus_tag LOCUS_18760 gene sucD 12816 11941 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222716.1 protein_id gnl|my_center|LOCUS_18760 13997 12816 gene locus_tag LOCUS_18770 gene sucC 13997 12816 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_18770 14555 14154 gene locus_tag LOCUS_18780 14555 14154 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence092 965 468 gene locus_tag LOCUS_18790 965 468 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313124.1 protein_id gnl|my_center|LOCUS_18790 986 1408 gene locus_tag LOCUS_18800 986 1408 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_18800 2369 1533 gene locus_tag LOCUS_18810 2369 1533 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_18810 2837 2761 gene locus_tag LOCUS_t00170 2837 2761 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2928 3001 gene locus_tag LOCUS_t00180 2928 3001 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3349 4002 gene locus_tag LOCUS_18820 3349 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4403 3924 gene locus_tag LOCUS_18830 4403 3924 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_18830 4678 5544 gene locus_tag LOCUS_18840 4678 5544 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_18840 5745 7136 gene locus_tag LOCUS_18850 gene tig 5745 7136 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_18850 7487 8131 gene locus_tag LOCUS_18860 7487 8131 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_18860 8146 8793 gene locus_tag LOCUS_18870 8146 8793 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_18870 9014 10297 gene locus_tag LOCUS_18880 gene clpX 9014 10297 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_18880 10380 12959 gene locus_tag LOCUS_18890 10380 12959 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_18890 14470 13124 gene locus_tag LOCUS_18900 14470 13124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence093 1684 827 gene locus_tag LOCUS_18910 1684 827 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_18910 3273 1687 gene locus_tag LOCUS_18920 gene metG 3273 1687 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_18920 4632 3394 gene locus_tag LOCUS_18930 4632 3394 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_18930 5002 6516 gene locus_tag LOCUS_18940 5002 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7462 6641 gene locus_tag LOCUS_18950 gene rsmI 7462 6641 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_18950 7569 9176 gene locus_tag LOCUS_18960 7569 9176 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_18960 9303 10727 gene locus_tag LOCUS_18970 9303 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 11617 10928 gene locus_tag LOCUS_18980 11617 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 11713 12336 gene locus_tag LOCUS_18990 gene wrbA 11713 12336 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_18990 12421 13890 gene locus_tag LOCUS_19000 12421 13890 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence094 656 2098 gene locus_tag LOCUS_19010 656 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2322 2912 gene locus_tag LOCUS_19020 2322 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3014 3928 gene locus_tag LOCUS_19030 gene bla 3014 3928 CDS product class A beta-lactamase Bla1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181667.1 protein_id gnl|my_center|LOCUS_19030 4000 6132 gene locus_tag LOCUS_19040 4000 6132 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811993.1 protein_id gnl|my_center|LOCUS_19040 6484 6143 gene locus_tag LOCUS_19050 6484 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 6941 7150 gene locus_tag LOCUS_19060 6941 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7210 7659 gene locus_tag LOCUS_19070 7210 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 7753 7826 gene locus_tag LOCUS_t00190 7753 7826 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7973 8047 gene locus_tag LOCUS_t00200 7973 8047 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8125 8289 gene locus_tag LOCUS_19080 gene rpmG 8125 8289 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_19080 8415 8864 gene locus_tag LOCUS_19090 8415 8864 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_19090 8867 9295 gene locus_tag LOCUS_19100 8867 9295 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_19100 9339 10388 gene locus_tag LOCUS_19110 9339 10388 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_19110 10605 11174 gene locus_tag LOCUS_19120 10605 11174 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_19120 14062 11171 gene locus_tag LOCUS_19130 14062 11171 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_19130 14350 14183 gene locus_tag LOCUS_19140 14350 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence095 1467 43 gene locus_tag LOCUS_19150 1467 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1984 2709 gene locus_tag LOCUS_19160 1984 2709 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091945.1 protein_id gnl|my_center|LOCUS_19160 2929 2853 gene locus_tag LOCUS_t00210 2929 2853 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3679 2981 gene locus_tag LOCUS_19170 3679 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 4687 4046 gene locus_tag LOCUS_19180 4687 4046 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_19180 5231 4755 gene locus_tag LOCUS_19190 5231 4755 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_19190 5709 5233 gene locus_tag LOCUS_19200 gene moaC 5709 5233 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_19200 6890 5706 gene locus_tag LOCUS_19210 6890 5706 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_19210 7800 6895 gene locus_tag LOCUS_19220 gene galU 7800 6895 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_19220 7825 8400 gene locus_tag LOCUS_19230 7825 8400 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_19230 8435 9940 gene locus_tag LOCUS_19240 8435 9940 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_19240 10344 10640 gene locus_tag LOCUS_19250 10344 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 10703 11509 gene locus_tag LOCUS_19260 10703 11509 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_19260 11846 12733 gene locus_tag LOCUS_19270 11846 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 14141 13053 gene locus_tag LOCUS_19280 14141 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence096 649 29 gene locus_tag LOCUS_19290 649 29 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_19290 1161 2813 gene locus_tag LOCUS_19300 1161 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2810 4339 gene locus_tag LOCUS_19310 2810 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 4336 8862 gene locus_tag LOCUS_19320 4336 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 8859 10133 gene locus_tag LOCUS_19330 8859 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 10183 11877 gene locus_tag LOCUS_19340 10183 11877 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730685.1 protein_id gnl|my_center|LOCUS_19340 13411 11975 gene locus_tag LOCUS_19350 13411 11975 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_19350 13623 14201 gene locus_tag LOCUS_19360 13623 14201 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978343.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence097 1081 2088 gene locus_tag LOCUS_19370 1081 2088 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028422.1 protein_id gnl|my_center|LOCUS_19370 2783 2061 gene locus_tag LOCUS_19380 2783 2061 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_19380 2826 3359 gene locus_tag LOCUS_19390 2826 3359 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_19390 3448 4344 gene locus_tag LOCUS_19400 gene miaA 3448 4344 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_19400 4354 5166 gene locus_tag LOCUS_19410 gene dapF 4354 5166 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_19410 5242 6009 gene locus_tag LOCUS_19420 5242 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 6072 8354 gene locus_tag LOCUS_19430 6072 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112509.1 protein_id gnl|my_center|LOCUS_19430 8472 9233 gene locus_tag LOCUS_19440 8472 9233 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_19440 9781 11211 gene locus_tag LOCUS_19450 9781 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 11212 13149 gene locus_tag LOCUS_19460 11212 13149 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_19460 13146 14129 gene locus_tag LOCUS_19470 13146 14129 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence098 1486 2325 gene locus_tag LOCUS_19480 1486 2325 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_19480 2312 3529 gene locus_tag LOCUS_19490 2312 3529 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_19490 4484 3504 gene locus_tag LOCUS_19500 4484 3504 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043788179.1 protein_id gnl|my_center|LOCUS_19500 4575 6032 gene locus_tag LOCUS_19510 4575 6032 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185757.1 protein_id gnl|my_center|LOCUS_19510 7004 7597 gene locus_tag LOCUS_19520 7004 7597 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 protein_id gnl|my_center|LOCUS_19520 7684 8679 gene locus_tag LOCUS_19530 7684 8679 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_19530 9554 9126 gene locus_tag LOCUS_19540 9554 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 11560 10379 gene locus_tag LOCUS_19550 11560 10379 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466614.1 protein_id gnl|my_center|LOCUS_19550 13081 11681 gene locus_tag LOCUS_19560 gene lpdA 13081 11681 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_19560 13343 13897 gene locus_tag LOCUS_19570 13343 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence099 193 119 gene locus_tag LOCUS_t00220 193 119 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 920 285 gene locus_tag LOCUS_19580 920 285 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_19580 1413 946 gene locus_tag LOCUS_19590 gene rsfS 1413 946 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_19590 2003 1482 gene locus_tag LOCUS_19600 2003 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2047 3294 gene locus_tag LOCUS_19610 2047 3294 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028035.1 protein_id gnl|my_center|LOCUS_19610 3963 3340 gene locus_tag LOCUS_19620 gene nadD 3963 3340 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_19620 4068 5078 gene locus_tag LOCUS_19630 4068 5078 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_19630 6760 5135 gene locus_tag LOCUS_19640 6760 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 8126 6870 gene locus_tag LOCUS_19650 8126 6870 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_19650 9264 8119 gene locus_tag LOCUS_19660 gene proB 9264 8119 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_19660 10627 9278 gene locus_tag LOCUS_19670 gene obgE 10627 9278 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_19670 10981 10724 gene locus_tag LOCUS_19680 gene rpmA 10981 10724 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_19680 11341 11027 gene locus_tag LOCUS_19690 gene rplU 11341 11027 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412578.1 protein_id gnl|my_center|LOCUS_19690 <14099 11528 gene locus_tag LOCUS_19700 <14099 11528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028446.1:Rne/Rng family ribonuclease note possible pseudo, internal stop codon, frameshifted >Feature sequence100 1658 756 gene locus_tag LOCUS_19710 gene sigJ 1658 756 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226028235.1 protein_id gnl|my_center|LOCUS_19710 1692 2126 gene locus_tag LOCUS_19720 1692 2126 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975279.1 protein_id gnl|my_center|LOCUS_19720 2623 2324 gene locus_tag LOCUS_19730 2623 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 5731 2798 gene locus_tag LOCUS_19740 5731 2798 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_19740 6333 5863 gene locus_tag LOCUS_19750 gene nrdR 6333 5863 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 protein_id gnl|my_center|LOCUS_19750 6755 7483 gene locus_tag LOCUS_19760 gene lexA 6755 7483 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_19760 7592 8695 gene locus_tag LOCUS_19770 7592 8695 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230022.1 protein_id gnl|my_center|LOCUS_19770 10342 8708 gene locus_tag LOCUS_19780 10342 8708 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227016.1 protein_id gnl|my_center|LOCUS_19780 13819 10544 gene locus_tag LOCUS_19790 13819 10544 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence101 1997 966 gene locus_tag LOCUS_19800 1997 966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085658.1 protein_id gnl|my_center|LOCUS_19800 2908 2000 gene locus_tag LOCUS_19810 2908 2000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_19810 3992 2985 gene locus_tag LOCUS_19820 3992 2985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225593.1 protein_id gnl|my_center|LOCUS_19820 5804 3996 gene locus_tag LOCUS_19830 5804 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 6220 6014 gene locus_tag LOCUS_19840 6220 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 6143 7177 gene locus_tag LOCUS_19850 6143 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 7255 8709 gene locus_tag LOCUS_19860 7255 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 9889 8774 gene locus_tag LOCUS_19870 gene ald 9889 8774 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_19870 11339 9957 gene locus_tag LOCUS_19880 11339 9957 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_19880 11725 13077 gene locus_tag LOCUS_19890 11725 13077 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 protein_id gnl|my_center|LOCUS_19890 13810 13196 gene locus_tag LOCUS_19900 13810 13196 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947370.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence102 27 242 gene locus_tag LOCUS_19910 27 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2384 636 gene locus_tag LOCUS_19920 2384 636 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_19920 3801 2596 gene locus_tag LOCUS_19930 3801 2596 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_19930 3874 4836 gene locus_tag LOCUS_19940 3874 4836 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_19940 4945 6306 gene locus_tag LOCUS_19950 gene glnA 4945 6306 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_19950 6466 7224 gene locus_tag LOCUS_19960 6466 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228025.1 protein_id gnl|my_center|LOCUS_19960 8131 7274 gene locus_tag LOCUS_19970 8131 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 8200 8901 gene locus_tag LOCUS_19980 8200 8901 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978258.1 protein_id gnl|my_center|LOCUS_19980 9092 12154 gene locus_tag LOCUS_19990 9092 12154 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_19990 12446 13759 gene locus_tag LOCUS_20000 12446 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence103 1152 115 gene locus_tag LOCUS_20010 1152 115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_20010 2342 1302 gene locus_tag LOCUS_20020 2342 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2633 2388 gene locus_tag LOCUS_20030 2633 2388 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031494.1 protein_id gnl|my_center|LOCUS_20030 2840 4639 gene locus_tag LOCUS_20040 gene leuA 2840 4639 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_20040 5643 4945 gene locus_tag LOCUS_20050 5643 4945 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839199.1 protein_id gnl|my_center|LOCUS_20050 5757 6104 gene locus_tag LOCUS_20060 5757 6104 CDS product YrdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086025693.1 protein_id gnl|my_center|LOCUS_20060 6115 7044 gene locus_tag LOCUS_20070 6115 7044 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_20070 7026 7748 gene locus_tag LOCUS_20080 7026 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 9348 8026 gene locus_tag LOCUS_20090 9348 8026 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_20090 9605 11188 gene locus_tag LOCUS_20100 9605 11188 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143814.1 protein_id gnl|my_center|LOCUS_20100 12362 11157 gene locus_tag LOCUS_20110 gene rocD 12362 11157 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_20110 13213 12359 gene locus_tag LOCUS_20120 13213 12359 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence104 1105 374 gene locus_tag LOCUS_20130 1105 374 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_20130 3287 1365 gene locus_tag LOCUS_20140 3287 1365 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_20140 4524 3352 gene locus_tag LOCUS_20150 gene rodA 4524 3352 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_20150 6543 4537 gene locus_tag LOCUS_20160 gene mrdA 6543 4537 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_20160 7109 6591 gene locus_tag LOCUS_20170 7109 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 8399 7113 gene locus_tag LOCUS_20180 8399 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 9439 8408 gene locus_tag LOCUS_20190 9439 8408 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_20190 10069 9659 gene locus_tag LOCUS_20200 gene ndk 10069 9659 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 protein_id gnl|my_center|LOCUS_20200 11785 10265 gene locus_tag LOCUS_20210 11785 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 12147 11797 gene locus_tag LOCUS_20220 12147 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 13427 12144 gene locus_tag LOCUS_20230 13427 12144 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence105 2181 202 gene locus_tag LOCUS_20240 2181 202 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_20240 3266 2181 gene locus_tag LOCUS_20250 3266 2181 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_20250 4476 3697 gene locus_tag LOCUS_20260 4476 3697 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_20260 4586 5452 gene locus_tag LOCUS_20270 gene purU 4586 5452 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_20270 5612 6394 gene locus_tag LOCUS_20280 5612 6394 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_20280 8724 6391 gene locus_tag LOCUS_20290 8724 6391 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_20290 9881 8760 gene locus_tag LOCUS_20300 9881 8760 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_20300 11129 10035 gene locus_tag LOCUS_20310 11129 10035 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_20310 12132 11131 gene locus_tag LOCUS_20320 12132 11131 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_20320 12742 12194 gene locus_tag LOCUS_20330 12742 12194 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056202.1 protein_id gnl|my_center|LOCUS_20330 13590 12751 gene locus_tag LOCUS_20340 13590 12751 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence106 1343 1540 gene locus_tag LOCUS_20350 1343 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2101 1742 gene locus_tag LOCUS_20360 2101 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2142 2318 gene locus_tag LOCUS_20370 2142 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2799 2299 gene locus_tag LOCUS_20380 2799 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3221 2826 gene locus_tag LOCUS_20390 3221 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 4210 3455 gene locus_tag LOCUS_20400 4210 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 5117 4377 gene locus_tag LOCUS_20410 5117 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 6453 5275 gene locus_tag LOCUS_20420 6453 5275 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_20420 7547 6450 gene locus_tag LOCUS_20430 7547 6450 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_20430 9249 8473 gene locus_tag LOCUS_20440 9249 8473 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_20440 9507 11483 gene locus_tag LOCUS_20450 gene acs 9507 11483 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_20450 12106 12606 gene locus_tag LOCUS_20460 12106 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 12596 13516 gene locus_tag LOCUS_20470 12596 13516 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence107 620 66 gene locus_tag LOCUS_20480 620 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2857 617 gene locus_tag LOCUS_20490 2857 617 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_20490 4654 3236 gene locus_tag LOCUS_20500 4654 3236 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 protein_id gnl|my_center|LOCUS_20500 5901 4669 gene locus_tag LOCUS_20510 5901 4669 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_20510 6243 6004 gene locus_tag LOCUS_20520 gene acpM 6243 6004 CDS product meromycolate extension acyl carrier protein AcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895721.1 protein_id gnl|my_center|LOCUS_20520 7281 6325 gene locus_tag LOCUS_20530 7281 6325 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223987.1 protein_id gnl|my_center|LOCUS_20530 8174 7278 gene locus_tag LOCUS_20540 8174 7278 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_20540 9569 8283 gene locus_tag LOCUS_20550 gene fasR 9569 8283 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_20550 11320 9629 gene locus_tag LOCUS_20560 11320 9629 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230373.1 protein_id gnl|my_center|LOCUS_20560 11998 11555 gene locus_tag LOCUS_20570 11998 11555 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082867.1 protein_id gnl|my_center|LOCUS_20570 13177 12014 gene locus_tag LOCUS_20580 13177 12014 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222139.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence108 561 1106 gene locus_tag LOCUS_20590 561 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1681 1980 gene locus_tag LOCUS_20600 1681 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3156 2200 gene locus_tag LOCUS_20610 3156 2200 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_20610 3367 4248 gene locus_tag LOCUS_20620 3367 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 4318 4515 gene locus_tag LOCUS_20630 4318 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 4588 5208 gene locus_tag LOCUS_20640 4588 5208 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_20640 5304 5534 gene locus_tag LOCUS_20650 5304 5534 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223016.1 protein_id gnl|my_center|LOCUS_20650 6680 6045 gene locus_tag LOCUS_20660 6680 6045 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_20660 7001 9013 gene locus_tag LOCUS_20670 7001 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 9371 10255 gene locus_tag LOCUS_20680 9371 10255 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_20680 10260 11171 gene locus_tag LOCUS_20690 10260 11171 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_20690 12090 11122 gene locus_tag LOCUS_20700 12090 11122 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_20700 12805 12095 gene locus_tag LOCUS_20710 12805 12095 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_20710 13398 12847 gene locus_tag LOCUS_20720 13398 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence109 1142 2800 gene locus_tag LOCUS_20730 1142 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4627 3068 gene locus_tag LOCUS_20740 4627 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4816 5874 gene locus_tag LOCUS_20750 gene thrC 4816 5874 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_20750 5918 6844 gene locus_tag LOCUS_20760 gene thrB 5918 6844 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_20760 7258 9201 gene locus_tag LOCUS_20770 7258 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 9695 9913 gene locus_tag LOCUS_20780 gene rpmE 9695 9913 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_20780 10021 11067 gene locus_tag LOCUS_20790 gene prfA 10021 11067 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_20790 11215 12069 gene locus_tag LOCUS_20800 gene prmC 11215 12069 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_20800 12213 12821 gene locus_tag LOCUS_20810 12213 12821 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence110 354 1004 gene locus_tag LOCUS_20820 354 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1195 3180 gene locus_tag LOCUS_20830 1195 3180 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225090.1 protein_id gnl|my_center|LOCUS_20830 3808 3224 gene locus_tag LOCUS_20840 3808 3224 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977779.1 protein_id gnl|my_center|LOCUS_20840 4096 4875 gene locus_tag LOCUS_20850 gene modA 4096 4875 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_20850 6232 4856 gene locus_tag LOCUS_20860 6232 4856 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_20860 6356 7192 gene locus_tag LOCUS_20870 6356 7192 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_20870 7233 7748 gene locus_tag LOCUS_20880 7233 7748 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815447.1 protein_id gnl|my_center|LOCUS_20880 8943 7717 gene locus_tag LOCUS_20890 8943 7717 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_20890 9000 10574 gene locus_tag LOCUS_20900 9000 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 11237 10584 gene locus_tag LOCUS_20910 11237 10584 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028005.1 protein_id gnl|my_center|LOCUS_20910 11285 11551 gene locus_tag LOCUS_20920 11285 11551 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_20920 11662 12012 gene locus_tag LOCUS_20930 11662 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 12470 12048 gene locus_tag LOCUS_20940 12470 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20940 12537 12998 gene locus_tag LOCUS_20950 12537 12998 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230087.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence111 1140 187 gene locus_tag LOCUS_20960 1140 187 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135338848.1 protein_id gnl|my_center|LOCUS_20960 1197 1613 gene locus_tag LOCUS_20970 1197 1613 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270054.1 protein_id gnl|my_center|LOCUS_20970 2495 1626 gene locus_tag LOCUS_20980 2495 1626 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226333.1 protein_id gnl|my_center|LOCUS_20980 4019 2571 gene locus_tag LOCUS_20990 4019 2571 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 protein_id gnl|my_center|LOCUS_20990 5674 4016 gene locus_tag LOCUS_21000 5674 4016 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_21000 5804 6502 gene locus_tag LOCUS_21010 5804 6502 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026928.1 protein_id gnl|my_center|LOCUS_21010 6499 6990 gene locus_tag LOCUS_21020 6499 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 8062 7058 gene locus_tag LOCUS_21030 8062 7058 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877764.1 protein_id gnl|my_center|LOCUS_21030 8649 8062 gene locus_tag LOCUS_21040 8649 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 8687 9091 gene locus_tag LOCUS_21050 8687 9091 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402907.1 protein_id gnl|my_center|LOCUS_21050 9510 10835 gene locus_tag LOCUS_21060 9510 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_21060 10985 11590 gene locus_tag LOCUS_21070 10985 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 11880 13322 gene locus_tag LOCUS_21080 11880 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence112 328 975 gene locus_tag LOCUS_21090 328 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 972 1604 gene locus_tag LOCUS_21100 972 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1508 2851 gene locus_tag LOCUS_21110 1508 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 4247 2862 gene locus_tag LOCUS_21120 4247 2862 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_21120 5932 4649 gene locus_tag LOCUS_21130 5932 4649 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_21130 6930 5929 gene locus_tag LOCUS_21140 6930 5929 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 protein_id gnl|my_center|LOCUS_21140 9731 6927 gene locus_tag LOCUS_21150 9731 6927 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030390.1 protein_id gnl|my_center|LOCUS_21150 11813 10602 gene locus_tag LOCUS_21160 11813 10602 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_21160 12782 12528 gene locus_tag LOCUS_21170 12782 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence113 2557 572 gene locus_tag LOCUS_21180 2557 572 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_21180 3129 2563 gene locus_tag LOCUS_21190 3129 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 4563 3268 gene locus_tag LOCUS_21200 4563 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 5757 8534 gene locus_tag LOCUS_21210 gene afsR 5757 8534 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_21210 10054 8531 gene locus_tag LOCUS_21220 10054 8531 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_21220 10174 12408 gene locus_tag LOCUS_21230 gene pucD 10174 12408 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226424.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence114 261 1205 gene locus_tag LOCUS_21240 261 1205 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_21240 1871 2338 gene locus_tag LOCUS_21250 1871 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3059 2529 gene locus_tag LOCUS_21260 3059 2529 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258976.1 protein_id gnl|my_center|LOCUS_21260 3263 3655 gene locus_tag LOCUS_21270 3263 3655 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228348.1 protein_id gnl|my_center|LOCUS_21270 4809 3916 gene locus_tag LOCUS_21280 4809 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974288.1 protein_id gnl|my_center|LOCUS_21280 5925 4927 gene locus_tag LOCUS_21290 5925 4927 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_21290 6178 5930 gene locus_tag LOCUS_21300 6178 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 7640 6189 gene locus_tag LOCUS_21310 gene hldE 7640 6189 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404685.1 protein_id gnl|my_center|LOCUS_21310 7991 9040 gene locus_tag LOCUS_21320 7991 9040 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188715.1 protein_id gnl|my_center|LOCUS_21320 9037 10104 gene locus_tag LOCUS_21330 9037 10104 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_21330 10193 10438 gene locus_tag LOCUS_21340 10193 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 10435 11163 gene locus_tag LOCUS_21350 10435 11163 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224986.1 protein_id gnl|my_center|LOCUS_21350 11424 11275 gene locus_tag LOCUS_21360 11424 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 12121 11600 gene locus_tag LOCUS_21370 12121 11600 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677243.1 protein_id gnl|my_center|LOCUS_21370 12618 12118 gene locus_tag LOCUS_21380 12618 12118 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_21380 12674 13270 gene locus_tag LOCUS_21390 12674 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence115 326 60 gene locus_tag LOCUS_21400 326 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 347 1174 gene locus_tag LOCUS_21410 347 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1230 3365 gene locus_tag LOCUS_21420 1230 3365 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_21420 3423 4151 gene locus_tag LOCUS_21430 3423 4151 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258317.1 protein_id gnl|my_center|LOCUS_21430 5241 4201 gene locus_tag LOCUS_21440 5241 4201 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226650.1 protein_id gnl|my_center|LOCUS_21440 6299 5250 gene locus_tag LOCUS_21450 6299 5250 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397730.1 protein_id gnl|my_center|LOCUS_21450 7272 6373 gene locus_tag LOCUS_21460 7272 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 8108 7269 gene locus_tag LOCUS_21470 8108 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 9477 8086 gene locus_tag LOCUS_21480 9477 8086 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948242.1 protein_id gnl|my_center|LOCUS_21480 10507 9470 gene locus_tag LOCUS_21490 10507 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 11777 10542 gene locus_tag LOCUS_21500 11777 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 12691 11774 gene locus_tag LOCUS_21510 12691 11774 CDS product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948240.1 protein_id gnl|my_center|LOCUS_21510 13281 12694 gene locus_tag LOCUS_21520 13281 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence116 211 597 gene locus_tag LOCUS_21530 211 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 928 1788 gene locus_tag LOCUS_21540 928 1788 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029307.1 protein_id gnl|my_center|LOCUS_21540 1889 3439 gene locus_tag LOCUS_21550 1889 3439 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224111.1 protein_id gnl|my_center|LOCUS_21550 3505 5073 gene locus_tag LOCUS_21560 3505 5073 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_21560 5073 6146 gene locus_tag LOCUS_21570 5073 6146 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_21570 6140 7501 gene locus_tag LOCUS_21580 6140 7501 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222806.1 protein_id gnl|my_center|LOCUS_21580 7521 8822 gene locus_tag LOCUS_21590 7521 8822 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037764.1 protein_id gnl|my_center|LOCUS_21590 8981 9628 gene locus_tag LOCUS_21600 8981 9628 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222808.1 protein_id gnl|my_center|LOCUS_21600 9625 10920 gene locus_tag LOCUS_21610 9625 10920 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222809.1 protein_id gnl|my_center|LOCUS_21610 11017 11460 gene locus_tag LOCUS_21620 11017 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 11460 12890 gene locus_tag LOCUS_21630 11460 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence117 93 1064 gene locus_tag LOCUS_21640 93 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1061 2014 gene locus_tag LOCUS_21650 1061 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2011 3060 gene locus_tag LOCUS_21660 2011 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3051 3857 gene locus_tag LOCUS_21670 3051 3857 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_21670 3844 5112 gene locus_tag LOCUS_21680 3844 5112 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_21680 5106 5993 gene locus_tag LOCUS_21690 5106 5993 CDS product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681897.1 protein_id gnl|my_center|LOCUS_21690 7036 5969 gene locus_tag LOCUS_21700 7036 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229816.1 protein_id gnl|my_center|LOCUS_21700 7332 7036 gene locus_tag LOCUS_21710 7332 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 7455 7925 gene locus_tag LOCUS_21720 7455 7925 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_21720 8914 7874 gene locus_tag LOCUS_21730 8914 7874 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_21730 10173 8911 gene locus_tag LOCUS_21740 10173 8911 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028492.1 protein_id gnl|my_center|LOCUS_21740 10994 10170 gene locus_tag LOCUS_21750 10994 10170 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028491.1 protein_id gnl|my_center|LOCUS_21750 11896 10991 gene locus_tag LOCUS_21760 11896 10991 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976142.1 protein_id gnl|my_center|LOCUS_21760 <13269 11902 gene locus_tag LOCUS_21770 <13269 11902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028490.1:ABC transporter substrate-binding protein >Feature sequence118 255 49 gene locus_tag LOCUS_21780 255 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 830 1687 gene locus_tag LOCUS_21790 830 1687 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_21790 1752 1958 gene locus_tag LOCUS_21800 1752 1958 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_21800 3544 2075 gene locus_tag LOCUS_21810 3544 2075 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 protein_id gnl|my_center|LOCUS_21810 3988 3599 gene locus_tag LOCUS_21820 3988 3599 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_21820 4144 5241 gene locus_tag LOCUS_21830 4144 5241 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854514.1 protein_id gnl|my_center|LOCUS_21830 5484 6050 gene locus_tag LOCUS_21840 5484 6050 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_21840 6507 6100 gene locus_tag LOCUS_21850 6507 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 6695 7210 gene locus_tag LOCUS_21860 6695 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 8724 7540 gene locus_tag LOCUS_21870 8724 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 11473 8885 gene locus_tag LOCUS_21880 gene clpB 11473 8885 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_21880 11844 11497 gene locus_tag LOCUS_21890 11844 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 13012 11849 gene locus_tag LOCUS_21900 gene dnaJ 13012 11849 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence119 360 791 gene locus_tag LOCUS_21910 360 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2302 824 gene locus_tag LOCUS_21920 2302 824 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030099.1 protein_id gnl|my_center|LOCUS_21920 2190 2657 gene locus_tag LOCUS_21930 2190 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2790 5426 gene locus_tag LOCUS_21940 gene ppdK 2790 5426 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_21940 5904 7205 gene locus_tag LOCUS_21950 5904 7205 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_21950 8194 7328 gene locus_tag LOCUS_21960 8194 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 8378 10249 gene locus_tag LOCUS_21970 gene dnaG 8378 10249 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_21970 10429 11535 gene locus_tag LOCUS_21980 10429 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 11937 12440 gene locus_tag LOCUS_21990 11937 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 13046 12747 gene locus_tag LOCUS_22000 13046 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence120 1010 207 gene locus_tag LOCUS_22010 1010 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 1515 1021 gene locus_tag LOCUS_22020 1515 1021 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731493.1 protein_id gnl|my_center|LOCUS_22020 2666 1584 gene locus_tag LOCUS_22030 2666 1584 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_22030 2898 2704 gene locus_tag LOCUS_22040 2898 2704 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062259.1 protein_id gnl|my_center|LOCUS_22040 3399 2920 gene locus_tag LOCUS_22050 3399 2920 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081451.1 protein_id gnl|my_center|LOCUS_22050 3480 4109 gene locus_tag LOCUS_22060 3480 4109 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_22060 5171 4110 gene locus_tag LOCUS_22070 5171 4110 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_22070 5881 5168 gene locus_tag LOCUS_22080 5881 5168 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_22080 7168 5927 gene locus_tag LOCUS_22090 7168 5927 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_22090 7434 8459 gene locus_tag LOCUS_22100 gene gmd 7434 8459 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_22100 9764 8565 gene locus_tag LOCUS_22110 9764 8565 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_22110 9980 10342 gene locus_tag LOCUS_22120 9980 10342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 11262 10630 gene locus_tag LOCUS_22130 11262 10630 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22130 12198 11674 gene locus_tag LOCUS_22140 12198 11674 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence121 1768 284 gene locus_tag LOCUS_22150 1768 284 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031038.1 protein_id gnl|my_center|LOCUS_22150 2118 1915 gene locus_tag LOCUS_22160 2118 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3908 2298 gene locus_tag LOCUS_22170 3908 2298 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228411.1 protein_id gnl|my_center|LOCUS_22170 4680 3970 gene locus_tag LOCUS_22180 4680 3970 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224251.1 protein_id gnl|my_center|LOCUS_22180 4765 6234 gene locus_tag LOCUS_22190 4765 6234 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466576.1 protein_id gnl|my_center|LOCUS_22190 6348 7598 gene locus_tag LOCUS_22200 6348 7598 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_22200 7585 9069 gene locus_tag LOCUS_22210 7585 9069 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_22210 9144 10328 gene locus_tag LOCUS_22220 9144 10328 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878137.1 protein_id gnl|my_center|LOCUS_22220 10544 10329 gene locus_tag LOCUS_22230 10544 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 10447 10896 gene locus_tag LOCUS_22240 10447 10896 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_22240 11157 10909 gene locus_tag LOCUS_22250 11157 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 12677 11328 gene locus_tag LOCUS_22260 gene gabT 12677 11328 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence122 1097 216 gene locus_tag LOCUS_22270 1097 216 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_22270 2042 1284 gene locus_tag LOCUS_22280 2042 1284 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_22280 3078 2020 gene locus_tag LOCUS_22290 3078 2020 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_22290 3834 3103 gene locus_tag LOCUS_22300 3834 3103 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_22300 4594 3929 gene locus_tag LOCUS_22310 4594 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 6224 4668 gene locus_tag LOCUS_22320 6224 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 6321 7751 gene locus_tag LOCUS_22330 6321 7751 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_22330 7786 9639 gene locus_tag LOCUS_22340 7786 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 9695 10312 gene locus_tag LOCUS_22350 9695 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 11275 10289 gene locus_tag LOCUS_22360 gene exoA 11275 10289 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434899.1 protein_id gnl|my_center|LOCUS_22360 11274 11441 gene locus_tag LOCUS_22370 11274 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 11402 12889 gene locus_tag LOCUS_22380 11402 12889 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence123 614 246 gene locus_tag LOCUS_22390 614 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 511 894 gene locus_tag LOCUS_22400 511 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1255 833 gene locus_tag LOCUS_22410 1255 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1303 1632 gene locus_tag LOCUS_22420 1303 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1629 2465 gene locus_tag LOCUS_22430 1629 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2452 2790 gene locus_tag LOCUS_22440 2452 2790 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187469.1 protein_id gnl|my_center|LOCUS_22440 3234 2935 gene locus_tag LOCUS_22450 3234 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3247 3861 gene locus_tag LOCUS_22460 3247 3861 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_22460 4035 5201 gene locus_tag LOCUS_22470 4035 5201 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_22470 8242 5633 gene locus_tag LOCUS_22480 gene ppsA 8242 5633 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_22480 8458 9426 gene locus_tag LOCUS_22490 8458 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 9426 10424 gene locus_tag LOCUS_22500 9426 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204030243.1 protein_id gnl|my_center|LOCUS_22500 10638 12236 gene locus_tag LOCUS_22510 10638 12236 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_22510 12233 12697 gene locus_tag LOCUS_22520 12233 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence124 1095 1619 gene locus_tag LOCUS_22530 1095 1619 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977781.1 protein_id gnl|my_center|LOCUS_22530 1673 2191 gene locus_tag LOCUS_22540 gene ripB 1673 2191 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212069.1 protein_id gnl|my_center|LOCUS_22540 2191 3351 gene locus_tag LOCUS_22550 2191 3351 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_22550 3354 3791 gene locus_tag LOCUS_22560 3354 3791 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_22560 3889 4794 gene locus_tag LOCUS_22570 3889 4794 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_22570 4832 6085 gene locus_tag LOCUS_22580 4832 6085 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_22580 6199 6792 gene locus_tag LOCUS_22590 6199 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 6891 7655 gene locus_tag LOCUS_22600 6891 7655 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_22600 7699 8085 gene locus_tag LOCUS_22610 7699 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 8156 9631 gene locus_tag LOCUS_22620 8156 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 9866 10210 gene locus_tag LOCUS_22630 9866 10210 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 protein_id gnl|my_center|LOCUS_22630 10207 11817 gene locus_tag LOCUS_22640 10207 11817 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_22640 12096 12704 gene locus_tag LOCUS_22650 12096 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence125 724 993 gene locus_tag LOCUS_22660 724 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1886 876 gene locus_tag LOCUS_22670 1886 876 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_22670 4450 2051 gene locus_tag LOCUS_22680 4450 2051 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_22680 4574 5449 gene locus_tag LOCUS_22690 4574 5449 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227980.1 protein_id gnl|my_center|LOCUS_22690 6038 6871 gene locus_tag LOCUS_22700 6038 6871 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_22700 6973 7719 gene locus_tag LOCUS_22710 6973 7719 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084097.1 protein_id gnl|my_center|LOCUS_22710 8105 7692 gene locus_tag LOCUS_22720 8105 7692 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_22720 8317 8976 gene locus_tag LOCUS_22730 8317 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 9680 9060 gene locus_tag LOCUS_22740 9680 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 10492 9884 gene locus_tag LOCUS_22750 10492 9884 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_22750 11621 10518 gene locus_tag LOCUS_22760 11621 10518 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091312173.1 protein_id gnl|my_center|LOCUS_22760 12107 11685 gene locus_tag LOCUS_22770 12107 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226389.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence126 938 108 gene locus_tag LOCUS_22780 938 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1103 2257 gene locus_tag LOCUS_22790 1103 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2559 2320 gene locus_tag LOCUS_22800 2559 2320 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_22800 3801 2704 gene locus_tag LOCUS_22810 3801 2704 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_22810 5074 3809 gene locus_tag LOCUS_22820 5074 3809 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 protein_id gnl|my_center|LOCUS_22820 5289 6080 gene locus_tag LOCUS_22830 5289 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6763 6074 gene locus_tag LOCUS_22840 6763 6074 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_22840 6838 7434 gene locus_tag LOCUS_22850 6838 7434 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 protein_id gnl|my_center|LOCUS_22850 7663 9402 gene locus_tag LOCUS_22860 gene leuA 7663 9402 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_22860 10616 9543 gene locus_tag LOCUS_22870 10616 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 11692 10613 gene locus_tag LOCUS_22880 11692 10613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_22880 12702 11689 gene locus_tag LOCUS_22890 12702 11689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence127 1227 2993 gene locus_tag LOCUS_22900 1227 2993 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080066.1 protein_id gnl|my_center|LOCUS_22900 3054 4046 gene locus_tag LOCUS_22910 3054 4046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080068.1 protein_id gnl|my_center|LOCUS_22910 4043 4927 gene locus_tag LOCUS_22920 4043 4927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080070.1 protein_id gnl|my_center|LOCUS_22920 4929 5873 gene locus_tag LOCUS_22930 4929 5873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080073.1 protein_id gnl|my_center|LOCUS_22930 5873 6808 gene locus_tag LOCUS_22940 5873 6808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080075.1 protein_id gnl|my_center|LOCUS_22940 6805 9189 gene locus_tag LOCUS_22950 6805 9189 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_22950 9228 10337 gene locus_tag LOCUS_22960 gene manA 9228 10337 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_22960 10439 11494 gene locus_tag LOCUS_22970 10439 11494 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_22970 11546 12391 gene locus_tag LOCUS_22980 11546 12391 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence128 978 67 gene locus_tag LOCUS_22990 978 67 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_22990 1036 1431 gene locus_tag LOCUS_23000 1036 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2376 1432 gene locus_tag LOCUS_23010 2376 1432 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027748.1 protein_id gnl|my_center|LOCUS_23010 2479 3672 gene locus_tag LOCUS_23020 2479 3672 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_23020 3665 4159 gene locus_tag LOCUS_23030 3665 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4177 5319 gene locus_tag LOCUS_23040 4177 5319 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_23040 5679 5335 gene locus_tag LOCUS_23050 5679 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 7052 5754 gene locus_tag LOCUS_23060 7052 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 7715 7158 gene locus_tag LOCUS_23070 7715 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 8314 7712 gene locus_tag LOCUS_23080 gene sigE 8314 7712 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_23080 8506 9135 gene locus_tag LOCUS_23090 8506 9135 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_23090 10638 9178 gene locus_tag LOCUS_23100 10638 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 10886 10719 gene locus_tag LOCUS_23110 10886 10719 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_23110 11136 11840 gene locus_tag LOCUS_23120 11136 11840 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655931.1 protein_id gnl|my_center|LOCUS_23120 11842 12621 gene locus_tag LOCUS_23130 11842 12621 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence129 1695 82 gene locus_tag LOCUS_23140 1695 82 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_23140 4045 2000 gene locus_tag LOCUS_23150 4045 2000 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_23150 4404 5006 gene locus_tag LOCUS_23160 4404 5006 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_23160 5003 5977 gene locus_tag LOCUS_23170 5003 5977 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_23170 6076 7104 gene locus_tag LOCUS_23180 6076 7104 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_23180 7202 7708 gene locus_tag LOCUS_23190 7202 7708 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_23190 7890 8900 gene locus_tag LOCUS_23200 7890 8900 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_23200 9007 9921 gene locus_tag LOCUS_23210 gene pdxS 9007 9921 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 protein_id gnl|my_center|LOCUS_23210 10028 10453 gene locus_tag LOCUS_23220 10028 10453 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230986.1 protein_id gnl|my_center|LOCUS_23220 10519 11109 gene locus_tag LOCUS_23230 gene pdxT 10519 11109 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728706.1 protein_id gnl|my_center|LOCUS_23230 11113 11865 gene locus_tag LOCUS_23240 11113 11865 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence130 1254 1694 gene locus_tag LOCUS_23250 1254 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2056 1868 gene locus_tag LOCUS_23260 2056 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2835 2587 gene locus_tag LOCUS_23270 2835 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 3902 2901 gene locus_tag LOCUS_23280 3902 2901 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_23280 4116 5537 gene locus_tag LOCUS_23290 4116 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 5546 6250 gene locus_tag LOCUS_23300 5546 6250 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_23300 6329 6736 gene locus_tag LOCUS_23310 6329 6736 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 protein_id gnl|my_center|LOCUS_23310 6772 7398 gene locus_tag LOCUS_23320 6772 7398 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224090.1 protein_id gnl|my_center|LOCUS_23320 8810 7395 gene locus_tag LOCUS_23330 8810 7395 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404013.1 protein_id gnl|my_center|LOCUS_23330 9544 8843 gene locus_tag LOCUS_23340 9544 8843 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222860.1 protein_id gnl|my_center|LOCUS_23340 10701 9541 gene locus_tag LOCUS_23350 10701 9541 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225409.1 protein_id gnl|my_center|LOCUS_23350 10833 11729 gene locus_tag LOCUS_23360 10833 11729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_23360 11726 12508 gene locus_tag LOCUS_23370 11726 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence131 1262 1435 gene locus_tag LOCUS_23380 1262 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1502 2674 gene locus_tag LOCUS_23390 1502 2674 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_23390 2914 4155 gene locus_tag LOCUS_23400 2914 4155 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_23400 4447 5370 gene locus_tag LOCUS_23410 4447 5370 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_23410 5589 6602 gene locus_tag LOCUS_23420 5589 6602 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_23420 6976 6662 gene locus_tag LOCUS_23430 6976 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 6860 8239 gene locus_tag LOCUS_23440 6860 8239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_23440 8343 9494 gene locus_tag LOCUS_23450 8343 9494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_23450 9604 10875 gene locus_tag LOCUS_23460 9604 10875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_23460 10872 11261 gene locus_tag LOCUS_23470 10872 11261 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056128.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence132 1633 338 gene locus_tag LOCUS_23480 1633 338 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_23480 2658 1630 gene locus_tag LOCUS_23490 2658 1630 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978470.1 protein_id gnl|my_center|LOCUS_23490 3316 2666 gene locus_tag LOCUS_23500 3316 2666 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978471.1 protein_id gnl|my_center|LOCUS_23500 4092 3313 gene locus_tag LOCUS_23510 4092 3313 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978472.1 protein_id gnl|my_center|LOCUS_23510 5312 4089 gene locus_tag LOCUS_23520 5312 4089 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_23520 5441 6031 gene locus_tag LOCUS_23530 5441 6031 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_23530 6867 6013 gene locus_tag LOCUS_23540 gene rfbD 6867 6013 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_23540 7841 6873 gene locus_tag LOCUS_23550 gene rfbB 7841 6873 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_23550 8071 9927 gene locus_tag LOCUS_23560 8071 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 11048 9984 gene locus_tag LOCUS_23570 11048 9984 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_23570 <12450 11050 gene locus_tag LOCUS_23580 <12450 11050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978484.1:sugar transferase >Feature sequence133 586 891 gene locus_tag LOCUS_23590 586 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 949 1173 gene locus_tag LOCUS_23600 949 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 1260 2243 gene locus_tag LOCUS_23610 1260 2243 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_23610 2297 3790 gene locus_tag LOCUS_23620 2297 3790 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_23620 3940 5760 gene locus_tag LOCUS_23630 3940 5760 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776035.1 protein_id gnl|my_center|LOCUS_23630 5757 6791 gene locus_tag LOCUS_23640 5757 6791 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225593.1 protein_id gnl|my_center|LOCUS_23640 6788 7720 gene locus_tag LOCUS_23650 6788 7720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_23650 7726 8739 gene locus_tag LOCUS_23660 7726 8739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085658.1 protein_id gnl|my_center|LOCUS_23660 8736 9737 gene locus_tag LOCUS_23670 8736 9737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_23670 9734 10594 gene locus_tag LOCUS_23680 9734 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 11703 10597 gene locus_tag LOCUS_23690 11703 10597 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence134 42 1217 gene locus_tag LOCUS_23700 42 1217 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141357.1 protein_id gnl|my_center|LOCUS_23700 1782 1168 gene locus_tag LOCUS_23710 gene plsY 1782 1168 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_23710 1739 2500 gene locus_tag LOCUS_23720 1739 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23720 3720 2530 gene locus_tag LOCUS_23730 gene plsX 3720 2530 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080328.1 protein_id gnl|my_center|LOCUS_23730 4630 3722 gene locus_tag LOCUS_23740 4630 3722 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_23740 6093 4627 gene locus_tag LOCUS_23750 gene crtI 6093 4627 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_23750 6568 7089 gene locus_tag LOCUS_23760 6568 7089 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026917.1 protein_id gnl|my_center|LOCUS_23760 7721 7215 gene locus_tag LOCUS_23770 7721 7215 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_23770 7807 10107 gene locus_tag LOCUS_23780 7807 10107 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_23780 10293 12269 gene locus_tag LOCUS_23790 gene thrS 10293 12269 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence135 1282 545 gene locus_tag LOCUS_23800 1282 545 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_23800 2290 1283 gene locus_tag LOCUS_23810 2290 1283 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_23810 3325 2414 gene locus_tag LOCUS_23820 3325 2414 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_23820 4331 3555 gene locus_tag LOCUS_23830 4331 3555 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_23830 5290 4328 gene locus_tag LOCUS_23840 5290 4328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_23840 5472 6386 gene locus_tag LOCUS_23850 5472 6386 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_23850 6383 7795 gene locus_tag LOCUS_23860 gene sufB 6383 7795 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_23860 7795 8919 gene locus_tag LOCUS_23870 gene sufD 7795 8919 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224698.1 protein_id gnl|my_center|LOCUS_23870 8916 9245 gene locus_tag LOCUS_23880 8916 9245 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_23880 9252 10037 gene locus_tag LOCUS_23890 gene sufC 9252 10037 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_23890 10037 11299 gene locus_tag LOCUS_23900 10037 11299 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_23900 11303 11740 gene locus_tag LOCUS_23910 11303 11740 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_23910 11808 12206 gene locus_tag LOCUS_23920 11808 12206 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057839.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence136 1949 504 gene locus_tag LOCUS_23930 1949 504 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226681.1 protein_id gnl|my_center|LOCUS_23930 2221 3402 gene locus_tag LOCUS_23940 2221 3402 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_23940 3395 4216 gene locus_tag LOCUS_23950 3395 4216 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226684.1 protein_id gnl|my_center|LOCUS_23950 4234 5097 gene locus_tag LOCUS_23960 4234 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5094 5453 gene locus_tag LOCUS_23970 5094 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 5459 6421 gene locus_tag LOCUS_23980 5459 6421 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191003.1 protein_id gnl|my_center|LOCUS_23980 7244 6444 gene locus_tag LOCUS_23990 7244 6444 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226682.1 protein_id gnl|my_center|LOCUS_23990 7387 7608 gene locus_tag LOCUS_24000 7387 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 7672 8295 gene locus_tag LOCUS_24010 7672 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 8402 9889 gene locus_tag LOCUS_24020 8402 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 9883 11079 gene locus_tag LOCUS_24030 9883 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 11208 11951 gene locus_tag LOCUS_24040 11208 11951 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_24040 11963 12250 gene locus_tag LOCUS_24050 11963 12250 CDS product DUF6295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226838.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence137 3544 1973 gene locus_tag LOCUS_24060 3544 1973 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131344932.1 protein_id gnl|my_center|LOCUS_24060 4561 3587 gene locus_tag LOCUS_24070 4561 3587 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_24070 5498 4575 gene locus_tag LOCUS_24080 5498 4575 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_24080 7038 5659 gene locus_tag LOCUS_24090 7038 5659 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972131.1 protein_id gnl|my_center|LOCUS_24090 7969 7598 gene locus_tag LOCUS_24100 7969 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 7982 9091 gene locus_tag LOCUS_24110 7982 9091 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228681.1 protein_id gnl|my_center|LOCUS_24110 9929 9165 gene locus_tag LOCUS_24120 9929 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 10672 9872 gene locus_tag LOCUS_24130 10672 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 11068 12039 gene locus_tag LOCUS_24140 11068 12039 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228681.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence138 694 1458 gene locus_tag LOCUS_24150 694 1458 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_24150 1471 1938 gene locus_tag LOCUS_24160 1471 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_24160 3309 2107 gene locus_tag LOCUS_24170 3309 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 4192 3437 gene locus_tag LOCUS_24180 4192 3437 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170055.1 protein_id gnl|my_center|LOCUS_24180 5111 4170 gene locus_tag LOCUS_24190 5111 4170 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_24190 5673 5239 gene locus_tag LOCUS_24200 5673 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 6782 5670 gene locus_tag LOCUS_24210 6782 5670 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256376.1 protein_id gnl|my_center|LOCUS_24210 7264 6827 gene locus_tag LOCUS_24220 7264 6827 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_24220 8046 7279 gene locus_tag LOCUS_24230 8046 7279 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_24230 8281 10065 gene locus_tag LOCUS_24240 8281 10065 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_24240 11379 10252 gene locus_tag LOCUS_24250 11379 10252 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence139 81 1613 gene locus_tag LOCUS_24260 gene tnpB 81 1613 CDS product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083165449.1 protein_id gnl|my_center|LOCUS_24260 1677 1948 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggacttccccgagcgcgaggacgacgg 2109 3329 gene locus_tag LOCUS_24270 2109 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 3398 3655 gene locus_tag LOCUS_24280 3398 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 3816 3980 gene locus_tag LOCUS_24290 3816 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 3983 5059 gene locus_tag LOCUS_24300 3983 5059 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_24300 5444 6028 gene locus_tag LOCUS_24310 5444 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 6086 6511 gene locus_tag LOCUS_24320 6086 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 6508 7293 gene locus_tag LOCUS_24330 6508 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 7367 7882 gene locus_tag LOCUS_24340 7367 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 7910 8461 gene locus_tag LOCUS_24350 7910 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 8566 9231 gene locus_tag LOCUS_24360 8566 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 9595 9356 gene locus_tag LOCUS_24370 9595 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 9810 9595 gene locus_tag LOCUS_24380 9810 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 10757 9825 gene locus_tag LOCUS_24390 10757 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 11146 10757 gene locus_tag LOCUS_24400 11146 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 11691 11464 gene locus_tag LOCUS_24410 11691 11464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 11820 12218 gene locus_tag LOCUS_24420 11820 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence140 1767 55 gene locus_tag LOCUS_24430 1767 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 1988 3457 gene locus_tag LOCUS_24440 1988 3457 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_24440 4372 3464 gene locus_tag LOCUS_24450 4372 3464 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 protein_id gnl|my_center|LOCUS_24450 5296 4376 gene locus_tag LOCUS_24460 5296 4376 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026993.1 protein_id gnl|my_center|LOCUS_24460 6765 5299 gene locus_tag LOCUS_24470 6765 5299 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026992.1 protein_id gnl|my_center|LOCUS_24470 6995 9430 gene locus_tag LOCUS_24480 6995 9430 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730344.1 protein_id gnl|my_center|LOCUS_24480 9414 10436 gene locus_tag LOCUS_24490 9414 10436 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896541.1 protein_id gnl|my_center|LOCUS_24490 10544 10864 gene locus_tag LOCUS_24500 10544 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 11463 11071 gene locus_tag LOCUS_24510 11463 11071 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 protein_id gnl|my_center|LOCUS_24510 12152 11739 gene locus_tag LOCUS_24520 12152 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence141 94 1443 gene locus_tag LOCUS_24530 94 1443 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_24530 1436 2098 gene locus_tag LOCUS_24540 1436 2098 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_24540 2303 3367 gene locus_tag LOCUS_24550 2303 3367 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029660.1 protein_id gnl|my_center|LOCUS_24550 3393 3737 gene locus_tag LOCUS_24560 3393 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 3790 5556 gene locus_tag LOCUS_24570 3790 5556 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975015.1 protein_id gnl|my_center|LOCUS_24570 5698 6267 gene locus_tag LOCUS_24580 5698 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 6264 7010 gene locus_tag LOCUS_24590 6264 7010 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730552.1 protein_id gnl|my_center|LOCUS_24590 7639 7007 gene locus_tag LOCUS_24600 7639 7007 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031854.1 protein_id gnl|my_center|LOCUS_24600 7750 8778 gene locus_tag LOCUS_24610 7750 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037665946.1 protein_id gnl|my_center|LOCUS_24610 8815 9675 gene locus_tag LOCUS_24620 8815 9675 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029194.1 protein_id gnl|my_center|LOCUS_24620 10054 9881 gene locus_tag LOCUS_24630 10054 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 9996 10955 gene locus_tag LOCUS_24640 9996 10955 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence142 1281 67 gene locus_tag LOCUS_24650 1281 67 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480120.1 protein_id gnl|my_center|LOCUS_24650 1911 1420 gene locus_tag LOCUS_24660 1911 1420 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_24660 1942 3168 gene locus_tag LOCUS_24670 1942 3168 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_24670 3709 3122 gene locus_tag LOCUS_24680 3709 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 4626 3712 gene locus_tag LOCUS_24690 4626 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 5791 4751 gene locus_tag LOCUS_24700 5791 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 5892 6977 gene locus_tag LOCUS_24710 gene mnmA 5892 6977 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_24710 7612 6980 gene locus_tag LOCUS_24720 7612 6980 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031843.1 protein_id gnl|my_center|LOCUS_24720 7599 8636 gene locus_tag LOCUS_24730 7599 8636 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_24730 8903 11191 gene locus_tag LOCUS_24740 gene ligA 8903 11191 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_24740 11262 12122 gene locus_tag LOCUS_24750 11262 12122 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence143 605 339 gene locus_tag LOCUS_24760 605 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1125 2228 gene locus_tag LOCUS_24770 1125 2228 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_24770 3021 2323 gene locus_tag LOCUS_24780 3021 2323 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230108.1 protein_id gnl|my_center|LOCUS_24780 3211 4452 gene locus_tag LOCUS_24790 3211 4452 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014042.1 protein_id gnl|my_center|LOCUS_24790 4454 5236 gene locus_tag LOCUS_24800 4454 5236 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 protein_id gnl|my_center|LOCUS_24800 5245 5847 gene locus_tag LOCUS_24810 5245 5847 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079953.1 protein_id gnl|my_center|LOCUS_24810 5844 6746 gene locus_tag LOCUS_24820 5844 6746 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230113.1 protein_id gnl|my_center|LOCUS_24820 7503 6766 gene locus_tag LOCUS_24830 7503 6766 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 protein_id gnl|my_center|LOCUS_24830 7616 8767 gene locus_tag LOCUS_24840 7616 8767 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_24840 8772 9608 gene locus_tag LOCUS_24850 8772 9608 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_24850 9596 10471 gene locus_tag LOCUS_24860 9596 10471 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388257.1 protein_id gnl|my_center|LOCUS_24860 10468 11550 gene locus_tag LOCUS_24870 10468 11550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_24870 11540 12208 gene locus_tag LOCUS_24880 11540 12208 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence144 670 2 gene locus_tag LOCUS_24890 670 2 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_24890 1604 663 gene locus_tag LOCUS_24900 1604 663 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_24900 3972 1588 gene locus_tag LOCUS_24910 3972 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 6668 3969 gene locus_tag LOCUS_24920 6668 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 7041 8546 gene locus_tag LOCUS_24930 7041 8546 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_24930 9162 9338 gene locus_tag LOCUS_24940 9162 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 10239 9382 gene locus_tag LOCUS_24950 10239 9382 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226056.1 protein_id gnl|my_center|LOCUS_24950 10920 10312 gene locus_tag LOCUS_24960 10920 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 11160 12047 gene locus_tag LOCUS_24970 11160 12047 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence145 <1 2279 gene locus_tag LOCUS_24980 <1 2279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029689.1:protein kinase 3291 2428 gene locus_tag LOCUS_24990 3291 2428 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225603.1 protein_id gnl|my_center|LOCUS_24990 3417 3614 gene locus_tag LOCUS_25000 3417 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 4900 3665 gene locus_tag LOCUS_25010 4900 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776735.1 protein_id gnl|my_center|LOCUS_25010 5465 5016 gene locus_tag LOCUS_25020 5465 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 5500 5922 gene locus_tag LOCUS_25030 5500 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 5970 6431 gene locus_tag LOCUS_25040 5970 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 6441 6845 gene locus_tag LOCUS_25050 6441 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 7049 8506 gene locus_tag LOCUS_25060 7049 8506 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_25060 8537 10075 gene locus_tag LOCUS_25070 8537 10075 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113631.1 protein_id gnl|my_center|LOCUS_25070 10079 10975 gene locus_tag LOCUS_25080 10079 10975 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence146 270 710 gene locus_tag LOCUS_25090 270 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 707 1123 gene locus_tag LOCUS_25100 707 1123 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974118.1 protein_id gnl|my_center|LOCUS_25100 1303 4521 gene locus_tag LOCUS_25110 1303 4521 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_25110 4522 5457 gene locus_tag LOCUS_25120 4522 5457 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_25120 6604 5675 gene locus_tag LOCUS_25130 6604 5675 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977679.1 protein_id gnl|my_center|LOCUS_25130 9465 6709 gene locus_tag LOCUS_25140 9465 6709 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_25140 9663 11003 gene locus_tag LOCUS_25150 9663 11003 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence147 1161 64 gene locus_tag LOCUS_25160 1161 64 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_25160 1063 1311 gene locus_tag LOCUS_25170 1063 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1320 2105 gene locus_tag LOCUS_25180 1320 2105 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_25180 2195 3271 gene locus_tag LOCUS_25190 2195 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3462 6815 gene locus_tag LOCUS_25200 3462 6815 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728047.1 protein_id gnl|my_center|LOCUS_25200 7019 7555 gene locus_tag LOCUS_25210 7019 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 7548 8420 gene locus_tag LOCUS_25220 7548 8420 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_25220 9216 8407 gene locus_tag LOCUS_25230 9216 8407 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067135926.1 protein_id gnl|my_center|LOCUS_25230 9425 11089 gene locus_tag LOCUS_25240 9425 11089 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113135.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence148 <1 1132 gene locus_tag LOCUS_25250 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976192.1:rod shape-determining protein RodA 1264 2901 gene locus_tag LOCUS_25260 1264 2901 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_25260 3517 2972 gene locus_tag LOCUS_25270 3517 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 4802 3861 gene locus_tag LOCUS_25280 4802 3861 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222877.1 protein_id gnl|my_center|LOCUS_25280 4874 5086 gene locus_tag LOCUS_25290 4874 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 5203 5529 gene locus_tag LOCUS_25300 5203 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 6584 5832 gene locus_tag LOCUS_25310 6584 5832 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 protein_id gnl|my_center|LOCUS_25310 6684 7634 gene locus_tag LOCUS_25320 6684 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 8814 7567 gene locus_tag LOCUS_25330 8814 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 9135 10460 gene locus_tag LOCUS_25340 9135 10460 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_25340 10611 11366 gene locus_tag LOCUS_25350 10611 11366 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence149 129 1727 gene locus_tag LOCUS_25360 129 1727 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727011.1 protein_id gnl|my_center|LOCUS_25360 3429 1732 gene locus_tag LOCUS_25370 gene treZ 3429 1732 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_25370 5650 3458 gene locus_tag LOCUS_25380 gene treY 5650 3458 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_25380 7966 5825 gene locus_tag LOCUS_25390 gene glgX 7966 5825 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030640.1 protein_id gnl|my_center|LOCUS_25390 8130 7963 gene locus_tag LOCUS_25400 8130 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 8578 8198 gene locus_tag LOCUS_25410 8578 8198 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224929.1 protein_id gnl|my_center|LOCUS_25410 8649 9506 gene locus_tag LOCUS_25420 8649 9506 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267584.1 protein_id gnl|my_center|LOCUS_25420 10967 9642 gene locus_tag LOCUS_25430 10967 9642 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_25430 11678 10995 gene locus_tag LOCUS_25440 11678 10995 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence150 95 1210 gene locus_tag LOCUS_25450 95 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1361 2059 gene locus_tag LOCUS_25460 1361 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2122 2628 gene locus_tag LOCUS_25470 2122 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_25470 2679 3311 gene locus_tag LOCUS_25480 2679 3311 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_25480 3525 3884 gene locus_tag LOCUS_25490 3525 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3894 5534 gene locus_tag LOCUS_25500 3894 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 5557 6351 gene locus_tag LOCUS_25510 5557 6351 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 protein_id gnl|my_center|LOCUS_25510 7937 6390 gene locus_tag LOCUS_25520 7937 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 8046 8993 gene locus_tag LOCUS_25530 8046 8993 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029226.1 protein_id gnl|my_center|LOCUS_25530 8990 9877 gene locus_tag LOCUS_25540 8990 9877 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029227.1 protein_id gnl|my_center|LOCUS_25540 9901 11853 gene locus_tag LOCUS_25550 9901 11853 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222224.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence151 58 669 gene locus_tag LOCUS_25560 58 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 683 1051 gene locus_tag LOCUS_25570 683 1051 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_25570 1147 2319 gene locus_tag LOCUS_25580 1147 2319 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227164.1 protein_id gnl|my_center|LOCUS_25580 2761 2324 gene locus_tag LOCUS_25590 2761 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3986 2808 gene locus_tag LOCUS_25600 3986 2808 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_25600 6040 3983 gene locus_tag LOCUS_25610 gene pta 6040 3983 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727187.1 protein_id gnl|my_center|LOCUS_25610 6823 6188 gene locus_tag LOCUS_25620 6823 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978526.1 protein_id gnl|my_center|LOCUS_25620 9638 6927 gene locus_tag LOCUS_25630 9638 6927 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227003.1 protein_id gnl|my_center|LOCUS_25630 9900 10709 gene locus_tag LOCUS_25640 9900 10709 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_25640 11776 10766 gene locus_tag LOCUS_25650 11776 10766 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 protein_id gnl|my_center|LOCUS_25650 12009 12085 gene locus_tag LOCUS_t00230 12009 12085 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence152 1747 617 gene locus_tag LOCUS_25660 1747 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2594 1803 gene locus_tag LOCUS_25670 2594 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2876 3319 gene locus_tag LOCUS_25680 gene rplM 2876 3319 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_25680 3350 3868 gene locus_tag LOCUS_25690 gene rpsI 3350 3868 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_25690 3868 5253 gene locus_tag LOCUS_25700 gene glmM 3868 5253 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_25700 5385 8126 gene locus_tag LOCUS_25710 5385 8126 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027310.1 protein_id gnl|my_center|LOCUS_25710 9075 8359 gene locus_tag LOCUS_25720 9075 8359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_25720 10025 9072 gene locus_tag LOCUS_25730 10025 9072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_25730 10888 10022 gene locus_tag LOCUS_25740 10888 10022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182524933.1 protein_id gnl|my_center|LOCUS_25740 11811 10885 gene locus_tag LOCUS_25750 11811 10885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence153 48 1121 gene locus_tag LOCUS_25760 gene hisC 48 1121 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_25760 1715 1305 gene locus_tag LOCUS_25770 1715 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3031 2105 gene locus_tag LOCUS_25780 gene yedA 3031 2105 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_25780 4441 3095 gene locus_tag LOCUS_25790 4441 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 5879 4602 gene locus_tag LOCUS_25800 gene murA 5879 4602 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_25800 6904 6056 gene locus_tag LOCUS_25810 6904 6056 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_25810 8187 6946 gene locus_tag LOCUS_25820 gene purD 8187 6946 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_25820 8570 9688 gene locus_tag LOCUS_25830 gene corA 8570 9688 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_25830 9934 11130 gene locus_tag LOCUS_25840 9934 11130 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_25840 11151 11345 gene locus_tag LOCUS_25850 11151 11345 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222786.1 protein_id gnl|my_center|LOCUS_25850 <12061 11506 gene locus_tag LOCUS_25860 <12061 11506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063921532.1:glycerophosphodiester phosphodiesterase >Feature sequence154 595 98 gene locus_tag LOCUS_25870 595 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2326 641 gene locus_tag LOCUS_25880 2326 641 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_25880 3372 2458 gene locus_tag LOCUS_25890 gene dapA 3372 2458 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_25890 4246 3926 gene locus_tag LOCUS_25900 4246 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 4360 5097 gene locus_tag LOCUS_25910 4360 5097 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_25910 5150 5824 gene locus_tag LOCUS_25920 gene radC 5150 5824 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_25920 5922 6404 gene locus_tag LOCUS_25930 5922 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 6470 6931 gene locus_tag LOCUS_25940 6470 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 7030 7758 gene locus_tag LOCUS_25950 7030 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 7982 8614 gene locus_tag LOCUS_25960 7982 8614 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229666.1 protein_id gnl|my_center|LOCUS_25960 8750 9190 gene locus_tag LOCUS_25970 8750 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 9968 9345 gene locus_tag LOCUS_25980 9968 9345 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_25980 10936 9965 gene locus_tag LOCUS_25990 10936 9965 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_25990 11887 11114 gene locus_tag LOCUS_26000 11887 11114 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777030.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence155 24 254 gene locus_tag LOCUS_26010 24 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1938 910 gene locus_tag LOCUS_26020 gene purM 1938 910 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_26020 3371 1935 gene locus_tag LOCUS_26030 gene purF 3371 1935 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_26030 3535 4161 gene locus_tag LOCUS_26040 3535 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 5035 4487 gene locus_tag LOCUS_26050 5035 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 5208 5032 gene locus_tag LOCUS_26060 5208 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 6991 5537 gene locus_tag LOCUS_26070 6991 5537 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029787.1 protein_id gnl|my_center|LOCUS_26070 7101 7796 gene locus_tag LOCUS_26080 7101 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 8204 9022 gene locus_tag LOCUS_26090 8204 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 10517 9327 gene locus_tag LOCUS_26100 10517 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence156 <1 2534 gene locus_tag LOCUS_26110 <1 2534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267241.1:non-ribosomal peptide synthetase 3191 2538 gene locus_tag LOCUS_26120 3191 2538 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183580.1 protein_id gnl|my_center|LOCUS_26120 4379 3213 gene locus_tag LOCUS_26130 4379 3213 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_26130 4512 8498 gene locus_tag LOCUS_26140 4512 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 8495 11752 gene locus_tag LOCUS_26150 8495 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence157 330 259 gene locus_tag LOCUS_t00240 330 259 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 432 358 gene locus_tag LOCUS_t00250 432 358 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1165 503 gene locus_tag LOCUS_26160 1165 503 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443162.1 protein_id gnl|my_center|LOCUS_26160 1267 2379 gene locus_tag LOCUS_26170 gene dusB 1267 2379 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_26170 2535 2885 gene locus_tag LOCUS_26180 2535 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 3354 2806 gene locus_tag LOCUS_26190 3354 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3523 4149 gene locus_tag LOCUS_26200 3523 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 4284 6227 gene locus_tag LOCUS_26210 4284 6227 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316996.1 protein_id gnl|my_center|LOCUS_26210 6224 7186 gene locus_tag LOCUS_26220 6224 7186 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_26220 9705 7192 gene locus_tag LOCUS_26230 9705 7192 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_26230 9832 10980 gene locus_tag LOCUS_26240 9832 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 11684 11007 gene locus_tag LOCUS_26250 11684 11007 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223255.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence158 3640 1514 gene locus_tag LOCUS_26260 3640 1514 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_26260 3883 4485 gene locus_tag LOCUS_26270 3883 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 4752 4543 gene locus_tag LOCUS_26280 4752 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 4751 6391 gene locus_tag LOCUS_26290 4751 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 7182 6886 gene locus_tag LOCUS_26300 7182 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 8148 7300 gene locus_tag LOCUS_26310 8148 7300 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_26310 8431 8216 gene locus_tag LOCUS_26320 8431 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 10294 8474 gene locus_tag LOCUS_26330 10294 8474 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_26330 11181 10294 gene locus_tag LOCUS_26340 11181 10294 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence159 1605 22 gene locus_tag LOCUS_26350 1605 22 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227193.1 protein_id gnl|my_center|LOCUS_26350 1713 2309 gene locus_tag LOCUS_26360 1713 2309 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227094.1 protein_id gnl|my_center|LOCUS_26360 3547 2609 gene locus_tag LOCUS_26370 3547 2609 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_26370 3659 4102 gene locus_tag LOCUS_26380 3659 4102 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975419.1 protein_id gnl|my_center|LOCUS_26380 4757 4128 gene locus_tag LOCUS_26390 4757 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026379.1 protein_id gnl|my_center|LOCUS_26390 5863 5138 gene locus_tag LOCUS_26400 5863 5138 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219470533.1 protein_id gnl|my_center|LOCUS_26400 6681 5866 gene locus_tag LOCUS_26410 6681 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 7019 7741 gene locus_tag LOCUS_26420 7019 7741 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_26420 7984 10758 gene locus_tag LOCUS_26430 gene acnA 7984 10758 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_26430 11228 10893 gene locus_tag LOCUS_26440 11228 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 11523 11209 gene locus_tag LOCUS_26450 11523 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence160 2813 1581 gene locus_tag LOCUS_26460 gene cobA 2813 1581 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_26460 4034 2949 gene locus_tag LOCUS_26470 4034 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 5238 4057 gene locus_tag LOCUS_26480 5238 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 6540 5452 gene locus_tag LOCUS_26490 6540 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 6676 7092 gene locus_tag LOCUS_26500 6676 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 7101 8168 gene locus_tag LOCUS_26510 7101 8168 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030976.1 protein_id gnl|my_center|LOCUS_26510 9080 8460 gene locus_tag LOCUS_26520 9080 8460 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_26520 10492 9077 gene locus_tag LOCUS_26530 10492 9077 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_26530 11226 10489 gene locus_tag LOCUS_26540 11226 10489 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence161 40 405 gene locus_tag LOCUS_26550 40 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1825 323 gene locus_tag LOCUS_26560 1825 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222128.1 protein_id gnl|my_center|LOCUS_26560 2283 2029 gene locus_tag LOCUS_26570 2283 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2434 3000 gene locus_tag LOCUS_26580 2434 3000 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_26580 3178 5259 gene locus_tag LOCUS_26590 3178 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 5529 7148 gene locus_tag LOCUS_26600 5529 7148 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 protein_id gnl|my_center|LOCUS_26600 8264 7518 gene locus_tag LOCUS_26610 gene yaaA 8264 7518 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_26610 10797 8344 gene locus_tag LOCUS_26620 gene aceE 10797 8344 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031447.1 protein_id gnl|my_center|LOCUS_26620 10902 11633 gene locus_tag LOCUS_26630 10902 11633 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640437.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence162 620 970 gene locus_tag LOCUS_26640 620 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 967 2586 gene locus_tag LOCUS_26650 gene ubiB 967 2586 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_26650 2691 3023 gene locus_tag LOCUS_26660 2691 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 3894 3271 gene locus_tag LOCUS_26670 3894 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 5722 4100 gene locus_tag LOCUS_26680 5722 4100 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361309.1 protein_id gnl|my_center|LOCUS_26680 6854 5715 gene locus_tag LOCUS_26690 6854 5715 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067010.1 protein_id gnl|my_center|LOCUS_26690 7317 6835 gene locus_tag LOCUS_26700 7317 6835 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966268.1 protein_id gnl|my_center|LOCUS_26700 7673 8716 gene locus_tag LOCUS_26710 7673 8716 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966136.1 protein_id gnl|my_center|LOCUS_26710 8713 11439 gene locus_tag LOCUS_26720 gene rbbA 8713 11439 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence163 88 387 gene locus_tag LOCUS_26730 88 387 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_26730 430 924 gene locus_tag LOCUS_26740 gene rbfA 430 924 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_26740 921 1949 gene locus_tag LOCUS_26750 921 1949 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728486.1 protein_id gnl|my_center|LOCUS_26750 1946 2860 gene locus_tag LOCUS_26760 gene truB 1946 2860 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_26760 3179 4132 gene locus_tag LOCUS_26770 3179 4132 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_26770 4323 4592 gene locus_tag LOCUS_26780 gene rpsO 4323 4592 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_26780 4877 7210 gene locus_tag LOCUS_26790 4877 7210 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_26790 7207 8517 gene locus_tag LOCUS_26800 7207 8517 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_26800 8840 8481 gene locus_tag LOCUS_26810 8840 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 8730 9422 gene locus_tag LOCUS_26820 gene dapB 8730 9422 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_26820 9631 9368 gene locus_tag LOCUS_26830 9631 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 10515 9643 gene locus_tag LOCUS_26840 10515 9643 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_26840 11331 10729 gene locus_tag LOCUS_26850 11331 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence164 1411 1175 gene locus_tag LOCUS_26860 1411 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2016 1411 gene locus_tag LOCUS_26870 2016 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2366 2013 gene locus_tag LOCUS_26880 2366 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 4339 2381 gene locus_tag LOCUS_26890 4339 2381 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_26890 4920 4339 gene locus_tag LOCUS_26900 4920 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 5095 5940 gene locus_tag LOCUS_26910 5095 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 6556 5960 gene locus_tag LOCUS_26920 6556 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 7824 6556 gene locus_tag LOCUS_26930 7824 6556 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_26930 9286 7814 gene locus_tag LOCUS_26940 9286 7814 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940138.1 protein_id gnl|my_center|LOCUS_26940 9804 9580 gene locus_tag LOCUS_26950 9804 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26950 10230 9841 gene locus_tag LOCUS_26960 10230 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26960 10883 10329 gene locus_tag LOCUS_26970 10883 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 11100 10873 gene locus_tag LOCUS_26980 11100 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence165 133 1380 gene locus_tag LOCUS_26990 133 1380 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084375.1 protein_id gnl|my_center|LOCUS_26990 4624 1466 gene locus_tag LOCUS_27000 gene ileS 4624 1466 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_27000 5479 5874 gene locus_tag LOCUS_27010 5479 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 5931 6470 gene locus_tag LOCUS_27020 5931 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 6463 7392 gene locus_tag LOCUS_27030 6463 7392 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_27030 9118 7478 gene locus_tag LOCUS_27040 9118 7478 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027941.1 protein_id gnl|my_center|LOCUS_27040 9272 9643 gene locus_tag LOCUS_27050 9272 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 9761 9958 gene locus_tag LOCUS_27060 9761 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 10021 10794 gene locus_tag LOCUS_27070 10021 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 11048 11476 gene locus_tag LOCUS_27080 11048 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence166 340 2778 gene locus_tag LOCUS_27090 340 2778 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_27090 2799 4079 gene locus_tag LOCUS_27100 2799 4079 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_27100 4076 5323 gene locus_tag LOCUS_27110 4076 5323 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229309.1 protein_id gnl|my_center|LOCUS_27110 5336 5614 gene locus_tag LOCUS_27120 5336 5614 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_27120 5611 8445 gene locus_tag LOCUS_27130 5611 8445 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229307.1 protein_id gnl|my_center|LOCUS_27130 8438 9028 gene locus_tag LOCUS_27140 8438 9028 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 protein_id gnl|my_center|LOCUS_27140 9025 10398 gene locus_tag LOCUS_27150 9025 10398 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_27150 10485 10898 gene locus_tag LOCUS_27160 10485 10898 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083440.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence167 561 1688 gene locus_tag LOCUS_27170 561 1688 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_27170 1825 2847 gene locus_tag LOCUS_27180 1825 2847 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_27180 2869 3870 gene locus_tag LOCUS_27190 2869 3870 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_27190 3945 6566 gene locus_tag LOCUS_27200 3945 6566 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_27200 6692 8440 gene locus_tag LOCUS_27210 6692 8440 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 protein_id gnl|my_center|LOCUS_27210 9727 8444 gene locus_tag LOCUS_27220 9727 8444 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_27220 10700 9762 gene locus_tag LOCUS_27230 gene cofD 10700 9762 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence168 <1 1145 gene locus_tag LOCUS_27240 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803806.1:sugar ABC transporter permease 1142 1981 gene locus_tag LOCUS_27250 1142 1981 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 protein_id gnl|my_center|LOCUS_27250 2035 4965 gene locus_tag LOCUS_27260 2035 4965 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226193.1 protein_id gnl|my_center|LOCUS_27260 7015 5060 gene locus_tag LOCUS_27270 7015 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 7307 7020 gene locus_tag LOCUS_27280 7307 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 8509 7196 gene locus_tag LOCUS_27290 8509 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27290 8931 8497 gene locus_tag LOCUS_27300 8931 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 9132 10637 gene locus_tag LOCUS_27310 9132 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence169 207 1187 gene locus_tag LOCUS_27320 207 1187 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_27320 1562 3241 gene locus_tag LOCUS_27330 1562 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3296 4114 gene locus_tag LOCUS_27340 3296 4114 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031676.1 protein_id gnl|my_center|LOCUS_27340 5508 4216 gene locus_tag LOCUS_27350 gene aceA 5508 4216 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223536.1 protein_id gnl|my_center|LOCUS_27350 5754 7226 gene locus_tag LOCUS_27360 5754 7226 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027490.1 protein_id gnl|my_center|LOCUS_27360 7885 7286 gene locus_tag LOCUS_27370 7885 7286 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029378.1 protein_id gnl|my_center|LOCUS_27370 7997 9202 gene locus_tag LOCUS_27380 7997 9202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112960.1 protein_id gnl|my_center|LOCUS_27380 9237 10202 gene locus_tag LOCUS_27390 9237 10202 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence170 397 654 gene locus_tag LOCUS_27400 397 654 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033875.1 protein_id gnl|my_center|LOCUS_27400 2289 706 gene locus_tag LOCUS_27410 2289 706 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_27410 2686 3528 gene locus_tag LOCUS_27420 2686 3528 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_27420 3543 4679 gene locus_tag LOCUS_27430 3543 4679 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_27430 4676 5926 gene locus_tag LOCUS_27440 gene efeB 4676 5926 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_27440 7884 5950 gene locus_tag LOCUS_27450 7884 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 8994 8002 gene locus_tag LOCUS_27460 gene meaB 8994 8002 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_27460 11126 8991 gene locus_tag LOCUS_27470 gene scpA 11126 8991 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence171 396 94 gene locus_tag LOCUS_27480 396 94 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878457.1 protein_id gnl|my_center|LOCUS_27480 1235 396 gene locus_tag LOCUS_27490 1235 396 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_27490 1642 1232 gene locus_tag LOCUS_27500 1642 1232 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_27500 2252 1815 gene locus_tag LOCUS_27510 2252 1815 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_27510 3194 2319 gene locus_tag LOCUS_27520 3194 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 3703 3191 gene locus_tag LOCUS_27530 3703 3191 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_27530 4445 3765 gene locus_tag LOCUS_27540 4445 3765 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230718.1 protein_id gnl|my_center|LOCUS_27540 4837 4589 gene locus_tag LOCUS_27550 4837 4589 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_27550 5087 5800 gene locus_tag LOCUS_27560 gene glnR 5087 5800 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_27560 7633 5849 gene locus_tag LOCUS_27570 7633 5849 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230897.1 protein_id gnl|my_center|LOCUS_27570 7764 8666 gene locus_tag LOCUS_27580 gene mshD 7764 8666 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_27580 8308 8379 gene locus_tag LOCUS_t00260 8308 8379 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9722 8724 gene locus_tag LOCUS_27590 gene pitH 9722 8724 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_27590 10340 9723 gene locus_tag LOCUS_27600 10340 9723 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_27600 11072 10497 gene locus_tag LOCUS_27610 gene dcd 11072 10497 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_27610 11193 11264 gene locus_tag LOCUS_t00270 11193 11264 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence172 333 1091 gene locus_tag LOCUS_27620 gene fabG 333 1091 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_27620 1651 1265 gene locus_tag LOCUS_27630 1651 1265 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_27630 2699 1755 gene locus_tag LOCUS_27640 2699 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 protein_id gnl|my_center|LOCUS_27640 4326 2797 gene locus_tag LOCUS_27650 4326 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 4797 4402 gene locus_tag LOCUS_27660 4797 4402 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259066.1 protein_id gnl|my_center|LOCUS_27660 5765 4803 gene locus_tag LOCUS_27670 5765 4803 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060315.1 protein_id gnl|my_center|LOCUS_27670 6552 5755 gene locus_tag LOCUS_27680 gene cysW 6552 5755 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_27680 7357 6545 gene locus_tag LOCUS_27690 gene cysT 7357 6545 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895898.1 protein_id gnl|my_center|LOCUS_27690 8378 7365 gene locus_tag LOCUS_27700 8378 7365 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 protein_id gnl|my_center|LOCUS_27700 8625 9734 gene locus_tag LOCUS_27710 8625 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 11155 9740 gene locus_tag LOCUS_27720 11155 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence173 252 785 gene locus_tag LOCUS_27730 252 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27730 1018 2442 gene locus_tag LOCUS_27740 1018 2442 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869905.1 protein_id gnl|my_center|LOCUS_27740 3137 2790 gene locus_tag LOCUS_27750 3137 2790 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975241.1 protein_id gnl|my_center|LOCUS_27750 4294 3239 gene locus_tag LOCUS_27760 4294 3239 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_27760 4402 5757 gene locus_tag LOCUS_27770 4402 5757 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485197.1 protein_id gnl|my_center|LOCUS_27770 5763 6986 gene locus_tag LOCUS_27780 5763 6986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031197.1 protein_id gnl|my_center|LOCUS_27780 7211 7137 gene locus_tag LOCUS_t00280 7211 7137 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7807 7349 gene locus_tag LOCUS_27790 7807 7349 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_27790 8017 8139 gene locus_tag LOCUS_27800 8017 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 8762 8166 gene locus_tag LOCUS_27810 8762 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 8970 9383 gene locus_tag LOCUS_27820 8970 9383 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225419.1 protein_id gnl|my_center|LOCUS_27820 9392 9760 gene locus_tag LOCUS_27830 9392 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 9784 10257 gene locus_tag LOCUS_27840 9784 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 10841 10209 gene locus_tag LOCUS_27850 10841 10209 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030265.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence174 1390 62 gene locus_tag LOCUS_27860 1390 62 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_27860 2655 1393 gene locus_tag LOCUS_27870 2655 1393 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_27870 2791 3297 gene locus_tag LOCUS_27880 2791 3297 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_27880 3294 4043 gene locus_tag LOCUS_27890 3294 4043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_27890 4075 6348 gene locus_tag LOCUS_27900 4075 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 7043 6453 gene locus_tag LOCUS_27910 7043 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 8922 7189 gene locus_tag LOCUS_27920 gene treS 8922 7189 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_27920 11165 9477 gene locus_tag LOCUS_27930 11165 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence175 <1 1749 gene locus_tag LOCUS_27940 <1 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028132.1:cell division protein FtsI 1757 3403 gene locus_tag LOCUS_27950 1757 3403 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_27950 3467 4834 gene locus_tag LOCUS_27960 3467 4834 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_27960 4831 5907 gene locus_tag LOCUS_27970 gene mraY 4831 5907 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_27970 5904 7265 gene locus_tag LOCUS_27980 gene murD 5904 7265 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_27980 7262 8698 gene locus_tag LOCUS_27990 gene ftsW 7262 8698 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_27990 8695 9774 gene locus_tag LOCUS_28000 gene murG 8695 9774 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_28000 9771 11195 gene locus_tag LOCUS_28010 gene murC 9771 11195 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence176 904 98 gene locus_tag LOCUS_28020 904 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_28020 1456 995 gene locus_tag LOCUS_28030 1456 995 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_28030 1608 1456 gene locus_tag LOCUS_28040 1608 1456 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855791.1 protein_id gnl|my_center|LOCUS_28040 2181 3221 gene locus_tag LOCUS_28050 2181 3221 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_28050 3259 4398 gene locus_tag LOCUS_28060 3259 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 4797 4501 gene locus_tag LOCUS_28070 gene wblA 4797 4501 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_28070 5133 7328 gene locus_tag LOCUS_28080 5133 7328 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_28080 7834 7379 gene locus_tag LOCUS_28090 7834 7379 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_28090 7915 8847 gene locus_tag LOCUS_28100 7915 8847 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 protein_id gnl|my_center|LOCUS_28100 8883 8957 gene locus_tag LOCUS_t00290 8883 8957 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9447 9025 gene locus_tag LOCUS_28110 9447 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 9422 9844 gene locus_tag LOCUS_28120 9422 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 11054 10266 gene locus_tag LOCUS_28130 11054 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence177 243 899 gene locus_tag LOCUS_28140 243 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 940 2610 gene locus_tag LOCUS_28150 940 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2634 3875 gene locus_tag LOCUS_28160 2634 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 3923 4471 gene locus_tag LOCUS_28170 gene def 3923 4471 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_28170 4471 5400 gene locus_tag LOCUS_28180 gene fmt 4471 5400 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_28180 5530 7026 gene locus_tag LOCUS_28190 5530 7026 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_28190 7143 7814 gene locus_tag LOCUS_28200 gene rpe 7143 7814 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_28200 8995 7964 gene locus_tag LOCUS_28210 8995 7964 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_28210 10056 8992 gene locus_tag LOCUS_28220 10056 8992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_28220 <11117 10097 gene locus_tag LOCUS_28230 <11117 10097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973863.1:ABC transporter permease subunit >Feature sequence178 1249 305 gene locus_tag LOCUS_28240 1249 305 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_28240 1299 1913 gene locus_tag LOCUS_28250 1299 1913 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971593.1 protein_id gnl|my_center|LOCUS_28250 3137 1944 gene locus_tag LOCUS_28260 3137 1944 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_28260 4996 3272 gene locus_tag LOCUS_28270 4996 3272 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_28270 5178 7562 gene locus_tag LOCUS_28280 5178 7562 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_28280 7994 7617 gene locus_tag LOCUS_28290 7994 7617 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224722.1 protein_id gnl|my_center|LOCUS_28290 8883 8212 gene locus_tag LOCUS_28300 8883 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 10426 9527 gene locus_tag LOCUS_28310 10426 9527 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222841.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence179 1325 39 gene locus_tag LOCUS_28320 gene nuoF 1325 39 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_28320 1993 1322 gene locus_tag LOCUS_28330 1993 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 3333 1990 gene locus_tag LOCUS_28340 3333 1990 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_28340 4021 3356 gene locus_tag LOCUS_28350 4021 3356 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_28350 4569 4018 gene locus_tag LOCUS_28360 4569 4018 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416420.1 protein_id gnl|my_center|LOCUS_28360 4931 4572 gene locus_tag LOCUS_28370 4931 4572 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_28370 6327 5056 gene locus_tag LOCUS_28380 6327 5056 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_28380 7193 6471 gene locus_tag LOCUS_28390 7193 6471 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_28390 7295 8539 gene locus_tag LOCUS_28400 7295 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 8745 8536 gene locus_tag LOCUS_28410 8745 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 9005 9226 gene locus_tag LOCUS_28420 9005 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 9583 9338 gene locus_tag LOCUS_28430 9583 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 10567 9584 gene locus_tag LOCUS_28440 10567 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 10674 11003 gene locus_tag LOCUS_28450 10674 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence180 155 1177 gene locus_tag LOCUS_28460 155 1177 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_28460 1174 2046 gene locus_tag LOCUS_28470 1174 2046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_28470 2199 2906 gene locus_tag LOCUS_28480 2199 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2978 3241 gene locus_tag LOCUS_28490 2978 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3238 3576 gene locus_tag LOCUS_28500 3238 3576 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284194.1 protein_id gnl|my_center|LOCUS_28500 3728 3594 gene locus_tag LOCUS_28510 3728 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 3988 3725 gene locus_tag LOCUS_28520 3988 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 4712 4044 gene locus_tag LOCUS_28530 4712 4044 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730508.1 protein_id gnl|my_center|LOCUS_28530 7432 4709 gene locus_tag LOCUS_28540 7432 4709 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_28540 8296 7439 gene locus_tag LOCUS_28550 8296 7439 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 protein_id gnl|my_center|LOCUS_28550 10386 8296 gene locus_tag LOCUS_28560 gene kdpB 10386 8296 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 protein_id gnl|my_center|LOCUS_28560 <10986 10383 gene locus_tag LOCUS_28570 <10986 10383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730504.1:potassium-transporting ATPase subunit KdpA >Feature sequence181 1038 91 gene locus_tag LOCUS_28580 1038 91 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_28580 3878 1035 gene locus_tag LOCUS_28590 3878 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 4020 5201 gene locus_tag LOCUS_28600 4020 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467860.1 protein_id gnl|my_center|LOCUS_28600 5793 5224 gene locus_tag LOCUS_28610 5793 5224 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087829.1 protein_id gnl|my_center|LOCUS_28610 6491 5793 gene locus_tag LOCUS_28620 6491 5793 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972704.1 protein_id gnl|my_center|LOCUS_28620 6684 6971 gene locus_tag LOCUS_28630 6684 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 8195 7155 gene locus_tag LOCUS_28640 8195 7155 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222043.1 protein_id gnl|my_center|LOCUS_28640 8971 8192 gene locus_tag LOCUS_28650 8971 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence182 510 3413 gene locus_tag LOCUS_28660 510 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224774.1 protein_id gnl|my_center|LOCUS_28660 3423 4814 gene locus_tag LOCUS_28670 3423 4814 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_28670 4882 5655 gene locus_tag LOCUS_28680 4882 5655 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_28680 5640 7544 gene locus_tag LOCUS_28690 5640 7544 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027517.1 protein_id gnl|my_center|LOCUS_28690 7621 8958 gene locus_tag LOCUS_28700 7621 8958 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_28700 10354 8969 gene locus_tag LOCUS_28710 10354 8969 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence183 <1 973 gene locus_tag LOCUS_28720 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028061.1:uridine diphosphate-N-acetylglucosamine-binding protein YvcK 974 2017 gene locus_tag LOCUS_28730 gene whiA 974 2017 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_28730 2393 3496 gene locus_tag LOCUS_28740 gene gap 2393 3496 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_28740 3496 4683 gene locus_tag LOCUS_28750 3496 4683 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_28750 4684 5463 gene locus_tag LOCUS_28760 gene tpiA 4684 5463 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_28760 5613 5843 gene locus_tag LOCUS_28770 5613 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 5919 6266 gene locus_tag LOCUS_28780 5919 6266 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_28780 8015 6408 gene locus_tag LOCUS_28790 8015 6408 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 protein_id gnl|my_center|LOCUS_28790 9510 8113 gene locus_tag LOCUS_28800 9510 8113 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_28800 9706 10776 gene locus_tag LOCUS_28810 9706 10776 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence184 1 753 gene locus_tag LOCUS_28820 1 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 1046 2248 gene locus_tag LOCUS_28830 1046 2248 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 protein_id gnl|my_center|LOCUS_28830 3250 2963 gene locus_tag LOCUS_28840 3250 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3706 3413 gene locus_tag LOCUS_28850 3706 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3947 3720 gene locus_tag LOCUS_28860 3947 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 4816 5529 gene locus_tag LOCUS_28870 4816 5529 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031806.1 protein_id gnl|my_center|LOCUS_28870 6301 5600 gene locus_tag LOCUS_28880 6301 5600 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978444.1 protein_id gnl|my_center|LOCUS_28880 7641 6298 gene locus_tag LOCUS_28890 7641 6298 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027103.1 protein_id gnl|my_center|LOCUS_28890 9972 7648 gene locus_tag LOCUS_28900 9972 7648 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_28900 10495 10265 gene locus_tag LOCUS_28910 10495 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence185 523 1824 gene locus_tag LOCUS_28920 523 1824 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_28920 1908 2867 gene locus_tag LOCUS_28930 1908 2867 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224315.1 protein_id gnl|my_center|LOCUS_28930 2860 3675 gene locus_tag LOCUS_28940 2860 3675 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_28940 3717 5063 gene locus_tag LOCUS_28950 3717 5063 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_28950 5141 6136 gene locus_tag LOCUS_28960 5141 6136 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_28960 7336 6140 gene locus_tag LOCUS_28970 7336 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 protein_id gnl|my_center|LOCUS_28970 7725 7339 gene locus_tag LOCUS_28980 7725 7339 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031756.1 protein_id gnl|my_center|LOCUS_28980 8989 7739 gene locus_tag LOCUS_28990 8989 7739 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 protein_id gnl|my_center|LOCUS_28990 10012 9098 gene locus_tag LOCUS_29000 10012 9098 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004530.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence186 1136 417 gene locus_tag LOCUS_29010 gene ureG 1136 417 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 protein_id gnl|my_center|LOCUS_29010 1931 1170 gene locus_tag LOCUS_29020 1931 1170 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230174.1 protein_id gnl|my_center|LOCUS_29020 3651 1933 gene locus_tag LOCUS_29030 3651 1933 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 protein_id gnl|my_center|LOCUS_29030 3988 3644 gene locus_tag LOCUS_29040 3988 3644 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_29040 4287 3985 gene locus_tag LOCUS_29050 4287 3985 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409305.1 protein_id gnl|my_center|LOCUS_29050 4499 5692 gene locus_tag LOCUS_29060 gene urtA 4499 5692 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 protein_id gnl|my_center|LOCUS_29060 5757 6611 gene locus_tag LOCUS_29070 gene urtB 5757 6611 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_29070 6608 7672 gene locus_tag LOCUS_29080 gene urtC 6608 7672 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 protein_id gnl|my_center|LOCUS_29080 7669 8430 gene locus_tag LOCUS_29090 gene urtD 7669 8430 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 protein_id gnl|my_center|LOCUS_29090 8417 9109 gene locus_tag LOCUS_29100 gene urtE 8417 9109 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_29100 9414 9262 gene locus_tag LOCUS_29110 9414 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 9619 9476 gene locus_tag LOCUS_29120 9619 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 10035 9616 gene locus_tag LOCUS_29130 10035 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 <10721 10205 gene locus_tag LOCUS_29140 <10721 10205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226021.1:MFS transporter >Feature sequence187 1211 3 gene locus_tag LOCUS_29150 1211 3 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107493.1 protein_id gnl|my_center|LOCUS_29150 2348 1215 gene locus_tag LOCUS_29160 gene sfnG 2348 1215 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730592.1 protein_id gnl|my_center|LOCUS_29160 3463 2543 gene locus_tag LOCUS_29170 3463 2543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943414.1 protein_id gnl|my_center|LOCUS_29170 3616 4839 gene locus_tag LOCUS_29180 3616 4839 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188478.1 protein_id gnl|my_center|LOCUS_29180 5834 4845 gene locus_tag LOCUS_29190 5834 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6907 6029 gene locus_tag LOCUS_29200 6907 6029 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_29200 7003 7821 gene locus_tag LOCUS_29210 7003 7821 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_29210 7818 8519 gene locus_tag LOCUS_29220 7818 8519 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_29220 8529 9092 gene locus_tag LOCUS_29230 8529 9092 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_29230 9139 9900 gene locus_tag LOCUS_29240 9139 9900 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence188 <1 609 gene locus_tag LOCUS_29250 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037666770.1:glycosyltransferase family 4 protein 890 1918 gene locus_tag LOCUS_29260 890 1918 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_29260 2123 2716 gene locus_tag LOCUS_29270 2123 2716 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_29270 2751 3542 gene locus_tag LOCUS_29280 gene pssA 2751 3542 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_29280 3641 3937 gene locus_tag LOCUS_29290 3641 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 5123 4023 gene locus_tag LOCUS_29300 gene menC 5123 4023 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_29300 5934 5290 gene locus_tag LOCUS_29310 5934 5290 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227876.1 protein_id gnl|my_center|LOCUS_29310 6764 5931 gene locus_tag LOCUS_29320 6764 5931 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222689.1 protein_id gnl|my_center|LOCUS_29320 7076 9874 gene locus_tag LOCUS_29330 gene uvrA 7076 9874 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_29330 10035 10472 gene locus_tag LOCUS_29340 10035 10472 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence189 2106 376 gene locus_tag LOCUS_29350 2106 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3192 2197 gene locus_tag LOCUS_29360 3192 2197 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_29360 4757 3204 gene locus_tag LOCUS_29370 gene nuoN 4757 3204 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_29370 6262 4754 gene locus_tag LOCUS_29380 6262 4754 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_29380 8160 6262 gene locus_tag LOCUS_29390 gene nuoL 8160 6262 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_29390 8466 8170 gene locus_tag LOCUS_29400 gene nuoK 8466 8170 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_29400 9380 8463 gene locus_tag LOCUS_29410 9380 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 9888 9373 gene locus_tag LOCUS_29420 gene nuoI 9888 9373 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_29420 <10615 9875 gene locus_tag LOCUS_29430 <10615 9875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029736.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence190 1452 487 gene locus_tag LOCUS_29440 1452 487 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 protein_id gnl|my_center|LOCUS_29440 2679 1717 gene locus_tag LOCUS_29450 2679 1717 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_29450 3307 2834 gene locus_tag LOCUS_29460 3307 2834 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 protein_id gnl|my_center|LOCUS_29460 3399 3680 gene locus_tag LOCUS_29470 3399 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 4312 4187 gene locus_tag LOCUS_29480 4312 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 5414 4809 gene locus_tag LOCUS_29490 5414 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 5595 5819 gene locus_tag LOCUS_29500 5595 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 6901 5858 gene locus_tag LOCUS_29510 6901 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 7833 6898 gene locus_tag LOCUS_29520 7833 6898 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973039.1 protein_id gnl|my_center|LOCUS_29520 8618 7830 gene locus_tag LOCUS_29530 8618 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29530 9490 8615 gene locus_tag LOCUS_29540 9490 8615 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312137.1 protein_id gnl|my_center|LOCUS_29540 <10601 9487 gene locus_tag LOCUS_29550 <10601 9487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096543.1:ABC transporter permease >Feature sequence191 823 44 gene locus_tag LOCUS_29560 gene pgl 823 44 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_29560 1743 820 gene locus_tag LOCUS_29570 gene opcA 1743 820 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_29570 3451 1799 gene locus_tag LOCUS_29580 gene zwf 3451 1799 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_29580 5117 3498 gene locus_tag LOCUS_29590 5117 3498 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_29590 6228 5125 gene locus_tag LOCUS_29600 gene tal 6228 5125 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_29600 8271 6238 gene locus_tag LOCUS_29610 gene tkt 8271 6238 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_29610 8176 8502 gene locus_tag LOCUS_29620 8176 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 8594 9547 gene locus_tag LOCUS_29630 8594 9547 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence192 <1 1353 gene locus_tag LOCUS_29640 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229919.1:S8 family serine peptidase 1429 1845 gene locus_tag LOCUS_29650 1429 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 2146 3579 gene locus_tag LOCUS_29660 gene pyk 2146 3579 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_29660 3725 5509 gene locus_tag LOCUS_29670 3725 5509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_29670 5594 7579 gene locus_tag LOCUS_29680 5594 7579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_29680 8132 7647 gene locus_tag LOCUS_29690 8132 7647 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222286.1 protein_id gnl|my_center|LOCUS_29690 9585 8317 gene locus_tag LOCUS_29700 9585 8317 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978156.1 protein_id gnl|my_center|LOCUS_29700 <10555 9546 gene locus_tag LOCUS_29710 <10555 9546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027307.1:branched-chain amino acid ABC transporter permease >Feature sequence193 410 48 gene locus_tag LOCUS_29720 410 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 2792 420 gene locus_tag LOCUS_29730 2792 420 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228212.1 protein_id gnl|my_center|LOCUS_29730 4399 2948 gene locus_tag LOCUS_29740 4399 2948 CDS product arabinofuranosidase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225158.1 protein_id gnl|my_center|LOCUS_29740 4676 5152 gene locus_tag LOCUS_29750 4676 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 5960 5220 gene locus_tag LOCUS_29760 5960 5220 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190909.1 protein_id gnl|my_center|LOCUS_29760 6382 8817 gene locus_tag LOCUS_29770 6382 8817 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225154.1 protein_id gnl|my_center|LOCUS_29770 9184 9002 gene locus_tag LOCUS_29780 9184 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 9111 10439 gene locus_tag LOCUS_29790 9111 10439 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226624.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence194 54 130 gene locus_tag LOCUS_t00300 54 130 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 224 1753 gene locus_tag LOCUS_29800 224 1753 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731180.1 protein_id gnl|my_center|LOCUS_29800 1873 3132 gene locus_tag LOCUS_29810 1873 3132 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_29810 3234 4352 gene locus_tag LOCUS_29820 3234 4352 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_29820 4349 5896 gene locus_tag LOCUS_29830 4349 5896 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972709.1 protein_id gnl|my_center|LOCUS_29830 5914 7536 gene locus_tag LOCUS_29840 5914 7536 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096544.1 protein_id gnl|my_center|LOCUS_29840 7539 8555 gene locus_tag LOCUS_29850 7539 8555 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096543.1 protein_id gnl|my_center|LOCUS_29850 8552 9409 gene locus_tag LOCUS_29860 8552 9409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence195 209 1099 gene locus_tag LOCUS_29870 209 1099 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_29870 1199 1675 gene locus_tag LOCUS_29880 1199 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1853 2161 gene locus_tag LOCUS_29890 1853 2161 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 protein_id gnl|my_center|LOCUS_29890 2929 2198 gene locus_tag LOCUS_29900 2929 2198 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949618.1 protein_id gnl|my_center|LOCUS_29900 3916 3011 gene locus_tag LOCUS_29910 3916 3011 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 protein_id gnl|my_center|LOCUS_29910 5219 4122 gene locus_tag LOCUS_29920 5219 4122 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975284.1 protein_id gnl|my_center|LOCUS_29920 5381 6034 gene locus_tag LOCUS_29930 5381 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 6012 6218 gene locus_tag LOCUS_29940 6012 6218 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_29940 6215 7483 gene locus_tag LOCUS_29950 6215 7483 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_29950 10231 7616 gene locus_tag LOCUS_29960 10231 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584087.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence196 1133 138 gene locus_tag LOCUS_29970 1133 138 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_29970 3367 1139 gene locus_tag LOCUS_29980 3367 1139 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_29980 4719 3778 gene locus_tag LOCUS_29990 4719 3778 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529611.1 protein_id gnl|my_center|LOCUS_29990 6060 4840 gene locus_tag LOCUS_30000 6060 4840 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_30000 6677 6078 gene locus_tag LOCUS_30010 gene folE 6677 6078 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_30010 6888 7577 gene locus_tag LOCUS_30020 6888 7577 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971473.1 protein_id gnl|my_center|LOCUS_30020 9457 7640 gene locus_tag LOCUS_30030 gene glmS 9457 7640 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_30030 9741 9466 gene locus_tag LOCUS_30040 9741 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 protein_id gnl|my_center|LOCUS_30040 >Feature sequence197 1 1236 gene locus_tag LOCUS_30050 1 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1376 2728 gene locus_tag LOCUS_30060 1376 2728 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871940.1 protein_id gnl|my_center|LOCUS_30060 2803 3687 gene locus_tag LOCUS_30070 2803 3687 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385217.1 protein_id gnl|my_center|LOCUS_30070 3684 4514 gene locus_tag LOCUS_30080 3684 4514 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_30080 5872 4577 gene locus_tag LOCUS_30090 5872 4577 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618218.1 protein_id gnl|my_center|LOCUS_30090 7536 5995 gene locus_tag LOCUS_30100 7536 5995 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_30100 8467 7643 gene locus_tag LOCUS_30110 8467 7643 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_30110 9148 8492 gene locus_tag LOCUS_30120 9148 8492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027847.1 protein_id gnl|my_center|LOCUS_30120 10089 9145 gene locus_tag LOCUS_30130 10089 9145 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence198 1334 21 gene locus_tag LOCUS_30140 1334 21 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_30140 1835 2410 gene locus_tag LOCUS_30150 1835 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2721 3923 gene locus_tag LOCUS_30160 2721 3923 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_30160 3937 4749 gene locus_tag LOCUS_30170 3937 4749 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950942.1 protein_id gnl|my_center|LOCUS_30170 4830 5993 gene locus_tag LOCUS_30180 4830 5993 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_30180 6292 6047 gene locus_tag LOCUS_30190 6292 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 6182 7255 gene locus_tag LOCUS_30200 6182 7255 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_30200 7738 7274 gene locus_tag LOCUS_30210 7738 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 8605 8048 gene locus_tag LOCUS_30220 8605 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 8968 9912 gene locus_tag LOCUS_30230 8968 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence199 813 2483 gene locus_tag LOCUS_30240 813 2483 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_30240 2480 3109 gene locus_tag LOCUS_30250 2480 3109 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_30250 3145 4083 gene locus_tag LOCUS_30260 gene xerD 3145 4083 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_30260 4209 5069 gene locus_tag LOCUS_30270 4209 5069 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_30270 5115 5990 gene locus_tag LOCUS_30280 5115 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 6092 6802 gene locus_tag LOCUS_30290 gene scpB 6092 6802 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_30290 6802 8265 gene locus_tag LOCUS_30300 6802 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 8375 8734 gene locus_tag LOCUS_30310 gene aroH 8375 8734 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_30310 8855 9949 gene locus_tag LOCUS_30320 8855 9949 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence200 180 509 gene locus_tag LOCUS_30330 180 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 677 2062 gene locus_tag LOCUS_30340 677 2062 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_30340 3154 2147 gene locus_tag LOCUS_30350 3154 2147 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_30350 3358 4629 gene locus_tag LOCUS_30360 3358 4629 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225265.1 protein_id gnl|my_center|LOCUS_30360 4638 5525 gene locus_tag LOCUS_30370 4638 5525 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225266.1 protein_id gnl|my_center|LOCUS_30370 5522 6304 gene locus_tag LOCUS_30380 5522 6304 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225267.1 protein_id gnl|my_center|LOCUS_30380 6297 8036 gene locus_tag LOCUS_30390 6297 8036 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803839.1 protein_id gnl|my_center|LOCUS_30390 >Feature sequence201 64 678 gene locus_tag LOCUS_30400 64 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 1058 792 gene locus_tag LOCUS_30410 1058 792 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_30410 1448 1206 gene locus_tag LOCUS_30420 1448 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 1599 2231 gene locus_tag LOCUS_30430 1599 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 2262 3107 gene locus_tag LOCUS_30440 2262 3107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226851.1 protein_id gnl|my_center|LOCUS_30440 3080 3847 gene locus_tag LOCUS_30450 3080 3847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226850.1 protein_id gnl|my_center|LOCUS_30450 3844 4836 gene locus_tag LOCUS_30460 3844 4836 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026153082.1 protein_id gnl|my_center|LOCUS_30460 4833 5966 gene locus_tag LOCUS_30470 4833 5966 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 protein_id gnl|my_center|LOCUS_30470 6438 5989 gene locus_tag LOCUS_30480 6438 5989 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805205.1 protein_id gnl|my_center|LOCUS_30480 7031 6561 gene locus_tag LOCUS_30490 gene ribH 7031 6561 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224642.1 protein_id gnl|my_center|LOCUS_30490 8397 7138 gene locus_tag LOCUS_30500 8397 7138 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_30500 9091 8456 gene locus_tag LOCUS_30510 9091 8456 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977383.1 protein_id gnl|my_center|LOCUS_30510 9696 9088 gene locus_tag LOCUS_30520 9696 9088 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_30520 10065 9697 gene locus_tag LOCUS_30530 10065 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence202 206 1270 gene locus_tag LOCUS_30540 206 1270 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462165.1 protein_id gnl|my_center|LOCUS_30540 2839 1313 gene locus_tag LOCUS_30550 2839 1313 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223342.1 protein_id gnl|my_center|LOCUS_30550 3252 3731 gene locus_tag LOCUS_30560 3252 3731 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293639.1 protein_id gnl|my_center|LOCUS_30560 3816 4718 gene locus_tag LOCUS_30570 3816 4718 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876665.1 protein_id gnl|my_center|LOCUS_30570 7196 4791 gene locus_tag LOCUS_30580 7196 4791 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027316.1 protein_id gnl|my_center|LOCUS_30580 7936 7193 gene locus_tag LOCUS_30590 7936 7193 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417961.1 protein_id gnl|my_center|LOCUS_30590 8092 9279 gene locus_tag LOCUS_30600 8092 9279 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence203 1005 2009 gene locus_tag LOCUS_30610 1005 2009 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_30610 2924 2031 gene locus_tag LOCUS_30620 2924 2031 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776639.1 protein_id gnl|my_center|LOCUS_30620 3814 2921 gene locus_tag LOCUS_30630 3814 2921 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776638.1 protein_id gnl|my_center|LOCUS_30630 5158 3887 gene locus_tag LOCUS_30640 5158 3887 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_30640 5390 7294 gene locus_tag LOCUS_30650 5390 7294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_30650 7877 7479 gene locus_tag LOCUS_30660 7877 7479 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224170.1 protein_id gnl|my_center|LOCUS_30660 8038 8958 gene locus_tag LOCUS_30670 8038 8958 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031422.1 protein_id gnl|my_center|LOCUS_30670 9077 9391 gene locus_tag LOCUS_30680 9077 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence204 <1 564 gene locus_tag LOCUS_30690 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230157.1:Uma2 family endonuclease 714 872 gene locus_tag LOCUS_30700 714 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 2819 939 gene locus_tag LOCUS_30710 2819 939 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_30710 4242 2857 gene locus_tag LOCUS_30720 4242 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 5054 4242 gene locus_tag LOCUS_30730 5054 4242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_30730 5850 5119 gene locus_tag LOCUS_30740 5850 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 6491 7030 gene locus_tag LOCUS_30750 6491 7030 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 protein_id gnl|my_center|LOCUS_30750 7017 7766 gene locus_tag LOCUS_30760 7017 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 8858 7833 gene locus_tag LOCUS_30770 8858 7833 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_30770 8927 9427 gene locus_tag LOCUS_30780 8927 9427 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence205 43 1335 gene locus_tag LOCUS_30790 43 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 1592 1356 gene locus_tag LOCUS_30800 1592 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 1663 2487 gene locus_tag LOCUS_30810 1663 2487 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902372.1 protein_id gnl|my_center|LOCUS_30810 2521 4095 gene locus_tag LOCUS_30820 gene mdlC 2521 4095 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089983.1 protein_id gnl|my_center|LOCUS_30820 4092 6641 gene locus_tag LOCUS_30830 4092 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 6685 7026 gene locus_tag LOCUS_30840 6685 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 7037 9148 gene locus_tag LOCUS_30850 gene glgX 7037 9148 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_30850 9155 9490 gene locus_tag LOCUS_30860 gene spoIIAA 9155 9490 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 protein_id gnl|my_center|LOCUS_30860 9541 9918 gene locus_tag LOCUS_30870 9541 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence206 471 1226 gene locus_tag LOCUS_30880 471 1226 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726679.1 protein_id gnl|my_center|LOCUS_30880 1251 1787 gene locus_tag LOCUS_30890 1251 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 2601 1777 gene locus_tag LOCUS_30900 2601 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_30900 4134 2647 gene locus_tag LOCUS_30910 4134 2647 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_30910 5570 4197 gene locus_tag LOCUS_30920 gene phoD 5570 4197 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_30920 5708 6385 gene locus_tag LOCUS_30930 5708 6385 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064806.1 protein_id gnl|my_center|LOCUS_30930 6382 7065 gene locus_tag LOCUS_30940 6382 7065 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_30940 7712 7047 gene locus_tag LOCUS_30950 7712 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence207 2076 1663 gene locus_tag LOCUS_30960 2076 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 2086 2415 gene locus_tag LOCUS_30970 2086 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 2699 3988 gene locus_tag LOCUS_30980 2699 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 5126 4311 gene locus_tag LOCUS_30990 5126 4311 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_30990 5346 6239 gene locus_tag LOCUS_31000 5346 6239 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_31000 7932 6247 gene locus_tag LOCUS_31010 gene polX 7932 6247 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_31010 8858 7938 gene locus_tag LOCUS_31020 8858 7938 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225228.1 protein_id gnl|my_center|LOCUS_31020 9465 8881 gene locus_tag LOCUS_31030 9465 8881 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence208 1637 153 gene locus_tag LOCUS_31040 1637 153 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_31040 1807 2382 gene locus_tag LOCUS_31050 1807 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 3238 2540 gene locus_tag LOCUS_31060 3238 2540 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731464.1 protein_id gnl|my_center|LOCUS_31060 3345 4799 gene locus_tag LOCUS_31070 gene hpaE 3345 4799 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064546.1 protein_id gnl|my_center|LOCUS_31070 4792 5733 gene locus_tag LOCUS_31080 4792 5733 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 protein_id gnl|my_center|LOCUS_31080 5733 6578 gene locus_tag LOCUS_31090 5733 6578 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009485356.1 protein_id gnl|my_center|LOCUS_31090 6592 6780 gene locus_tag LOCUS_31100 6592 6780 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 protein_id gnl|my_center|LOCUS_31100 6747 7976 gene locus_tag LOCUS_31110 6747 7976 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_31110 8006 9430 gene locus_tag LOCUS_31120 8006 9430 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence209 294 79 gene locus_tag LOCUS_31130 294 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 664 843 gene locus_tag LOCUS_31140 664 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 961 1479 gene locus_tag LOCUS_31150 961 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1476 1982 gene locus_tag LOCUS_31160 1476 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 2410 5889 gene locus_tag LOCUS_31170 gene rpoB 2410 5889 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_31170 5909 9784 gene locus_tag LOCUS_31180 5909 9784 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence210 845 81 gene locus_tag LOCUS_31190 gene fabI 845 81 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_31190 1599 895 gene locus_tag LOCUS_31200 gene fabG 1599 895 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_31200 1677 3170 gene locus_tag LOCUS_31210 1677 3170 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_31210 3167 4549 gene locus_tag LOCUS_31220 3167 4549 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_31220 5630 4608 gene locus_tag LOCUS_31230 5630 4608 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_31230 5873 6715 gene locus_tag LOCUS_31240 5873 6715 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728224.1 protein_id gnl|my_center|LOCUS_31240 6958 6743 gene locus_tag LOCUS_31250 6958 6743 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_31250 7093 7368 gene locus_tag LOCUS_31260 7093 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 7937 7680 gene locus_tag LOCUS_31270 7937 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31270 8563 7949 gene locus_tag LOCUS_31280 8563 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31280 9592 8603 gene locus_tag LOCUS_31290 gene moaA 9592 8603 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence211 355 825 gene locus_tag LOCUS_31300 355 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 2716 1031 gene locus_tag LOCUS_31310 2716 1031 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_31310 3798 2881 gene locus_tag LOCUS_31320 3798 2881 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028273.1 protein_id gnl|my_center|LOCUS_31320 4131 3865 gene locus_tag LOCUS_31330 4131 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 5334 4246 gene locus_tag LOCUS_31340 5334 4246 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_31340 5522 6241 gene locus_tag LOCUS_31350 5522 6241 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030160.1 protein_id gnl|my_center|LOCUS_31350 7263 6835 gene locus_tag LOCUS_31360 7263 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 8343 7477 gene locus_tag LOCUS_31370 8343 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_31370 8478 9593 gene locus_tag LOCUS_31380 8478 9593 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228727.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence212 957 100 gene locus_tag LOCUS_31390 957 100 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 protein_id gnl|my_center|LOCUS_31390 1880 954 gene locus_tag LOCUS_31400 1880 954 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_31400 3060 1888 gene locus_tag LOCUS_31410 3060 1888 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310853.1 protein_id gnl|my_center|LOCUS_31410 4345 3761 gene locus_tag LOCUS_31420 4345 3761 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_31420 4700 4326 gene locus_tag LOCUS_31430 4700 4326 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977426.1 protein_id gnl|my_center|LOCUS_31430 5116 4697 gene locus_tag LOCUS_31440 5116 4697 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_31440 7413 5113 gene locus_tag LOCUS_31450 7413 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 9208 7622 gene locus_tag LOCUS_31460 9208 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533383.1 protein_id gnl|my_center|LOCUS_31460 >Feature sequence213 148 435 gene locus_tag LOCUS_31470 148 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 1882 401 gene locus_tag LOCUS_31480 1882 401 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_31480 3863 1950 gene locus_tag LOCUS_31490 gene dxs 3863 1950 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_31490 5456 4251 gene locus_tag LOCUS_31500 5456 4251 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_31500 6787 5540 gene locus_tag LOCUS_31510 6787 5540 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_31510 7560 6784 gene locus_tag LOCUS_31520 7560 6784 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_31520 8860 7739 gene locus_tag LOCUS_31530 8860 7739 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_31530 <9799 9150 gene locus_tag LOCUS_31540 <9799 9150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731052.1:sulfite exporter TauE/SafE family protein >Feature sequence214 1988 2725 gene locus_tag LOCUS_31550 1988 2725 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_31550 3676 2666 gene locus_tag LOCUS_31560 3676 2666 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229285.1 protein_id gnl|my_center|LOCUS_31560 7797 3673 gene locus_tag LOCUS_31570 7797 3673 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_31570 9101 7806 gene locus_tag LOCUS_31580 9101 7806 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_31580 9413 9282 gene locus_tag LOCUS_31590 9413 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence215 847 212 gene locus_tag LOCUS_31600 847 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 978 2141 gene locus_tag LOCUS_31610 978 2141 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230055.1 protein_id gnl|my_center|LOCUS_31610 2138 2548 gene locus_tag LOCUS_31620 2138 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3082 2432 gene locus_tag LOCUS_31630 3082 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2996 3598 gene locus_tag LOCUS_31640 2996 3598 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 protein_id gnl|my_center|LOCUS_31640 3829 3602 gene locus_tag LOCUS_31650 3829 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731457.1 protein_id gnl|my_center|LOCUS_31650 4494 3826 gene locus_tag LOCUS_31660 4494 3826 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_31660 4606 5091 gene locus_tag LOCUS_31670 4606 5091 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898082.1 protein_id gnl|my_center|LOCUS_31670 5146 5910 gene locus_tag LOCUS_31680 5146 5910 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_31680 7274 6030 gene locus_tag LOCUS_31690 gene cyp124 7274 6030 CDS product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 protein_id gnl|my_center|LOCUS_31690 8631 7294 gene locus_tag LOCUS_31700 gene glnA 8631 7294 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_31700 8798 9610 gene locus_tag LOCUS_31710 8798 9610 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978705.1 protein_id gnl|my_center|LOCUS_31710 >Feature sequence216 195 806 gene locus_tag LOCUS_31720 195 806 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226517.1 protein_id gnl|my_center|LOCUS_31720 971 2056 gene locus_tag LOCUS_31730 gene pdhA 971 2056 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_31730 2059 3990 gene locus_tag LOCUS_31740 2059 3990 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027769.1 protein_id gnl|my_center|LOCUS_31740 3987 6770 gene locus_tag LOCUS_31750 3987 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027768.1 protein_id gnl|my_center|LOCUS_31750 6795 7064 gene locus_tag LOCUS_31760 6795 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 7299 8462 gene locus_tag LOCUS_31770 7299 8462 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225409.1 protein_id gnl|my_center|LOCUS_31770 8459 9115 gene locus_tag LOCUS_31780 8459 9115 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_31780 9112 9276 gene locus_tag LOCUS_31790 9112 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence217 831 55 gene locus_tag LOCUS_31800 831 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1338 1265 gene locus_tag LOCUS_t00310 1338 1265 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2643 1486 gene locus_tag LOCUS_31810 2643 1486 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_31810 2729 3148 gene locus_tag LOCUS_31820 2729 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 4442 3150 gene locus_tag LOCUS_31830 4442 3150 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315434.1 protein_id gnl|my_center|LOCUS_31830 5014 4673 gene locus_tag LOCUS_31840 5014 4673 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_31840 5857 5027 gene locus_tag LOCUS_31850 5857 5027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_31850 6801 5854 gene locus_tag LOCUS_31860 6801 5854 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_31860 6846 7505 gene locus_tag LOCUS_31870 6846 7505 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973638.1 protein_id gnl|my_center|LOCUS_31870 7558 9189 gene locus_tag LOCUS_31880 7558 9189 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_31880 9190 9263 gene locus_tag LOCUS_t00320 9190 9263 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9372 9447 gene locus_tag LOCUS_t00330 9372 9447 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9467 9541 gene locus_tag LOCUS_t00340 9467 9541 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence218 574 236 gene locus_tag LOCUS_31890 574 236 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_31890 1887 571 gene locus_tag LOCUS_31900 1887 571 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_31900 3095 2163 gene locus_tag LOCUS_31910 3095 2163 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_31910 4485 3322 gene locus_tag LOCUS_31920 gene hutI 4485 3322 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892542.1 protein_id gnl|my_center|LOCUS_31920 5890 4547 gene locus_tag LOCUS_31930 5890 4547 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_31930 6635 5964 gene locus_tag LOCUS_31940 6635 5964 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_31940 7076 6735 gene locus_tag LOCUS_31950 7076 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 7131 7664 gene locus_tag LOCUS_31960 7131 7664 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229981.1 protein_id gnl|my_center|LOCUS_31960 7682 8656 gene locus_tag LOCUS_31970 7682 8656 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461138.1 protein_id gnl|my_center|LOCUS_31970 8682 9431 gene locus_tag LOCUS_31980 8682 9431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence219 939 388 gene locus_tag LOCUS_31990 939 388 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057157.1 protein_id gnl|my_center|LOCUS_31990 1503 2552 gene locus_tag LOCUS_32000 1503 2552 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_32000 2819 2571 gene locus_tag LOCUS_32010 2819 2571 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227583.1 protein_id gnl|my_center|LOCUS_32010 3303 2893 gene locus_tag LOCUS_32020 3303 2893 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226716.1 protein_id gnl|my_center|LOCUS_32020 3403 4326 gene locus_tag LOCUS_32030 3403 4326 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226717.1 protein_id gnl|my_center|LOCUS_32030 6094 4409 gene locus_tag LOCUS_32040 gene lysS 6094 4409 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_32040 6936 6154 gene locus_tag LOCUS_32050 6936 6154 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_32050 9445 6944 gene locus_tag LOCUS_32060 9445 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence220 524 916 gene locus_tag LOCUS_32070 524 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 2520 922 gene locus_tag LOCUS_32080 2520 922 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096544.1 protein_id gnl|my_center|LOCUS_32080 2698 4710 gene locus_tag LOCUS_32090 2698 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 4707 5078 gene locus_tag LOCUS_32100 4707 5078 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_32100 6922 5213 gene locus_tag LOCUS_32110 6922 5213 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385682.1 protein_id gnl|my_center|LOCUS_32110 8919 6919 gene locus_tag LOCUS_32120 8919 6919 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067510.1 protein_id gnl|my_center|LOCUS_32120 <9622 8963 gene locus_tag LOCUS_32130 <9622 8963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003916779.1:PucR family transcriptional regulator >Feature sequence221 1877 135 gene locus_tag LOCUS_32140 1877 135 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_32140 2596 2084 gene locus_tag LOCUS_32150 2596 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 2826 4145 gene locus_tag LOCUS_32160 2826 4145 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_32160 4923 4273 gene locus_tag LOCUS_32170 4923 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 5122 6309 gene locus_tag LOCUS_32180 5122 6309 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_32180 7216 6557 gene locus_tag LOCUS_32190 7216 6557 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 protein_id gnl|my_center|LOCUS_32190 8116 7289 gene locus_tag LOCUS_32200 8116 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 9118 8366 gene locus_tag LOCUS_32210 9118 8366 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423797.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence222 <1 1325 gene locus_tag LOCUS_32220 <1 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026923.1:two-component system sensor histidine kinase 1322 2194 gene locus_tag LOCUS_32230 1322 2194 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_32230 2756 2196 gene locus_tag LOCUS_32240 2756 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 2929 3420 gene locus_tag LOCUS_32250 2929 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 3499 4128 gene locus_tag LOCUS_32260 3499 4128 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_32260 4977 4159 gene locus_tag LOCUS_32270 4977 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 5288 6796 gene locus_tag LOCUS_32280 5288 6796 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 protein_id gnl|my_center|LOCUS_32280 7242 8105 gene locus_tag LOCUS_32290 7242 8105 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_32290 8438 8151 gene locus_tag LOCUS_32300 8438 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32300 8655 8972 gene locus_tag LOCUS_32310 8655 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence223 161 394 gene locus_tag LOCUS_32320 161 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 1206 391 gene locus_tag LOCUS_32330 1206 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971044.1 protein_id gnl|my_center|LOCUS_32330 1595 1203 gene locus_tag LOCUS_32340 1595 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 2954 2100 gene locus_tag LOCUS_32350 2954 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3457 2951 gene locus_tag LOCUS_32360 3457 2951 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_32360 3692 4330 gene locus_tag LOCUS_32370 3692 4330 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729106.1 protein_id gnl|my_center|LOCUS_32370 4668 4333 gene locus_tag LOCUS_32380 4668 4333 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413663.1 protein_id gnl|my_center|LOCUS_32380 5117 4665 gene locus_tag LOCUS_32390 gene merR 5117 4665 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_32390 5446 5114 gene locus_tag LOCUS_32400 5446 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 7811 5544 gene locus_tag LOCUS_32410 7811 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 7900 8412 gene locus_tag LOCUS_32420 7900 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 8963 8424 gene locus_tag LOCUS_32430 8963 8424 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730328.1 protein_id gnl|my_center|LOCUS_32430 <9587 8979 gene locus_tag LOCUS_32440 <9587 8979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729466.1:SMP-30/gluconolactonase/LRE family protein >Feature sequence224 31 1665 gene locus_tag LOCUS_32450 31 1665 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408080.1 protein_id gnl|my_center|LOCUS_32450 3212 1632 gene locus_tag LOCUS_32460 3212 1632 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976207.1 protein_id gnl|my_center|LOCUS_32460 3367 4251 gene locus_tag LOCUS_32470 3367 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 4376 5416 gene locus_tag LOCUS_32480 4376 5416 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_32480 6044 5493 gene locus_tag LOCUS_32490 6044 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 6692 6468 gene locus_tag LOCUS_32500 6692 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 7015 6689 gene locus_tag LOCUS_32510 7015 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32510 7153 7404 gene locus_tag LOCUS_32520 7153 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 7964 7428 gene locus_tag LOCUS_32530 7964 7428 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_32530 8954 8073 gene locus_tag LOCUS_32540 8954 8073 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731504.1 protein_id gnl|my_center|LOCUS_32540 9399 8956 gene locus_tag LOCUS_32550 9399 8956 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731503.1 protein_id gnl|my_center|LOCUS_32550 >Feature sequence225 519 1472 gene locus_tag LOCUS_32560 519 1472 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026990.1 protein_id gnl|my_center|LOCUS_32560 1526 2278 gene locus_tag LOCUS_32570 1526 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 2275 3939 gene locus_tag LOCUS_32580 2275 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 4438 4031 gene locus_tag LOCUS_32590 4438 4031 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977952.1 protein_id gnl|my_center|LOCUS_32590 5036 4491 gene locus_tag LOCUS_32600 5036 4491 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081838.1 protein_id gnl|my_center|LOCUS_32600 5452 6666 gene locus_tag LOCUS_32610 5452 6666 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_32610 6844 8331 gene locus_tag LOCUS_32620 6844 8331 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229300.1 protein_id gnl|my_center|LOCUS_32620 8591 8869 gene locus_tag LOCUS_32630 8591 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence226 1154 63 gene locus_tag LOCUS_32640 1154 63 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229171.1 protein_id gnl|my_center|LOCUS_32640 3217 1220 gene locus_tag LOCUS_32650 3217 1220 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804048.1 protein_id gnl|my_center|LOCUS_32650 3427 4743 gene locus_tag LOCUS_32660 3427 4743 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804049.1 protein_id gnl|my_center|LOCUS_32660 4746 5645 gene locus_tag LOCUS_32670 4746 5645 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804050.1 protein_id gnl|my_center|LOCUS_32670 5642 6523 gene locus_tag LOCUS_32680 5642 6523 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804051.1 protein_id gnl|my_center|LOCUS_32680 6568 7569 gene locus_tag LOCUS_32690 6568 7569 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_32690 7642 8532 gene locus_tag LOCUS_32700 7642 8532 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_32700 8535 8984 gene locus_tag LOCUS_32710 8535 8984 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_32710 9242 9427 gene locus_tag LOCUS_32720 9242 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence227 <1 1358 gene locus_tag LOCUS_32730 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742126.1:penicillin acylase family protein 1612 1367 gene locus_tag LOCUS_32740 1612 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666679.1 protein_id gnl|my_center|LOCUS_32740 4390 1820 gene locus_tag LOCUS_32750 gene pheT 4390 1820 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093159782.1 protein_id gnl|my_center|LOCUS_32750 5490 4390 gene locus_tag LOCUS_32760 gene pheS 5490 4390 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_32760 6862 5768 gene locus_tag LOCUS_32770 6862 5768 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_32770 7793 6960 gene locus_tag LOCUS_32780 7793 6960 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_32780 8245 7865 gene locus_tag LOCUS_32790 gene rplT 8245 7865 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776197.1 protein_id gnl|my_center|LOCUS_32790 8460 8266 gene locus_tag LOCUS_32800 gene rpmI 8460 8266 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058702.1 protein_id gnl|my_center|LOCUS_32800 9279 8602 gene locus_tag LOCUS_32810 gene infC 9279 8602 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_32810 >Feature sequence228 2378 144 gene locus_tag LOCUS_32820 2378 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 4205 2487 gene locus_tag LOCUS_32830 4205 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 4875 4273 gene locus_tag LOCUS_32840 gene rdgB 4875 4273 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_32840 5567 4893 gene locus_tag LOCUS_32850 gene rph 5567 4893 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_32850 6367 5615 gene locus_tag LOCUS_32860 6367 5615 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_32860 7197 6364 gene locus_tag LOCUS_32870 gene murI 7197 6364 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776024.1 protein_id gnl|my_center|LOCUS_32870 8071 7391 gene locus_tag LOCUS_32880 8071 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 9427 8633 gene locus_tag LOCUS_32890 9427 8633 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_32890 >Feature sequence229 777 493 gene locus_tag LOCUS_32900 777 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 1995 820 gene locus_tag LOCUS_32910 1995 820 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037159.1 protein_id gnl|my_center|LOCUS_32910 2432 1992 gene locus_tag LOCUS_32920 2432 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 2892 2515 gene locus_tag LOCUS_32930 2892 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 4472 2892 gene locus_tag LOCUS_32940 4472 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 4686 6449 gene locus_tag LOCUS_32950 4686 6449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_32950 6544 7797 gene locus_tag LOCUS_32960 6544 7797 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_32960 7947 8540 gene locus_tag LOCUS_32970 7947 8540 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_32970 >Feature sequence230 1579 881 gene locus_tag LOCUS_32980 1579 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 1800 1576 gene locus_tag LOCUS_32990 1800 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2673 1972 gene locus_tag LOCUS_33000 2673 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33000 2798 3013 gene locus_tag LOCUS_33010 2798 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 3258 2995 gene locus_tag LOCUS_33020 3258 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 3411 5588 gene locus_tag LOCUS_33030 3411 5588 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_33030 6054 5596 gene locus_tag LOCUS_33040 6054 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 6356 6898 gene locus_tag LOCUS_33050 gene pyrE 6356 6898 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_33050 7307 6870 gene locus_tag LOCUS_33060 7307 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 8101 7421 gene locus_tag LOCUS_33070 8101 7421 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184762868.1 protein_id gnl|my_center|LOCUS_33070 8278 9300 gene locus_tag LOCUS_33080 gene fbaA 8278 9300 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence231 4085 159 gene locus_tag LOCUS_33090 gene hrpA 4085 159 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_33090 4673 4158 gene locus_tag LOCUS_33100 4673 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 5621 4884 gene locus_tag LOCUS_33110 5621 4884 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_33110 5771 6061 gene locus_tag LOCUS_33120 5771 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 6139 6735 gene locus_tag LOCUS_33130 6139 6735 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_33130 7130 7567 gene locus_tag LOCUS_33140 gene hspX 7130 7567 CDS product alpha-crystallin HspX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410189.1 protein_id gnl|my_center|LOCUS_33140 8563 7703 gene locus_tag LOCUS_33150 8563 7703 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_33150 8775 9044 gene locus_tag LOCUS_33160 8775 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 >Feature sequence232 993 46 gene locus_tag LOCUS_33170 993 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 1736 990 gene locus_tag LOCUS_33180 1736 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 2696 1746 gene locus_tag LOCUS_33190 2696 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 3869 2700 gene locus_tag LOCUS_33200 3869 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 4836 3880 gene locus_tag LOCUS_33210 4836 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 8583 4849 gene locus_tag LOCUS_33220 8583 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 8949 8590 gene locus_tag LOCUS_33230 8949 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 >Feature sequence233 192 491 gene locus_tag LOCUS_33240 gene gatC 192 491 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_33240 488 1978 gene locus_tag LOCUS_33250 gene gatA 488 1978 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_33250 2059 3567 gene locus_tag LOCUS_33260 gene gatB 2059 3567 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_33260 3719 5683 gene locus_tag LOCUS_33270 3719 5683 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_33270 6805 5684 gene locus_tag LOCUS_33280 6805 5684 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_33280 6869 7789 gene locus_tag LOCUS_33290 6869 7789 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence234 122 1327 gene locus_tag LOCUS_33300 gene xseA 122 1327 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_33300 3328 1487 gene locus_tag LOCUS_33310 gene asnB 3328 1487 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_33310 3464 3793 gene locus_tag LOCUS_33320 3464 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 4485 3937 gene locus_tag LOCUS_33330 4485 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 5095 4532 gene locus_tag LOCUS_33340 5095 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 5270 6298 gene locus_tag LOCUS_33350 gene glpX 5270 6298 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_33350 6933 6310 gene locus_tag LOCUS_33360 6933 6310 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence235 27 500 gene locus_tag LOCUS_33370 27 500 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_33370 583 1446 gene locus_tag LOCUS_33380 583 1446 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978710.1 protein_id gnl|my_center|LOCUS_33380 1597 4035 gene locus_tag LOCUS_33390 1597 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 5760 4075 gene locus_tag LOCUS_33400 gene ctaD 5760 4075 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_33400 5907 6272 gene locus_tag LOCUS_33410 gene trxA 5907 6272 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_33410 7822 6446 gene locus_tag LOCUS_33420 7822 6446 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_33420 9057 7825 gene locus_tag LOCUS_33430 9057 7825 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651240.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence236 <1 872 gene locus_tag LOCUS_33440 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920791.1:tetratricopeptide repeat protein 2389 1112 gene locus_tag LOCUS_33450 2389 1112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230284.1 protein_id gnl|my_center|LOCUS_33450 2910 2386 gene locus_tag LOCUS_33460 2910 2386 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230285.1 protein_id gnl|my_center|LOCUS_33460 4568 3162 gene locus_tag LOCUS_33470 gene pntB 4568 3162 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971522.1 protein_id gnl|my_center|LOCUS_33470 6151 4571 gene locus_tag LOCUS_33480 6151 4571 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031784.1 protein_id gnl|my_center|LOCUS_33480 8100 6565 gene locus_tag LOCUS_33490 8100 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence237 179 1936 gene locus_tag LOCUS_33500 179 1936 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_33500 2956 2195 gene locus_tag LOCUS_33510 2956 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 3850 3224 gene locus_tag LOCUS_33520 3850 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 4591 4019 gene locus_tag LOCUS_33530 4591 4019 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_33530 5939 4656 gene locus_tag LOCUS_33540 5939 4656 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_33540 6024 6266 gene locus_tag LOCUS_33550 6024 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 6266 6790 gene locus_tag LOCUS_33560 6266 6790 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_33560 6800 7216 gene locus_tag LOCUS_33570 6800 7216 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_33570 7493 7771 gene locus_tag LOCUS_33580 7493 7771 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_33580 7772 8719 gene locus_tag LOCUS_33590 7772 8719 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence238 2769 2323 gene locus_tag LOCUS_33600 2769 2323 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031523.1 protein_id gnl|my_center|LOCUS_33600 4231 3320 gene locus_tag LOCUS_33610 4231 3320 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 protein_id gnl|my_center|LOCUS_33610 4686 4249 gene locus_tag LOCUS_33620 4686 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 4803 5708 gene locus_tag LOCUS_33630 4803 5708 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030266.1 protein_id gnl|my_center|LOCUS_33630 6186 5731 gene locus_tag LOCUS_33640 6186 5731 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189554466.1 protein_id gnl|my_center|LOCUS_33640 6185 6922 gene locus_tag LOCUS_33650 6185 6922 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226466.1 protein_id gnl|my_center|LOCUS_33650 7853 6954 gene locus_tag LOCUS_33660 7853 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229069.1 protein_id gnl|my_center|LOCUS_33660 8299 7850 gene locus_tag LOCUS_33670 8299 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 8516 8764 gene locus_tag LOCUS_33680 8516 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence239 759 436 gene locus_tag LOCUS_33690 759 436 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_33690 1563 814 gene locus_tag LOCUS_33700 1563 814 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414713.1 protein_id gnl|my_center|LOCUS_33700 2421 1618 gene locus_tag LOCUS_33710 gene lepB 2421 1618 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030325.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33710 3312 2449 gene locus_tag LOCUS_33720 3312 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 3787 3422 gene locus_tag LOCUS_33730 gene rplS 3787 3422 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_33730 4895 4089 gene locus_tag LOCUS_33740 gene trmD 4895 4089 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_33740 5423 4905 gene locus_tag LOCUS_33750 gene rimM 5423 4905 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142459073.1 protein_id gnl|my_center|LOCUS_33750 5796 5554 gene locus_tag LOCUS_33760 5796 5554 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_33760 6253 5798 gene locus_tag LOCUS_33770 gene rpsP 6253 5798 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728340.1 protein_id gnl|my_center|LOCUS_33770 6519 7136 gene locus_tag LOCUS_33780 6519 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 8697 7156 gene locus_tag LOCUS_33790 gene ffh 8697 7156 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_33790 9089 8826 gene locus_tag LOCUS_33800 9089 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence240 443 66 gene locus_tag LOCUS_33810 443 66 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_33810 1835 591 gene locus_tag LOCUS_33820 gene dinB 1835 591 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_33820 2600 1878 gene locus_tag LOCUS_33830 2600 1878 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_33830 3064 2654 gene locus_tag LOCUS_33840 gene nusB 3064 2654 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_33840 3626 3066 gene locus_tag LOCUS_33850 gene efp 3626 3066 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_33850 4713 3652 gene locus_tag LOCUS_33860 4713 3652 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_33860 5362 4880 gene locus_tag LOCUS_33870 5362 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 5461 6150 gene locus_tag LOCUS_33880 5461 6150 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467100.1 protein_id gnl|my_center|LOCUS_33880 7333 6299 gene locus_tag LOCUS_33890 7333 6299 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_33890 7402 7653 gene locus_tag LOCUS_33900 7402 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 8376 8915 gene locus_tag LOCUS_33910 8376 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 >Feature sequence241 2449 902 gene locus_tag LOCUS_33920 gene guaA 2449 902 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_33920 3623 2547 gene locus_tag LOCUS_33930 3623 2547 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971557.1 protein_id gnl|my_center|LOCUS_33930 3735 4247 gene locus_tag LOCUS_33940 3735 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 5967 4276 gene locus_tag LOCUS_33950 5967 4276 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086844353.1 protein_id gnl|my_center|LOCUS_33950 7542 5986 gene locus_tag LOCUS_33960 7542 5986 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_33960 8221 7610 gene locus_tag LOCUS_33970 8221 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 8805 8218 gene locus_tag LOCUS_33980 8805 8218 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972778.1 protein_id gnl|my_center|LOCUS_33980 >Feature sequence242 679 80 gene locus_tag LOCUS_33990 679 80 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728980.1 protein_id gnl|my_center|LOCUS_33990 776 2203 gene locus_tag LOCUS_34000 776 2203 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027644.1 protein_id gnl|my_center|LOCUS_34000 2735 2232 gene locus_tag LOCUS_34010 gene purE 2735 2232 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_34010 3894 2728 gene locus_tag LOCUS_34020 3894 2728 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_34020 4893 3931 gene locus_tag LOCUS_34030 4893 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 5128 5664 gene locus_tag LOCUS_34040 5128 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 7178 5910 gene locus_tag LOCUS_34050 gene draK 7178 5910 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_34050 7882 7214 gene locus_tag LOCUS_34060 7882 7214 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_34060 8662 8180 gene locus_tag LOCUS_34070 gene bfrA 8662 8180 CDS product bacterioferritin BfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409398.1 protein_id gnl|my_center|LOCUS_34070 8891 8676 gene locus_tag LOCUS_34080 8891 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence243 2097 121 gene locus_tag LOCUS_34090 2097 121 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_34090 2330 3331 gene locus_tag LOCUS_34100 2330 3331 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_34100 4556 3360 gene locus_tag LOCUS_34110 4556 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 4857 4585 gene locus_tag LOCUS_34120 4857 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 4760 5953 gene locus_tag LOCUS_34130 4760 5953 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_34130 6042 7334 gene locus_tag LOCUS_34140 6042 7334 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_34140 >Feature sequence244 1417 443 gene locus_tag LOCUS_34150 1417 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 2866 1706 gene locus_tag LOCUS_34160 2866 1706 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_34160 3041 3247 gene locus_tag LOCUS_34170 3041 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_34170 4548 3550 gene locus_tag LOCUS_34180 4548 3550 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_34180 5329 4694 gene locus_tag LOCUS_34190 5329 4694 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 protein_id gnl|my_center|LOCUS_34190 5500 6279 gene locus_tag LOCUS_34200 5500 6279 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_34200 6276 6554 gene locus_tag LOCUS_34210 6276 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_34210 6554 7444 gene locus_tag LOCUS_34220 gene htpX 6554 7444 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_34220 7458 8006 gene locus_tag LOCUS_34230 7458 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_34230 8025 8783 gene locus_tag LOCUS_34240 8025 8783 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223524.1 protein_id gnl|my_center|LOCUS_34240 >Feature sequence245 1817 1113 gene locus_tag LOCUS_34250 1817 1113 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 protein_id gnl|my_center|LOCUS_34250 2555 1836 gene locus_tag LOCUS_34260 2555 1836 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031481.1 protein_id gnl|my_center|LOCUS_34260 2764 3753 gene locus_tag LOCUS_34270 2764 3753 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142427.1 protein_id gnl|my_center|LOCUS_34270 3802 5295 gene locus_tag LOCUS_34280 3802 5295 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729461.1 protein_id gnl|my_center|LOCUS_34280 5304 6317 gene locus_tag LOCUS_34290 5304 6317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729462.1 protein_id gnl|my_center|LOCUS_34290 6314 7381 gene locus_tag LOCUS_34300 6314 7381 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_34300 7381 8322 gene locus_tag LOCUS_34310 7381 8322 CDS product DUF4380 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729464.1 protein_id gnl|my_center|LOCUS_34310 >Feature sequence246 1576 113 gene locus_tag LOCUS_34320 1576 113 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_34320 1713 1973 gene locus_tag LOCUS_34330 1713 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 4930 1976 gene locus_tag LOCUS_34340 4930 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_34340 5730 4933 gene locus_tag LOCUS_34350 5730 4933 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_34350 5838 7097 gene locus_tag LOCUS_34360 5838 7097 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_34360 7873 7475 gene locus_tag LOCUS_34370 7873 7475 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence247 364 1137 gene locus_tag LOCUS_34380 364 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 1694 1047 gene locus_tag LOCUS_34390 1694 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 1806 2186 gene locus_tag LOCUS_34400 1806 2186 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223911.1 protein_id gnl|my_center|LOCUS_34400 2183 2746 gene locus_tag LOCUS_34410 gene ybaK 2183 2746 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_34410 2824 4212 gene locus_tag LOCUS_34420 2824 4212 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_34420 4715 4230 gene locus_tag LOCUS_34430 4715 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 4829 6133 gene locus_tag LOCUS_34440 gene murA 4829 6133 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775882.1 protein_id gnl|my_center|LOCUS_34440 >Feature sequence248 872 48 gene locus_tag LOCUS_34450 872 48 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_34450 1689 1138 gene locus_tag LOCUS_34460 1689 1138 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_34460 2311 1697 gene locus_tag LOCUS_34470 2311 1697 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_34470 2452 3066 gene locus_tag LOCUS_34480 2452 3066 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_34480 3063 4178 gene locus_tag LOCUS_34490 3063 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 4585 4872 gene locus_tag LOCUS_34500 4585 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 5826 4879 gene locus_tag LOCUS_34510 5826 4879 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_34510 6743 5823 gene locus_tag LOCUS_34520 6743 5823 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_34520 7780 6740 gene locus_tag LOCUS_34530 7780 6740 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_34530 7877 8638 gene locus_tag LOCUS_34540 7877 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 >Feature sequence249 390 1535 gene locus_tag LOCUS_34550 390 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34550 1540 1848 gene locus_tag LOCUS_34560 1540 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34560 1841 2308 gene locus_tag LOCUS_34570 1841 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34570 2305 3345 gene locus_tag LOCUS_34580 2305 3345 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_34580 3452 3751 gene locus_tag LOCUS_34590 3452 3751 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804336.1 protein_id gnl|my_center|LOCUS_34590 3984 3766 gene locus_tag LOCUS_34600 3984 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 4291 5952 gene locus_tag LOCUS_34610 4291 5952 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731142.1 protein_id gnl|my_center|LOCUS_34610 6063 7184 gene locus_tag LOCUS_34620 gene galK 6063 7184 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_34620 8188 7418 gene locus_tag LOCUS_34630 8188 7418 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893601.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence250 134 871 gene locus_tag LOCUS_34640 134 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 2140 902 gene locus_tag LOCUS_34650 2140 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 4164 2269 gene locus_tag LOCUS_34660 4164 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 6524 4161 gene locus_tag LOCUS_34670 6524 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 7145 6630 gene locus_tag LOCUS_34680 7145 6630 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_34680 <8672 7146 gene locus_tag LOCUS_34690 <8672 7146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275275.1:flavin monoamine oxidase family protein >Feature sequence251 160 1125 gene locus_tag LOCUS_34700 gene murQ 160 1125 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144000.1 protein_id gnl|my_center|LOCUS_34700 2045 1146 gene locus_tag LOCUS_34710 2045 1146 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_34710 1957 2148 gene locus_tag LOCUS_34720 1957 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 2247 3839 gene locus_tag LOCUS_34730 2247 3839 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_34730 3904 5070 gene locus_tag LOCUS_34740 3904 5070 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031767.1 protein_id gnl|my_center|LOCUS_34740 6048 5095 gene locus_tag LOCUS_34750 6048 5095 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226103.1 protein_id gnl|my_center|LOCUS_34750 7366 6173 gene locus_tag LOCUS_34760 gene fahA 7366 6173 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113316.1 protein_id gnl|my_center|LOCUS_34760 8253 7369 gene locus_tag LOCUS_34770 8253 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 protein_id gnl|my_center|LOCUS_34770 8594 8250 gene locus_tag LOCUS_34780 8594 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence252 47 412 gene locus_tag LOCUS_34790 47 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 703 2025 gene locus_tag LOCUS_34800 703 2025 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467055.1 protein_id gnl|my_center|LOCUS_34800 2485 1991 gene locus_tag LOCUS_34810 2485 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 2580 3029 gene locus_tag LOCUS_34820 2580 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 3703 3182 gene locus_tag LOCUS_34830 3703 3182 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189303094.1 protein_id gnl|my_center|LOCUS_34830 3869 4357 gene locus_tag LOCUS_34840 3869 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 6728 4317 gene locus_tag LOCUS_34850 6728 4317 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_34850 7102 8385 gene locus_tag LOCUS_34860 7102 8385 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223728.1 protein_id gnl|my_center|LOCUS_34860 >Feature sequence253 <1 1159 gene locus_tag LOCUS_34870 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224340.1:glycoside hydrolase family 18 protein 1285 2976 gene locus_tag LOCUS_34880 1285 2976 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_34880 3472 2981 gene locus_tag LOCUS_34890 3472 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 4514 3597 gene locus_tag LOCUS_34900 4514 3597 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020544063.1 protein_id gnl|my_center|LOCUS_34900 5216 4554 gene locus_tag LOCUS_34910 5216 4554 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_34910 5887 5213 gene locus_tag LOCUS_34920 5887 5213 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972858.1 protein_id gnl|my_center|LOCUS_34920 7002 5884 gene locus_tag LOCUS_34930 7002 5884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972859.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence254 2389 1439 gene locus_tag LOCUS_34940 2389 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_34940 3408 2431 gene locus_tag LOCUS_34950 3408 2431 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_34950 4601 3405 gene locus_tag LOCUS_34960 gene steA 4601 3405 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_34960 6622 4880 gene locus_tag LOCUS_34970 gene recN 6622 4880 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_34970 7752 6805 gene locus_tag LOCUS_34980 7752 6805 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_34980 <8503 7778 gene locus_tag LOCUS_34990 <8503 7778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027974.1:hemolysin >Feature sequence255 650 1783 gene locus_tag LOCUS_35000 650 1783 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 protein_id gnl|my_center|LOCUS_35000 1795 2904 gene locus_tag LOCUS_35010 1795 2904 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_35010 2992 3228 gene locus_tag LOCUS_35020 2992 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 6476 3429 gene locus_tag LOCUS_35030 6476 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 7426 6608 gene locus_tag LOCUS_35040 7426 6608 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224936.1 protein_id gnl|my_center|LOCUS_35040 8433 7426 gene locus_tag LOCUS_35050 8433 7426 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224935.1 protein_id gnl|my_center|LOCUS_35050 >Feature sequence256 1605 97 gene locus_tag LOCUS_35060 1605 97 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229568.1 protein_id gnl|my_center|LOCUS_35060 1487 1699 gene locus_tag LOCUS_35070 1487 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3820 1718 gene locus_tag LOCUS_35080 3820 1718 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190907.1 protein_id gnl|my_center|LOCUS_35080 4457 4086 gene locus_tag LOCUS_35090 4457 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 6533 4554 gene locus_tag LOCUS_35100 6533 4554 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225152.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence257 544 2316 gene locus_tag LOCUS_35110 gene ggt 544 2316 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 protein_id gnl|my_center|LOCUS_35110 3824 2322 gene locus_tag LOCUS_35120 3824 2322 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 protein_id gnl|my_center|LOCUS_35120 4153 3980 gene locus_tag LOCUS_35130 4153 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 4296 5114 gene locus_tag LOCUS_35140 4296 5114 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 protein_id gnl|my_center|LOCUS_35140 5184 5507 gene locus_tag LOCUS_35150 5184 5507 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224358.1 protein_id gnl|my_center|LOCUS_35150 5766 5572 gene locus_tag LOCUS_35160 5766 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 6619 6026 gene locus_tag LOCUS_35170 6619 6026 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893780.1 protein_id gnl|my_center|LOCUS_35170 6759 7511 gene locus_tag LOCUS_35180 6759 7511 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_35180 >Feature sequence258 686 12 gene locus_tag LOCUS_35190 686 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 1869 679 gene locus_tag LOCUS_35200 1869 679 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_35200 2819 1866 gene locus_tag LOCUS_35210 gene argB 2819 1866 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977246.1 protein_id gnl|my_center|LOCUS_35210 3970 2816 gene locus_tag LOCUS_35220 gene argJ 3970 2816 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_35220 5039 4017 gene locus_tag LOCUS_35230 gene argC 5039 4017 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_35230 5190 6887 gene locus_tag LOCUS_35240 5190 6887 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_35240 7001 7366 gene locus_tag LOCUS_35250 7001 7366 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031557.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence259 719 138 gene locus_tag LOCUS_35260 719 138 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_35260 1222 716 gene locus_tag LOCUS_35270 1222 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 1266 1538 gene locus_tag LOCUS_35280 1266 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 2123 1545 gene locus_tag LOCUS_35290 2123 1545 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088046.1 protein_id gnl|my_center|LOCUS_35290 2885 2133 gene locus_tag LOCUS_35300 2885 2133 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_35300 4162 3107 gene locus_tag LOCUS_35310 gene dapE 4162 3107 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_35310 4987 4187 gene locus_tag LOCUS_35320 4987 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319978.1 protein_id gnl|my_center|LOCUS_35320 5629 5009 gene locus_tag LOCUS_35330 5629 5009 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413441.1 protein_id gnl|my_center|LOCUS_35330 6720 5641 gene locus_tag LOCUS_35340 gene dapC 6720 5641 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222936.1 protein_id gnl|my_center|LOCUS_35340 7190 6765 gene locus_tag LOCUS_35350 7190 6765 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_35350 7078 7422 gene locus_tag LOCUS_35360 7078 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence260 822 337 gene locus_tag LOCUS_35370 822 337 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227655.1 protein_id gnl|my_center|LOCUS_35370 983 4420 gene locus_tag LOCUS_35380 983 4420 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_35380 4417 5556 gene locus_tag LOCUS_35390 4417 5556 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_35390 5874 6449 gene locus_tag LOCUS_35400 5874 6449 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063830.1 protein_id gnl|my_center|LOCUS_35400 7178 6453 gene locus_tag LOCUS_35410 7178 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 7780 7178 gene locus_tag LOCUS_35420 7780 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence261 1567 1974 gene locus_tag LOCUS_35430 1567 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 1971 2387 gene locus_tag LOCUS_35440 1971 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 3197 2802 gene locus_tag LOCUS_35450 3197 2802 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742073.1 protein_id gnl|my_center|LOCUS_35450 3246 4142 gene locus_tag LOCUS_35460 3246 4142 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 protein_id gnl|my_center|LOCUS_35460 5762 4419 gene locus_tag LOCUS_35470 gene argG 5762 4419 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_35470 6688 6056 gene locus_tag LOCUS_35480 6688 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 7953 6748 gene locus_tag LOCUS_35490 7953 6748 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence262 2388 37 gene locus_tag LOCUS_35500 2388 37 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730344.1 protein_id gnl|my_center|LOCUS_35500 2679 3722 gene locus_tag LOCUS_35510 2679 3722 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_35510 3932 5185 gene locus_tag LOCUS_35520 3932 5185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_35520 5832 5191 gene locus_tag LOCUS_35530 5832 5191 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_35530 6040 7326 gene locus_tag LOCUS_35540 gene aldO 6040 7326 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_35540 7531 7998 gene locus_tag LOCUS_35550 7531 7998 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 protein_id gnl|my_center|LOCUS_35550 >Feature sequence263 1065 4529 gene locus_tag LOCUS_35560 gene metH 1065 4529 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_35560 4610 5251 gene locus_tag LOCUS_35570 4610 5251 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_35570 5321 5800 gene locus_tag LOCUS_35580 5321 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977282.1 protein_id gnl|my_center|LOCUS_35580 6159 7151 gene locus_tag LOCUS_35590 6159 7151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_35590 >Feature sequence264 <1 727 gene locus_tag LOCUS_35600 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889128.1:prolyl oligopeptidase family protein 1631 735 gene locus_tag LOCUS_35610 gene purU 1631 735 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_35610 3644 1635 gene locus_tag LOCUS_35620 3644 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 4363 3797 gene locus_tag LOCUS_35630 4363 3797 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091014.1 protein_id gnl|my_center|LOCUS_35630 5974 4385 gene locus_tag LOCUS_35640 5974 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 6309 6569 gene locus_tag LOCUS_35650 6309 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 7044 8057 gene locus_tag LOCUS_35660 7044 8057 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283001.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence265 582 815 gene locus_tag LOCUS_35670 582 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 924 1490 gene locus_tag LOCUS_35680 924 1490 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777029.1 protein_id gnl|my_center|LOCUS_35680 1642 1568 gene locus_tag LOCUS_t00350 1642 1568 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1727 1656 gene locus_tag LOCUS_t00360 1727 1656 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1842 1770 gene locus_tag LOCUS_t00370 1842 1770 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1992 2759 gene locus_tag LOCUS_35690 1992 2759 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189917.1 protein_id gnl|my_center|LOCUS_35690 2818 4365 gene locus_tag LOCUS_35700 gene hutH 2818 4365 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_35700 5617 4394 gene locus_tag LOCUS_35710 5617 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 5714 6601 gene locus_tag LOCUS_35720 5714 6601 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031796.1 protein_id gnl|my_center|LOCUS_35720 6657 7652 gene locus_tag LOCUS_35730 6657 7652 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence266 2984 216 gene locus_tag LOCUS_35740 2984 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 3405 4385 gene locus_tag LOCUS_35750 3405 4385 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230270.1 protein_id gnl|my_center|LOCUS_35750 4407 5180 gene locus_tag LOCUS_35760 4407 5180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_35760 5177 5968 gene locus_tag LOCUS_35770 5177 5968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_35770 5978 6754 gene locus_tag LOCUS_35780 5978 6754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230261.1 protein_id gnl|my_center|LOCUS_35780 6751 7755 gene locus_tag LOCUS_35790 6751 7755 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_35790 8041 7766 gene locus_tag LOCUS_35800 8041 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence267 62 1009 gene locus_tag LOCUS_35810 62 1009 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031713.1 protein_id gnl|my_center|LOCUS_35810 1154 2152 gene locus_tag LOCUS_35820 gene gap 1154 2152 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971634.1 protein_id gnl|my_center|LOCUS_35820 2976 2257 gene locus_tag LOCUS_35830 2976 2257 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029682.1 protein_id gnl|my_center|LOCUS_35830 3195 4139 gene locus_tag LOCUS_35840 gene sigJ 3195 4139 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226028235.1 protein_id gnl|my_center|LOCUS_35840 4234 5448 gene locus_tag LOCUS_35850 4234 5448 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_35850 6957 5509 gene locus_tag LOCUS_35860 6957 5509 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284325.1 protein_id gnl|my_center|LOCUS_35860 7305 7883 gene locus_tag LOCUS_35870 7305 7883 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_35870 >Feature sequence268 172 735 gene locus_tag LOCUS_35880 172 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 745 1086 gene locus_tag LOCUS_35890 745 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 1100 1477 gene locus_tag LOCUS_35900 1100 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 1477 1896 gene locus_tag LOCUS_35910 1477 1896 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532641.1 protein_id gnl|my_center|LOCUS_35910 1899 2318 gene locus_tag LOCUS_35920 1899 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 2324 2692 gene locus_tag LOCUS_35930 2324 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 2743 3030 gene locus_tag LOCUS_35940 2743 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 3051 5198 gene locus_tag LOCUS_35950 3051 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 >Feature sequence269 1370 651 gene locus_tag LOCUS_35960 1370 651 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359197.1 protein_id gnl|my_center|LOCUS_35960 2485 1559 gene locus_tag LOCUS_35970 2485 1559 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163264318.1 protein_id gnl|my_center|LOCUS_35970 2595 3209 gene locus_tag LOCUS_35980 2595 3209 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814509.1 protein_id gnl|my_center|LOCUS_35980 4119 3313 gene locus_tag LOCUS_35990 4119 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 4312 4133 gene locus_tag LOCUS_36000 4312 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 4807 4397 gene locus_tag LOCUS_36010 4807 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 5408 6607 gene locus_tag LOCUS_36020 5408 6607 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence270 543 172 gene locus_tag LOCUS_36030 543 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 431 706 gene locus_tag LOCUS_36040 431 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1433 2605 gene locus_tag LOCUS_36050 1433 2605 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_36050 3539 2709 gene locus_tag LOCUS_36060 3539 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 4508 3543 gene locus_tag LOCUS_36070 4508 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 4801 5295 gene locus_tag LOCUS_36080 4801 5295 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_36080 6309 5305 gene locus_tag LOCUS_36090 6309 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 6940 6446 gene locus_tag LOCUS_36100 6940 6446 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_36100 7040 7603 gene locus_tag LOCUS_36110 7040 7603 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854913.1 protein_id gnl|my_center|LOCUS_36110 7795 7885 gene locus_tag LOCUS_t00380 7795 7885 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence271 2553 295 gene locus_tag LOCUS_36120 gene pcrA 2553 295 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_36120 2674 3393 gene locus_tag LOCUS_36130 2674 3393 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_36130 3648 4241 gene locus_tag LOCUS_36140 3648 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 4251 5426 gene locus_tag LOCUS_36150 4251 5426 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030479.1 protein_id gnl|my_center|LOCUS_36150 5423 6205 gene locus_tag LOCUS_36160 5423 6205 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_36160 7066 6341 gene locus_tag LOCUS_36170 7066 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 <7961 7099 gene locus_tag LOCUS_36180 <7961 7099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899053.1:type II CAAX endopeptidase family protein >Feature sequence272 230 1090 gene locus_tag LOCUS_36190 gene rpsB 230 1090 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_36190 1282 2115 gene locus_tag LOCUS_36200 gene tsf 1282 2115 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_36200 2167 2937 gene locus_tag LOCUS_36210 gene pyrH 2167 2937 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_36210 2947 3504 gene locus_tag LOCUS_36220 gene frr 2947 3504 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_36220 3776 4663 gene locus_tag LOCUS_36230 3776 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 5891 4857 gene locus_tag LOCUS_36240 5891 4857 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200269.1 protein_id gnl|my_center|LOCUS_36240 5996 7111 gene locus_tag LOCUS_36250 gene rlmN 5996 7111 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_36250 7790 7119 gene locus_tag LOCUS_36260 7790 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 >Feature sequence273 2717 1548 gene locus_tag LOCUS_36270 2717 1548 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_36270 2858 3505 gene locus_tag LOCUS_36280 2858 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 4354 3515 gene locus_tag LOCUS_36290 gene htdY 4354 3515 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_36290 5273 4356 gene locus_tag LOCUS_36300 5273 4356 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_36300 5383 6855 gene locus_tag LOCUS_36310 5383 6855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_36310 7712 6942 gene locus_tag LOCUS_36320 7712 6942 CDS product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089568.1 protein_id gnl|my_center|LOCUS_36320 >Feature sequence274 4330 35 gene locus_tag LOCUS_36330 4330 35 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487683.1 protein_id gnl|my_center|LOCUS_36330 4731 5771 gene locus_tag LOCUS_36340 4731 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 6223 5804 gene locus_tag LOCUS_36350 6223 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 6614 6480 gene locus_tag LOCUS_36360 6614 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 6937 7305 gene locus_tag LOCUS_36370 gene glbN 6937 7305 CDS product group 1 truncated hemoglobin GlbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407730.1 protein_id gnl|my_center|LOCUS_36370 >Feature sequence275 3126 61 gene locus_tag LOCUS_36380 3126 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 4250 3426 gene locus_tag LOCUS_36390 4250 3426 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_36390 5578 4415 gene locus_tag LOCUS_36400 5578 4415 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151614010.1 protein_id gnl|my_center|LOCUS_36400 6611 5595 gene locus_tag LOCUS_36410 6611 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 >Feature sequence276 1 1254 gene locus_tag LOCUS_36420 1 1254 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_36420 1451 2065 gene locus_tag LOCUS_36430 gene sigR 1451 2065 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_36430 2445 2077 gene locus_tag LOCUS_36440 2445 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 3486 2488 gene locus_tag LOCUS_36450 3486 2488 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227097.1 protein_id gnl|my_center|LOCUS_36450 3608 5377 gene locus_tag LOCUS_36460 3608 5377 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_36460 5532 6602 gene locus_tag LOCUS_36470 5532 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 6610 7302 gene locus_tag LOCUS_36480 6610 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230033.1 protein_id gnl|my_center|LOCUS_36480 >Feature sequence277 1495 32 gene locus_tag LOCUS_36490 gene crtI 1495 32 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_36490 2298 1483 gene locus_tag LOCUS_36500 2298 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 3353 2376 gene locus_tag LOCUS_36510 3353 2376 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_36510 4088 3423 gene locus_tag LOCUS_36520 4088 3423 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_36520 4655 4212 gene locus_tag LOCUS_36530 4655 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 6892 4709 gene locus_tag LOCUS_36540 6892 4709 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_36540 7077 7235 gene locus_tag LOCUS_36550 7077 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 7651 7301 gene locus_tag LOCUS_36560 7651 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence278 2111 1383 gene locus_tag LOCUS_36570 2111 1383 CDS product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803819.1 protein_id gnl|my_center|LOCUS_36570 3649 2108 gene locus_tag LOCUS_36580 3649 2108 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_36580 5381 3720 gene locus_tag LOCUS_36590 5381 3720 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803820.1 protein_id gnl|my_center|LOCUS_36590 6316 5444 gene locus_tag LOCUS_36600 6316 5444 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_36600 7302 6310 gene locus_tag LOCUS_36610 7302 6310 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_36610 >Feature sequence279 1243 1872 gene locus_tag LOCUS_36620 1243 1872 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223045.1 protein_id gnl|my_center|LOCUS_36620 1869 3065 gene locus_tag LOCUS_36630 1869 3065 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139569.1 protein_id gnl|my_center|LOCUS_36630 3062 4036 gene locus_tag LOCUS_36640 3062 4036 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731130.1 protein_id gnl|my_center|LOCUS_36640 4044 5369 gene locus_tag LOCUS_36650 4044 5369 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731131.1 protein_id gnl|my_center|LOCUS_36650 6436 5414 gene locus_tag LOCUS_36660 6436 5414 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 protein_id gnl|my_center|LOCUS_36660 >Feature sequence280 <1 752 gene locus_tag LOCUS_36670 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030136.1:class I SAM-dependent methyltransferase 789 1589 gene locus_tag LOCUS_36680 789 1589 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230233.1 protein_id gnl|my_center|LOCUS_36680 2588 1584 gene locus_tag LOCUS_36690 2588 1584 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030905.1 protein_id gnl|my_center|LOCUS_36690 2748 4085 gene locus_tag LOCUS_36700 2748 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 4082 4756 gene locus_tag LOCUS_36710 4082 4756 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972556.1 protein_id gnl|my_center|LOCUS_36710 7032 4768 gene locus_tag LOCUS_36720 gene metE 7032 4768 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 protein_id gnl|my_center|LOCUS_36720 >Feature sequence281 180 1325 gene locus_tag LOCUS_36730 gene xylA 180 1325 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228546.1 protein_id gnl|my_center|LOCUS_36730 1354 2724 gene locus_tag LOCUS_36740 gene xylB 1354 2724 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_36740 2872 3525 gene locus_tag LOCUS_36750 2872 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 3965 5656 gene locus_tag LOCUS_36760 3965 5656 CDS product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224121.1 protein_id gnl|my_center|LOCUS_36760 6479 5787 gene locus_tag LOCUS_36770 6479 5787 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969543.1 protein_id gnl|my_center|LOCUS_36770 6613 7551 gene locus_tag LOCUS_36780 6613 7551 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence282 1086 373 gene locus_tag LOCUS_36790 1086 373 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971520.1 protein_id gnl|my_center|LOCUS_36790 1169 2383 gene locus_tag LOCUS_36800 1169 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_36800 2529 3197 gene locus_tag LOCUS_36810 gene cmk 2529 3197 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_36810 3334 4752 gene locus_tag LOCUS_36820 gene der 3334 4752 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_36820 5227 6474 gene locus_tag LOCUS_36830 5227 6474 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104242.1 protein_id gnl|my_center|LOCUS_36830 6474 7112 gene locus_tag LOCUS_36840 6474 7112 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726958.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence283 633 46 gene locus_tag LOCUS_36850 633 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 1592 933 gene locus_tag LOCUS_36860 1592 933 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_36860 1854 3428 gene locus_tag LOCUS_36870 gene cimA 1854 3428 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_36870 3820 4203 gene locus_tag LOCUS_36880 3820 4203 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730775.1 protein_id gnl|my_center|LOCUS_36880 4204 5325 gene locus_tag LOCUS_36890 4204 5325 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_36890 5322 5987 gene locus_tag LOCUS_36900 gene wag31 5322 5987 CDS product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411131.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence284 1086 118 gene locus_tag LOCUS_36910 1086 118 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_36910 2187 1162 gene locus_tag LOCUS_36920 2187 1162 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226230.1 protein_id gnl|my_center|LOCUS_36920 2410 6165 gene locus_tag LOCUS_36930 2410 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 7230 6250 gene locus_tag LOCUS_36940 7230 6250 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_36940 >Feature sequence285 1734 367 gene locus_tag LOCUS_36950 1734 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 1950 2678 gene locus_tag LOCUS_36960 1950 2678 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_36960 2806 2994 gene locus_tag LOCUS_36970 2806 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36970 4467 3520 gene locus_tag LOCUS_36980 4467 3520 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_36980 4586 5059 gene locus_tag LOCUS_36990 gene uraD 4586 5059 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076325.1 protein_id gnl|my_center|LOCUS_36990 5056 5403 gene locus_tag LOCUS_37000 gene uraH 5056 5403 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223819.1 protein_id gnl|my_center|LOCUS_37000 5405 6265 gene locus_tag LOCUS_37010 gene pucL 5405 6265 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_37010 6269 7141 gene locus_tag LOCUS_37020 6269 7141 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223811.1 protein_id gnl|my_center|LOCUS_37020 >Feature sequence286 496 1644 gene locus_tag LOCUS_37030 496 1644 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229059.1 protein_id gnl|my_center|LOCUS_37030 1641 2045 gene locus_tag LOCUS_37040 1641 2045 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_37040 2268 2086 gene locus_tag LOCUS_37050 2268 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 2186 3118 gene locus_tag LOCUS_37060 2186 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 3933 3181 gene locus_tag LOCUS_37070 3933 3181 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_37070 5819 3933 gene locus_tag LOCUS_37080 5819 3933 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_37080 6631 5846 gene locus_tag LOCUS_37090 6631 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_37090 7594 6944 gene locus_tag LOCUS_37100 7594 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 >Feature sequence287 1448 135 gene locus_tag LOCUS_37110 1448 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 4417 2057 gene locus_tag LOCUS_37120 4417 2057 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_37120 5475 5176 gene locus_tag LOCUS_37130 5475 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 7332 5584 gene locus_tag LOCUS_37140 7332 5584 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence288 230 2146 gene locus_tag LOCUS_37150 gene pknB 230 2146 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_37150 2881 2303 gene locus_tag LOCUS_37160 2881 2303 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_37160 3046 3291 gene locus_tag LOCUS_37170 3046 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 4264 3398 gene locus_tag LOCUS_37180 4264 3398 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_37180 4915 4385 gene locus_tag LOCUS_37190 4915 4385 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_37190 5057 5530 gene locus_tag LOCUS_37200 5057 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 <7594 5592 gene locus_tag LOCUS_37210 <7594 5592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041449606.1:AAA family ATPase >Feature sequence289 1190 2545 gene locus_tag LOCUS_37220 1190 2545 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803742.1 protein_id gnl|my_center|LOCUS_37220 2552 3520 gene locus_tag LOCUS_37230 2552 3520 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_37230 3517 4341 gene locus_tag LOCUS_37240 3517 4341 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 protein_id gnl|my_center|LOCUS_37240 4433 5581 gene locus_tag LOCUS_37250 4433 5581 CDS product glycoside hydrolase family 68 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965080.1 protein_id gnl|my_center|LOCUS_37250 6904 5642 gene locus_tag LOCUS_37260 6904 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 >Feature sequence290 282 1427 gene locus_tag LOCUS_37270 282 1427 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027309.1 protein_id gnl|my_center|LOCUS_37270 2796 1888 gene locus_tag LOCUS_37280 2796 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 2791 2716 gene locus_tag LOCUS_t00390 2791 2716 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2929 3507 gene locus_tag LOCUS_37290 2929 3507 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_37290 3921 4964 gene locus_tag LOCUS_37300 3921 4964 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227931.1 protein_id gnl|my_center|LOCUS_37300 5068 6036 gene locus_tag LOCUS_37310 5068 6036 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227932.1 protein_id gnl|my_center|LOCUS_37310 6033 7178 gene locus_tag LOCUS_37320 6033 7178 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093952556.1 protein_id gnl|my_center|LOCUS_37320 >Feature sequence291 <1 1008 gene locus_tag LOCUS_37330 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974853.1:NAD(P)/FAD-dependent oxidoreductase 3120 1141 gene locus_tag LOCUS_37340 3120 1141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_37340 4850 3117 gene locus_tag LOCUS_37350 4850 3117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_37350 5193 5363 gene locus_tag LOCUS_37360 5193 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 5410 5649 gene locus_tag LOCUS_37370 5410 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 5887 6129 gene locus_tag LOCUS_37380 5887 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 6538 7047 gene locus_tag LOCUS_37390 6538 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 7044 7265 gene locus_tag LOCUS_37400 7044 7265 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228849.1 protein_id gnl|my_center|LOCUS_37400 >Feature sequence292 2708 1017 gene locus_tag LOCUS_37410 2708 1017 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_37410 4269 2782 gene locus_tag LOCUS_37420 4269 2782 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971785.1 protein_id gnl|my_center|LOCUS_37420 5948 4347 gene locus_tag LOCUS_37430 5948 4347 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_37430 6006 7499 gene locus_tag LOCUS_37440 6006 7499 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027283.1 protein_id gnl|my_center|LOCUS_37440 >Feature sequence293 828 58 gene locus_tag LOCUS_37450 828 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 3160 992 gene locus_tag LOCUS_37460 3160 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 3633 3175 gene locus_tag LOCUS_37470 3633 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 5129 3990 gene locus_tag LOCUS_37480 5129 3990 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_37480 5508 5122 gene locus_tag LOCUS_37490 5508 5122 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172803.1 protein_id gnl|my_center|LOCUS_37490 5721 6455 gene locus_tag LOCUS_37500 5721 6455 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230869.1 protein_id gnl|my_center|LOCUS_37500 6670 6362 gene locus_tag LOCUS_37510 6670 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 7330 6743 gene locus_tag LOCUS_37520 7330 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 >Feature sequence294 1138 218 gene locus_tag LOCUS_37530 1138 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 2070 1135 gene locus_tag LOCUS_37540 2070 1135 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122762.1 protein_id gnl|my_center|LOCUS_37540 3581 2319 gene locus_tag LOCUS_37550 3581 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 4495 3581 gene locus_tag LOCUS_37560 gene cysD 4495 3581 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_37560 5274 4507 gene locus_tag LOCUS_37570 5274 4507 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_37570 6744 5284 gene locus_tag LOCUS_37580 6744 5284 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_37580 6823 7449 gene locus_tag LOCUS_37590 6823 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195773.1 protein_id gnl|my_center|LOCUS_37590 >Feature sequence295 194 652 gene locus_tag LOCUS_37600 194 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 663 1088 gene locus_tag LOCUS_37610 663 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 1237 1680 gene locus_tag LOCUS_37620 1237 1680 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974639.1 protein_id gnl|my_center|LOCUS_37620 1686 2939 gene locus_tag LOCUS_37630 1686 2939 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_37630 2917 3471 gene locus_tag LOCUS_37640 gene thpR 2917 3471 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_37640 4541 3573 gene locus_tag LOCUS_37650 4541 3573 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974629.1 protein_id gnl|my_center|LOCUS_37650 5174 4593 gene locus_tag LOCUS_37660 5174 4593 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200072.1 protein_id gnl|my_center|LOCUS_37660 5216 6388 gene locus_tag LOCUS_37670 5216 6388 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 protein_id gnl|my_center|LOCUS_37670 >Feature sequence296 887 600 gene locus_tag LOCUS_37680 887 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 1882 938 gene locus_tag LOCUS_37690 1882 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 3788 2706 gene locus_tag LOCUS_37700 gene ychF 3788 2706 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_37700 3882 5204 gene locus_tag LOCUS_37710 3882 5204 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_37710 5215 5709 gene locus_tag LOCUS_37720 5215 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 6717 5752 gene locus_tag LOCUS_37730 6717 5752 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_37730 >Feature sequence297 2144 966 gene locus_tag LOCUS_37740 2144 966 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_37740 2385 3815 gene locus_tag LOCUS_37750 gene hemG 2385 3815 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_37750 3903 4604 gene locus_tag LOCUS_37760 3903 4604 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_37760 4722 5315 gene locus_tag LOCUS_37770 4722 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 5729 5319 gene locus_tag LOCUS_37780 gene msrB 5729 5319 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224520.1 protein_id gnl|my_center|LOCUS_37780 6131 7126 gene locus_tag LOCUS_37790 gene ligD 6131 7126 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence298 1543 431 gene locus_tag LOCUS_37800 1543 431 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230788.1 protein_id gnl|my_center|LOCUS_37800 1940 1635 gene locus_tag LOCUS_37810 1940 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 5947 1961 gene locus_tag LOCUS_37820 5947 1961 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224114.1 protein_id gnl|my_center|LOCUS_37820 6090 7484 gene locus_tag LOCUS_37830 gene eccD 6090 7484 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 protein_id gnl|my_center|LOCUS_37830 >Feature sequence299 94 18 gene locus_tag LOCUS_t00400 94 18 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3075 178 gene locus_tag LOCUS_37840 3075 178 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_37840 4380 3334 gene locus_tag LOCUS_37850 4380 3334 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_37850 4850 4428 gene locus_tag LOCUS_37860 4850 4428 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_37860 5959 4889 gene locus_tag LOCUS_37870 5959 4889 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_37870 6042 7307 gene locus_tag LOCUS_37880 6042 7307 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_37880 >Feature sequence300 528 1532 gene locus_tag LOCUS_37890 528 1532 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_37890 1689 2066 gene locus_tag LOCUS_37900 1689 2066 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 protein_id gnl|my_center|LOCUS_37900 2242 2027 gene locus_tag LOCUS_37910 2242 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 2877 2239 gene locus_tag LOCUS_37920 2877 2239 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_37920 4923 3301 gene locus_tag LOCUS_37930 gene groL 4923 3301 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_37930 5308 4997 gene locus_tag LOCUS_37940 gene groES 5308 4997 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418028.1 protein_id gnl|my_center|LOCUS_37940 6221 5280 gene locus_tag LOCUS_37950 6221 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 6354 6908 gene locus_tag LOCUS_37960 6354 6908 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369894.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence301 141 1349 gene locus_tag LOCUS_37970 141 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 2160 1459 gene locus_tag LOCUS_37980 2160 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 2777 2133 gene locus_tag LOCUS_37990 2777 2133 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990826.1 protein_id gnl|my_center|LOCUS_37990 2899 3489 gene locus_tag LOCUS_38000 2899 3489 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030034.1 protein_id gnl|my_center|LOCUS_38000 3682 3509 gene locus_tag LOCUS_38010 3682 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 4739 3717 gene locus_tag LOCUS_38020 4739 3717 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228279.1 protein_id gnl|my_center|LOCUS_38020 5136 4741 gene locus_tag LOCUS_38030 5136 4741 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228278.1 protein_id gnl|my_center|LOCUS_38030 5211 5660 gene locus_tag LOCUS_38040 5211 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 5657 6910 gene locus_tag LOCUS_38050 5657 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence302 405 94 gene locus_tag LOCUS_38060 405 94 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174185.1 protein_id gnl|my_center|LOCUS_38060 937 419 gene locus_tag LOCUS_38070 937 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 1032 1754 gene locus_tag LOCUS_38080 1032 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 1748 3010 gene locus_tag LOCUS_38090 gene mycP 1748 3010 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_38090 3020 3955 gene locus_tag LOCUS_38100 3020 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 3949 5121 gene locus_tag LOCUS_38110 gene mycP 3949 5121 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111995.1 protein_id gnl|my_center|LOCUS_38110 5230 5598 gene locus_tag LOCUS_38120 5230 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 5586 5906 gene locus_tag LOCUS_38130 5586 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence303 466 852 gene locus_tag LOCUS_38140 466 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 985 1308 gene locus_tag LOCUS_38150 985 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 2360 1305 gene locus_tag LOCUS_38160 2360 1305 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230370.1 protein_id gnl|my_center|LOCUS_38160 2497 3288 gene locus_tag LOCUS_38170 2497 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 3635 5296 gene locus_tag LOCUS_38180 3635 5296 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804967.1 protein_id gnl|my_center|LOCUS_38180 5320 6291 gene locus_tag LOCUS_38190 5320 6291 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030392.1 protein_id gnl|my_center|LOCUS_38190 6303 7199 gene locus_tag LOCUS_38200 6303 7199 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804969.1 protein_id gnl|my_center|LOCUS_38200 >Feature sequence304 2823 412 gene locus_tag LOCUS_38210 2823 412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_38210 3587 2823 gene locus_tag LOCUS_38220 3587 2823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_38220 3919 4614 gene locus_tag LOCUS_38230 3919 4614 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467764.1 protein_id gnl|my_center|LOCUS_38230 4625 5794 gene locus_tag LOCUS_38240 gene vanS-Sc 4625 5794 CDS product VanSc-type vancomycin resistance histidine kinase VanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975349.1 protein_id gnl|my_center|LOCUS_38240 6433 5960 gene locus_tag LOCUS_38250 6433 5960 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229828.1 protein_id gnl|my_center|LOCUS_38250 >Feature sequence305 483 163 gene locus_tag LOCUS_38260 483 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 1652 609 gene locus_tag LOCUS_38270 1652 609 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_38270 1755 2534 gene locus_tag LOCUS_38280 1755 2534 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_38280 2967 2545 gene locus_tag LOCUS_38290 gene arfB 2967 2545 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_38290 3144 3971 gene locus_tag LOCUS_38300 3144 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 4007 4585 gene locus_tag LOCUS_38310 4007 4585 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804764.1 protein_id gnl|my_center|LOCUS_38310 4697 7057 gene locus_tag LOCUS_38320 gene lon 4697 7057 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030152.1 protein_id gnl|my_center|LOCUS_38320 >Feature sequence306 1635 2564 gene locus_tag LOCUS_38330 1635 2564 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950365.1 protein_id gnl|my_center|LOCUS_38330 2577 3527 gene locus_tag LOCUS_38340 2577 3527 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_38340 3524 4861 gene locus_tag LOCUS_38350 3524 4861 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_38350 4884 5675 gene locus_tag LOCUS_38360 4884 5675 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_38360 6869 5715 gene locus_tag LOCUS_38370 6869 5715 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_38370 6925 7242 gene locus_tag LOCUS_38380 6925 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence307 218 1297 gene locus_tag LOCUS_38390 218 1297 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_38390 2576 1347 gene locus_tag LOCUS_38400 2576 1347 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230104.1 protein_id gnl|my_center|LOCUS_38400 3691 2846 gene locus_tag LOCUS_38410 3691 2846 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731143.1 protein_id gnl|my_center|LOCUS_38410 4219 3794 gene locus_tag LOCUS_38420 4219 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 4585 4226 gene locus_tag LOCUS_38430 4585 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 4875 6101 gene locus_tag LOCUS_38440 4875 6101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618904.1 protein_id gnl|my_center|LOCUS_38440 6139 6957 gene locus_tag LOCUS_38450 6139 6957 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971512.1 protein_id gnl|my_center|LOCUS_38450 >Feature sequence308 890 279 gene locus_tag LOCUS_38460 890 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 1075 887 gene locus_tag LOCUS_38470 1075 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 1290 1075 gene locus_tag LOCUS_38480 1290 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 2141 1290 gene locus_tag LOCUS_38490 2141 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 2989 2138 gene locus_tag LOCUS_38500 2989 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 3186 2986 gene locus_tag LOCUS_38510 3186 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 3761 3186 gene locus_tag LOCUS_38520 3761 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 4201 3758 gene locus_tag LOCUS_38530 4201 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 4392 4198 gene locus_tag LOCUS_38540 4392 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 4985 4392 gene locus_tag LOCUS_38550 4985 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 5248 5021 gene locus_tag LOCUS_38560 5248 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 6162 5248 gene locus_tag LOCUS_38570 6162 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 6377 6159 gene locus_tag LOCUS_38580 6377 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 6514 6903 gene locus_tag LOCUS_38590 6514 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 >Feature sequence309 836 2863 gene locus_tag LOCUS_38600 836 2863 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_38600 3849 3049 gene locus_tag LOCUS_38610 3849 3049 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_38610 4298 3864 gene locus_tag LOCUS_38620 gene aroQ 4298 3864 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052141.1 protein_id gnl|my_center|LOCUS_38620 5371 4295 gene locus_tag LOCUS_38630 gene aroB 5371 4295 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_38630 5880 5368 gene locus_tag LOCUS_38640 5880 5368 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_38640 7073 5895 gene locus_tag LOCUS_38650 gene aroC 7073 5895 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_38650 >Feature sequence310 <1 764 gene locus_tag LOCUS_38660 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113360.1:LLM class flavin-dependent oxidoreductase 761 3034 gene locus_tag LOCUS_38670 761 3034 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728553.1 protein_id gnl|my_center|LOCUS_38670 3143 4282 gene locus_tag LOCUS_38680 3143 4282 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089192.1 protein_id gnl|my_center|LOCUS_38680 4391 4852 gene locus_tag LOCUS_38690 4391 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 5842 5138 gene locus_tag LOCUS_38700 5842 5138 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_38700 5957 6976 gene locus_tag LOCUS_38710 5957 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 >Feature sequence311 734 1411 gene locus_tag LOCUS_38720 734 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029707.1 protein_id gnl|my_center|LOCUS_38720 1413 2201 gene locus_tag LOCUS_38730 1413 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_38730 2198 3514 gene locus_tag LOCUS_38740 2198 3514 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_38740 3514 4422 gene locus_tag LOCUS_38750 3514 4422 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029709.1 protein_id gnl|my_center|LOCUS_38750 4419 5393 gene locus_tag LOCUS_38760 4419 5393 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 protein_id gnl|my_center|LOCUS_38760 5393 5635 gene locus_tag LOCUS_38770 5393 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 5632 6078 gene locus_tag LOCUS_38780 5632 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 6204 6569 gene locus_tag LOCUS_38790 6204 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 6749 7150 gene locus_tag LOCUS_38800 6749 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence312 1218 100 gene locus_tag LOCUS_38810 1218 100 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_38810 1437 2333 gene locus_tag LOCUS_38820 1437 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 2354 3250 gene locus_tag LOCUS_38830 2354 3250 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_38830 6002 3291 gene locus_tag LOCUS_38840 6002 3291 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_38840 6987 6076 gene locus_tag LOCUS_38850 6987 6076 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_38850 >Feature sequence313 1254 73 gene locus_tag LOCUS_38860 1254 73 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_38860 2603 1251 gene locus_tag LOCUS_38870 2603 1251 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222506.1 protein_id gnl|my_center|LOCUS_38870 3345 2647 gene locus_tag LOCUS_38880 3345 2647 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_38880 4300 3383 gene locus_tag LOCUS_38890 4300 3383 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015533.1 protein_id gnl|my_center|LOCUS_38890 4441 5403 gene locus_tag LOCUS_38900 4441 5403 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085761.1 protein_id gnl|my_center|LOCUS_38900 5400 6164 gene locus_tag LOCUS_38910 5400 6164 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086424.1 protein_id gnl|my_center|LOCUS_38910 >Feature sequence314 <1 760 gene locus_tag LOCUS_38920 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764311.1:alpha/beta hydrolase-fold protein 911 750 gene locus_tag LOCUS_38930 911 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 980 2338 gene locus_tag LOCUS_38940 980 2338 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 protein_id gnl|my_center|LOCUS_38940 2408 3349 gene locus_tag LOCUS_38950 2408 3349 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031643.1 protein_id gnl|my_center|LOCUS_38950 3349 4230 gene locus_tag LOCUS_38960 3349 4230 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_38960 4275 6002 gene locus_tag LOCUS_38970 4275 6002 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027630.1 protein_id gnl|my_center|LOCUS_38970 6177 7163 gene locus_tag LOCUS_38980 6177 7163 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029602.1 protein_id gnl|my_center|LOCUS_38980 >Feature sequence315 72 902 gene locus_tag LOCUS_38990 72 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 1190 954 gene locus_tag LOCUS_39000 1190 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 1929 1372 gene locus_tag LOCUS_39010 1929 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 2106 2333 gene locus_tag LOCUS_39020 2106 2333 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875417.1 protein_id gnl|my_center|LOCUS_39020 2611 2288 gene locus_tag LOCUS_39030 2611 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 2649 3212 gene locus_tag LOCUS_39040 2649 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 3209 3346 gene locus_tag LOCUS_39050 3209 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 3343 3597 gene locus_tag LOCUS_39060 3343 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 3594 3851 gene locus_tag LOCUS_39070 3594 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 3848 4738 gene locus_tag LOCUS_39080 3848 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 4735 5553 gene locus_tag LOCUS_39090 4735 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 5624 6019 gene locus_tag LOCUS_39100 5624 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 6068 6802 gene locus_tag LOCUS_39110 6068 6802 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_39110 6866 7039 gene locus_tag LOCUS_39120 6866 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 >Feature sequence316 2329 1229 gene locus_tag LOCUS_39130 2329 1229 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_39130 2457 3950 gene locus_tag LOCUS_39140 2457 3950 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230396.1 protein_id gnl|my_center|LOCUS_39140 4038 5564 gene locus_tag LOCUS_39150 4038 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 6633 5671 gene locus_tag LOCUS_39160 gene menC 6633 5671 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_39160 >Feature sequence317 1259 42 gene locus_tag LOCUS_39170 1259 42 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_39170 1431 3683 gene locus_tag LOCUS_39180 1431 3683 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_39180 4150 5709 gene locus_tag LOCUS_39190 gene lnt 4150 5709 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_39190 5709 6452 gene locus_tag LOCUS_39200 5709 6452 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_39200 6530 7027 gene locus_tag LOCUS_39210 6530 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence318 3 404 gene locus_tag LOCUS_39220 3 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 464 1171 gene locus_tag LOCUS_39230 464 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 1210 3315 gene locus_tag LOCUS_39240 1210 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 3754 3900 gene locus_tag LOCUS_39250 3754 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 3951 4820 gene locus_tag LOCUS_39260 3951 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 4828 5073 gene locus_tag LOCUS_39270 4828 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 5095 6027 gene locus_tag LOCUS_39280 5095 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 6090 6704 gene locus_tag LOCUS_39290 6090 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 >Feature sequence319 660 85 gene locus_tag LOCUS_39300 660 85 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_39300 1006 641 gene locus_tag LOCUS_39310 1006 641 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_39310 1427 1020 gene locus_tag LOCUS_39320 1427 1020 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_39320 4045 1424 gene locus_tag LOCUS_39330 4045 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 4091 4969 gene locus_tag LOCUS_39340 4091 4969 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_39340 5265 5516 gene locus_tag LOCUS_39350 5265 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224191.1 protein_id gnl|my_center|LOCUS_39350 5559 7076 gene locus_tag LOCUS_39360 5559 7076 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224190.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence320 <1 933 gene locus_tag LOCUS_39370 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005093101.1:cytochrome c oxidase assembly protein 1936 863 gene locus_tag LOCUS_39380 1936 863 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_39380 2105 3418 gene locus_tag LOCUS_39390 2105 3418 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114086.1 protein_id gnl|my_center|LOCUS_39390 3485 4438 gene locus_tag LOCUS_39400 3485 4438 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051281.1 protein_id gnl|my_center|LOCUS_39400 4422 5330 gene locus_tag LOCUS_39410 4422 5330 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032738944.1 protein_id gnl|my_center|LOCUS_39410 5366 7003 gene locus_tag LOCUS_39420 5366 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 >Feature sequence321 1289 75 gene locus_tag LOCUS_39430 1289 75 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028051.1 protein_id gnl|my_center|LOCUS_39430 3482 1347 gene locus_tag LOCUS_39440 3482 1347 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396108.1 protein_id gnl|my_center|LOCUS_39440 3766 5418 gene locus_tag LOCUS_39450 3766 5418 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224032.1 protein_id gnl|my_center|LOCUS_39450 5592 5813 gene locus_tag LOCUS_39460 5592 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence322 825 133 gene locus_tag LOCUS_39470 825 133 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267506.1 protein_id gnl|my_center|LOCUS_39470 2337 877 gene locus_tag LOCUS_39480 2337 877 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_39480 3019 2381 gene locus_tag LOCUS_39490 3019 2381 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_39490 4215 3016 gene locus_tag LOCUS_39500 4215 3016 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_39500 4457 5257 gene locus_tag LOCUS_39510 4457 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 5250 5654 gene locus_tag LOCUS_39520 5250 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 >Feature sequence323 98 1546 gene locus_tag LOCUS_39530 98 1546 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028648.1 protein_id gnl|my_center|LOCUS_39530 2445 1570 gene locus_tag LOCUS_39540 2445 1570 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222195.1 protein_id gnl|my_center|LOCUS_39540 2511 3176 gene locus_tag LOCUS_39550 2511 3176 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093220.1 protein_id gnl|my_center|LOCUS_39550 3229 3825 gene locus_tag LOCUS_39560 3229 3825 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027620.1 protein_id gnl|my_center|LOCUS_39560 3907 4317 gene locus_tag LOCUS_39570 3907 4317 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728091.1 protein_id gnl|my_center|LOCUS_39570 4326 5099 gene locus_tag LOCUS_39580 gene modA 4326 5099 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_39580 5096 5905 gene locus_tag LOCUS_39590 5096 5905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_39590 5902 6933 gene locus_tag LOCUS_39600 5902 6933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_39600 >Feature sequence324 945 232 gene locus_tag LOCUS_39610 945 232 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971520.1 protein_id gnl|my_center|LOCUS_39610 1017 2171 gene locus_tag LOCUS_39620 1017 2171 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031785.1 protein_id gnl|my_center|LOCUS_39620 2550 4622 gene locus_tag LOCUS_39630 gene uvrC 2550 4622 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_39630 4845 5714 gene locus_tag LOCUS_39640 gene rapZ 4845 5714 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_39640 6718 5957 gene locus_tag LOCUS_39650 6718 5957 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_39650 6783 7013 gene locus_tag LOCUS_39660 6783 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence325 137 355 gene locus_tag LOCUS_39670 137 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 686 414 gene locus_tag LOCUS_39680 686 414 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_39680 970 683 gene locus_tag LOCUS_39690 gene relF 970 683 CDS product type II toxin-antitoxin system antitoxin RelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414599.1 protein_id gnl|my_center|LOCUS_39690 2779 1106 gene locus_tag LOCUS_39700 gene pruA 2779 1106 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_39700 3690 2779 gene locus_tag LOCUS_39710 3690 2779 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_39710 3774 4823 gene locus_tag LOCUS_39720 3774 4823 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_39720 5289 4828 gene locus_tag LOCUS_39730 5289 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 6411 5353 gene locus_tag LOCUS_39740 6411 5353 CDS product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 protein_id gnl|my_center|LOCUS_39740 >Feature sequence326 3196 590 gene locus_tag LOCUS_39750 3196 590 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229885.1 protein_id gnl|my_center|LOCUS_39750 3854 3315 gene locus_tag LOCUS_39760 3854 3315 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111221.1 protein_id gnl|my_center|LOCUS_39760 3961 6213 gene locus_tag LOCUS_39770 3961 6213 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_39770 >Feature sequence327 1412 93 gene locus_tag LOCUS_39780 1412 93 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972377.1 protein_id gnl|my_center|LOCUS_39780 1861 1418 gene locus_tag LOCUS_39790 1861 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 1957 2265 gene locus_tag LOCUS_39800 1957 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 2349 2951 gene locus_tag LOCUS_39810 2349 2951 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892887.1 protein_id gnl|my_center|LOCUS_39810 2968 3789 gene locus_tag LOCUS_39820 2968 3789 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080109.1 protein_id gnl|my_center|LOCUS_39820 3889 4905 gene locus_tag LOCUS_39830 3889 4905 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776787.1 protein_id gnl|my_center|LOCUS_39830 5701 4934 gene locus_tag LOCUS_39840 5701 4934 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082824.1 protein_id gnl|my_center|LOCUS_39840 >Feature sequence328 466 254 gene locus_tag LOCUS_39850 466 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 401 2371 gene locus_tag LOCUS_39860 401 2371 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410178.1 protein_id gnl|my_center|LOCUS_39860 4686 2449 gene locus_tag LOCUS_39870 gene katG 4686 2449 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_39870 5157 4720 gene locus_tag LOCUS_39880 5157 4720 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_39880 >Feature sequence329 253 104 gene locus_tag LOCUS_39890 253 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 1726 494 gene locus_tag LOCUS_39900 1726 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 1902 2120 gene locus_tag LOCUS_39910 1902 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 2117 2452 gene locus_tag LOCUS_39920 2117 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 4214 2691 gene locus_tag LOCUS_39930 4214 2691 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 protein_id gnl|my_center|LOCUS_39930 4578 5480 gene locus_tag LOCUS_39940 4578 5480 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_39940 5477 6415 gene locus_tag LOCUS_39950 5477 6415 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_39950 >Feature sequence330 1509 655 gene locus_tag LOCUS_39960 1509 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 1675 2628 gene locus_tag LOCUS_39970 1675 2628 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_39970 3701 2592 gene locus_tag LOCUS_39980 3701 2592 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_39980 4600 3698 gene locus_tag LOCUS_39990 4600 3698 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_39990 6711 4693 gene locus_tag LOCUS_40000 6711 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 >Feature sequence331 <1 1136 gene locus_tag LOCUS_40010 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222435.1:MinD/ParA family protein 1235 1324 gene locus_tag LOCUS_t00410 1235 1324 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1683 1492 gene locus_tag LOCUS_40020 1683 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 1745 2413 gene locus_tag LOCUS_40030 1745 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 4514 2469 gene locus_tag LOCUS_40040 4514 2469 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532328.1 protein_id gnl|my_center|LOCUS_40040 5968 4592 gene locus_tag LOCUS_40050 5968 4592 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728727.1 protein_id gnl|my_center|LOCUS_40050 6419 6030 gene locus_tag LOCUS_40060 6419 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence332 2019 373 gene locus_tag LOCUS_40070 2019 373 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908709.1 protein_id gnl|my_center|LOCUS_40070 3240 2242 gene locus_tag LOCUS_40080 gene bioB 3240 2242 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728886.1 protein_id gnl|my_center|LOCUS_40080 3991 3269 gene locus_tag LOCUS_40090 gene bioD 3991 3269 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742103.1 protein_id gnl|my_center|LOCUS_40090 4754 4026 gene locus_tag LOCUS_40100 4754 4026 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_40100 5938 4751 gene locus_tag LOCUS_40110 5938 4751 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111242.1 protein_id gnl|my_center|LOCUS_40110 >Feature sequence333 497 1240 gene locus_tag LOCUS_40120 497 1240 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 protein_id gnl|my_center|LOCUS_40120 1637 3778 gene locus_tag LOCUS_40130 gene helR 1637 3778 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728199.1 protein_id gnl|my_center|LOCUS_40130 4546 3788 gene locus_tag LOCUS_40140 4546 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 6108 4555 gene locus_tag LOCUS_40150 gene purB 6108 4555 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_40150 >Feature sequence334 1587 280 gene locus_tag LOCUS_40160 1587 280 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_40160 3036 1630 gene locus_tag LOCUS_40170 gene lysA 3036 1630 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_40170 4061 3165 gene locus_tag LOCUS_40180 4061 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 6294 4273 gene locus_tag LOCUS_40190 6294 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 6577 6831 gene locus_tag LOCUS_40200 6577 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 >Feature sequence335 1 441 gene locus_tag LOCUS_40210 1 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 451 885 gene locus_tag LOCUS_40220 451 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 902 1765 gene locus_tag LOCUS_40230 902 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 1762 3204 gene locus_tag LOCUS_40240 1762 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 4494 3388 gene locus_tag LOCUS_40250 4494 3388 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109278575.1 protein_id gnl|my_center|LOCUS_40250 4737 5126 gene locus_tag LOCUS_40260 4737 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 5123 5467 gene locus_tag LOCUS_40270 5123 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 6005 5784 gene locus_tag LOCUS_40280 6005 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 >Feature sequence336 454 3180 gene locus_tag LOCUS_40290 454 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 3199 4848 gene locus_tag LOCUS_40300 3199 4848 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_40300 4848 6053 gene locus_tag LOCUS_40310 4848 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence337 1490 843 gene locus_tag LOCUS_40320 1490 843 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920592.1 protein_id gnl|my_center|LOCUS_40320 3203 1629 gene locus_tag LOCUS_40330 3203 1629 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_40330 6689 3405 gene locus_tag LOCUS_40340 6689 3405 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525251.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence338 1327 290 gene locus_tag LOCUS_40350 gene tsaD 1327 290 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_40350 1849 1373 gene locus_tag LOCUS_40360 gene rimI 1849 1373 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_40360 2568 1846 gene locus_tag LOCUS_40370 gene tsaB 2568 1846 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_40370 3221 2667 gene locus_tag LOCUS_40380 3221 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 3859 3224 gene locus_tag LOCUS_40390 3859 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 4564 4103 gene locus_tag LOCUS_40400 gene tsaE 4564 4103 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_40400 5613 4561 gene locus_tag LOCUS_40410 5613 4561 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_40410 6783 5638 gene locus_tag LOCUS_40420 gene alr 6783 5638 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_40420 >Feature sequence339 2203 620 gene locus_tag LOCUS_40430 2203 620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027955.1 protein_id gnl|my_center|LOCUS_40430 2520 4868 gene locus_tag LOCUS_40440 2520 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 4971 6674 gene locus_tag LOCUS_40450 4971 6674 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051713212.1 protein_id gnl|my_center|LOCUS_40450 >Feature sequence340 <1 777 gene locus_tag LOCUS_40460 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162495298.1:SpoIIE family protein phosphatase 774 1532 gene locus_tag LOCUS_40470 774 1532 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257171.1 protein_id gnl|my_center|LOCUS_40470 1672 2226 gene locus_tag LOCUS_40480 gene rpoE 1672 2226 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_40480 2325 3014 gene locus_tag LOCUS_40490 2325 3014 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781894.1 protein_id gnl|my_center|LOCUS_40490 3011 3859 gene locus_tag LOCUS_40500 3011 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 3955 6165 gene locus_tag LOCUS_40510 3955 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 >Feature sequence341 43 1260 gene locus_tag LOCUS_40520 43 1260 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_40520 1322 1582 gene locus_tag LOCUS_40530 1322 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 2207 1608 gene locus_tag LOCUS_40540 2207 1608 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973719.1 protein_id gnl|my_center|LOCUS_40540 3676 2204 gene locus_tag LOCUS_40550 3676 2204 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_40550 4266 3706 gene locus_tag LOCUS_40560 4266 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 4438 5115 gene locus_tag LOCUS_40570 4438 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 5400 6788 gene locus_tag LOCUS_40580 5400 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 >Feature sequence342 1031 231 gene locus_tag LOCUS_40590 1031 231 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_40590 1705 1109 gene locus_tag LOCUS_40600 1705 1109 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_40600 2802 1702 gene locus_tag LOCUS_40610 2802 1702 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_40610 3931 2795 gene locus_tag LOCUS_40620 3931 2795 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_40620 4826 3924 gene locus_tag LOCUS_40630 4826 3924 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_40630 5245 4976 gene locus_tag LOCUS_40640 5245 4976 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729016.1 protein_id gnl|my_center|LOCUS_40640 5379 6740 gene locus_tag LOCUS_40650 5379 6740 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390922.1 protein_id gnl|my_center|LOCUS_40650 >Feature sequence343 <1 704 gene locus_tag LOCUS_40660 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730837.1:S9 family peptidase 701 1726 gene locus_tag LOCUS_40670 gene mgrA 701 1726 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_40670 2737 2228 gene locus_tag LOCUS_40680 2737 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 5214 2815 gene locus_tag LOCUS_40690 5214 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 5265 5702 gene locus_tag LOCUS_40700 5265 5702 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027656.1 protein_id gnl|my_center|LOCUS_40700 5801 6814 gene locus_tag LOCUS_40710 5801 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 >Feature sequence344 1540 35 gene locus_tag LOCUS_40720 1540 35 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479846.1 protein_id gnl|my_center|LOCUS_40720 1637 2290 gene locus_tag LOCUS_40730 1637 2290 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 protein_id gnl|my_center|LOCUS_40730 2485 2826 gene locus_tag LOCUS_40740 2485 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 2823 5546 gene locus_tag LOCUS_40750 2823 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 5980 5570 gene locus_tag LOCUS_40760 5980 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 >Feature sequence345 796 365 gene locus_tag LOCUS_40770 796 365 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782036.1 protein_id gnl|my_center|LOCUS_40770 962 783 gene locus_tag LOCUS_40780 962 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 925 2067 gene locus_tag LOCUS_40790 925 2067 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182893188.1 protein_id gnl|my_center|LOCUS_40790 2755 2357 gene locus_tag LOCUS_40800 2755 2357 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227867.1 protein_id gnl|my_center|LOCUS_40800 2871 4349 gene locus_tag LOCUS_40810 2871 4349 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485352.1 protein_id gnl|my_center|LOCUS_40810 4444 5025 gene locus_tag LOCUS_40820 4444 5025 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_40820 5066 5644 gene locus_tag LOCUS_40830 5066 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40830 5557 5886 gene locus_tag LOCUS_40840 5557 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 6752 5892 gene locus_tag LOCUS_40850 6752 5892 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_40850 >Feature sequence346 187 4833 gene locus_tag LOCUS_40860 187 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 6458 5022 gene locus_tag LOCUS_40870 6458 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 >Feature sequence347 1816 308 gene locus_tag LOCUS_40880 gene miaB 1816 308 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_40880 1897 2439 gene locus_tag LOCUS_40890 1897 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 2624 3388 gene locus_tag LOCUS_40900 2624 3388 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_40900 3403 4287 gene locus_tag LOCUS_40910 3403 4287 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_40910 4321 4992 gene locus_tag LOCUS_40920 4321 4992 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057178.1 protein_id gnl|my_center|LOCUS_40920 5043 5864 gene locus_tag LOCUS_40930 5043 5864 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_40930 5945 6682 gene locus_tag LOCUS_40940 5945 6682 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_40940 >Feature sequence348 1687 1103 gene locus_tag LOCUS_40950 1687 1103 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_40950 3123 1684 gene locus_tag LOCUS_40960 3123 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 4517 3120 gene locus_tag LOCUS_40970 gene paaF 4517 3120 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064014.1 protein_id gnl|my_center|LOCUS_40970 5199 4510 gene locus_tag LOCUS_40980 5199 4510 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_40980 6022 5225 gene locus_tag LOCUS_40990 6022 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 >Feature sequence349 591 196 gene locus_tag LOCUS_41000 591 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_41000 844 1371 gene locus_tag LOCUS_41010 844 1371 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_41010 1389 2198 gene locus_tag LOCUS_41020 1389 2198 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_41020 2195 3274 gene locus_tag LOCUS_41030 2195 3274 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_41030 3271 4902 gene locus_tag LOCUS_41040 3271 4902 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_41040 6600 5431 gene locus_tag LOCUS_41050 6600 5431 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_41050 >Feature sequence350 146 1147 gene locus_tag LOCUS_41060 146 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 1183 2646 gene locus_tag LOCUS_41070 1183 2646 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222228.1 protein_id gnl|my_center|LOCUS_41070 3228 4604 gene locus_tag LOCUS_41080 3228 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 5031 4624 gene locus_tag LOCUS_41090 5031 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 6393 5308 gene locus_tag LOCUS_41100 6393 5308 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_41100 >Feature sequence351 353 126 gene locus_tag LOCUS_41110 353 126 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_41110 1464 541 gene locus_tag LOCUS_41120 1464 541 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031333.1 protein_id gnl|my_center|LOCUS_41120 2887 1472 gene locus_tag LOCUS_41130 2887 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 3186 3473 gene locus_tag LOCUS_41140 3186 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 3544 4134 gene locus_tag LOCUS_41150 3544 4134 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200072.1 protein_id gnl|my_center|LOCUS_41150 4897 4154 gene locus_tag LOCUS_41160 4897 4154 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878120.1 protein_id gnl|my_center|LOCUS_41160 5091 6380 gene locus_tag LOCUS_41170 gene cysS 5091 6380 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_41170 >Feature sequence352 >Feature sequence353 1117 155 gene locus_tag LOCUS_41180 1117 155 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_41180 2038 1352 gene locus_tag LOCUS_41190 2038 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230700.1 protein_id gnl|my_center|LOCUS_41190 2902 2162 gene locus_tag LOCUS_41200 2902 2162 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_41200 3666 2899 gene locus_tag LOCUS_41210 gene map 3666 2899 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_41210 3721 3996 gene locus_tag LOCUS_41220 3721 3996 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972569.1 protein_id gnl|my_center|LOCUS_41220 4198 4722 gene locus_tag LOCUS_41230 4198 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 5785 4751 gene locus_tag LOCUS_41240 5785 4751 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_41240 >Feature sequence354 542 120 gene locus_tag LOCUS_41250 542 120 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886487.1 protein_id gnl|my_center|LOCUS_41250 783 1121 gene locus_tag LOCUS_41260 783 1121 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029816.1 protein_id gnl|my_center|LOCUS_41260 1624 1190 gene locus_tag LOCUS_41270 1624 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030561.1 protein_id gnl|my_center|LOCUS_41270 2889 1840 gene locus_tag LOCUS_41280 2889 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 2970 4124 gene locus_tag LOCUS_41290 2970 4124 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275497.1 protein_id gnl|my_center|LOCUS_41290 5418 4270 gene locus_tag LOCUS_41300 5418 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 5573 6592 gene locus_tag LOCUS_41310 5573 6592 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 protein_id gnl|my_center|LOCUS_41310 >Feature sequence355 1950 1660 gene locus_tag LOCUS_41320 1950 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 3648 2170 gene locus_tag LOCUS_41330 3648 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 4553 3654 gene locus_tag LOCUS_41340 4553 3654 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224285.1 protein_id gnl|my_center|LOCUS_41340 >Feature sequence356 412 86 gene locus_tag LOCUS_41350 412 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 756 421 gene locus_tag LOCUS_41360 756 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 1668 808 gene locus_tag LOCUS_41370 1668 808 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 protein_id gnl|my_center|LOCUS_41370 1748 3175 gene locus_tag LOCUS_41380 1748 3175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229299.1 protein_id gnl|my_center|LOCUS_41380 3706 3341 gene locus_tag LOCUS_41390 3706 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 4034 3717 gene locus_tag LOCUS_41400 4034 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 4157 4432 gene locus_tag LOCUS_41410 4157 4432 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727177.1 protein_id gnl|my_center|LOCUS_41410 6161 4572 gene locus_tag LOCUS_41420 6161 4572 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_41420 >Feature sequence357 1795 2706 gene locus_tag LOCUS_41430 1795 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 2703 3914 gene locus_tag LOCUS_41440 2703 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 3973 4149 gene locus_tag LOCUS_41450 3973 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 4153 4731 gene locus_tag LOCUS_41460 4153 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 4748 5089 gene locus_tag LOCUS_41470 4748 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 5103 5354 gene locus_tag LOCUS_41480 5103 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 5351 5767 gene locus_tag LOCUS_41490 5351 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 5851 6408 gene locus_tag LOCUS_41500 5851 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence358 2065 1547 gene locus_tag LOCUS_41510 2065 1547 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_41510 2212 3078 gene locus_tag LOCUS_41520 2212 3078 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_41520 3079 3312 gene locus_tag LOCUS_41530 3079 3312 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_41530 3430 3705 gene locus_tag LOCUS_41540 3430 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 4327 3749 gene locus_tag LOCUS_41550 4327 3749 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_41550 4479 5348 gene locus_tag LOCUS_41560 4479 5348 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535503.1 protein_id gnl|my_center|LOCUS_41560 6585 5311 gene locus_tag LOCUS_41570 6585 5311 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223158.1 protein_id gnl|my_center|LOCUS_41570 >Feature sequence359 <1 2497 gene locus_tag LOCUS_41580 <1 2497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110226.1:DUF4173 domain-containing protein 2510 4051 gene locus_tag LOCUS_41590 2510 4051 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804106.1 protein_id gnl|my_center|LOCUS_41590 4939 4073 gene locus_tag LOCUS_41600 4939 4073 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 protein_id gnl|my_center|LOCUS_41600 >Feature sequence360 83 541 gene locus_tag LOCUS_41610 83 541 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900701.1 protein_id gnl|my_center|LOCUS_41610 513 2306 gene locus_tag LOCUS_41620 513 2306 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_41620 2328 2498 gene locus_tag LOCUS_41630 2328 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 2498 4426 gene locus_tag LOCUS_41640 2498 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 4438 5178 gene locus_tag LOCUS_41650 4438 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 5244 6464 gene locus_tag LOCUS_41660 5244 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 >Feature sequence361 742 2 gene locus_tag LOCUS_41670 742 2 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_41670 1569 739 gene locus_tag LOCUS_41680 1569 739 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_41680 2333 1575 gene locus_tag LOCUS_41690 2333 1575 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_41690 2305 2511 gene locus_tag LOCUS_41700 2305 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 3065 2589 gene locus_tag LOCUS_41710 3065 2589 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_41710 5843 3309 gene locus_tag LOCUS_41720 5843 3309 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029396.1 protein_id gnl|my_center|LOCUS_41720 6499 6008 gene locus_tag LOCUS_41730 6499 6008 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_41730 >Feature sequence362 1668 139 gene locus_tag LOCUS_41740 gene gguA 1668 139 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 protein_id gnl|my_center|LOCUS_41740 2838 1720 gene locus_tag LOCUS_41750 gene chvE 2838 1720 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_41750 3919 2921 gene locus_tag LOCUS_41760 gene yjfF 3919 2921 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_41760 4962 3916 gene locus_tag LOCUS_41770 4962 3916 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_41770 6470 4959 gene locus_tag LOCUS_41780 6470 4959 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_41780 >Feature sequence363 151 516 gene locus_tag LOCUS_41790 151 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 1650 616 gene locus_tag LOCUS_41800 1650 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 1928 2137 gene locus_tag LOCUS_41810 1928 2137 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_41810 3116 2748 gene locus_tag LOCUS_41820 3116 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 4404 3208 gene locus_tag LOCUS_41830 4404 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 4784 5620 gene locus_tag LOCUS_41840 gene prcB 4784 5620 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_41840 5642 6466 gene locus_tag LOCUS_41850 gene prcA 5642 6466 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_41850 >Feature sequence364 2605 134 gene locus_tag LOCUS_41860 2605 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 5079 2602 gene locus_tag LOCUS_41870 5079 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 <6561 5110 gene locus_tag LOCUS_41880 <6561 5110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003909105.1:type VII secretion system ESX-1 associated protein EspI >Feature sequence365 313 3291 gene locus_tag LOCUS_41890 gene afsR 313 3291 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_41890 5020 3551 gene locus_tag LOCUS_41900 5020 3551 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_41900 5671 5081 gene locus_tag LOCUS_41910 5671 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 6195 5668 gene locus_tag LOCUS_41920 6195 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 >Feature sequence366 2109 511 gene locus_tag LOCUS_41930 2109 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 3077 2124 gene locus_tag LOCUS_41940 3077 2124 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089196.1 protein_id gnl|my_center|LOCUS_41940 4032 3082 gene locus_tag LOCUS_41950 4032 3082 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089196.1 protein_id gnl|my_center|LOCUS_41950 4990 4037 gene locus_tag LOCUS_41960 4990 4037 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089196.1 protein_id gnl|my_center|LOCUS_41960 6083 4998 gene locus_tag LOCUS_41970 6083 4998 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138358771.1 protein_id gnl|my_center|LOCUS_41970 >Feature sequence367 1194 868 gene locus_tag LOCUS_41980 1194 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 1714 1259 gene locus_tag LOCUS_41990 1714 1259 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_41990 2215 1787 gene locus_tag LOCUS_42000 2215 1787 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060606.1 protein_id gnl|my_center|LOCUS_42000 2751 2356 gene locus_tag LOCUS_42010 2751 2356 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_42010 2968 2774 gene locus_tag LOCUS_42020 2968 2774 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_42020 3556 6309 gene locus_tag LOCUS_42030 gene aceE 3556 6309 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_42030 >Feature sequence368 3126 94 gene locus_tag LOCUS_42040 3126 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42040 3159 3350 gene locus_tag LOCUS_42050 3159 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 3559 3314 gene locus_tag LOCUS_42060 3559 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 4601 3600 gene locus_tag LOCUS_42070 gene nusA 4601 3600 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_42070 5140 4613 gene locus_tag LOCUS_42080 gene rimP 5140 4613 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_42080 5373 5864 gene locus_tag LOCUS_42090 5373 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 >Feature sequence369 45 2087 gene locus_tag LOCUS_42100 45 2087 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_42100 2390 6097 gene locus_tag LOCUS_42110 2390 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 >Feature sequence370 1708 527 gene locus_tag LOCUS_42120 1708 527 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_42120 2586 1705 gene locus_tag LOCUS_42130 gene rbsK 2586 1705 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_42130 3935 2583 gene locus_tag LOCUS_42140 3935 2583 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_42140 5113 3932 gene locus_tag LOCUS_42150 5113 3932 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_42150 6171 5155 gene locus_tag LOCUS_42160 6171 5155 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028106.1 protein_id gnl|my_center|LOCUS_42160 >Feature sequence371 2041 389 gene locus_tag LOCUS_42170 2041 389 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_42170 3280 2330 gene locus_tag LOCUS_42180 3280 2330 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031632.1 protein_id gnl|my_center|LOCUS_42180 3360 4724 gene locus_tag LOCUS_42190 3360 4724 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283916.1 protein_id gnl|my_center|LOCUS_42190 5982 4741 gene locus_tag LOCUS_42200 5982 4741 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028914.1 protein_id gnl|my_center|LOCUS_42200 >Feature sequence372 1190 93 gene locus_tag LOCUS_42210 gene recA 1190 93 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_42210 1522 1797 gene locus_tag LOCUS_42220 1522 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 2914 1829 gene locus_tag LOCUS_42230 2914 1829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_42230 3789 2911 gene locus_tag LOCUS_42240 3789 2911 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_42240 4090 3782 gene locus_tag LOCUS_42250 4090 3782 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_42250 4518 4087 gene locus_tag LOCUS_42260 4518 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 5077 4883 gene locus_tag LOCUS_42270 5077 4883 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224216.1 protein_id gnl|my_center|LOCUS_42270 5635 5147 gene locus_tag LOCUS_42280 5635 5147 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467800.1 protein_id gnl|my_center|LOCUS_42280 >Feature sequence373 984 2573 gene locus_tag LOCUS_42290 gene serA 984 2573 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_42290 2721 3026 gene locus_tag LOCUS_42300 2721 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 3081 3767 gene locus_tag LOCUS_42310 3081 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 3845 4891 gene locus_tag LOCUS_42320 3845 4891 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_42320 5036 6127 gene locus_tag LOCUS_42330 5036 6127 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_42330 >Feature sequence374 1315 47 gene locus_tag LOCUS_42340 1315 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 2456 1491 gene locus_tag LOCUS_42350 2456 1491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223209.1 protein_id gnl|my_center|LOCUS_42350 3403 2453 gene locus_tag LOCUS_42360 3403 2453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223210.1 protein_id gnl|my_center|LOCUS_42360 4946 3396 gene locus_tag LOCUS_42370 4946 3396 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_42370 6164 5094 gene locus_tag LOCUS_42380 6164 5094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223212.1 protein_id gnl|my_center|LOCUS_42380 >Feature sequence375 1359 610 gene locus_tag LOCUS_42390 1359 610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767688.1 protein_id gnl|my_center|LOCUS_42390 2136 3758 gene locus_tag LOCUS_42400 2136 3758 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973036.1 protein_id gnl|my_center|LOCUS_42400 3771 4757 gene locus_tag LOCUS_42410 3771 4757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970496.1 protein_id gnl|my_center|LOCUS_42410 4759 5616 gene locus_tag LOCUS_42420 4759 5616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968090.1 protein_id gnl|my_center|LOCUS_42420 >Feature sequence376 77 475 gene locus_tag LOCUS_42430 77 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 475 864 gene locus_tag LOCUS_42440 475 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 755 1030 gene locus_tag LOCUS_42450 755 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 1027 1335 gene locus_tag LOCUS_42460 1027 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 1345 1662 gene locus_tag LOCUS_42470 1345 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 1659 2387 gene locus_tag LOCUS_42480 1659 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 2384 2830 gene locus_tag LOCUS_42490 2384 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 2865 3821 gene locus_tag LOCUS_42500 2865 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 5342 3882 gene locus_tag LOCUS_42510 5342 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 5524 5901 gene locus_tag LOCUS_42520 5524 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 6066 6218 gene locus_tag LOCUS_42530 6066 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 >Feature sequence377 2228 75 gene locus_tag LOCUS_42540 2228 75 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_42540 3110 2241 gene locus_tag LOCUS_42550 3110 2241 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_42550 4423 3107 gene locus_tag LOCUS_42560 4423 3107 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787334.1 protein_id gnl|my_center|LOCUS_42560 <6247 4416 gene locus_tag LOCUS_42570 <6247 4416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222484.1:alginate lyase family protein >Feature sequence378 175 543 gene locus_tag LOCUS_42580 175 543 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872145.1 protein_id gnl|my_center|LOCUS_42580 1650 571 gene locus_tag LOCUS_42590 1650 571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_42590 1853 3307 gene locus_tag LOCUS_42600 1853 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 3371 5140 gene locus_tag LOCUS_42610 3371 5140 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_42610 >Feature sequence379 400 1305 gene locus_tag LOCUS_42620 400 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 1708 2961 gene locus_tag LOCUS_42630 1708 2961 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169733975.1 protein_id gnl|my_center|LOCUS_42630 4149 3301 gene locus_tag LOCUS_42640 gene map 4149 3301 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_42640 4192 4368 gene locus_tag LOCUS_42650 4192 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 4711 4409 gene locus_tag LOCUS_42660 4711 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 5548 4868 gene locus_tag LOCUS_42670 5548 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028233.1 protein_id gnl|my_center|LOCUS_42670 >Feature sequence380 272 196 gene locus_tag LOCUS_t00420 272 196 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 727 2256 gene locus_tag LOCUS_42680 727 2256 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_42680 2457 4040 gene locus_tag LOCUS_42690 2457 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 4304 6124 gene locus_tag LOCUS_42700 4304 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 >Feature sequence381 1532 3619 gene locus_tag LOCUS_42710 gene fusA 1532 3619 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031026.1 protein_id gnl|my_center|LOCUS_42710 4372 3713 gene locus_tag LOCUS_42720 4372 3713 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972782.1 protein_id gnl|my_center|LOCUS_42720 5523 4369 gene locus_tag LOCUS_42730 5523 4369 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972783.1 protein_id gnl|my_center|LOCUS_42730 6209 5520 gene locus_tag LOCUS_42740 6209 5520 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222998.1 protein_id gnl|my_center|LOCUS_42740 >Feature sequence382 1219 86 gene locus_tag LOCUS_42750 1219 86 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_42750 2973 1216 gene locus_tag LOCUS_42760 2973 1216 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_42760 3828 3010 gene locus_tag LOCUS_42770 3828 3010 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974185.1 protein_id gnl|my_center|LOCUS_42770 5417 3882 gene locus_tag LOCUS_42780 5417 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 5992 5450 gene locus_tag LOCUS_42790 5992 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 >Feature sequence383 1024 590 gene locus_tag LOCUS_42800 1024 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 1499 1062 gene locus_tag LOCUS_42810 1499 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 2427 1522 gene locus_tag LOCUS_42820 gene mshB 2427 1522 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_42820 2469 4514 gene locus_tag LOCUS_42830 2469 4514 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_42830 4736 4969 gene locus_tag LOCUS_42840 4736 4969 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_42840 4970 5527 gene locus_tag LOCUS_42850 4970 5527 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895204.1 protein_id gnl|my_center|LOCUS_42850 <6131 5556 gene locus_tag LOCUS_42860 <6131 5556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974572.1:STAS domain-containing protein >Feature sequence384 <1 778 gene locus_tag LOCUS_42870 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110455.1:2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase 957 1838 gene locus_tag LOCUS_42880 957 1838 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729703.1 protein_id gnl|my_center|LOCUS_42880 1864 2613 gene locus_tag LOCUS_42890 1864 2613 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_42890 2610 3287 gene locus_tag LOCUS_42900 gene lipB 2610 3287 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_42900 3590 4516 gene locus_tag LOCUS_42910 gene lipA 3590 4516 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729704.1 protein_id gnl|my_center|LOCUS_42910 4607 5233 gene locus_tag LOCUS_42920 4607 5233 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_42920 5235 6035 gene locus_tag LOCUS_42930 5235 6035 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_42930 >Feature sequence385 2 229 gene locus_tag LOCUS_42940 2 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 226 579 gene locus_tag LOCUS_42950 226 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 659 2659 gene locus_tag LOCUS_42960 659 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 2668 4506 gene locus_tag LOCUS_42970 2668 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 4722 4585 gene locus_tag LOCUS_42980 4722 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 4729 5031 gene locus_tag LOCUS_42990 4729 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 <6085 5167 gene locus_tag LOCUS_43000 <6085 5167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943323.1:ABC transporter permease >Feature sequence386 993 49 gene locus_tag LOCUS_43010 gene ccsB 993 49 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222434.1 protein_id gnl|my_center|LOCUS_43010 2709 997 gene locus_tag LOCUS_43020 2709 997 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_43020 3440 2709 gene locus_tag LOCUS_43030 3440 2709 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_43030 4035 3433 gene locus_tag LOCUS_43040 4035 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 4848 4108 gene locus_tag LOCUS_43050 4848 4108 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_43050 5769 4861 gene locus_tag LOCUS_43060 5769 4861 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_43060 >Feature sequence387 1385 480 gene locus_tag LOCUS_43070 1385 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_43070 2581 1382 gene locus_tag LOCUS_43080 2581 1382 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 protein_id gnl|my_center|LOCUS_43080 3654 2578 gene locus_tag LOCUS_43090 3654 2578 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_43090 3739 4590 gene locus_tag LOCUS_43100 3739 4590 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_43100 4601 5341 gene locus_tag LOCUS_43110 4601 5341 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_43110 >Feature sequence388 848 126 gene locus_tag LOCUS_43120 848 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 1824 1198 gene locus_tag LOCUS_43130 1824 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 2944 1934 gene locus_tag LOCUS_43140 2944 1934 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_43140 5444 3147 gene locus_tag LOCUS_43150 5444 3147 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224095.1 protein_id gnl|my_center|LOCUS_43150 >Feature sequence389 1925 1020 gene locus_tag LOCUS_43160 1925 1020 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_43160 2030 2422 gene locus_tag LOCUS_43170 2030 2422 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_43170 2628 3521 gene locus_tag LOCUS_43180 2628 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 5610 3544 gene locus_tag LOCUS_43190 5610 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_43190 >Feature sequence390 1429 155 gene locus_tag LOCUS_43200 1429 155 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_43200 2126 1434 gene locus_tag LOCUS_43210 2126 1434 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_43210 2220 2735 gene locus_tag LOCUS_43220 2220 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 4374 2857 gene locus_tag LOCUS_43230 gene dop 4374 2857 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_43230 5643 4450 gene locus_tag LOCUS_43240 5643 4450 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 protein_id gnl|my_center|LOCUS_43240 >Feature sequence391 606 1202 gene locus_tag LOCUS_43250 gene orn 606 1202 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_43250 1285 1360 gene locus_tag LOCUS_t00430 1285 1360 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1539 1853 gene locus_tag LOCUS_43260 1539 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 3047 1761 gene locus_tag LOCUS_43270 gene lat 3047 1761 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893146.1 protein_id gnl|my_center|LOCUS_43270 5003 3351 gene locus_tag LOCUS_43280 5003 3351 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975660.1 protein_id gnl|my_center|LOCUS_43280 5036 5878 gene locus_tag LOCUS_43290 5036 5878 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878192.1 protein_id gnl|my_center|LOCUS_43290 >Feature sequence392 2104 2691 gene locus_tag LOCUS_43300 2104 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 2691 3368 gene locus_tag LOCUS_43310 2691 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 3365 4291 gene locus_tag LOCUS_43320 3365 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 5600 4245 gene locus_tag LOCUS_43330 5600 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 >Feature sequence393 1012 2664 gene locus_tag LOCUS_43340 1012 2664 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015501.1 protein_id gnl|my_center|LOCUS_43340 3354 2713 gene locus_tag LOCUS_43350 3354 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 3358 4314 gene locus_tag LOCUS_43360 3358 4314 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_43360 >Feature sequence394 29 1414 gene locus_tag LOCUS_43370 29 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_43370 2442 1462 gene locus_tag LOCUS_43380 2442 1462 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_43380 3324 2449 gene locus_tag LOCUS_43390 3324 2449 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228180.1 protein_id gnl|my_center|LOCUS_43390 3469 3933 gene locus_tag LOCUS_43400 3469 3933 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224848.1 protein_id gnl|my_center|LOCUS_43400 >Feature sequence395 70 142 gene locus_tag LOCUS_t00440 70 142 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 331 1797 gene locus_tag LOCUS_43410 gene glmU 331 1797 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_43410 2024 3001 gene locus_tag LOCUS_43420 2024 3001 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_43420 4137 3046 gene locus_tag LOCUS_43430 gene trpS 4137 3046 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004573597.1 protein_id gnl|my_center|LOCUS_43430 4461 5042 gene locus_tag LOCUS_43440 4461 5042 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_43440 5122 5733 gene locus_tag LOCUS_43450 gene pth 5122 5733 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_43450 >Feature sequence396 125 457 gene locus_tag LOCUS_43460 125 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 1407 370 gene locus_tag LOCUS_43470 1407 370 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_43470 1565 3745 gene locus_tag LOCUS_43480 gene amyA 1565 3745 CDS product alpha-amylase AmyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922388.1 protein_id gnl|my_center|LOCUS_43480 4228 3926 gene locus_tag LOCUS_43490 4228 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 4584 5816 gene locus_tag LOCUS_43500 4584 5816 CDS product maltose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583219.1 protein_id gnl|my_center|LOCUS_43500 >Feature sequence397 805 308 gene locus_tag LOCUS_43510 805 308 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_43510 999 2057 gene locus_tag LOCUS_43520 999 2057 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223262.1 protein_id gnl|my_center|LOCUS_43520 2160 2684 gene locus_tag LOCUS_43530 2160 2684 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_43530 2681 3133 gene locus_tag LOCUS_43540 2681 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 3181 5850 gene locus_tag LOCUS_43550 3181 5850 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223261.1 protein_id gnl|my_center|LOCUS_43550 >Feature sequence398 2303 1905 gene locus_tag LOCUS_43560 2303 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 2428 2805 gene locus_tag LOCUS_43570 2428 2805 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_43570 3551 4849 gene locus_tag LOCUS_43580 3551 4849 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 protein_id gnl|my_center|LOCUS_43580 <5840 5330 gene locus_tag LOCUS_43590 <5840 5330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226302.1:helix-turn-helix domain-containing protein >Feature sequence399 1122 625 gene locus_tag LOCUS_43600 1122 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 1269 2006 gene locus_tag LOCUS_43610 1269 2006 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283980.1 protein_id gnl|my_center|LOCUS_43610 2003 3259 gene locus_tag LOCUS_43620 2003 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 4308 3370 gene locus_tag LOCUS_43630 4308 3370 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026854.1 protein_id gnl|my_center|LOCUS_43630 >Feature sequence400 1772 393 gene locus_tag LOCUS_43640 gene lpdA 1772 393 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_43640 3406 1898 gene locus_tag LOCUS_43650 3406 1898 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_43650 3542 3937 gene locus_tag LOCUS_43660 3542 3937 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_43660 3934 4935 gene locus_tag LOCUS_43670 3934 4935 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029244.1 protein_id gnl|my_center|LOCUS_43670 >Feature sequence401 724 395 gene locus_tag LOCUS_43680 724 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 674 985 gene locus_tag LOCUS_43690 674 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 2679 1756 gene locus_tag LOCUS_43700 2679 1756 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_43700 2875 3357 gene locus_tag LOCUS_43710 2875 3357 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028555.1 protein_id gnl|my_center|LOCUS_43710 3369 4709 gene locus_tag LOCUS_43720 3369 4709 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525361.1 protein_id gnl|my_center|LOCUS_43720 5198 4803 gene locus_tag LOCUS_43730 5198 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 >Feature sequence402 >Feature sequence403 285 1352 gene locus_tag LOCUS_43740 285 1352 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_43740 1381 3510 gene locus_tag LOCUS_43750 1381 3510 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_43750 3510 4643 gene locus_tag LOCUS_43760 3510 4643 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_43760 >Feature sequence404 <1 1279 gene locus_tag LOCUS_43770 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228232.1:LLM class flavin-dependent oxidoreductase 1575 2831 gene locus_tag LOCUS_43780 1575 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 3026 3529 gene locus_tag LOCUS_43790 3026 3529 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 protein_id gnl|my_center|LOCUS_43790 3718 4752 gene locus_tag LOCUS_43800 3718 4752 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_43800 >Feature sequence405 816 34 gene locus_tag LOCUS_43810 816 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 1002 1358 gene locus_tag LOCUS_43820 1002 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 2088 1375 gene locus_tag LOCUS_43830 2088 1375 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029394.1 protein_id gnl|my_center|LOCUS_43830 2184 3989 gene locus_tag LOCUS_43840 2184 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 4197 5246 gene locus_tag LOCUS_43850 4197 5246 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_43850 >Feature sequence406 598 326 gene locus_tag LOCUS_43860 598 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 1529 603 gene locus_tag LOCUS_43870 1529 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_43870 1849 1619 gene locus_tag LOCUS_43880 1849 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 2008 4290 gene locus_tag LOCUS_43890 gene yicI 2008 4290 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 protein_id gnl|my_center|LOCUS_43890 4342 5625 gene locus_tag LOCUS_43900 4342 5625 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 protein_id gnl|my_center|LOCUS_43900 >Feature sequence407 41 1282 gene locus_tag LOCUS_43910 41 1282 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_43910 2746 1541 gene locus_tag LOCUS_43920 2746 1541 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_43920 2981 3054 gene locus_tag LOCUS_t00450 2981 3054 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3129 3386 gene locus_tag LOCUS_43930 gene secE 3129 3386 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_43930 3442 4206 gene locus_tag LOCUS_43940 gene nusG 3442 4206 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222524.1 protein_id gnl|my_center|LOCUS_43940 4301 4732 gene locus_tag LOCUS_43950 gene rplK 4301 4732 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_43950 4881 5594 gene locus_tag LOCUS_43960 gene rplA 4881 5594 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_43960 >Feature sequence408 576 4 gene locus_tag LOCUS_43970 576 4 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976016.1 protein_id gnl|my_center|LOCUS_43970 1868 573 gene locus_tag LOCUS_43980 1868 573 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326291.1 protein_id gnl|my_center|LOCUS_43980 3333 1855 gene locus_tag LOCUS_43990 gene desA 3333 1855 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_43990 4471 3446 gene locus_tag LOCUS_44000 gene desE 4471 3446 CDS product siderophore-binding protein DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976020.1 protein_id gnl|my_center|LOCUS_44000 4596 5636 gene locus_tag LOCUS_44010 4596 5636 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_44010 >Feature sequence409 <1 1080 gene locus_tag LOCUS_44020 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071933.1:methionine gamma-lyase 2040 1189 gene locus_tag LOCUS_44030 gene panB 2040 1189 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 protein_id gnl|my_center|LOCUS_44030 2241 3530 gene locus_tag LOCUS_44040 2241 3530 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 protein_id gnl|my_center|LOCUS_44040 3994 5556 gene locus_tag LOCUS_44050 3994 5556 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_44050 >Feature sequence410 452 838 gene locus_tag LOCUS_44060 452 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44060 2157 958 gene locus_tag LOCUS_44070 2157 958 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_44070 2942 2241 gene locus_tag LOCUS_44080 2942 2241 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_44080 3637 2981 gene locus_tag LOCUS_44090 gene nth 3637 2981 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 protein_id gnl|my_center|LOCUS_44090 3998 3684 gene locus_tag LOCUS_44100 3998 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 4120 4800 gene locus_tag LOCUS_44110 4120 4800 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_44110 5619 4810 gene locus_tag LOCUS_44120 5619 4810 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_44120 >Feature sequence411 719 66 gene locus_tag LOCUS_44130 719 66 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_44130 2847 757 gene locus_tag LOCUS_44140 2847 757 CDS product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082817098.1 protein_id gnl|my_center|LOCUS_44140 3104 4627 gene locus_tag LOCUS_44150 3104 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 >Feature sequence412 287 1003 gene locus_tag LOCUS_44160 287 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 1286 963 gene locus_tag LOCUS_44170 1286 963 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_44170 1385 2572 gene locus_tag LOCUS_44180 1385 2572 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222962.1 protein_id gnl|my_center|LOCUS_44180 2587 3330 gene locus_tag LOCUS_44190 2587 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 3341 5002 gene locus_tag LOCUS_44200 3341 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44200 >Feature sequence413 289 74 gene locus_tag LOCUS_44210 289 74 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_44210 1273 416 gene locus_tag LOCUS_44220 1273 416 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_44220 1553 1879 gene locus_tag LOCUS_44230 1553 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 1876 2469 gene locus_tag LOCUS_44240 1876 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 4182 2791 gene locus_tag LOCUS_44250 4182 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 5251 4247 gene locus_tag LOCUS_44260 5251 4247 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224960.1 protein_id gnl|my_center|LOCUS_44260 >Feature sequence414 1680 2030 gene locus_tag LOCUS_44270 1680 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 2030 2428 gene locus_tag LOCUS_44280 2030 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 2467 2817 gene locus_tag LOCUS_44290 2467 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 2708 2983 gene locus_tag LOCUS_44300 2708 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 2980 3288 gene locus_tag LOCUS_44310 2980 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 3302 3622 gene locus_tag LOCUS_44320 3302 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 3619 4347 gene locus_tag LOCUS_44330 3619 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 4350 4790 gene locus_tag LOCUS_44340 4350 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 >Feature sequence415 1360 494 gene locus_tag LOCUS_44350 gene wag31 1360 494 CDS product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729650.1 protein_id gnl|my_center|LOCUS_44350 1748 1410 gene locus_tag LOCUS_44360 1748 1410 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_44360 2308 1781 gene locus_tag LOCUS_44370 gene sepF 2308 1781 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_44370 3150 2443 gene locus_tag LOCUS_44380 3150 2443 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_44380 4632 3184 gene locus_tag LOCUS_44390 4632 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 <5576 4882 gene locus_tag LOCUS_44400 <5576 4882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729654.1:FtsQ-type POTRA domain-containing protein >Feature sequence416 162 1643 gene locus_tag LOCUS_44410 gene guaB 162 1643 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_44410 1686 2804 gene locus_tag LOCUS_44420 1686 2804 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_44420 3593 2931 gene locus_tag LOCUS_44430 3593 2931 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 protein_id gnl|my_center|LOCUS_44430 4681 3590 gene locus_tag LOCUS_44440 4681 3590 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 protein_id gnl|my_center|LOCUS_44440 4925 5332 gene locus_tag LOCUS_44450 4925 5332 CDS product DUF6223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222880.1 protein_id gnl|my_center|LOCUS_44450 >Feature sequence417 <1 1235 gene locus_tag LOCUS_44460 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531683.1:phage/plasmid primase, P4 family 1320 1853 gene locus_tag LOCUS_44470 1320 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 1850 2077 gene locus_tag LOCUS_44480 1850 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 2067 2612 gene locus_tag LOCUS_44490 2067 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 2690 3409 gene locus_tag LOCUS_44500 2690 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 3406 3831 gene locus_tag LOCUS_44510 3406 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 >Feature sequence418 2539 479 gene locus_tag LOCUS_44520 2539 479 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_44520 4234 2543 gene locus_tag LOCUS_44530 4234 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 5085 4309 gene locus_tag LOCUS_44540 5085 4309 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_44540 >Feature sequence419 1 690 gene locus_tag LOCUS_44550 1 690 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_44550 721 1917 gene locus_tag LOCUS_44560 721 1917 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_44560 2019 3203 gene locus_tag LOCUS_44570 2019 3203 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 protein_id gnl|my_center|LOCUS_44570 3200 5305 gene locus_tag LOCUS_44580 3200 5305 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_44580 >Feature sequence420 558 1004 gene locus_tag LOCUS_44590 558 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 1001 1231 gene locus_tag LOCUS_44600 1001 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 1228 2052 gene locus_tag LOCUS_44610 1228 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 2049 2288 gene locus_tag LOCUS_44620 2049 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 2285 2842 gene locus_tag LOCUS_44630 2285 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 2906 3226 gene locus_tag LOCUS_44640 2906 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 3227 3670 gene locus_tag LOCUS_44650 3227 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 3667 3924 gene locus_tag LOCUS_44660 3667 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 3917 4285 gene locus_tag LOCUS_44670 3917 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 4278 4481 gene locus_tag LOCUS_44680 gene bldC 4278 4481 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_44680 >Feature sequence421 1621 782 gene locus_tag LOCUS_44690 1621 782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537723.1 protein_id gnl|my_center|LOCUS_44690 2583 1621 gene locus_tag LOCUS_44700 2583 1621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384277.1 protein_id gnl|my_center|LOCUS_44700 4190 2580 gene locus_tag LOCUS_44710 4190 2580 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384278.1 protein_id gnl|my_center|LOCUS_44710 5383 4187 gene locus_tag LOCUS_44720 5383 4187 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086421.1 protein_id gnl|my_center|LOCUS_44720 >Feature sequence422 1853 1629 gene locus_tag LOCUS_44730 1853 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 1872 2426 gene locus_tag LOCUS_44740 1872 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 2986 2606 gene locus_tag LOCUS_44750 2986 2606 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_44750 3082 3546 gene locus_tag LOCUS_44760 3082 3546 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_44760 3630 4109 gene locus_tag LOCUS_44770 3630 4109 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229196.1 protein_id gnl|my_center|LOCUS_44770 4619 4275 gene locus_tag LOCUS_44780 4619 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 >Feature sequence423 2678 1701 gene locus_tag LOCUS_44790 2678 1701 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929922.1 protein_id gnl|my_center|LOCUS_44790 3711 2671 gene locus_tag LOCUS_44800 3711 2671 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064871.1 protein_id gnl|my_center|LOCUS_44800 4793 3723 gene locus_tag LOCUS_44810 gene ord 4793 3723 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_44810 >Feature sequence424 371 646 gene locus_tag LOCUS_44820 371 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 640 2049 gene locus_tag LOCUS_44830 640 2049 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225487.1 protein_id gnl|my_center|LOCUS_44830 2641 2009 gene locus_tag LOCUS_44840 2641 2009 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918344.1 protein_id gnl|my_center|LOCUS_44840 2741 2938 gene locus_tag LOCUS_44850 2741 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 3651 3139 gene locus_tag LOCUS_44860 3651 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 4605 3784 gene locus_tag LOCUS_44870 4605 3784 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014630030.1 protein_id gnl|my_center|LOCUS_44870 <5466 4782 gene locus_tag LOCUS_44880 <5466 4782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971441.1:family 2B encapsulin nanocompartment shell protein >Feature sequence425 1361 651 gene locus_tag LOCUS_44890 1361 651 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986262.1 protein_id gnl|my_center|LOCUS_44890 2112 1363 gene locus_tag LOCUS_44900 2112 1363 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888312.1 protein_id gnl|my_center|LOCUS_44900 2063 2269 gene locus_tag LOCUS_44910 2063 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 2366 2965 gene locus_tag LOCUS_44920 2366 2965 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_44920 2955 3719 gene locus_tag LOCUS_44930 2955 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 4781 3882 gene locus_tag LOCUS_44940 4781 3882 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029465.1 protein_id gnl|my_center|LOCUS_44940 5413 4778 gene locus_tag LOCUS_44950 5413 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 >Feature sequence426 2713 1256 gene locus_tag LOCUS_44960 gene pbpA 2713 1256 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082861.1 protein_id gnl|my_center|LOCUS_44960 4020 2710 gene locus_tag LOCUS_44970 4020 2710 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_44970 5357 4080 gene locus_tag LOCUS_44980 5357 4080 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_44980 >Feature sequence427 182 1162 gene locus_tag LOCUS_44990 182 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 1222 1779 gene locus_tag LOCUS_45000 1222 1779 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_45000 3127 1880 gene locus_tag LOCUS_45010 3127 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 3474 3139 gene locus_tag LOCUS_45020 3474 3139 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222672.1 protein_id gnl|my_center|LOCUS_45020 3921 3538 gene locus_tag LOCUS_45030 3921 3538 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_45030 4045 4479 gene locus_tag LOCUS_45040 4045 4479 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031198.1 protein_id gnl|my_center|LOCUS_45040 4571 4909 gene locus_tag LOCUS_45050 4571 4909 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_45050 5211 5417 gene locus_tag LOCUS_45060 5211 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 >Feature sequence428 1055 174 gene locus_tag LOCUS_45070 1055 174 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331391.1 protein_id gnl|my_center|LOCUS_45070 1465 2667 gene locus_tag LOCUS_45080 1465 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 4062 3079 gene locus_tag LOCUS_45090 gene repB 4062 3079 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976299.1 protein_id gnl|my_center|LOCUS_45090 5273 4059 gene locus_tag LOCUS_45100 gene repA 5273 4059 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969818.1 protein_id gnl|my_center|LOCUS_45100 >Feature sequence429 183 656 gene locus_tag LOCUS_45110 183 656 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224812.1 protein_id gnl|my_center|LOCUS_45110 1022 1855 gene locus_tag LOCUS_45120 1022 1855 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_45120 2381 2010 gene locus_tag LOCUS_45130 2381 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 2731 2378 gene locus_tag LOCUS_45140 2731 2378 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_45140 3258 2728 gene locus_tag LOCUS_45150 3258 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 3145 3366 gene locus_tag LOCUS_45160 3145 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 3520 3804 gene locus_tag LOCUS_45170 3520 3804 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225091.1 protein_id gnl|my_center|LOCUS_45170 <5419 3785 gene locus_tag LOCUS_45180 <5419 3785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028585.1:desferrioxamine E synthetase DesD >Feature sequence430 <1 637 gene locus_tag LOCUS_45190 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013003532.1:ROK family transcriptional regulator 708 1337 gene locus_tag LOCUS_45200 708 1337 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_45200 <5419 1353 gene locus_tag LOCUS_45210 <5419 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030438.1:ATP-dependent helicase >Feature sequence431 60 2969 gene locus_tag LOCUS_45220 60 2969 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_45220 5276 3048 gene locus_tag LOCUS_45230 5276 3048 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316462.1 protein_id gnl|my_center|LOCUS_45230 >Feature sequence432 980 597 gene locus_tag LOCUS_45240 980 597 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_45240 1180 977 gene locus_tag LOCUS_45250 1180 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 2427 1252 gene locus_tag LOCUS_45260 2427 1252 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222355.1 protein_id gnl|my_center|LOCUS_45260 2575 3594 gene locus_tag LOCUS_45270 2575 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 3524 4315 gene locus_tag LOCUS_45280 3524 4315 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224126.1 protein_id gnl|my_center|LOCUS_45280 4326 4781 gene locus_tag LOCUS_45290 4326 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 4781 5227 gene locus_tag LOCUS_45300 4781 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 >Feature sequence433 110 1474 gene locus_tag LOCUS_45310 110 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 1937 1542 gene locus_tag LOCUS_45320 1937 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 2717 2235 gene locus_tag LOCUS_45330 2717 2235 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 protein_id gnl|my_center|LOCUS_45330 3466 3026 gene locus_tag LOCUS_45340 3466 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027385.1 protein_id gnl|my_center|LOCUS_45340 4466 3558 gene locus_tag LOCUS_45350 4466 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 4670 4506 gene locus_tag LOCUS_45360 4670 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 5081 4749 gene locus_tag LOCUS_45370 5081 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 >Feature sequence434 397 98 gene locus_tag LOCUS_45380 397 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 1545 394 gene locus_tag LOCUS_45390 1545 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 2050 1538 gene locus_tag LOCUS_45400 2050 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 2493 2047 gene locus_tag LOCUS_45410 2493 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 2733 2500 gene locus_tag LOCUS_45420 2733 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 3544 2753 gene locus_tag LOCUS_45430 3544 2753 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_45430 3959 3546 gene locus_tag LOCUS_45440 3959 3546 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030969.1 protein_id gnl|my_center|LOCUS_45440 <5382 4024 gene locus_tag LOCUS_45450 <5382 4024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027275.1:SRPBCC family protein >Feature sequence435 1121 159 gene locus_tag LOCUS_45460 1121 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 1220 2086 gene locus_tag LOCUS_45470 1220 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 2122 2373 gene locus_tag LOCUS_45480 2122 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 2383 2733 gene locus_tag LOCUS_45490 2383 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 4336 2876 gene locus_tag LOCUS_45500 4336 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 <5379 4862 gene locus_tag LOCUS_45510 <5379 4862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976827.1:RNA-binding S4 domain-containing protein >Feature sequence436 334 41 gene locus_tag LOCUS_45520 334 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 837 331 gene locus_tag LOCUS_45530 837 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 1030 842 gene locus_tag LOCUS_45540 1030 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 1029 2396 gene locus_tag LOCUS_45550 1029 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 2393 2926 gene locus_tag LOCUS_45560 2393 2926 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_45560 3258 3641 gene locus_tag LOCUS_45570 3258 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 3803 4006 gene locus_tag LOCUS_45580 3803 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 >Feature sequence437 1325 84 gene locus_tag LOCUS_45590 1325 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 2410 1364 gene locus_tag LOCUS_45600 2410 1364 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_45600 2559 4682 gene locus_tag LOCUS_45610 2559 4682 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_45610 4733 5374 gene locus_tag LOCUS_45620 4733 5374 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_45620 >Feature sequence438 380 967 gene locus_tag LOCUS_45630 380 967 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_45630 964 1119 gene locus_tag LOCUS_45640 964 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 1267 2697 gene locus_tag LOCUS_45650 gene argH 1267 2697 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_45650 2679 3362 gene locus_tag LOCUS_45660 2679 3362 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_45660 3455 4759 gene locus_tag LOCUS_45670 gene tyrS 3455 4759 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_45670 >Feature sequence439 2090 1449 gene locus_tag LOCUS_45680 2090 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 2224 3789 gene locus_tag LOCUS_45690 2224 3789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_45690 3887 4138 gene locus_tag LOCUS_45700 3887 4138 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_45700 >Feature sequence440 235 1215 gene locus_tag LOCUS_45710 235 1215 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_45710 1304 2560 gene locus_tag LOCUS_45720 1304 2560 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_45720 2595 5024 gene locus_tag LOCUS_45730 2595 5024 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_45730 >Feature sequence441 1087 4098 gene locus_tag LOCUS_45740 1087 4098 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_45740 5136 4111 gene locus_tag LOCUS_45750 5136 4111 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134732678.1 protein_id gnl|my_center|LOCUS_45750 >Feature sequence442 1811 930 gene locus_tag LOCUS_45760 1811 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 2542 1874 gene locus_tag LOCUS_45770 2542 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 3169 2711 gene locus_tag LOCUS_45780 3169 2711 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950169.1 protein_id gnl|my_center|LOCUS_45780 3427 3354 gene locus_tag LOCUS_t00460 3427 3354 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4980 3649 gene locus_tag LOCUS_45790 4980 3649 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_45790 >Feature sequence443 159 701 gene locus_tag LOCUS_45800 159 701 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_45800 1580 993 gene locus_tag LOCUS_45810 1580 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 2245 1577 gene locus_tag LOCUS_45820 2245 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 2293 3366 gene locus_tag LOCUS_45830 2293 3366 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_45830 3480 4823 gene locus_tag LOCUS_45840 3480 4823 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_45840 >Feature sequence444 560 2305 gene locus_tag LOCUS_45850 560 2305 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_45850 2415 2939 gene locus_tag LOCUS_45860 gene ilvN 2415 2939 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_45860 2972 3988 gene locus_tag LOCUS_45870 gene ilvC 2972 3988 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973482.1 protein_id gnl|my_center|LOCUS_45870 4733 4200 gene locus_tag LOCUS_45880 4733 4200 CDS product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 protein_id gnl|my_center|LOCUS_45880 >Feature sequence445 2786 1635 gene locus_tag LOCUS_45890 2786 1635 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224105.1 protein_id gnl|my_center|LOCUS_45890 3037 4800 gene locus_tag LOCUS_45900 3037 4800 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_45900 >Feature sequence446 1208 99 gene locus_tag LOCUS_45910 1208 99 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027639.1 protein_id gnl|my_center|LOCUS_45910 1438 1797 gene locus_tag LOCUS_45920 1438 1797 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 protein_id gnl|my_center|LOCUS_45920 2383 1808 gene locus_tag LOCUS_45930 2383 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 3035 2427 gene locus_tag LOCUS_45940 3035 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 3360 3052 gene locus_tag LOCUS_45950 3360 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 3542 3357 gene locus_tag LOCUS_45960 3542 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 3961 3545 gene locus_tag LOCUS_45970 3961 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 4371 3958 gene locus_tag LOCUS_45980 4371 3958 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 protein_id gnl|my_center|LOCUS_45980 >Feature sequence447 1291 2010 gene locus_tag LOCUS_45990 1291 2010 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_45990 2053 2997 gene locus_tag LOCUS_46000 2053 2997 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030814.1 protein_id gnl|my_center|LOCUS_46000 5116 3152 gene locus_tag LOCUS_46010 5116 3152 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027370.1 protein_id gnl|my_center|LOCUS_46010 >Feature sequence448 2248 1427 gene locus_tag LOCUS_46020 2248 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46020 2288 2587 gene locus_tag LOCUS_46030 2288 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 3748 2882 gene locus_tag LOCUS_46040 gene folP 3748 2882 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_46040 4903 4034 gene locus_tag LOCUS_46050 4903 4034 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776963.1 protein_id gnl|my_center|LOCUS_46050 >Feature sequence449 200 1897 gene locus_tag LOCUS_46060 200 1897 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_46060 3827 1890 gene locus_tag LOCUS_46070 3827 1890 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_46070 >Feature sequence450 <1 1227 gene locus_tag LOCUS_46080 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004111610.1:glutamate ABC transporter substrate-binding protein 2177 1632 gene locus_tag LOCUS_46090 gene padR 2177 1632 CDS product transcriptional regulator PadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233588.1 protein_id gnl|my_center|LOCUS_46090 2225 3652 gene locus_tag LOCUS_46100 2225 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 3773 4615 gene locus_tag LOCUS_46110 3773 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 <5230 4625 gene locus_tag LOCUS_46120 <5230 4625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224287.1:UDP-glucose 4-epimerase GalE >Feature sequence451 736 509 gene locus_tag LOCUS_46130 736 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 1766 768 gene locus_tag LOCUS_46140 1766 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 2917 1928 gene locus_tag LOCUS_46150 2917 1928 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_46150 3285 5123 gene locus_tag LOCUS_46160 3285 5123 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742058.1 protein_id gnl|my_center|LOCUS_46160 >Feature sequence452 671 12 gene locus_tag LOCUS_46170 671 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 1048 668 gene locus_tag LOCUS_46180 1048 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 1333 2235 gene locus_tag LOCUS_46190 gene xerC 1333 2235 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_46190 2854 3198 gene locus_tag LOCUS_46200 2854 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 3195 3551 gene locus_tag LOCUS_46210 3195 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 3544 4479 gene locus_tag LOCUS_46220 3544 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 4476 4751 gene locus_tag LOCUS_46230 4476 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 4748 5137 gene locus_tag LOCUS_46240 4748 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 >Feature sequence453 171 1229 gene locus_tag LOCUS_46250 171 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 1510 3132 gene locus_tag LOCUS_46260 1510 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 5079 3235 gene locus_tag LOCUS_46270 5079 3235 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_46270 >Feature sequence454 432 127 gene locus_tag LOCUS_46280 432 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 2382 1288 gene locus_tag LOCUS_46290 2382 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031309.1 protein_id gnl|my_center|LOCUS_46290 4430 2388 gene locus_tag LOCUS_46300 gene fxlM 4430 2388 CDS product methyltransferase, FxLD system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031310.1 protein_id gnl|my_center|LOCUS_46300 <5195 4451 gene locus_tag LOCUS_46310 <5195 4451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026975.1:lanthionine synthetase C family protein >Feature sequence455 684 58 gene locus_tag LOCUS_46320 684 58 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225120.1 protein_id gnl|my_center|LOCUS_46320 2214 745 gene locus_tag LOCUS_46330 2214 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 2462 2914 gene locus_tag LOCUS_46340 2462 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 2943 4274 gene locus_tag LOCUS_46350 2943 4274 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027365.1 protein_id gnl|my_center|LOCUS_46350 4271 5095 gene locus_tag LOCUS_46360 4271 5095 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225013.1 protein_id gnl|my_center|LOCUS_46360 >Feature sequence456 1075 65 gene locus_tag LOCUS_46370 1075 65 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225829.1 protein_id gnl|my_center|LOCUS_46370 2250 1072 gene locus_tag LOCUS_46380 2250 1072 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_46380 3322 2264 gene locus_tag LOCUS_46390 3322 2264 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225827.1 protein_id gnl|my_center|LOCUS_46390 4441 3431 gene locus_tag LOCUS_46400 4441 3431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225826.1 protein_id gnl|my_center|LOCUS_46400 <5175 4438 gene locus_tag LOCUS_46410 <5175 4438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972412.1:sugar ABC transporter ATP-binding protein >Feature sequence457 4044 1195 gene locus_tag LOCUS_46420 4044 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 4473 4216 gene locus_tag LOCUS_46430 4473 4216 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_46430 >Feature sequence458 <5156 770 gene locus_tag LOCUS_46440 <5156 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063855.1:type I polyketide synthase >Feature sequence459 3586 3254 gene locus_tag LOCUS_46450 3586 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 3990 3712 gene locus_tag LOCUS_46460 3990 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 4202 4029 gene locus_tag LOCUS_46470 4202 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 4964 4293 gene locus_tag LOCUS_46480 4964 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 >Feature sequence460 488 45 gene locus_tag LOCUS_46490 488 45 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_46490 606 1655 gene locus_tag LOCUS_46500 606 1655 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972380.1 protein_id gnl|my_center|LOCUS_46500 3048 1678 gene locus_tag LOCUS_46510 3048 1678 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_46510 3931 3092 gene locus_tag LOCUS_46520 3931 3092 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_46520 4931 3924 gene locus_tag LOCUS_46530 4931 3924 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_46530 >Feature sequence461 1385 891 gene locus_tag LOCUS_46540 1385 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 1764 2369 gene locus_tag LOCUS_46550 1764 2369 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_46550 2366 3196 gene locus_tag LOCUS_46560 2366 3196 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_46560 >Feature sequence462 305 940 gene locus_tag LOCUS_46570 305 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 1147 947 gene locus_tag LOCUS_46580 1147 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46580 2280 1156 gene locus_tag LOCUS_46590 gene fbp 2280 1156 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_46590 2400 2813 gene locus_tag LOCUS_46600 2400 2813 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199006.1 protein_id gnl|my_center|LOCUS_46600 2814 4172 gene locus_tag LOCUS_46610 2814 4172 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803753.1 protein_id gnl|my_center|LOCUS_46610 5017 4592 gene locus_tag LOCUS_46620 5017 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 >Feature sequence463 1866 232 gene locus_tag LOCUS_46630 1866 232 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_46630 2674 1877 gene locus_tag LOCUS_46640 2674 1877 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_46640 3181 2729 gene locus_tag LOCUS_46650 3181 2729 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417219.1 protein_id gnl|my_center|LOCUS_46650 3313 4713 gene locus_tag LOCUS_46660 3313 4713 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_46660 >Feature sequence464 620 1291 gene locus_tag LOCUS_46670 620 1291 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_46670 2558 1560 gene locus_tag LOCUS_46680 2558 1560 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224954.1 protein_id gnl|my_center|LOCUS_46680 4069 2558 gene locus_tag LOCUS_46690 4069 2558 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224953.1 protein_id gnl|my_center|LOCUS_46690 <5080 4066 gene locus_tag LOCUS_46700 <5080 4066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224952.1:sugar ABC transporter substrate-binding protein >Feature sequence465 1480 62 gene locus_tag LOCUS_46710 1480 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 1956 2648 gene locus_tag LOCUS_46720 1956 2648 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_46720 2836 3054 gene locus_tag LOCUS_46730 2836 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 3312 3722 gene locus_tag LOCUS_46740 3312 3722 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_46740 4988 3771 gene locus_tag LOCUS_46750 4988 3771 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_46750 >Feature sequence466 1154 87 gene locus_tag LOCUS_46760 1154 87 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_46760 2425 1151 gene locus_tag LOCUS_46770 2425 1151 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_46770 3052 2522 gene locus_tag LOCUS_46780 3052 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 3644 3045 gene locus_tag LOCUS_46790 gene recR 3644 3045 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_46790 3999 3649 gene locus_tag LOCUS_46800 3999 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 >Feature sequence467 131 1072 gene locus_tag LOCUS_46810 131 1072 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228840.1 protein_id gnl|my_center|LOCUS_46810 1175 1666 gene locus_tag LOCUS_46820 1175 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 1663 2556 gene locus_tag LOCUS_46830 1663 2556 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 protein_id gnl|my_center|LOCUS_46830 3429 2695 gene locus_tag LOCUS_46840 3429 2695 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978487.1 protein_id gnl|my_center|LOCUS_46840 3715 3494 gene locus_tag LOCUS_46850 3715 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 4229 4519 gene locus_tag LOCUS_46860 4229 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 4575 4889 gene locus_tag LOCUS_46870 4575 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 4896 4970 gene locus_tag LOCUS_t00470 4896 4970 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence468 266 1168 gene locus_tag LOCUS_46880 266 1168 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296810.1 protein_id gnl|my_center|LOCUS_46880 2064 1186 gene locus_tag LOCUS_46890 2064 1186 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224948.1 protein_id gnl|my_center|LOCUS_46890 2969 2061 gene locus_tag LOCUS_46900 2969 2061 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_46900 3679 2966 gene locus_tag LOCUS_46910 3679 2966 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027048.1 protein_id gnl|my_center|LOCUS_46910 4554 3706 gene locus_tag LOCUS_46920 4554 3706 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_46920 >Feature sequence469 <1 798 gene locus_tag LOCUS_46930 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229532.1:M6 family metalloprotease domain-containing protein 3156 901 gene locus_tag LOCUS_46940 gene purL 3156 901 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_46940 3899 3216 gene locus_tag LOCUS_46950 gene purQ 3899 3216 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_46950 4525 4076 gene locus_tag LOCUS_46960 4525 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 4959 4714 gene locus_tag LOCUS_46970 gene purS 4959 4714 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_46970 >Feature sequence470 <1 520 gene locus_tag LOCUS_46980 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389782.1:serine O-acetyltransferase 1186 542 gene locus_tag LOCUS_46990 1186 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 1377 1808 gene locus_tag LOCUS_47000 1377 1808 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340074.1 protein_id gnl|my_center|LOCUS_47000 1984 2058 gene locus_tag LOCUS_t00480 1984 2058 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2200 3513 gene locus_tag LOCUS_47010 2200 3513 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 protein_id gnl|my_center|LOCUS_47010 3725 3997 gene locus_tag LOCUS_47020 3725 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 >Feature sequence471 111 668 gene locus_tag LOCUS_47030 111 668 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889480.1 protein_id gnl|my_center|LOCUS_47030 4759 710 gene locus_tag LOCUS_47040 4759 710 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170068736.1 protein_id gnl|my_center|LOCUS_47040 >Feature sequence472 2995 575 gene locus_tag LOCUS_47050 2995 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 3666 3166 gene locus_tag LOCUS_47060 3666 3166 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_47060 3799 4866 gene locus_tag LOCUS_47070 gene hppD 3799 4866 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 protein_id gnl|my_center|LOCUS_47070 >Feature sequence473 1478 2053 gene locus_tag LOCUS_47080 1478 2053 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227638.1 protein_id gnl|my_center|LOCUS_47080 2949 2194 gene locus_tag LOCUS_47090 2949 2194 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922560.1 protein_id gnl|my_center|LOCUS_47090 3134 3610 gene locus_tag LOCUS_47100 3134 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 4049 4315 gene locus_tag LOCUS_47110 4049 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 >Feature sequence474 <1 1063 gene locus_tag LOCUS_47120 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104003.1:D-isomer specific 2-hydroxyacid dehydrogenase family protein 1169 2824 gene locus_tag LOCUS_47130 1169 2824 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974947.1 protein_id gnl|my_center|LOCUS_47130 3336 2827 gene locus_tag LOCUS_47140 3336 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47140 3725 3312 gene locus_tag LOCUS_47150 3725 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47150 <4961 3822 gene locus_tag LOCUS_47160 <4961 3822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973593.1:HAMP domain-containing sensor histidine kinase >Feature sequence475 591 1475 gene locus_tag LOCUS_47170 591 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 1672 2103 gene locus_tag LOCUS_47180 1672 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 2141 4954 gene locus_tag LOCUS_47190 2141 4954 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031757.1 protein_id gnl|my_center|LOCUS_47190 >Feature sequence476 647 261 gene locus_tag LOCUS_47200 647 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 917 1783 gene locus_tag LOCUS_47210 917 1783 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976933.1 protein_id gnl|my_center|LOCUS_47210 1887 2681 gene locus_tag LOCUS_47220 1887 2681 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_47220 2714 4003 gene locus_tag LOCUS_47230 2714 4003 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_47230 >Feature sequence477 795 112 gene locus_tag LOCUS_47240 795 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 1337 792 gene locus_tag LOCUS_47250 1337 792 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_47250 1517 1861 gene locus_tag LOCUS_47260 1517 1861 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_47260 1999 3021 gene locus_tag LOCUS_47270 1999 3021 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_47270 3050 3523 gene locus_tag LOCUS_47280 gene ybeY 3050 3523 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899292.1 protein_id gnl|my_center|LOCUS_47280 3520 4815 gene locus_tag LOCUS_47290 3520 4815 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_47290 >Feature sequence478 587 141 gene locus_tag LOCUS_47300 587 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 1306 584 gene locus_tag LOCUS_47310 1306 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 1609 1310 gene locus_tag LOCUS_47320 1609 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 1927 1619 gene locus_tag LOCUS_47330 1927 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 2565 1924 gene locus_tag LOCUS_47340 2565 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 2909 2562 gene locus_tag LOCUS_47350 2909 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 2908 3240 gene locus_tag LOCUS_47360 2908 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 3242 3661 gene locus_tag LOCUS_47370 3242 3661 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970313.1 protein_id gnl|my_center|LOCUS_47370 4753 3686 gene locus_tag LOCUS_47380 4753 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 >Feature sequence479 3080 2049 gene locus_tag LOCUS_47390 3080 2049 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_47390 3288 4049 gene locus_tag LOCUS_47400 3288 4049 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_47400 >Feature sequence480 961 119 gene locus_tag LOCUS_47410 961 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47410 1356 958 gene locus_tag LOCUS_47420 1356 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47420 1824 2114 gene locus_tag LOCUS_47430 1824 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 2104 2421 gene locus_tag LOCUS_47440 2104 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 2464 2790 gene locus_tag LOCUS_47450 2464 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 3082 3540 gene locus_tag LOCUS_47460 3082 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47460 4688 4191 gene locus_tag LOCUS_47470 4688 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 >Feature sequence481 4040 519 gene locus_tag LOCUS_47480 gene dnaE 4040 519 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_47480 >Feature sequence482 1571 1365 gene locus_tag LOCUS_47490 1571 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 1756 1998 gene locus_tag LOCUS_47500 1756 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 2209 2003 gene locus_tag LOCUS_47510 2209 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 2666 3088 gene locus_tag LOCUS_47520 2666 3088 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171645.1 protein_id gnl|my_center|LOCUS_47520 3239 4504 gene locus_tag LOCUS_47530 3239 4504 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087760.1 protein_id gnl|my_center|LOCUS_47530 >Feature sequence483 <1 1065 gene locus_tag LOCUS_47540 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527789.1:molybdopterin oxidoreductase family protein 1501 1055 gene locus_tag LOCUS_47550 1501 1055 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223560.1 protein_id gnl|my_center|LOCUS_47550 1588 2037 gene locus_tag LOCUS_47560 1588 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 2490 2071 gene locus_tag LOCUS_47570 2490 2071 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_47570 2741 2496 gene locus_tag LOCUS_47580 2741 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888728.1 protein_id gnl|my_center|LOCUS_47580 2965 4788 gene locus_tag LOCUS_47590 2965 4788 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112395.1 protein_id gnl|my_center|LOCUS_47590 >Feature sequence484 <1 2681 gene locus_tag LOCUS_47600 <1 2681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031088.1:glycoside hydrolase family 16 protein 3284 2733 gene locus_tag LOCUS_47610 3284 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 4032 3439 gene locus_tag LOCUS_47620 4032 3439 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529441.1 protein_id gnl|my_center|LOCUS_47620 >Feature sequence485 1762 830 gene locus_tag LOCUS_47630 1762 830 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_47630 1851 2981 gene locus_tag LOCUS_47640 1851 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 3276 4748 gene locus_tag LOCUS_47650 3276 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 >Feature sequence486 1651 986 gene locus_tag LOCUS_47660 1651 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 2501 1908 gene locus_tag LOCUS_47670 2501 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 2560 2733 gene locus_tag LOCUS_47680 2560 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 2910 3146 gene locus_tag LOCUS_47690 2910 3146 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 protein_id gnl|my_center|LOCUS_47690 3536 3943 gene locus_tag LOCUS_47700 3536 3943 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_47700 4332 4562 gene locus_tag LOCUS_47710 4332 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47710 >Feature sequence487 1154 3 gene locus_tag LOCUS_47720 1154 3 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_47720 1785 1174 gene locus_tag LOCUS_47730 1785 1174 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_47730 2042 3082 gene locus_tag LOCUS_47740 gene aroF 2042 3082 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_47740 4595 3399 gene locus_tag LOCUS_47750 gene thiI 4595 3399 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 protein_id gnl|my_center|LOCUS_47750 >Feature sequence488 547 765 gene locus_tag LOCUS_47760 547 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 762 1181 gene locus_tag LOCUS_47770 762 1181 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_47770 1197 1556 gene locus_tag LOCUS_47780 1197 1556 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_47780 1537 2121 gene locus_tag LOCUS_47790 1537 2121 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_47790 >Feature sequence489 895 650 gene locus_tag LOCUS_47800 895 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 897 1421 gene locus_tag LOCUS_47810 897 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 1520 2248 gene locus_tag LOCUS_47820 1520 2248 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_47820 2651 2253 gene locus_tag LOCUS_47830 2651 2253 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_47830 2841 3674 gene locus_tag LOCUS_47840 2841 3674 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086127.1 protein_id gnl|my_center|LOCUS_47840 3733 4677 gene locus_tag LOCUS_47850 3733 4677 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091887.1 protein_id gnl|my_center|LOCUS_47850 >Feature sequence490 427 1212 gene locus_tag LOCUS_47860 427 1212 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_47860 1330 2478 gene locus_tag LOCUS_47870 1330 2478 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_47870 2928 2593 gene locus_tag LOCUS_47880 2928 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 3952 2996 gene locus_tag LOCUS_47890 3952 2996 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_47890 4667 4011 gene locus_tag LOCUS_47900 4667 4011 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 protein_id gnl|my_center|LOCUS_47900 >Feature sequence491 1358 318 gene locus_tag LOCUS_47910 1358 318 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_47910 1425 2366 gene locus_tag LOCUS_47920 1425 2366 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_47920 2363 3313 gene locus_tag LOCUS_47930 2363 3313 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_47930 3586 3912 gene locus_tag LOCUS_47940 3586 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 >Feature sequence492 2501 42 gene locus_tag LOCUS_47950 2501 42 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203995958.1 protein_id gnl|my_center|LOCUS_47950 3389 2727 gene locus_tag LOCUS_47960 3389 2727 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_47960 3542 4309 gene locus_tag LOCUS_47970 3542 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 >Feature sequence493 147 1862 gene locus_tag LOCUS_47980 147 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 1867 2214 gene locus_tag LOCUS_47990 1867 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 2211 3551 gene locus_tag LOCUS_48000 2211 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 >Feature sequence494 986 252 gene locus_tag LOCUS_48010 986 252 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_48010 1810 983 gene locus_tag LOCUS_48020 1810 983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838698.1 protein_id gnl|my_center|LOCUS_48020 2865 1807 gene locus_tag LOCUS_48030 2865 1807 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_48030 3837 2902 gene locus_tag LOCUS_48040 3837 2902 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_48040 >Feature sequence495 <1 2167 gene locus_tag LOCUS_48050 <1 2167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193487177.1:[protein-PII] uridylyltransferase >Feature sequence496 983 408 gene locus_tag LOCUS_48060 983 408 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_48060 2491 1082 gene locus_tag LOCUS_48070 2491 1082 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_48070 3638 2727 gene locus_tag LOCUS_48080 3638 2727 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_48080 3765 4271 gene locus_tag LOCUS_48090 3765 4271 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_48090 4665 4414 gene locus_tag LOCUS_48100 4665 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 >Feature sequence497 187 3453 gene locus_tag LOCUS_48110 187 3453 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_48110 3526 4152 gene locus_tag LOCUS_48120 3526 4152 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 protein_id gnl|my_center|LOCUS_48120 >Feature sequence498 1026 1511 gene locus_tag LOCUS_48130 1026 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 2367 1888 gene locus_tag LOCUS_48140 2367 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 2840 4258 gene locus_tag LOCUS_48150 2840 4258 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_48150 >Feature sequence499 1524 679 gene locus_tag LOCUS_48160 gene hisG 1524 679 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_48160 1849 1586 gene locus_tag LOCUS_48170 1849 1586 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 protein_id gnl|my_center|LOCUS_48170 3015 2050 gene locus_tag LOCUS_48180 gene axeA 3015 2050 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_48180 3348 4604 gene locus_tag LOCUS_48190 3348 4604 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 protein_id gnl|my_center|LOCUS_48190 >Feature sequence500 1266 40 gene locus_tag LOCUS_48200 1266 40 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_48200 1354 1785 gene locus_tag LOCUS_48210 1354 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 1824 2813 gene locus_tag LOCUS_48220 1824 2813 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_48220 3601 3254 gene locus_tag LOCUS_48230 3601 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_48230 4272 4526 gene locus_tag LOCUS_48240 4272 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 >Feature sequence501 304 915 gene locus_tag LOCUS_48250 304 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 985 2343 gene locus_tag LOCUS_48260 gene pafA 985 2343 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_48260 2415 3377 gene locus_tag LOCUS_48270 2415 3377 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_48270 4399 3446 gene locus_tag LOCUS_48280 4399 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 >Feature sequence502 627 1226 gene locus_tag LOCUS_48290 627 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 2589 1204 gene locus_tag LOCUS_48300 2589 1204 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223637.1 protein_id gnl|my_center|LOCUS_48300 2658 3311 gene locus_tag LOCUS_48310 2658 3311 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_48310 >Feature sequence503 470 117 gene locus_tag LOCUS_48320 470 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 495 932 gene locus_tag LOCUS_48330 495 932 CDS product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208848.1 protein_id gnl|my_center|LOCUS_48330 936 2039 gene locus_tag LOCUS_48340 936 2039 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208847.1 protein_id gnl|my_center|LOCUS_48340 2043 2648 gene locus_tag LOCUS_48350 2043 2648 CDS product DUF2313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937529.1 protein_id gnl|my_center|LOCUS_48350 2652 3494 gene locus_tag LOCUS_48360 2652 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 3505 4047 gene locus_tag LOCUS_48370 3505 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 4309 4584 gene locus_tag LOCUS_48380 4309 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 >Feature sequence504 453 1634 gene locus_tag LOCUS_48390 453 1634 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_48390 1650 2627 gene locus_tag LOCUS_48400 1650 2627 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_48400 2800 4548 gene locus_tag LOCUS_48410 2800 4548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975712.1 protein_id gnl|my_center|LOCUS_48410 >Feature sequence505 960 421 gene locus_tag LOCUS_48420 960 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 887 1414 gene locus_tag LOCUS_48430 887 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 1628 2461 gene locus_tag LOCUS_48440 1628 2461 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730515.1 protein_id gnl|my_center|LOCUS_48440 2492 2917 gene locus_tag LOCUS_48450 2492 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 2941 3234 gene locus_tag LOCUS_48460 2941 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48460 >Feature sequence506 843 121 gene locus_tag LOCUS_48470 843 121 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_48470 2001 865 gene locus_tag LOCUS_48480 gene dnaJ 2001 865 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_48480 3015 2002 gene locus_tag LOCUS_48490 gene hrcA 3015 2002 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_48490 3173 3829 gene locus_tag LOCUS_48500 3173 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 3839 4654 gene locus_tag LOCUS_48510 3839 4654 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_48510 >Feature sequence507 449 790 gene locus_tag LOCUS_48520 449 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 973 1791 gene locus_tag LOCUS_48530 973 1791 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975366.1 protein_id gnl|my_center|LOCUS_48530 1821 2789 gene locus_tag LOCUS_48540 1821 2789 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_48540 2762 2932 gene locus_tag LOCUS_48550 2762 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 2910 3365 gene locus_tag LOCUS_48560 2910 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 3447 4346 gene locus_tag LOCUS_48570 3447 4346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_48570 >Feature sequence508 332 57 gene locus_tag LOCUS_48580 gene rpsT 332 57 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_48580 1482 442 gene locus_tag LOCUS_48590 1482 442 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030060.1 protein_id gnl|my_center|LOCUS_48590 1673 3496 gene locus_tag LOCUS_48600 gene lepA 1673 3496 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_48600 3564 4211 gene locus_tag LOCUS_48610 3564 4211 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_48610 >Feature sequence509 1558 515 gene locus_tag LOCUS_48620 1558 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 2580 1555 gene locus_tag LOCUS_48630 2580 1555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_48630 3596 2577 gene locus_tag LOCUS_48640 3596 2577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_48640 4538 3687 gene locus_tag LOCUS_48650 4538 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 >Feature sequence510 2190 1363 gene locus_tag LOCUS_48660 2190 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 2691 4046 gene locus_tag LOCUS_48670 2691 4046 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085590.1 protein_id gnl|my_center|LOCUS_48670 >Feature sequence511 1010 417 gene locus_tag LOCUS_48680 1010 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 1899 1327 gene locus_tag LOCUS_48690 1899 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 2292 3254 gene locus_tag LOCUS_48700 2292 3254 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_48700 3356 4483 gene locus_tag LOCUS_48710 gene moeZ 3356 4483 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_48710 >Feature sequence512 828 58 gene locus_tag LOCUS_48720 828 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 997 1236 gene locus_tag LOCUS_48730 997 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 1816 1247 gene locus_tag LOCUS_48740 1816 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 3110 2004 gene locus_tag LOCUS_48750 3110 2004 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_48750 4045 3110 gene locus_tag LOCUS_48760 gene arcC 4045 3110 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_48760 >Feature sequence513 1116 1265 gene locus_tag LOCUS_48770 1116 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 1471 2118 gene locus_tag LOCUS_48780 1471 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 2610 2254 gene locus_tag LOCUS_48790 2610 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 4356 2623 gene locus_tag LOCUS_48800 4356 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 >Feature sequence514 1215 25 gene locus_tag LOCUS_48810 1215 25 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469107.1 protein_id gnl|my_center|LOCUS_48810 2327 1545 gene locus_tag LOCUS_48820 2327 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 4242 2611 gene locus_tag LOCUS_48830 4242 2611 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_48830 >Feature sequence515 318 130 gene locus_tag LOCUS_48840 318 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 438 1109 gene locus_tag LOCUS_48850 438 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 1180 1461 gene locus_tag LOCUS_48860 1180 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 1540 1743 gene locus_tag LOCUS_48870 1540 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 1740 3134 gene locus_tag LOCUS_48880 1740 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 3262 3510 gene locus_tag LOCUS_48890 3262 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 3527 4450 gene locus_tag LOCUS_48900 3527 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 >Feature sequence516 109 420 gene locus_tag LOCUS_48910 109 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 862 452 gene locus_tag LOCUS_48920 862 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 1372 959 gene locus_tag LOCUS_48930 1372 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 1937 1446 gene locus_tag LOCUS_48940 1937 1446 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_48940 2171 2626 gene locus_tag LOCUS_48950 2171 2626 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 protein_id gnl|my_center|LOCUS_48950 3314 2850 gene locus_tag LOCUS_48960 3314 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 4385 3441 gene locus_tag LOCUS_48970 4385 3441 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_48970 >Feature sequence517 272 1093 gene locus_tag LOCUS_48980 272 1093 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228128.1 protein_id gnl|my_center|LOCUS_48980 1281 2426 gene locus_tag LOCUS_48990 1281 2426 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 protein_id gnl|my_center|LOCUS_48990 2859 2680 gene locus_tag LOCUS_49000 2859 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 4049 3285 gene locus_tag LOCUS_49010 4049 3285 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_49010 4438 4106 gene locus_tag LOCUS_49020 4438 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 >Feature sequence518 1715 828 gene locus_tag LOCUS_49030 1715 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 1954 2781 gene locus_tag LOCUS_49040 1954 2781 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_49040 4300 2789 gene locus_tag LOCUS_49050 gene glpK 4300 2789 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226254.1 protein_id gnl|my_center|LOCUS_49050 >Feature sequence519 2055 1633 gene locus_tag LOCUS_49060 2055 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 2520 3926 gene locus_tag LOCUS_49070 2520 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 >Feature sequence520 527 2551 gene locus_tag LOCUS_49080 527 2551 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727420.1 protein_id gnl|my_center|LOCUS_49080 3091 2534 gene locus_tag LOCUS_49090 3091 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 3216 4205 gene locus_tag LOCUS_49100 3216 4205 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 protein_id gnl|my_center|LOCUS_49100 >Feature sequence521 521 183 gene locus_tag LOCUS_49110 521 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 2326 518 gene locus_tag LOCUS_49120 2326 518 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_49120 2856 2323 gene locus_tag LOCUS_49130 2856 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 4504 3035 gene locus_tag LOCUS_49140 4504 3035 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226994.1 protein_id gnl|my_center|LOCUS_49140 >Feature sequence522 1193 6 gene locus_tag LOCUS_49150 1193 6 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_49150 1843 1190 gene locus_tag LOCUS_49160 1843 1190 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_49160 1995 2516 gene locus_tag LOCUS_49170 1995 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 2528 3577 gene locus_tag LOCUS_49180 2528 3577 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225401.1 protein_id gnl|my_center|LOCUS_49180 3574 4371 gene locus_tag LOCUS_49190 3574 4371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_49190 >Feature sequence523 3922 2324 gene locus_tag LOCUS_49200 3922 2324 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_49200 4474 4040 gene locus_tag LOCUS_49210 4474 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 >Feature sequence524 313 1803 gene locus_tag LOCUS_49220 313 1803 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026955.1 protein_id gnl|my_center|LOCUS_49220 1800 2801 gene locus_tag LOCUS_49230 1800 2801 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 protein_id gnl|my_center|LOCUS_49230 3139 3054 gene locus_tag LOCUS_t00490 3139 3054 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3296 4036 gene locus_tag LOCUS_49240 3296 4036 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_49240 >Feature sequence525 47 1396 gene locus_tag LOCUS_49250 47 1396 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_49250 1544 1888 gene locus_tag LOCUS_49260 1544 1888 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_49260 3089 1971 gene locus_tag LOCUS_49270 3089 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49270 3664 3086 gene locus_tag LOCUS_49280 3664 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49280 3909 3625 gene locus_tag LOCUS_49290 3909 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49290 4328 4104 gene locus_tag LOCUS_49300 4328 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 >Feature sequence526 345 1148 gene locus_tag LOCUS_49310 345 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 1521 2612 gene locus_tag LOCUS_49320 gene gcvT 1521 2612 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_49320 2609 3001 gene locus_tag LOCUS_49330 gene gcvH 2609 3001 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_49330 3027 4400 gene locus_tag LOCUS_49340 3027 4400 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_49340 >Feature sequence527 303 1067 gene locus_tag LOCUS_49350 303 1067 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_49350 1112 1702 gene locus_tag LOCUS_49360 1112 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972086.1 protein_id gnl|my_center|LOCUS_49360 2965 1739 gene locus_tag LOCUS_49370 gene glgC 2965 1739 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_49370 3050 4240 gene locus_tag LOCUS_49380 gene glgA 3050 4240 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_49380 >Feature sequence528 89 442 gene locus_tag LOCUS_49390 89 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 439 852 gene locus_tag LOCUS_49400 439 852 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_49400 1164 2648 gene locus_tag LOCUS_49410 1164 2648 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_49410 2718 3344 gene locus_tag LOCUS_49420 2718 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 3513 4256 gene locus_tag LOCUS_49430 3513 4256 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336442.1 protein_id gnl|my_center|LOCUS_49430 >Feature sequence529 1108 104 gene locus_tag LOCUS_49440 1108 104 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223218.1 protein_id gnl|my_center|LOCUS_49440 2005 1109 gene locus_tag LOCUS_49450 2005 1109 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_49450 3681 2359 gene locus_tag LOCUS_49460 3681 2359 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_49460 <4421 3686 gene locus_tag LOCUS_49470 <4421 3686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027682.1:2-oxo acid dehydrogenase subunit E2 >Feature sequence530 2015 2524 gene locus_tag LOCUS_49480 2015 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 2903 2538 gene locus_tag LOCUS_49490 2903 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 4212 3079 gene locus_tag LOCUS_49500 4212 3079 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_49500 >Feature sequence531 1611 100 gene locus_tag LOCUS_49510 1611 100 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029652.1 protein_id gnl|my_center|LOCUS_49510 3205 2012 gene locus_tag LOCUS_49520 3205 2012 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029306.1 protein_id gnl|my_center|LOCUS_49520 3313 3771 gene locus_tag LOCUS_49530 3313 3771 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975018.1 protein_id gnl|my_center|LOCUS_49530 4210 3917 gene locus_tag LOCUS_49540 4210 3917 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728084.1 protein_id gnl|my_center|LOCUS_49540 >Feature sequence532 282 1286 gene locus_tag LOCUS_49550 gene hpnH 282 1286 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_49550 2049 1303 gene locus_tag LOCUS_49560 2049 1303 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325650.1 protein_id gnl|my_center|LOCUS_49560 2176 2409 gene locus_tag LOCUS_49570 2176 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 2406 2855 gene locus_tag LOCUS_49580 2406 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 2901 3881 gene locus_tag LOCUS_49590 2901 3881 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_49590 >Feature sequence533 1398 2417 gene locus_tag LOCUS_49600 1398 2417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973865.1 protein_id gnl|my_center|LOCUS_49600 2480 4243 gene locus_tag LOCUS_49610 2480 4243 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_49610 >Feature sequence534 187 861 gene locus_tag LOCUS_49620 187 861 CDS product pyridoxal 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221982.1 protein_id gnl|my_center|LOCUS_49620 1936 941 gene locus_tag LOCUS_49630 1936 941 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055585491.1 protein_id gnl|my_center|LOCUS_49630 2024 3328 gene locus_tag LOCUS_49640 2024 3328 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528603.1 protein_id gnl|my_center|LOCUS_49640 3531 3872 gene locus_tag LOCUS_49650 3531 3872 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226217.1 protein_id gnl|my_center|LOCUS_49650 >Feature sequence535 1772 93 gene locus_tag LOCUS_49660 1772 93 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113213.1 protein_id gnl|my_center|LOCUS_49660 2465 1896 gene locus_tag LOCUS_49670 2465 1896 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730990.1 protein_id gnl|my_center|LOCUS_49670 3095 3805 gene locus_tag LOCUS_49680 3095 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 >Feature sequence536 1915 551 gene locus_tag LOCUS_49690 gene dacB 1915 551 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_49690 2023 2526 gene locus_tag LOCUS_49700 2023 2526 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_49700 3878 2712 gene locus_tag LOCUS_49710 3878 2712 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226784.1 protein_id gnl|my_center|LOCUS_49710 >Feature sequence537 1698 1255 gene locus_tag LOCUS_49720 1698 1255 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239004.1 protein_id gnl|my_center|LOCUS_49720 2645 1761 gene locus_tag LOCUS_49730 2645 1761 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_49730 2793 3158 gene locus_tag LOCUS_49740 2793 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 <4308 3451 gene locus_tag LOCUS_49750 <4308 3451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227866.1:C4-dicarboxylate transporter DctA >Feature sequence538 742 74 gene locus_tag LOCUS_49760 742 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 1316 900 gene locus_tag LOCUS_49770 1316 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 1379 4060 gene locus_tag LOCUS_49780 gene polA 1379 4060 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_49780 >Feature sequence539 613 74 gene locus_tag LOCUS_49790 613 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 883 1071 gene locus_tag LOCUS_49800 883 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 2120 1158 gene locus_tag LOCUS_49810 2120 1158 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_49810 3573 2257 gene locus_tag LOCUS_49820 3573 2257 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_49820 >Feature sequence540 <4263 898 gene locus_tag LOCUS_49830 <4263 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027948.1:DNA polymerase III subunit alpha >Feature sequence541 628 182 gene locus_tag LOCUS_49840 628 182 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_49840 3995 1323 gene locus_tag LOCUS_49850 3995 1323 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072227.1 protein_id gnl|my_center|LOCUS_49850 >Feature sequence542 29 1270 gene locus_tag LOCUS_49860 29 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 2561 1362 gene locus_tag LOCUS_49870 2561 1362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226769.1 protein_id gnl|my_center|LOCUS_49870 3736 2558 gene locus_tag LOCUS_49880 3736 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 3630 4232 gene locus_tag LOCUS_49890 3630 4232 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226060.1 protein_id gnl|my_center|LOCUS_49890 >Feature sequence543 187 408 gene locus_tag LOCUS_49900 187 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 2462 468 gene locus_tag LOCUS_49910 2462 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 2595 3809 gene locus_tag LOCUS_49920 2595 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 >Feature sequence544 152 1054 gene locus_tag LOCUS_49930 152 1054 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731064.1 protein_id gnl|my_center|LOCUS_49930 1051 2310 gene locus_tag LOCUS_49940 1051 2310 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_49940 2307 3428 gene locus_tag LOCUS_49950 2307 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731583.1 protein_id gnl|my_center|LOCUS_49950 >Feature sequence545 496 1779 gene locus_tag LOCUS_49960 496 1779 CDS product cellulose-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030452.1 protein_id gnl|my_center|LOCUS_49960 1837 2415 gene locus_tag LOCUS_49970 1837 2415 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226035.1 protein_id gnl|my_center|LOCUS_49970 3669 2470 gene locus_tag LOCUS_49980 3669 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 >Feature sequence546 452 2479 gene locus_tag LOCUS_49990 452 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 3513 2587 gene locus_tag LOCUS_50000 3513 2587 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257434.1 protein_id gnl|my_center|LOCUS_50000 >Feature sequence547 739 92 gene locus_tag LOCUS_50010 739 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 2042 810 gene locus_tag LOCUS_50020 2042 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 2266 2997 gene locus_tag LOCUS_50030 2266 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 <4180 3303 gene locus_tag LOCUS_50040 <4180 3303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027426.1:BTAD domain-containing putative transcriptional regulator >Feature sequence548 421 1596 gene locus_tag LOCUS_50050 421 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50050 2761 1787 gene locus_tag LOCUS_50060 2761 1787 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_50060 >Feature sequence549 458 739 gene locus_tag LOCUS_50070 458 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 726 1091 gene locus_tag LOCUS_50080 726 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 1133 1345 gene locus_tag LOCUS_50090 1133 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 1346 2164 gene locus_tag LOCUS_50100 1346 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 2161 2733 gene locus_tag LOCUS_50110 2161 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 2730 2999 gene locus_tag LOCUS_50120 2730 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 3008 3178 gene locus_tag LOCUS_50130 3008 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 3175 3555 gene locus_tag LOCUS_50140 3175 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 3549 3803 gene locus_tag LOCUS_50150 3549 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 3796 3990 gene locus_tag LOCUS_50160 3796 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 >Feature sequence550 2559 1684 gene locus_tag LOCUS_50170 2559 1684 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_50170 2849 4108 gene locus_tag LOCUS_50180 2849 4108 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742198.1 protein_id gnl|my_center|LOCUS_50180 >Feature sequence551 1026 304 gene locus_tag LOCUS_50190 1026 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 1845 1030 gene locus_tag LOCUS_50200 1845 1030 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095584129.1 protein_id gnl|my_center|LOCUS_50200 2117 2335 gene locus_tag LOCUS_50210 2117 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 2376 3755 gene locus_tag LOCUS_50220 2376 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 >Feature sequence552 478 855 gene locus_tag LOCUS_50230 478 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 1376 771 gene locus_tag LOCUS_50240 1376 771 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_50240 2536 1373 gene locus_tag LOCUS_50250 2536 1373 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030073.1 protein_id gnl|my_center|LOCUS_50250 3301 2564 gene locus_tag LOCUS_50260 3301 2564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973847.1 protein_id gnl|my_center|LOCUS_50260 4089 3304 gene locus_tag LOCUS_50270 4089 3304 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028266.1 protein_id gnl|my_center|LOCUS_50270 >Feature sequence553 2557 62 gene locus_tag LOCUS_50280 2557 62 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_50280 3304 2561 gene locus_tag LOCUS_50290 3304 2561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_50290 <4073 3417 gene locus_tag LOCUS_50300 <4073 3417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975444.1:response regulator transcription factor >Feature sequence554 272 3361 gene locus_tag LOCUS_50310 272 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 3390 3944 gene locus_tag LOCUS_50320 3390 3944 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222694.1 protein_id gnl|my_center|LOCUS_50320 >Feature sequence555 503 1270 gene locus_tag LOCUS_50330 gene recO 503 1270 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_50330 1426 2220 gene locus_tag LOCUS_50340 1426 2220 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_50340 2817 2269 gene locus_tag LOCUS_50350 2817 2269 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_50350 3301 2900 gene locus_tag LOCUS_50360 3301 2900 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_50360 3686 3357 gene locus_tag LOCUS_50370 3686 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 >Feature sequence556 606 869 gene locus_tag LOCUS_50380 606 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 1422 1234 gene locus_tag LOCUS_50390 1422 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 1844 1437 gene locus_tag LOCUS_50400 1844 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 2302 1841 gene locus_tag LOCUS_50410 2302 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 3220 2381 gene locus_tag LOCUS_50420 3220 2381 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831648.1 protein_id gnl|my_center|LOCUS_50420 >Feature sequence557 1226 237 gene locus_tag LOCUS_50430 1226 237 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228674.1 protein_id gnl|my_center|LOCUS_50430 1784 1413 gene locus_tag LOCUS_50440 1784 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 2229 2819 gene locus_tag LOCUS_50450 2229 2819 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 protein_id gnl|my_center|LOCUS_50450 2816 3412 gene locus_tag LOCUS_50460 2816 3412 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_50460 3814 3416 gene locus_tag LOCUS_50470 3814 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 >Feature sequence558 630 1268 gene locus_tag LOCUS_50480 630 1268 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_50480 1265 3235 gene locus_tag LOCUS_50490 1265 3235 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225082.1 protein_id gnl|my_center|LOCUS_50490 3232 3972 gene locus_tag LOCUS_50500 3232 3972 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225083.1 protein_id gnl|my_center|LOCUS_50500 >Feature sequence559 866 177 gene locus_tag LOCUS_50510 866 177 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_50510 1643 879 gene locus_tag LOCUS_50520 1643 879 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_50520 3003 1648 gene locus_tag LOCUS_50530 3003 1648 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_50530 <4050 3000 gene locus_tag LOCUS_50540 <4050 3000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200876257.1:glutamine synthetase family protein >Feature sequence560 1248 145 gene locus_tag LOCUS_50550 1248 145 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_50550 2425 1475 gene locus_tag LOCUS_50560 2425 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 3414 2422 gene locus_tag LOCUS_50570 3414 2422 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_50570 >Feature sequence561 276 2321 gene locus_tag LOCUS_50580 276 2321 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067631220.1 protein_id gnl|my_center|LOCUS_50580 >Feature sequence562 1720 779 gene locus_tag LOCUS_50590 gene coaA 1720 779 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222129.1 protein_id gnl|my_center|LOCUS_50590 2033 2383 gene locus_tag LOCUS_50600 2033 2383 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_50600 2502 4004 gene locus_tag LOCUS_50610 2502 4004 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_50610 >Feature sequence563 1708 164 gene locus_tag LOCUS_50620 1708 164 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_50620 2063 1710 gene locus_tag LOCUS_50630 2063 1710 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_50630 >Feature sequence564 <1 1010 gene locus_tag LOCUS_50640 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226355.1:LacI family DNA-binding transcriptional regulator 3039 1012 gene locus_tag LOCUS_50650 3039 1012 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_50650 <3998 3121 gene locus_tag LOCUS_50660 <3998 3121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225149.1:cellulose binding domain-containing protein >Feature sequence565 215 1252 gene locus_tag LOCUS_50670 215 1252 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_50670 1269 2246 gene locus_tag LOCUS_50680 1269 2246 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031473.1 protein_id gnl|my_center|LOCUS_50680 3562 2549 gene locus_tag LOCUS_50690 3562 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 3996 3826 gene locus_tag LOCUS_50700 3996 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 >Feature sequence566 777 505 gene locus_tag LOCUS_50710 777 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 1241 2653 gene locus_tag LOCUS_50720 gene eccB 1241 2653 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_50720 3197 2655 gene locus_tag LOCUS_50730 3197 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 3718 3209 gene locus_tag LOCUS_50740 3718 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 >Feature sequence567 439 65 gene locus_tag LOCUS_50750 439 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 1058 531 gene locus_tag LOCUS_50760 1058 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 2320 1094 gene locus_tag LOCUS_50770 2320 1094 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198965.1 protein_id gnl|my_center|LOCUS_50770 2404 3273 gene locus_tag LOCUS_50780 2404 3273 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891436.1 protein_id gnl|my_center|LOCUS_50780 3289 3903 gene locus_tag LOCUS_50790 3289 3903 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730026.1 protein_id gnl|my_center|LOCUS_50790 >Feature sequence568 1477 155 gene locus_tag LOCUS_50800 1477 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 1654 2166 gene locus_tag LOCUS_50810 gene mce 1654 2166 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059866.1 protein_id gnl|my_center|LOCUS_50810 2239 2661 gene locus_tag LOCUS_50820 2239 2661 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_50820 2658 3797 gene locus_tag LOCUS_50830 2658 3797 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_50830 >Feature sequence569 1400 42 gene locus_tag LOCUS_50840 1400 42 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638993.1 protein_id gnl|my_center|LOCUS_50840 1713 3857 gene locus_tag LOCUS_50850 gene rmdB 1713 3857 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_50850 >Feature sequence570 <1 3837 gene locus_tag LOCUS_50860 <1 3837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121221131.1:RICIN domain-containing protein >Feature sequence571 876 217 gene locus_tag LOCUS_50870 876 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 1869 919 gene locus_tag LOCUS_50880 1869 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 2174 1866 gene locus_tag LOCUS_50890 2174 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 2985 2071 gene locus_tag LOCUS_50900 2985 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 3362 2982 gene locus_tag LOCUS_50910 3362 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 <3919 3359 gene locus_tag LOCUS_50920 <3919 3359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942038.1:type I-E CRISPR-associated protein Cas6/Cse3/CasE >Feature sequence572 511 1692 gene locus_tag LOCUS_50930 511 1692 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_50930 1689 2138 gene locus_tag LOCUS_50940 1689 2138 CDS product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206153.1 protein_id gnl|my_center|LOCUS_50940 2148 3728 gene locus_tag LOCUS_50950 2148 3728 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468324.1 protein_id gnl|my_center|LOCUS_50950 >Feature sequence573 113 1216 gene locus_tag LOCUS_50960 113 1216 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 protein_id gnl|my_center|LOCUS_50960 1213 3468 gene locus_tag LOCUS_50970 1213 3468 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729600.1 protein_id gnl|my_center|LOCUS_50970 3455 3907 gene locus_tag LOCUS_50980 3455 3907 CDS product DUF6262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729601.1 protein_id gnl|my_center|LOCUS_50980 >Feature sequence574 1007 627 gene locus_tag LOCUS_50990 1007 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 2207 1200 gene locus_tag LOCUS_51000 2207 1200 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484222.1 protein_id gnl|my_center|LOCUS_51000 3532 2309 gene locus_tag LOCUS_51010 3532 2309 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_51010 >Feature sequence575 <1 954 gene locus_tag LOCUS_51020 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223426.1:BTAD domain-containing putative transcriptional regulator 1419 997 gene locus_tag LOCUS_51030 1419 997 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 protein_id gnl|my_center|LOCUS_51030 1639 3078 gene locus_tag LOCUS_51040 1639 3078 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040347.1 protein_id gnl|my_center|LOCUS_51040 3613 3176 gene locus_tag LOCUS_51050 3613 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231066.1 protein_id gnl|my_center|LOCUS_51050 >Feature sequence576 1026 1439 gene locus_tag LOCUS_51060 1026 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 1605 1832 gene locus_tag LOCUS_51070 1605 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 1845 2378 gene locus_tag LOCUS_51080 1845 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 2454 3587 gene locus_tag LOCUS_51090 2454 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 >Feature sequence577 1222 68 gene locus_tag LOCUS_51100 gene nadA 1222 68 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_51100 1419 1772 gene locus_tag LOCUS_51110 1419 1772 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_51110 1994 2980 gene locus_tag LOCUS_51120 1994 2980 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_51120 3308 2991 gene locus_tag LOCUS_51130 3308 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51130 <3851 3308 gene locus_tag LOCUS_51140 <3851 3308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028169.1:cysteine desulfurase/sulfurtransferase TusA family protein note possible pseudo, internal stop codon, frameshifted >Feature sequence578 37 900 gene locus_tag LOCUS_51150 37 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 897 2708 gene locus_tag LOCUS_51160 897 2708 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_51160 3440 2724 gene locus_tag LOCUS_51170 3440 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 3720 3466 gene locus_tag LOCUS_51180 3720 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 >Feature sequence579 2 280 gene locus_tag LOCUS_51190 2 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 277 1245 gene locus_tag LOCUS_51200 277 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 1242 2345 gene locus_tag LOCUS_51210 1242 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 2345 2719 gene locus_tag LOCUS_51220 2345 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 2719 3444 gene locus_tag LOCUS_51230 2719 3444 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_51230 >Feature sequence580 1450 143 gene locus_tag LOCUS_51240 1450 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 2124 1447 gene locus_tag LOCUS_51250 gene prrA 2124 1447 CDS product two-component system response regulator PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168189073.1 protein_id gnl|my_center|LOCUS_51250 2572 2997 gene locus_tag LOCUS_51260 2572 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 >Feature sequence581 1292 2686 gene locus_tag LOCUS_51270 gene cysS 1292 2686 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_51270 2709 3668 gene locus_tag LOCUS_51280 gene rlmB 2709 3668 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_51280 3719 3792 gene locus_tag LOCUS_t00500 3719 3792 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence582 139 1230 gene locus_tag LOCUS_51290 gene pdhA 139 1230 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_51290 1227 2201 gene locus_tag LOCUS_51300 1227 2201 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_51300 2218 3675 gene locus_tag LOCUS_51310 2218 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 >Feature sequence583 <1 1603 gene locus_tag LOCUS_51320 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270140.1:RNA degradosome polyphosphate kinase 1603 2490 gene locus_tag LOCUS_51330 1603 2490 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093939.1 protein_id gnl|my_center|LOCUS_51330 3344 2586 gene locus_tag LOCUS_51340 3344 2586 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727078.1 protein_id gnl|my_center|LOCUS_51340 >Feature sequence584 1115 372 gene locus_tag LOCUS_51350 1115 372 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495273.1 protein_id gnl|my_center|LOCUS_51350 1336 3396 gene locus_tag LOCUS_51360 1336 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 >Feature sequence585 1700 507 gene locus_tag LOCUS_51370 1700 507 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_51370 1794 2216 gene locus_tag LOCUS_51380 gene mce 1794 2216 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_51380 2399 3703 gene locus_tag LOCUS_51390 2399 3703 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 protein_id gnl|my_center|LOCUS_51390 >Feature sequence586 706 272 gene locus_tag LOCUS_51400 706 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 925 1332 gene locus_tag LOCUS_51410 925 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 1866 1375 gene locus_tag LOCUS_51420 1866 1375 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226161.1 protein_id gnl|my_center|LOCUS_51420 >Feature sequence587 2238 991 gene locus_tag LOCUS_51430 2238 991 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_51430 2310 2510 gene locus_tag LOCUS_51440 2310 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030307.1 protein_id gnl|my_center|LOCUS_51440 3348 2557 gene locus_tag LOCUS_51450 3348 2557 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_51450 >Feature sequence588 178 576 gene locus_tag LOCUS_51460 178 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 576 782 gene locus_tag LOCUS_51470 576 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 784 1122 gene locus_tag LOCUS_51480 784 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 1115 1477 gene locus_tag LOCUS_51490 1115 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 1514 3547 gene locus_tag LOCUS_51500 1514 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 >Feature sequence589 269 1186 gene locus_tag LOCUS_51510 269 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 1268 2233 gene locus_tag LOCUS_51520 1268 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 2321 3466 gene locus_tag LOCUS_51530 2321 3466 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897409.1 protein_id gnl|my_center|LOCUS_51530 >Feature sequence590 462 67 gene locus_tag LOCUS_51540 462 67 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_51540 2123 462 gene locus_tag LOCUS_51550 gene ctaD 2123 462 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_51550 2902 2120 gene locus_tag LOCUS_51560 gene coxB 2902 2120 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_51560 >Feature sequence591 788 69 gene locus_tag LOCUS_51570 788 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 913 1485 gene locus_tag LOCUS_51580 913 1485 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_51580 1639 2556 gene locus_tag LOCUS_51590 1639 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974288.1 protein_id gnl|my_center|LOCUS_51590 3626 2694 gene locus_tag LOCUS_51600 3626 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 >Feature sequence592 920 273 gene locus_tag LOCUS_51610 920 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 1575 895 gene locus_tag LOCUS_51620 1575 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 2606 1572 gene locus_tag LOCUS_51630 2606 1572 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331462.1 protein_id gnl|my_center|LOCUS_51630 3647 2670 gene locus_tag LOCUS_51640 3647 2670 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389876.1 protein_id gnl|my_center|LOCUS_51640 >Feature sequence593 36 725 gene locus_tag LOCUS_51650 36 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 763 1008 gene locus_tag LOCUS_51660 763 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 1005 1274 gene locus_tag LOCUS_51670 1005 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 1305 1967 gene locus_tag LOCUS_51680 1305 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 2605 3588 gene locus_tag LOCUS_51690 2605 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 >Feature sequence594 895 413 gene locus_tag LOCUS_51700 gene rraA 895 413 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731282.1 protein_id gnl|my_center|LOCUS_51700 2114 1017 gene locus_tag LOCUS_51710 2114 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 >Feature sequence595 1022 60 gene locus_tag LOCUS_51720 1022 60 CDS product TIGR03620 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_51720 1404 1964 gene locus_tag LOCUS_51730 1404 1964 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971468.1 protein_id gnl|my_center|LOCUS_51730 2182 3234 gene locus_tag LOCUS_51740 2182 3234 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_51740 3266 3463 gene locus_tag LOCUS_51750 3266 3463 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855276.1 protein_id gnl|my_center|LOCUS_51750 >Feature sequence596 1539 835 gene locus_tag LOCUS_51760 1539 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 1886 1560 gene locus_tag LOCUS_51770 1886 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_51770 2026 2700 gene locus_tag LOCUS_51780 gene nucS 2026 2700 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_51780 2785 3657 gene locus_tag LOCUS_51790 2785 3657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_51790 >Feature sequence597 1504 77 gene locus_tag LOCUS_51800 1504 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 3188 1518 gene locus_tag LOCUS_51810 3188 1518 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 protein_id gnl|my_center|LOCUS_51810 3577 3188 gene locus_tag LOCUS_51820 3577 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 >Feature sequence598 593 1543 gene locus_tag LOCUS_51830 593 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 3006 1480 gene locus_tag LOCUS_51840 3006 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 3233 3388 gene locus_tag LOCUS_51850 3233 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 >Feature sequence599 165 1166 gene locus_tag LOCUS_51860 165 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 1183 1500 gene locus_tag LOCUS_51870 1183 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 >Feature sequence600 601 1419 gene locus_tag LOCUS_51880 601 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 1519 1872 gene locus_tag LOCUS_51890 1519 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 1954 3042 gene locus_tag LOCUS_51900 1954 3042 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_51900 3039 3620 gene locus_tag LOCUS_51910 3039 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 >Feature sequence601 775 5 gene locus_tag LOCUS_51920 775 5 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223482.1 protein_id gnl|my_center|LOCUS_51920 937 1584 gene locus_tag LOCUS_51930 937 1584 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228584.1 protein_id gnl|my_center|LOCUS_51930 1702 2769 gene locus_tag LOCUS_51940 1702 2769 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_51940 >Feature sequence602 <1 1867 gene locus_tag LOCUS_51950 <1 1867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_168488820.1:CDP-glycerol glycerophosphotransferase family protein 2304 2726 gene locus_tag LOCUS_51960 2304 2726 CDS product DUF6010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225312.1 protein_id gnl|my_center|LOCUS_51960 2786 3379 gene locus_tag LOCUS_51970 2786 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 >Feature sequence603 361 1242 gene locus_tag LOCUS_51980 gene mmuM 361 1242 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909348.1 protein_id gnl|my_center|LOCUS_51980 3122 1584 gene locus_tag LOCUS_51990 3122 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 >Feature sequence604 818 432 gene locus_tag LOCUS_52000 818 432 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230629.1 protein_id gnl|my_center|LOCUS_52000 920 1558 gene locus_tag LOCUS_52010 920 1558 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222779.1 protein_id gnl|my_center|LOCUS_52010 1939 1562 gene locus_tag LOCUS_52020 1939 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 2195 2344 gene locus_tag LOCUS_52030 2195 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 <3655 2293 gene locus_tag LOCUS_52040 <3655 2293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222121.1:helicase-associated domain-containing protein >Feature sequence605 2213 3 gene locus_tag LOCUS_52050 2213 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 2431 2937 gene locus_tag LOCUS_52060 2431 2937 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409568.1 protein_id gnl|my_center|LOCUS_52060 >Feature sequence606 839 219 gene locus_tag LOCUS_52070 839 219 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230285.1 protein_id gnl|my_center|LOCUS_52070 997 3537 gene locus_tag LOCUS_52080 997 3537 CDS product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027340.1 protein_id gnl|my_center|LOCUS_52080 >Feature sequence607 <1 2324 gene locus_tag LOCUS_52090 <1 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228172.1:BTAD domain-containing putative transcriptional regulator 3175 2402 gene locus_tag LOCUS_52100 3175 2402 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 protein_id gnl|my_center|LOCUS_52100 >Feature sequence608 875 1441 gene locus_tag LOCUS_52110 875 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 2308 3012 gene locus_tag LOCUS_52120 2308 3012 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028564.1 protein_id gnl|my_center|LOCUS_52120 >Feature sequence609 363 1343 gene locus_tag LOCUS_52130 363 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 1343 2095 gene locus_tag LOCUS_52140 1343 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 2460 2092 gene locus_tag LOCUS_52150 2460 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 3057 2704 gene locus_tag LOCUS_52160 3057 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 >Feature sequence610 <1 994 gene locus_tag LOCUS_52170 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030868159.1:alanine dehydrogenase 1683 1006 gene locus_tag LOCUS_52180 1683 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 1792 2472 gene locus_tag LOCUS_52190 1792 2472 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_52190 3553 2480 gene locus_tag LOCUS_52200 3553 2480 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_52200 >Feature sequence611 <1 2389 gene locus_tag LOCUS_52210 <1 2389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230032.1:DUF87 domain-containing protein 3261 2440 gene locus_tag LOCUS_52220 3261 2440 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229627.1 protein_id gnl|my_center|LOCUS_52220 >Feature sequence612 1530 739 gene locus_tag LOCUS_52230 1530 739 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_52230 2452 1532 gene locus_tag LOCUS_52240 2452 1532 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_52240 2629 3114 gene locus_tag LOCUS_52250 2629 3114 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_52250 >Feature sequence613 1127 72 gene locus_tag LOCUS_52260 1127 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 1712 2533 gene locus_tag LOCUS_52270 1712 2533 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_52270 >Feature sequence614 >Feature sequence615 3210 2359 gene locus_tag LOCUS_52280 3210 2359 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_52280 >Feature sequence616 2305 1442 gene locus_tag LOCUS_52290 2305 1442 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_52290 2429 3541 gene locus_tag LOCUS_52300 2429 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 >Feature sequence617 2259 1756 gene locus_tag LOCUS_52310 2259 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 2964 2332 gene locus_tag LOCUS_52320 2964 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 >Feature sequence618 1420 596 gene locus_tag LOCUS_52330 1420 596 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015087.1 protein_id gnl|my_center|LOCUS_52330 1757 2386 gene locus_tag LOCUS_52340 1757 2386 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286365.1 protein_id gnl|my_center|LOCUS_52340 2402 3343 gene locus_tag LOCUS_52350 2402 3343 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110882.1 protein_id gnl|my_center|LOCUS_52350 >Feature sequence619 434 2830 gene locus_tag LOCUS_52360 434 2830 CDS product germacradienol/geosmin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630266.1 protein_id gnl|my_center|LOCUS_52360 >Feature sequence620 1880 564 gene locus_tag LOCUS_52370 1880 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_52370 2152 3258 gene locus_tag LOCUS_52380 2152 3258 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726945.1 protein_id gnl|my_center|LOCUS_52380 3486 3289 gene locus_tag LOCUS_52390 3486 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 >Feature sequence621 774 1160 gene locus_tag LOCUS_52400 774 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 1314 2171 gene locus_tag LOCUS_52410 1314 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 2297 2491 gene locus_tag LOCUS_52420 2297 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 2528 3247 gene locus_tag LOCUS_52430 2528 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 >Feature sequence622 647 474 gene locus_tag LOCUS_52440 647 474 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_52440 2007 652 gene locus_tag LOCUS_52450 2007 652 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_52450 2509 2144 gene locus_tag LOCUS_52460 2509 2144 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_52460 2718 3143 gene locus_tag LOCUS_52470 2718 3143 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 protein_id gnl|my_center|LOCUS_52470 >Feature sequence623 479 117 gene locus_tag LOCUS_52480 479 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 760 476 gene locus_tag LOCUS_52490 760 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 1134 760 gene locus_tag LOCUS_52500 1134 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 1520 1131 gene locus_tag LOCUS_52510 1520 1131 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_52510 1647 2393 gene locus_tag LOCUS_52520 1647 2393 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_52520 2631 2446 gene locus_tag LOCUS_52530 2631 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 2965 2654 gene locus_tag LOCUS_52540 2965 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 3431 2967 gene locus_tag LOCUS_52550 3431 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 >Feature sequence624 669 1850 gene locus_tag LOCUS_52560 669 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 2499 1945 gene locus_tag LOCUS_52570 2499 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 2851 2564 gene locus_tag LOCUS_52580 2851 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 >Feature sequence625 2 280 gene locus_tag LOCUS_52590 2 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 277 615 gene locus_tag LOCUS_52600 277 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 615 1700 gene locus_tag LOCUS_52610 615 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 1757 2074 gene locus_tag LOCUS_52620 1757 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 2071 2292 gene locus_tag LOCUS_52630 2071 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 2285 2872 gene locus_tag LOCUS_52640 2285 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 2862 3158 gene locus_tag LOCUS_52650 2862 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 >Feature sequence626 1165 266 gene locus_tag LOCUS_52660 1165 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 1815 1162 gene locus_tag LOCUS_52670 1815 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 2063 1812 gene locus_tag LOCUS_52680 2063 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 2827 2060 gene locus_tag LOCUS_52690 2827 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 3183 2821 gene locus_tag LOCUS_52700 3183 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 >Feature sequence627 63 1115 gene locus_tag LOCUS_52710 63 1115 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_52710 2152 1190 gene locus_tag LOCUS_52720 2152 1190 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877580.1 protein_id gnl|my_center|LOCUS_52720 3273 2227 gene locus_tag LOCUS_52730 3273 2227 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142257.1 protein_id gnl|my_center|LOCUS_52730 >Feature sequence628 1749 445 gene locus_tag LOCUS_52740 1749 445 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_52740 >Feature sequence629 282 776 gene locus_tag LOCUS_52750 282 776 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_52750 2885 813 gene locus_tag LOCUS_52760 2885 813 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_52760 3132 3362 gene locus_tag LOCUS_52770 3132 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_52770 >Feature sequence630 2017 3315 gene locus_tag LOCUS_52780 2017 3315 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871009.1 protein_id gnl|my_center|LOCUS_52780 >Feature sequence631 <1 1094 gene locus_tag LOCUS_52790 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029762.1:APC family permease 2567 1134 gene locus_tag LOCUS_52800 2567 1134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_52800 2641 3108 gene locus_tag LOCUS_52810 2641 3108 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_52810 >Feature sequence632 2342 81 gene locus_tag LOCUS_52820 2342 81 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 protein_id gnl|my_center|LOCUS_52820 >Feature sequence633 193 1392 gene locus_tag LOCUS_52830 193 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 1852 2124 gene locus_tag LOCUS_52840 1852 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 2121 2483 gene locus_tag LOCUS_52850 2121 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 2477 2761 gene locus_tag LOCUS_52860 2477 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 3147 2902 gene locus_tag LOCUS_52870 3147 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 >Feature sequence634 <1 940 gene locus_tag LOCUS_52880 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027559.1:sensor histidine kinase 937 1599 gene locus_tag LOCUS_52890 937 1599 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_52890 1710 2246 gene locus_tag LOCUS_52900 1710 2246 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113318.1 protein_id gnl|my_center|LOCUS_52900 >Feature sequence635 215 781 gene locus_tag LOCUS_52910 215 781 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_52910 1079 1882 gene locus_tag LOCUS_52920 1079 1882 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_52920 1981 3039 gene locus_tag LOCUS_52930 gene galT 1981 3039 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_52930 >Feature sequence636 433 1761 gene locus_tag LOCUS_52940 433 1761 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_52940 1774 3279 gene locus_tag LOCUS_52950 1774 3279 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_52950 >Feature sequence637 <1 667 gene locus_tag LOCUS_52960 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223027.1:FAD-dependent oxidoreductase 664 3135 gene locus_tag LOCUS_52970 gene nirB 664 3135 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_52970 >Feature sequence638 537 208 gene locus_tag LOCUS_52980 537 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 835 527 gene locus_tag LOCUS_52990 835 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 1833 1105 gene locus_tag LOCUS_53000 gene cofE 1833 1105 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921993.1 protein_id gnl|my_center|LOCUS_53000 2000 1830 gene locus_tag LOCUS_53010 2000 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 2749 1997 gene locus_tag LOCUS_53020 2749 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 2931 2746 gene locus_tag LOCUS_53030 2931 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 >Feature sequence639 1121 303 gene locus_tag LOCUS_53040 1121 303 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114349.1 protein_id gnl|my_center|LOCUS_53040 1639 1130 gene locus_tag LOCUS_53050 1639 1130 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878108.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53050 >Feature sequence640 1092 73 gene locus_tag LOCUS_53060 1092 73 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_53060 2706 1981 gene locus_tag LOCUS_53070 2706 1981 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027884.1 protein_id gnl|my_center|LOCUS_53070 >Feature sequence641 1254 3218 gene locus_tag LOCUS_53080 1254 3218 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 protein_id gnl|my_center|LOCUS_53080 >Feature sequence642 133 366 gene locus_tag LOCUS_53090 133 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 985 455 gene locus_tag LOCUS_53100 985 455 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227140.1 protein_id gnl|my_center|LOCUS_53100 >Feature sequence643 1287 1457 gene locus_tag LOCUS_53110 1287 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 1847 2986 gene locus_tag LOCUS_53120 1847 2986 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966314.1 protein_id gnl|my_center|LOCUS_53120 >Feature sequence644 270 881 gene locus_tag LOCUS_53130 270 881 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_53130 2951 1131 gene locus_tag LOCUS_53140 2951 1131 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_53140 >Feature sequence645 1533 175 gene locus_tag LOCUS_53150 1533 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 >Feature sequence646 905 561 gene locus_tag LOCUS_53160 905 561 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_53160 2744 2214 gene locus_tag LOCUS_53170 2744 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 >Feature sequence647 3 527 gene locus_tag LOCUS_53180 3 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 1593 673 gene locus_tag LOCUS_53190 1593 673 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088347.1 protein_id gnl|my_center|LOCUS_53190 <3241 2028 gene locus_tag LOCUS_53200 <3241 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193487183.1:DNA-processing protein DprA >Feature sequence648 552 2006 gene locus_tag LOCUS_53210 552 2006 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_53210 >Feature sequence649 1632 325 gene locus_tag LOCUS_53220 1632 325 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_53220 3147 1981 gene locus_tag LOCUS_53230 3147 1981 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_53230 >Feature sequence650 <1 806 gene locus_tag LOCUS_53240 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082543.1:xylan alpha-(1->2)-glucuronosidase 803 2050 gene locus_tag LOCUS_53250 803 2050 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 protein_id gnl|my_center|LOCUS_53250 >Feature sequence651 865 83 gene locus_tag LOCUS_53260 gene thyX 865 83 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390602.1 protein_id gnl|my_center|LOCUS_53260 1039 1287 gene locus_tag LOCUS_53270 1039 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 2183 1392 gene locus_tag LOCUS_53280 2183 1392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804277.1 protein_id gnl|my_center|LOCUS_53280 3070 2180 gene locus_tag LOCUS_53290 3070 2180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_53290 >Feature sequence652 940 344 gene locus_tag LOCUS_53300 940 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 1154 1588 gene locus_tag LOCUS_53310 1154 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 2854 1502 gene locus_tag LOCUS_53320 2854 1502 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_53320 3017 3094 gene locus_tag LOCUS_t00510 3017 3094 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence653 <3208 1882 gene locus_tag LOCUS_53330 <3208 1882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228765.1:TrpB-like pyridoxal phosphate-dependent enzyme >Feature sequence654 87 632 gene locus_tag LOCUS_53340 87 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 1137 613 gene locus_tag LOCUS_53350 1137 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 1898 1134 gene locus_tag LOCUS_53360 1898 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 <3208 1895 gene locus_tag LOCUS_53370 <3208 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965965.1:lytic transglycosylase domain-containing protein >Feature sequence655 61 1776 gene locus_tag LOCUS_53380 61 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 1871 3145 gene locus_tag LOCUS_53390 1871 3145 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224934.1 protein_id gnl|my_center|LOCUS_53390 >Feature sequence656 1493 477 gene locus_tag LOCUS_53400 1493 477 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_53400 2488 1622 gene locus_tag LOCUS_53410 2488 1622 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_53410 >Feature sequence657 255 896 gene locus_tag LOCUS_53420 255 896 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_53420 1692 952 gene locus_tag LOCUS_53430 1692 952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973847.1 protein_id gnl|my_center|LOCUS_53430 2677 1745 gene locus_tag LOCUS_53440 2677 1745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223406.1 protein_id gnl|my_center|LOCUS_53440 2946 3119 gene locus_tag LOCUS_53450 2946 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 >Feature sequence658 1581 118 gene locus_tag LOCUS_53460 1581 118 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 protein_id gnl|my_center|LOCUS_53460 1781 2527 gene locus_tag LOCUS_53470 1781 2527 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728450.1 protein_id gnl|my_center|LOCUS_53470 >Feature sequence659 204 800 gene locus_tag LOCUS_53480 204 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 814 1107 gene locus_tag LOCUS_53490 814 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 >Feature sequence660 634 29 gene locus_tag LOCUS_53500 634 29 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977621.1 protein_id gnl|my_center|LOCUS_53500 2525 930 gene locus_tag LOCUS_53510 2525 930 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_53510 2693 3151 gene locus_tag LOCUS_53520 2693 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 >Feature sequence661 188 1399 gene locus_tag LOCUS_53530 gene mshC 188 1399 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_53530 2280 1648 gene locus_tag LOCUS_53540 2280 1648 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_53540 >Feature sequence662 2626 1364 gene locus_tag LOCUS_53550 2626 1364 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973633.1 protein_id gnl|my_center|LOCUS_53550 3097 2708 gene locus_tag LOCUS_53560 3097 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 >Feature sequence663 <3168 542 gene locus_tag LOCUS_53570 <3168 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028431.1:ComEC/Rec2 family competence protein >Feature sequence664 210 1187 gene locus_tag LOCUS_53580 gene holA 210 1187 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_53580 1841 1344 gene locus_tag LOCUS_53590 1841 1344 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028479.1 protein_id gnl|my_center|LOCUS_53590 1896 3113 gene locus_tag LOCUS_53600 1896 3113 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_53600 >Feature sequence665 433 32 gene locus_tag LOCUS_53610 433 32 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_53610 1012 464 gene locus_tag LOCUS_53620 1012 464 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_53620 1194 2717 gene locus_tag LOCUS_53630 1194 2717 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 protein_id gnl|my_center|LOCUS_53630 >Feature sequence666 2753 510 gene locus_tag LOCUS_53640 2753 510 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_53640 >Feature sequence667 938 588 gene locus_tag LOCUS_53650 938 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 1357 935 gene locus_tag LOCUS_53660 1357 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 1865 1527 gene locus_tag LOCUS_53670 1865 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 >Feature sequence668 2046 748 gene locus_tag LOCUS_53680 2046 748 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030646.1 protein_id gnl|my_center|LOCUS_53680 2972 2154 gene locus_tag LOCUS_53690 2972 2154 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 protein_id gnl|my_center|LOCUS_53690 >Feature sequence669 785 2278 gene locus_tag LOCUS_53700 785 2278 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620927.1 protein_id gnl|my_center|LOCUS_53700 >Feature sequence670 255 2309 gene locus_tag LOCUS_53710 255 2309 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_53710 >Feature sequence671 <1 649 gene locus_tag LOCUS_53720 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975785.1:SIS domain-containing protein 730 1671 gene locus_tag LOCUS_53730 730 1671 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_53730 1832 2443 gene locus_tag LOCUS_53740 1832 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 >Feature sequence672 607 1632 gene locus_tag LOCUS_53750 607 1632 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085973.1 protein_id gnl|my_center|LOCUS_53750 1712 3097 gene locus_tag LOCUS_53760 1712 3097 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535871.1 protein_id gnl|my_center|LOCUS_53760 >Feature sequence673 2295 1273 gene locus_tag LOCUS_53770 2295 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_53770 2496 2705 gene locus_tag LOCUS_53780 2496 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 >Feature sequence674 712 359 gene locus_tag LOCUS_53790 712 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 901 1173 gene locus_tag LOCUS_53800 901 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 2221 1667 gene locus_tag LOCUS_53810 2221 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 2368 2736 gene locus_tag LOCUS_53820 2368 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 >Feature sequence675 229 888 gene locus_tag LOCUS_53830 229 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 885 1220 gene locus_tag LOCUS_53840 885 1220 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_53840 1222 2133 gene locus_tag LOCUS_53850 gene era 1222 2133 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_53850 2571 2140 gene locus_tag LOCUS_53860 2571 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 >Feature sequence676 209 1567 gene locus_tag LOCUS_53870 gene nhaA 209 1567 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169998.1 protein_id gnl|my_center|LOCUS_53870 1646 2083 gene locus_tag LOCUS_53880 1646 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 2800 2357 gene locus_tag LOCUS_53890 2800 2357 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 protein_id gnl|my_center|LOCUS_53890 >Feature sequence677 955 1167 gene locus_tag LOCUS_53900 955 1167 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490270.1 protein_id gnl|my_center|LOCUS_53900 1315 1617 gene locus_tag LOCUS_53910 1315 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 1614 2528 gene locus_tag LOCUS_53920 1614 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 >Feature sequence678 952 1164 gene locus_tag LOCUS_53930 952 1164 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490270.1 protein_id gnl|my_center|LOCUS_53930 1312 1614 gene locus_tag LOCUS_53940 1312 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 1611 2525 gene locus_tag LOCUS_53950 1611 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 >Feature sequence679 2880 304 gene locus_tag LOCUS_53960 2880 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 >Feature sequence680 431 1990 gene locus_tag LOCUS_53970 431 1990 CDS product alpha-L-arabinofuranosidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224931.1 protein_id gnl|my_center|LOCUS_53970 2119 2688 gene locus_tag LOCUS_53980 2119 2688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031763.1 protein_id gnl|my_center|LOCUS_53980 >Feature sequence681 1882 140 gene locus_tag LOCUS_53990 1882 140 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 protein_id gnl|my_center|LOCUS_53990 2652 1879 gene locus_tag LOCUS_54000 2652 1879 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 protein_id gnl|my_center|LOCUS_54000 >Feature sequence682 <1 1478 gene locus_tag LOCUS_54010 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256192.1:YfjI family protein 1743 1928 gene locus_tag LOCUS_54020 1743 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 1925 2248 gene locus_tag LOCUS_54030 1925 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 2245 2751 gene locus_tag LOCUS_54040 2245 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 >Feature sequence683 <1 862 gene locus_tag LOCUS_54050 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727635.1:L-2-hydroxyglutarate oxidase 881 1591 gene locus_tag LOCUS_54060 gene phoP 881 1591 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_54060 >Feature sequence684 243 419 gene locus_tag LOCUS_54070 243 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 416 736 gene locus_tag LOCUS_54080 416 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 733 1248 gene locus_tag LOCUS_54090 733 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 1241 1405 gene locus_tag LOCUS_54100 1241 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 1405 1890 gene locus_tag LOCUS_54110 1405 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 1887 2054 gene locus_tag LOCUS_54120 1887 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 2051 2242 gene locus_tag LOCUS_54130 2051 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 2239 2769 gene locus_tag LOCUS_54140 2239 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 >Feature sequence685 1660 533 gene locus_tag LOCUS_54150 1660 533 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 protein_id gnl|my_center|LOCUS_54150 >Feature sequence686 649 194 gene locus_tag LOCUS_54160 649 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 944 654 gene locus_tag LOCUS_54170 944 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 1443 1183 gene locus_tag LOCUS_54180 1443 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 2311 1502 gene locus_tag LOCUS_54190 2311 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 2943 2302 gene locus_tag LOCUS_54200 2943 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 >Feature sequence687 1483 74 gene locus_tag LOCUS_54210 1483 74 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_54210 1583 2173 gene locus_tag LOCUS_54220 1583 2173 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_54220 2929 2180 gene locus_tag LOCUS_54230 2929 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 >Feature sequence688 648 301 gene locus_tag LOCUS_54240 gene tnpB 648 301 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529308.1 protein_id gnl|my_center|LOCUS_54240 923 648 gene locus_tag LOCUS_54250 923 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 <3002 1404 gene locus_tag LOCUS_54260 <3002 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463740.1:cellulose biosynthesis protein BcsC >Feature sequence689 489 857 gene locus_tag LOCUS_54270 489 857 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782036.1 protein_id gnl|my_center|LOCUS_54270 1637 876 gene locus_tag LOCUS_54280 1637 876 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_54280 2180 1767 gene locus_tag LOCUS_54290 2180 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 2440 2177 gene locus_tag LOCUS_54300 2440 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 >Feature sequence690 759 100 gene locus_tag LOCUS_54310 gene phoU 759 100 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_54310 864 2054 gene locus_tag LOCUS_54320 864 2054 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_54320 2051 2740 gene locus_tag LOCUS_54330 2051 2740 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_54330 >Feature sequence691 1340 1002 gene locus_tag LOCUS_54340 1340 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 >Feature sequence692 2110 848 gene locus_tag LOCUS_54350 2110 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 >Feature sequence693 3 1193 gene locus_tag LOCUS_54360 3 1193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_54360 2561 1209 gene locus_tag LOCUS_54370 2561 1209 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_54370 >Feature sequence694 >Feature sequence695 <1 961 gene locus_tag LOCUS_54380 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000786824.1:VWA domain-containing protein 975 2090 gene locus_tag LOCUS_54390 975 2090 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_54390 >Feature sequence696 1472 1110 gene locus_tag LOCUS_54400 1472 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 1854 1552 gene locus_tag LOCUS_54410 1854 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 2241 1891 gene locus_tag LOCUS_54420 2241 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 >Feature sequence697 120 1208 gene locus_tag LOCUS_54430 120 1208 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_54430 1242 1526 gene locus_tag LOCUS_54440 1242 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 1634 2851 gene locus_tag LOCUS_54450 1634 2851 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_54450 >Feature sequence698 1604 1074 gene locus_tag LOCUS_54460 1604 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54460 2213 1641 gene locus_tag LOCUS_54470 2213 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 <2843 2219 gene locus_tag LOCUS_54480 <2843 2219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194209.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence699 913 89 gene locus_tag LOCUS_54490 913 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 1613 2038 gene locus_tag LOCUS_54500 1613 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 2150 2542 gene locus_tag LOCUS_54510 2150 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 >Feature sequence700 <1 527 gene locus_tag LOCUS_54520 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029749.1:EamA family transporter RarD 605 1432 gene locus_tag LOCUS_54530 605 1432 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227668.1 protein_id gnl|my_center|LOCUS_54530 1958 1479 gene locus_tag LOCUS_54540 1958 1479 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_54540 2027 2770 gene locus_tag LOCUS_54550 2027 2770 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804160.1 protein_id gnl|my_center|LOCUS_54550 >Feature sequence701 1363 185 gene locus_tag LOCUS_54560 1363 185 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867479.1 protein_id gnl|my_center|LOCUS_54560 1609 2826 gene locus_tag LOCUS_54570 1609 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 >Feature sequence702 1521 94 gene locus_tag LOCUS_54580 gene ahcY 1521 94 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_54580 1691 2023 gene locus_tag LOCUS_54590 1691 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 >Feature sequence703 1406 2749 gene locus_tag LOCUS_54600 gene gdhA 1406 2749 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896839.1 protein_id gnl|my_center|LOCUS_54600 >Feature sequence704 293 697 gene locus_tag LOCUS_54610 293 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 1154 1558 gene locus_tag LOCUS_54620 1154 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029512.1 protein_id gnl|my_center|LOCUS_54620 1653 2420 gene locus_tag LOCUS_54630 1653 2420 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_54630 2676 2434 gene locus_tag LOCUS_54640 2676 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 >Feature sequence705 2379 2179 gene locus_tag LOCUS_54650 2379 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 2357 2779 gene locus_tag LOCUS_54660 2357 2779 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_54660 >Feature sequence706 102 785 gene locus_tag LOCUS_54670 102 785 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_54670 2235 814 gene locus_tag LOCUS_54680 2235 814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230065.1 protein_id gnl|my_center|LOCUS_54680 >Feature sequence707 307 1155 gene locus_tag LOCUS_54690 307 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 1380 1904 gene locus_tag LOCUS_54700 gene rplJ 1380 1904 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_54700 1983 2378 gene locus_tag LOCUS_54710 gene rplL 1983 2378 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_54710 >Feature sequence708 <1 814 gene locus_tag LOCUS_54720 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803855.1:glycosyltransferase family 4 protein 811 1911 gene locus_tag LOCUS_54730 gene wlbD 811 1911 CDS product O-antigen biosynthesis protein WlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447875.1 protein_id gnl|my_center|LOCUS_54730 >Feature sequence709 133 2724 gene locus_tag LOCUS_54740 133 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027393.1 protein_id gnl|my_center|LOCUS_54740 >Feature sequence710 <1 1400 gene locus_tag LOCUS_54750 <1 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030865510.1:sugar ABC transporter permease 1397 2284 gene locus_tag LOCUS_54760 1397 2284 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_54760 >Feature sequence711 1578 766 gene locus_tag LOCUS_54770 1578 766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_54770 2584 1625 gene locus_tag LOCUS_54780 2584 1625 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_54780 >Feature sequence712 288 2000 gene locus_tag LOCUS_54790 288 2000 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_54790 >Feature sequence713 105 401 gene locus_tag LOCUS_54800 105 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 1525 440 gene locus_tag LOCUS_54810 1525 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 2585 1515 gene locus_tag LOCUS_54820 2585 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 >Feature sequence714 218 823 gene locus_tag LOCUS_54830 218 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 1598 873 gene locus_tag LOCUS_54840 1598 873 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_54840 >Feature sequence715 728 1921 gene locus_tag LOCUS_54850 728 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 1933 2223 gene locus_tag LOCUS_54860 1933 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 >Feature sequence716 1555 527 gene locus_tag LOCUS_54870 1555 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 1721 1545 gene locus_tag LOCUS_54880 1721 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 2083 1718 gene locus_tag LOCUS_54890 2083 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 >Feature sequence717 1000 116 gene locus_tag LOCUS_54900 1000 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 <2680 1320 gene locus_tag LOCUS_54910 <2680 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028459.1:acyltransferase family protein >Feature sequence718 <1 1321 gene locus_tag LOCUS_54920 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027941.1:serine/threonine-protein kinase >Feature sequence719 1 540 gene locus_tag LOCUS_54930 1 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 1590 1021 gene locus_tag LOCUS_54940 1590 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 <2667 1629 gene locus_tag LOCUS_54950 <2667 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_079172699.1:site-specific integrase >Feature sequence720 318 746 gene locus_tag LOCUS_54960 318 746 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_54960 758 1081 gene locus_tag LOCUS_54970 758 1081 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_54970 1868 1494 gene locus_tag LOCUS_54980 1868 1494 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164277346.1 protein_id gnl|my_center|LOCUS_54980 >Feature sequence721 <1 1483 gene locus_tag LOCUS_54990 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977659.1:N-acetylmuramoyl-L-alanine amidase <2654 1493 gene locus_tag LOCUS_55000 <2654 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731135.1:carotenoid oxygenase family protein >Feature sequence722 2007 1564 gene locus_tag LOCUS_55010 2007 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 2546 2061 gene locus_tag LOCUS_55020 2546 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 >Feature sequence723 1532 597 gene locus_tag LOCUS_55030 1532 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 >Feature sequence724 1862 96 gene locus_tag LOCUS_55040 1862 96 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030802.1 protein_id gnl|my_center|LOCUS_55040 >Feature sequence725 831 1874 gene locus_tag LOCUS_55050 831 1874 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976198.1 protein_id gnl|my_center|LOCUS_55050 >Feature sequence726 <1 975 gene locus_tag LOCUS_55060 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225534.1:SGNH/GDSL hydrolase family protein 988 2442 gene locus_tag LOCUS_55070 988 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 >Feature sequence727 1025 72 gene locus_tag LOCUS_55080 1025 72 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_55080 2434 1103 gene locus_tag LOCUS_55090 2434 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 >Feature sequence728 1294 1103 gene locus_tag LOCUS_55100 1294 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 1461 2594 gene locus_tag LOCUS_55110 gene nagA 1461 2594 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_55110 >Feature sequence729 <1 1479 gene locus_tag LOCUS_55120 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222688.1:GMC family oxidoreductase <2598 1529 gene locus_tag LOCUS_55130 <2598 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031655.1:MFS transporter >Feature sequence730 977 192 gene locus_tag LOCUS_55140 977 192 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_55140 1049 2080 gene locus_tag LOCUS_55150 1049 2080 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_55150 >Feature sequence731 493 17 gene locus_tag LOCUS_55160 493 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_55160 1296 829 gene locus_tag LOCUS_55170 1296 829 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031866.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55170 1424 2347 gene locus_tag LOCUS_55180 1424 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 >Feature sequence732 468 1460 gene locus_tag LOCUS_55190 gene dhaK 468 1460 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_55190 1488 2114 gene locus_tag LOCUS_55200 gene dhaL 1488 2114 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_55200 >Feature sequence733 1040 558 gene locus_tag LOCUS_55210 1040 558 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112386.1 protein_id gnl|my_center|LOCUS_55210 1138 1563 gene locus_tag LOCUS_55220 1138 1563 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089439.1 protein_id gnl|my_center|LOCUS_55220 >Feature sequence734 <1 806 gene locus_tag LOCUS_55230 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727788.1:helix-turn-helix transcriptional regulator 823 1914 gene locus_tag LOCUS_55240 823 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 >Feature sequence735 109 429 gene locus_tag LOCUS_55250 109 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 426 1154 gene locus_tag LOCUS_55260 426 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 1151 1597 gene locus_tag LOCUS_55270 1151 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 >Feature sequence736 1832 90 gene locus_tag LOCUS_55280 1832 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 >Feature sequence737 237 1286 gene locus_tag LOCUS_55290 gene trpD 237 1286 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_55290 1929 1642 gene locus_tag LOCUS_55300 1929 1642 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_55300 >Feature sequence738 <1 1233 gene locus_tag LOCUS_55310 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226279.1:pectate lyase <2508 1383 gene locus_tag LOCUS_55320 <2508 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028022.1:aldehyde dehydrogenase (NADP(+)) >Feature sequence739 841 44 gene locus_tag LOCUS_55330 841 44 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 protein_id gnl|my_center|LOCUS_55330 1107 2312 gene locus_tag LOCUS_55340 1107 2312 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_55340 >Feature sequence740 439 855 gene locus_tag LOCUS_55350 439 855 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_55350 1073 1243 gene locus_tag LOCUS_55360 1073 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 1607 1269 gene locus_tag LOCUS_55370 1607 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 1717 2382 gene locus_tag LOCUS_55380 1717 2382 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888709.1 protein_id gnl|my_center|LOCUS_55380 >Feature sequence741 384 692 gene locus_tag LOCUS_55390 384 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 996 910 gene locus_tag LOCUS_t00520 996 910 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence742 1699 149 gene locus_tag LOCUS_55400 1699 149 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131344932.1 protein_id gnl|my_center|LOCUS_55400 2112 1729 gene locus_tag LOCUS_55410 2112 1729 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_55410 >Feature sequence743 >Feature sequence744 1873 521 gene locus_tag LOCUS_55420 1873 521 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224828.1 protein_id gnl|my_center|LOCUS_55420 >Feature sequence745 1765 482 gene locus_tag LOCUS_55430 1765 482 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_55430 2341 1919 gene locus_tag LOCUS_55440 2341 1919 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_55440 >Feature sequence746 <1 1061 gene locus_tag LOCUS_55450 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931320.1:glycosyltransferase family 4 protein 1058 2158 gene locus_tag LOCUS_55460 1058 2158 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_55460 >Feature sequence747 <1 609 gene locus_tag LOCUS_55470 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014466719.1:GntR family transcriptional regulator >Feature sequence748 >Feature sequence749 377 60 gene locus_tag LOCUS_55480 377 60 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831628.1 protein_id gnl|my_center|LOCUS_55480 1039 374 gene locus_tag LOCUS_55490 1039 374 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878471.1 protein_id gnl|my_center|LOCUS_55490 1472 1149 gene locus_tag LOCUS_55500 1472 1149 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976901.1 protein_id gnl|my_center|LOCUS_55500 >Feature sequence750 2000 426 gene locus_tag LOCUS_55510 2000 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 >Feature sequence751 353 81 gene locus_tag LOCUS_55520 353 81 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_55520 803 432 gene locus_tag LOCUS_55530 803 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 872 1315 gene locus_tag LOCUS_55540 872 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 2313 1306 gene locus_tag LOCUS_55550 2313 1306 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_55550 >Feature sequence752 838 2262 gene locus_tag LOCUS_55560 gene glnA 838 2262 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223133.1 protein_id gnl|my_center|LOCUS_55560 >Feature sequence753 2033 1957 gene locus_tag LOCUS_t00530 2033 1957 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence754 543 103 gene locus_tag LOCUS_55570 543 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 723 1652 gene locus_tag LOCUS_55580 gene sigJ 723 1652 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_55580 1772 2332 gene locus_tag LOCUS_55590 1772 2332 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_55590 >Feature sequence755 1037 12 gene locus_tag LOCUS_55600 1037 12 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_55600 1302 2213 gene locus_tag LOCUS_55610 1302 2213 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230946.1 protein_id gnl|my_center|LOCUS_55610 >Feature sequence756 1577 189 gene locus_tag LOCUS_55620 1577 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 >Feature sequence757 880 266 gene locus_tag LOCUS_55630 880 266 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807699.1 protein_id gnl|my_center|LOCUS_55630 1356 997 gene locus_tag LOCUS_55640 1356 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 1610 1768 gene locus_tag LOCUS_55650 1610 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 >Feature sequence758 1575 505 gene locus_tag LOCUS_55660 1575 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 2111 1617 gene locus_tag LOCUS_55670 2111 1617 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487439.1 protein_id gnl|my_center|LOCUS_55670 >Feature sequence759 843 190 gene locus_tag LOCUS_55680 843 190 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_55680 1086 1250 gene locus_tag LOCUS_55690 1086 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 2198 1377 gene locus_tag LOCUS_55700 2198 1377 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_55700 >Feature sequence760 622 227 gene locus_tag LOCUS_55710 622 227 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228813.1 protein_id gnl|my_center|LOCUS_55710 1565 852 gene locus_tag LOCUS_55720 1565 852 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640423.1 protein_id gnl|my_center|LOCUS_55720 2295 1837 gene locus_tag LOCUS_55730 2295 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 >Feature sequence761 <1 761 gene locus_tag LOCUS_55740 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230141.1:sigma-70 family RNA polymerase sigma factor 2139 1084 gene locus_tag LOCUS_55750 2139 1084 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_55750 >Feature sequence762 167 1270 gene locus_tag LOCUS_55760 167 1270 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877954.1 protein_id gnl|my_center|LOCUS_55760 >Feature sequence763 92 1015 gene locus_tag LOCUS_55770 92 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 >Feature sequence764 842 1324 gene locus_tag LOCUS_55780 842 1324 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_55780 1342 1800 gene locus_tag LOCUS_55790 gene ispF 1342 1800 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_55790 1995 2264 gene locus_tag LOCUS_55800 1995 2264 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894403.1 protein_id gnl|my_center|LOCUS_55800 >Feature sequence765 96 1760 gene locus_tag LOCUS_55810 gene ettA 96 1760 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_55810 1821 2255 gene locus_tag LOCUS_55820 1821 2255 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_55820 >Feature sequence766 194 613 gene locus_tag LOCUS_55830 194 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 631 1809 gene locus_tag LOCUS_55840 631 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 >Feature sequence767 1421 207 gene locus_tag LOCUS_55850 1421 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 1966 1700 gene locus_tag LOCUS_55860 1966 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 >Feature sequence768 1399 491 gene locus_tag LOCUS_55870 1399 491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978153.1 protein_id gnl|my_center|LOCUS_55870 <2243 1387 gene locus_tag LOCUS_55880 <2243 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978152.1:ABC transporter ATP-binding protein >Feature sequence769 1051 122 gene locus_tag LOCUS_55890 1051 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 1242 1541 gene locus_tag LOCUS_55900 1242 1541 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_55900 2219 1620 gene locus_tag LOCUS_55910 2219 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031046.1 protein_id gnl|my_center|LOCUS_55910 >Feature sequence770 218 616 gene locus_tag LOCUS_55920 218 616 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_55920 822 2219 gene locus_tag LOCUS_55930 822 2219 CDS product IS1380-like element ISMsm11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727590.1 protein_id gnl|my_center|LOCUS_55930 >Feature sequence771 <1 516 gene locus_tag LOCUS_55940 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228805.1:HAD-IA family hydrolase 1336 716 gene locus_tag LOCUS_55950 1336 716 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974324.1 protein_id gnl|my_center|LOCUS_55950 1456 2208 gene locus_tag LOCUS_55960 1456 2208 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_55960 >Feature sequence772 1021 1359 gene locus_tag LOCUS_55970 1021 1359 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_55970 1401 1646 gene locus_tag LOCUS_55980 1401 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 >Feature sequence773 <1 2153 gene locus_tag LOCUS_55990 <1 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223197.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence774 14 1432 gene locus_tag LOCUS_56000 14 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 1837 1361 gene locus_tag LOCUS_56010 1837 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 >Feature sequence775 145 360 gene locus_tag LOCUS_56020 145 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 425 1111 gene locus_tag LOCUS_56030 425 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 1189 1839 gene locus_tag LOCUS_56040 1189 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 1836 2057 gene locus_tag LOCUS_56050 1836 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 >Feature sequence776 <1 955 gene locus_tag LOCUS_56060 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105653.1:DEAD/DEAH box helicase family protein >Feature sequence777 >Feature sequence778 597 415 gene locus_tag LOCUS_56070 597 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 1830 607 gene locus_tag LOCUS_56080 1830 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 >Feature sequence779 1430 624 gene locus_tag LOCUS_56090 1430 624 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_56090 >Feature sequence780 298 1083 gene locus_tag LOCUS_56100 298 1083 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731472.1 protein_id gnl|my_center|LOCUS_56100 1578 1099 gene locus_tag LOCUS_56110 1578 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 >Feature sequence781 1345 221 gene locus_tag LOCUS_56120 1345 221 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 protein_id gnl|my_center|LOCUS_56120 1440 2063 gene locus_tag LOCUS_56130 1440 2063 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222937.1 protein_id gnl|my_center|LOCUS_56130 >Feature sequence782 1032 1574 gene locus_tag LOCUS_56140 1032 1574 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_56140 1704 2027 gene locus_tag LOCUS_56150 1704 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 >Feature sequence783 460 1116 gene locus_tag LOCUS_56160 460 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 1342 1833 gene locus_tag LOCUS_56170 1342 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 >Feature sequence784 232 1185 gene locus_tag LOCUS_56180 232 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 <2161 1335 gene locus_tag LOCUS_56190 <2161 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003419190.1:acetoacetate decarboxylase family protein >Feature sequence785 869 489 gene locus_tag LOCUS_56200 869 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 1068 1337 gene locus_tag LOCUS_56210 1068 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 1334 1504 gene locus_tag LOCUS_56220 1334 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 1501 1710 gene locus_tag LOCUS_56230 1501 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 1700 2107 gene locus_tag LOCUS_56240 1700 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 >Feature sequence786 >Feature sequence787 119 976 gene locus_tag LOCUS_56250 119 976 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530305.1 protein_id gnl|my_center|LOCUS_56250 973 1896 gene locus_tag LOCUS_56260 973 1896 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665673.1 protein_id gnl|my_center|LOCUS_56260 >Feature sequence788 <1 961 gene locus_tag LOCUS_56270 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029846.1:class I SAM-dependent methyltransferase 1118 2140 gene locus_tag LOCUS_56280 1118 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 >Feature sequence789 387 163 gene locus_tag LOCUS_56290 387 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 335 1114 gene locus_tag LOCUS_56300 335 1114 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_56300 1125 2078 gene locus_tag LOCUS_56310 1125 2078 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_56310 >Feature sequence790 2072 159 gene locus_tag LOCUS_56320 2072 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 >Feature sequence791 760 320 gene locus_tag LOCUS_56330 760 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 950 1846 gene locus_tag LOCUS_56340 950 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 >Feature sequence792 <2129 141 gene locus_tag LOCUS_56350 <2129 141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222149.1:BTAD domain-containing putative transcriptional regulator >Feature sequence793 691 224 gene locus_tag LOCUS_56360 691 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 908 1825 gene locus_tag LOCUS_56370 908 1825 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_56370 >Feature sequence794 <1 546 gene locus_tag LOCUS_56380 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029949.1:DeoR/GlpR family DNA-binding transcription regulator 613 2109 gene locus_tag LOCUS_56390 613 2109 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_56390 >Feature sequence795 215 646 gene locus_tag LOCUS_56400 gene mraZ 215 646 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_56400 930 1853 gene locus_tag LOCUS_56410 gene rsmH 930 1853 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_56410 >Feature sequence796 >Feature sequence797 783 1082 gene locus_tag LOCUS_56420 783 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 1079 1324 gene locus_tag LOCUS_56430 1079 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 1321 1635 gene locus_tag LOCUS_56440 1321 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 >Feature sequence798 845 6 gene locus_tag LOCUS_56450 845 6 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_56450 1996 842 gene locus_tag LOCUS_56460 1996 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 >Feature sequence799 >Feature sequence800 1696 530 gene locus_tag LOCUS_56470 1696 530 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_56470 >Feature sequence801 <2078 735 gene locus_tag LOCUS_56480 <2078 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974973.1:aminopeptidase P family protein >Feature sequence802 113 1120 gene locus_tag LOCUS_56490 113 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 1509 1267 gene locus_tag LOCUS_56500 1509 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 1668 1895 gene locus_tag LOCUS_56510 1668 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 >Feature sequence803 >Feature sequence804 >Feature sequence805 23 400 gene locus_tag LOCUS_56520 23 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 413 859 gene locus_tag LOCUS_56530 413 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 >Feature sequence806 26 346 gene locus_tag LOCUS_56540 26 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 1188 523 gene locus_tag LOCUS_56550 1188 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 >Feature sequence807 1963 1598 gene locus_tag LOCUS_56560 1963 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 >Feature sequence808 548 1858 gene locus_tag LOCUS_56570 548 1858 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582296.1 protein_id gnl|my_center|LOCUS_56570