>Feature sequence001 323 1381 gene locus_tag LOCUS_00010 323 1381 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073986.1 protein_id gnl|my_center|LOCUS_00010 1388 4525 gene locus_tag LOCUS_00020 1388 4525 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_00020 4548 5081 gene locus_tag LOCUS_00030 4548 5081 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_00030 5181 6854 gene locus_tag LOCUS_00040 5181 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7106 7390 gene locus_tag LOCUS_00050 7106 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7395 8993 gene locus_tag LOCUS_00060 7395 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9036 10247 gene locus_tag LOCUS_00070 9036 10247 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642921.1 protein_id gnl|my_center|LOCUS_00070 10237 11529 gene locus_tag LOCUS_00080 10237 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11712 12845 gene locus_tag LOCUS_00090 11712 12845 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_00090 13021 14265 gene locus_tag LOCUS_00100 13021 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14444 14359 gene locus_tag LOCUS_t00010 14444 14359 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14942 14499 gene locus_tag LOCUS_00110 14942 14499 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_00110 15358 14948 gene locus_tag LOCUS_00120 15358 14948 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_00120 15871 15647 gene locus_tag LOCUS_00130 15871 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00130 16130 15903 gene locus_tag LOCUS_00140 16130 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00140 17185 16256 gene locus_tag LOCUS_00150 17185 16256 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989618.1 protein_id gnl|my_center|LOCUS_00150 18336 17209 gene locus_tag LOCUS_00160 18336 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19394 18336 gene locus_tag LOCUS_00170 19394 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23100 20518 gene locus_tag LOCUS_00180 23100 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23851 23528 gene locus_tag LOCUS_00190 23851 23528 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_00190 24087 23842 gene locus_tag LOCUS_00200 24087 23842 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_00200 24617 24690 gene locus_tag LOCUS_t00020 24617 24690 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 25716 24757 gene locus_tag LOCUS_00210 25716 24757 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727141.1 protein_id gnl|my_center|LOCUS_00210 28867 25718 gene locus_tag LOCUS_00220 28867 25718 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_00220 29890 28925 gene locus_tag LOCUS_00230 29890 28925 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_00230 31240 29900 gene locus_tag LOCUS_00240 31240 29900 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_00240 33215 31290 gene locus_tag LOCUS_00250 33215 31290 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839216.1 protein_id gnl|my_center|LOCUS_00250 33317 34720 gene locus_tag LOCUS_00260 gene rlmD 33317 34720 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107369.1 protein_id gnl|my_center|LOCUS_00260 34722 35966 gene locus_tag LOCUS_00270 34722 35966 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056098.1 protein_id gnl|my_center|LOCUS_00270 36621 35971 gene locus_tag LOCUS_00280 36621 35971 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_00280 36772 37821 gene locus_tag LOCUS_00290 36772 37821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37890 38912 gene locus_tag LOCUS_00300 gene pheS 37890 38912 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_00300 38923 40140 gene locus_tag LOCUS_00310 38923 40140 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_00310 42243 40150 gene locus_tag LOCUS_00320 42243 40150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 42813 42259 gene locus_tag LOCUS_00330 42813 42259 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985956.1 protein_id gnl|my_center|LOCUS_00330 42776 42973 gene locus_tag LOCUS_00340 42776 42973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 43665 42979 gene locus_tag LOCUS_00350 43665 42979 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237711.1 protein_id gnl|my_center|LOCUS_00350 45079 43793 gene locus_tag LOCUS_00360 45079 43793 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_00360 46089 45181 gene locus_tag LOCUS_00370 gene cysD 46089 45181 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_00370 46695 46093 gene locus_tag LOCUS_00380 gene cysC 46695 46093 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_00380 48340 46802 gene locus_tag LOCUS_00390 48340 46802 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797168.1 protein_id gnl|my_center|LOCUS_00390 49737 48514 gene locus_tag LOCUS_00400 49737 48514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 49837 50703 gene locus_tag LOCUS_00410 49837 50703 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_00410 51299 50706 gene locus_tag LOCUS_00420 gene hisIE 51299 50706 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963101.1 protein_id gnl|my_center|LOCUS_00420 51373 52176 gene locus_tag LOCUS_00430 51373 52176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52925 52173 gene locus_tag LOCUS_00440 gene hisF 52925 52173 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_00440 53641 52925 gene locus_tag LOCUS_00450 gene hisA 53641 52925 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_00450 53987 55117 gene locus_tag LOCUS_00460 gene atpB 53987 55117 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_00460 55162 55365 gene locus_tag LOCUS_00470 55162 55365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55432 55947 gene locus_tag LOCUS_00480 55432 55947 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_00480 55947 56486 gene locus_tag LOCUS_00490 gene atpH 55947 56486 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_00490 56535 58112 gene locus_tag LOCUS_00500 gene atpA 56535 58112 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_00500 58177 59064 gene locus_tag LOCUS_00510 gene atpG 58177 59064 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_00510 60264 59173 gene locus_tag LOCUS_00520 60264 59173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 62287 60344 gene locus_tag LOCUS_00530 62287 60344 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_00530 63077 62361 gene locus_tag LOCUS_00540 63077 62361 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_00540 64121 63087 gene locus_tag LOCUS_00550 64121 63087 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_00550 64873 64151 gene locus_tag LOCUS_00560 64873 64151 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963855.1 protein_id gnl|my_center|LOCUS_00560 66666 64903 gene locus_tag LOCUS_00570 gene rho 66666 64903 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_00570 66943 67887 gene locus_tag LOCUS_00580 66943 67887 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_00580 67884 68981 gene locus_tag LOCUS_00590 67884 68981 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_00590 70666 69011 gene locus_tag LOCUS_00600 70666 69011 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_00600 70794 72032 gene locus_tag LOCUS_00610 70794 72032 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081499.1 protein_id gnl|my_center|LOCUS_00610 72034 73167 gene locus_tag LOCUS_00620 72034 73167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 74563 73220 gene locus_tag LOCUS_00630 74563 73220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 74997 75326 gene locus_tag LOCUS_00640 gene yajC 74997 75326 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_00640 >Feature sequence002 1749 1276 gene locus_tag LOCUS_00650 1749 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 1818 2561 gene locus_tag LOCUS_00660 1818 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 2548 4113 gene locus_tag LOCUS_00670 2548 4113 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_00670 4139 6508 gene locus_tag LOCUS_00680 4139 6508 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_00680 6585 7484 gene locus_tag LOCUS_00690 6585 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 7565 7846 gene locus_tag LOCUS_00700 7565 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 7943 8641 gene locus_tag LOCUS_00710 gene pdxH 7943 8641 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371278.1 protein_id gnl|my_center|LOCUS_00710 8756 9616 gene locus_tag LOCUS_00720 8756 9616 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_00720 9846 9706 gene locus_tag LOCUS_00730 9846 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 10014 11504 gene locus_tag LOCUS_00740 10014 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 11661 12848 gene locus_tag LOCUS_00750 gene mnmA 11661 12848 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_00750 12928 14280 gene locus_tag LOCUS_00760 gene bexA 12928 14280 CDS product multidrug efflux MATE transporter BexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107339.1 protein_id gnl|my_center|LOCUS_00760 14871 14290 gene locus_tag LOCUS_00770 gene purN 14871 14290 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796813.1 protein_id gnl|my_center|LOCUS_00770 14946 16058 gene locus_tag LOCUS_00780 gene gmd 14946 16058 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 protein_id gnl|my_center|LOCUS_00780 16134 17087 gene locus_tag LOCUS_00790 16134 17087 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_00790 17117 18484 gene locus_tag LOCUS_00800 17117 18484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_00800 18481 19146 gene locus_tag LOCUS_00810 18481 19146 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_00810 19407 19168 gene locus_tag LOCUS_00820 19407 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 20000 19410 gene locus_tag LOCUS_00830 20000 19410 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_00830 21766 20006 gene locus_tag LOCUS_00840 21766 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 22650 21868 gene locus_tag LOCUS_00850 22650 21868 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_00850 24097 22757 gene locus_tag LOCUS_00860 24097 22757 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338149.1 protein_id gnl|my_center|LOCUS_00860 24550 24122 gene locus_tag LOCUS_00870 24550 24122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 25286 24855 gene locus_tag LOCUS_00880 25286 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_00880 25455 26201 gene locus_tag LOCUS_00890 25455 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 26204 27835 gene locus_tag LOCUS_00900 26204 27835 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_00900 28998 27838 gene locus_tag LOCUS_00910 28998 27838 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_00910 29166 29241 gene locus_tag LOCUS_t00030 29166 29241 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29953 29303 gene locus_tag LOCUS_00920 gene aat 29953 29303 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_00920 30305 29958 gene locus_tag LOCUS_00930 30305 29958 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_00930 30345 30419 gene locus_tag LOCUS_t00040 30345 30419 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31388 30480 gene locus_tag LOCUS_00940 31388 30480 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_00940 32363 31416 gene locus_tag LOCUS_00950 32363 31416 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_00950 34843 32381 gene locus_tag LOCUS_00960 gene thrA 34843 32381 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_00960 35048 35722 gene locus_tag LOCUS_00970 35048 35722 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561039.1 protein_id gnl|my_center|LOCUS_00970 35726 36409 gene locus_tag LOCUS_00980 35726 36409 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_00980 36497 38140 gene locus_tag LOCUS_00990 gene cdr 36497 38140 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087584.1 protein_id gnl|my_center|LOCUS_00990 38874 38164 gene locus_tag LOCUS_01000 38874 38164 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_01000 39286 38927 gene locus_tag LOCUS_01010 gene rpiB 39286 38927 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01010 41997 39376 gene locus_tag LOCUS_01020 gene alaS 41997 39376 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964045.1 protein_id gnl|my_center|LOCUS_01020 42680 42054 gene locus_tag LOCUS_01030 42680 42054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 43356 42715 gene locus_tag LOCUS_01040 43356 42715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 43440 45599 gene locus_tag LOCUS_01050 43440 45599 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_01050 46083 45586 gene locus_tag LOCUS_01060 gene folK 46083 45586 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_01060 46313 46068 gene locus_tag LOCUS_01070 46313 46068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 46216 47922 gene locus_tag LOCUS_01080 gene sppA 46216 47922 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_01080 49516 47909 gene locus_tag LOCUS_01090 gene polX 49516 47909 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867515.1 protein_id gnl|my_center|LOCUS_01090 51074 49506 gene locus_tag LOCUS_01100 51074 49506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 51910 51074 gene locus_tag LOCUS_01110 51910 51074 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_01110 51998 53389 gene locus_tag LOCUS_01120 51998 53389 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_01120 53409 54401 gene locus_tag LOCUS_01130 53409 54401 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404152.1 protein_id gnl|my_center|LOCUS_01130 54517 55338 gene locus_tag LOCUS_01140 54517 55338 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_01140 56723 55377 gene locus_tag LOCUS_01150 gene nuoF 56723 55377 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_01150 57263 56739 gene locus_tag LOCUS_01160 57263 56739 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_01160 57343 58332 gene locus_tag LOCUS_01170 57343 58332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 59406 58357 gene locus_tag LOCUS_01180 gene queA 59406 58357 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_01180 59502 60755 gene locus_tag LOCUS_01190 59502 60755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_01190 61391 60990 gene locus_tag LOCUS_01200 61391 60990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 62011 61610 gene locus_tag LOCUS_01210 62011 61610 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_01210 62449 62057 gene locus_tag LOCUS_01220 62449 62057 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_01220 63159 62455 gene locus_tag LOCUS_01230 63159 62455 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962705.1 protein_id gnl|my_center|LOCUS_01230 63296 64600 gene locus_tag LOCUS_01240 63296 64600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 64933 64601 gene locus_tag LOCUS_01250 64933 64601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 65093 65509 gene locus_tag LOCUS_01260 65093 65509 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870334.1 protein_id gnl|my_center|LOCUS_01260 65543 66691 gene locus_tag LOCUS_01270 65543 66691 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130543805.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence003 2423 807 gene locus_tag LOCUS_01280 2423 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 2512 2979 gene locus_tag LOCUS_01290 2512 2979 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053574.1 protein_id gnl|my_center|LOCUS_01290 4231 3032 gene locus_tag LOCUS_01300 4231 3032 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_01300 5602 4280 gene locus_tag LOCUS_01310 5602 4280 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877291.1 protein_id gnl|my_center|LOCUS_01310 6424 5696 gene locus_tag LOCUS_01320 6424 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 6542 7102 gene locus_tag LOCUS_01330 6542 7102 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_01330 7108 7872 gene locus_tag LOCUS_01340 7108 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 9549 7876 gene locus_tag LOCUS_01350 9549 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 10597 9737 gene locus_tag LOCUS_01360 gene lipA 10597 9737 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_01360 11390 10599 gene locus_tag LOCUS_01370 11390 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 11819 11502 gene locus_tag LOCUS_01380 gene ytxJ 11819 11502 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_01380 12039 13400 gene locus_tag LOCUS_01390 12039 13400 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_01390 14167 13406 gene locus_tag LOCUS_01400 14167 13406 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_01400 15905 14211 gene locus_tag LOCUS_01410 15905 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 15936 16262 gene locus_tag LOCUS_01420 15936 16262 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_01420 17475 16255 gene locus_tag LOCUS_01430 17475 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 18287 17586 gene locus_tag LOCUS_01440 18287 17586 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_01440 18353 19114 gene locus_tag LOCUS_01450 18353 19114 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_01450 19118 19894 gene locus_tag LOCUS_01460 19118 19894 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_01460 19891 20760 gene locus_tag LOCUS_01470 gene sucD 19891 20760 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_01470 20954 22870 gene locus_tag LOCUS_01480 20954 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_01480 23017 24711 gene locus_tag LOCUS_01490 23017 24711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 24826 27291 gene locus_tag LOCUS_01500 gene priA 24826 27291 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963958.1 protein_id gnl|my_center|LOCUS_01500 27341 27991 gene locus_tag LOCUS_01510 27341 27991 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_01510 28074 29972 gene locus_tag LOCUS_01520 28074 29972 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_01520 30829 29969 gene locus_tag LOCUS_01530 30829 29969 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_01530 31052 30804 gene locus_tag LOCUS_01540 31052 30804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 31710 31132 gene locus_tag LOCUS_01550 31710 31132 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_01550 31823 32599 gene locus_tag LOCUS_01560 31823 32599 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_01560 32647 33288 gene locus_tag LOCUS_01570 32647 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 33362 34498 gene locus_tag LOCUS_01580 33362 34498 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_01580 34910 34545 gene locus_tag LOCUS_01590 34910 34545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 35541 34969 gene locus_tag LOCUS_01600 35541 34969 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_01600 36669 35545 gene locus_tag LOCUS_01610 36669 35545 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_01610 37737 36676 gene locus_tag LOCUS_01620 gene leuB 37737 36676 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_01620 37928 40768 gene locus_tag LOCUS_01630 37928 40768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 40752 41840 gene locus_tag LOCUS_01640 40752 41840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 41833 42867 gene locus_tag LOCUS_01650 41833 42867 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107805.1 protein_id gnl|my_center|LOCUS_01650 43031 43450 gene locus_tag LOCUS_01660 43031 43450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 43901 45349 gene locus_tag LOCUS_01670 43901 45349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_01670 46058 46306 gene locus_tag LOCUS_01680 46058 46306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 46306 46608 gene locus_tag LOCUS_01690 46306 46608 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_01690 48116 46725 gene locus_tag LOCUS_01700 48116 46725 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_01700 48508 48164 gene locus_tag LOCUS_01710 48508 48164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 49996 48686 gene locus_tag LOCUS_01720 49996 48686 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_01720 50876 50022 gene locus_tag LOCUS_01730 50876 50022 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_01730 51784 50957 gene locus_tag LOCUS_01740 51784 50957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 52881 51883 gene locus_tag LOCUS_01750 52881 51883 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_01750 54947 53043 gene locus_tag LOCUS_01760 gene dnaK 54947 53043 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_01760 56143 55082 gene locus_tag LOCUS_01770 56143 55082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 58098 56167 gene locus_tag LOCUS_01780 58098 56167 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_01780 60038 58404 gene locus_tag LOCUS_01790 gene groL 60038 58404 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_01790 60376 60092 gene locus_tag LOCUS_01800 60376 60092 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_01800 62956 60554 gene locus_tag LOCUS_01810 62956 60554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 64006 62993 gene locus_tag LOCUS_01820 64006 62993 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_01820 <65621 64084 gene locus_tag LOCUS_01830 <65621 64084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362020.1:choice-of-anchor L domain-containing protein >Feature sequence004 <1 672 gene locus_tag LOCUS_01840 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785154.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase 841 3216 gene locus_tag LOCUS_01850 841 3216 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_01850 4339 3236 gene locus_tag LOCUS_01860 4339 3236 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_01860 4877 4491 gene locus_tag LOCUS_01870 4877 4491 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_01870 6472 4967 gene locus_tag LOCUS_01880 6472 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 7511 6492 gene locus_tag LOCUS_01890 7511 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 7658 9139 gene locus_tag LOCUS_01900 gene proS 7658 9139 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963521.1 protein_id gnl|my_center|LOCUS_01900 9344 10117 gene locus_tag LOCUS_01910 9344 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 10252 11667 gene locus_tag LOCUS_01920 gene asnS 10252 11667 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_01920 11677 12285 gene locus_tag LOCUS_01930 11677 12285 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763583.1 protein_id gnl|my_center|LOCUS_01930 12333 13586 gene locus_tag LOCUS_01940 12333 13586 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108036.1 protein_id gnl|my_center|LOCUS_01940 13622 13870 gene locus_tag LOCUS_01950 gene purS 13622 13870 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275007.1 protein_id gnl|my_center|LOCUS_01950 16266 13885 gene locus_tag LOCUS_01960 16266 13885 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_01960 18147 16294 gene locus_tag LOCUS_01970 18147 16294 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_01970 18801 18259 gene locus_tag LOCUS_01980 18801 18259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 20197 19202 gene locus_tag LOCUS_01990 20197 19202 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_01990 20320 21183 gene locus_tag LOCUS_02000 20320 21183 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_02000 21187 21585 gene locus_tag LOCUS_02010 21187 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 21563 21787 gene locus_tag LOCUS_02020 21563 21787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 21791 22162 gene locus_tag LOCUS_02030 21791 22162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 22238 22903 gene locus_tag LOCUS_02040 gene mtgA 22238 22903 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_02040 22956 23342 gene locus_tag LOCUS_02050 22956 23342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 23398 24552 gene locus_tag LOCUS_02060 23398 24552 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_02060 24753 26867 gene locus_tag LOCUS_02070 24753 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 28102 26870 gene locus_tag LOCUS_02080 28102 26870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 29374 28187 gene locus_tag LOCUS_02090 29374 28187 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097845.1 protein_id gnl|my_center|LOCUS_02090 29551 30063 gene locus_tag LOCUS_02100 29551 30063 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_02100 31289 30147 gene locus_tag LOCUS_02110 31289 30147 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_02110 31431 32876 gene locus_tag LOCUS_02120 31431 32876 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_02120 32919 33365 gene locus_tag LOCUS_02130 gene dut 32919 33365 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784036.1 protein_id gnl|my_center|LOCUS_02130 33413 35218 gene locus_tag LOCUS_02140 33413 35218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 36150 35215 gene locus_tag LOCUS_02150 36150 35215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 37349 36207 gene locus_tag LOCUS_02160 37349 36207 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_02160 38300 37416 gene locus_tag LOCUS_02170 38300 37416 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_02170 38861 38355 gene locus_tag LOCUS_02180 38861 38355 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_02180 39851 38940 gene locus_tag LOCUS_02190 39851 38940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 40109 41809 gene locus_tag LOCUS_02200 40109 41809 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405397.1 protein_id gnl|my_center|LOCUS_02200 41869 42315 gene locus_tag LOCUS_02210 41869 42315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 42302 43732 gene locus_tag LOCUS_02220 gene pyk 42302 43732 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_02220 44290 43751 gene locus_tag LOCUS_02230 44290 43751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 46461 44380 gene locus_tag LOCUS_02240 gene ppk1 46461 44380 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460183.1 protein_id gnl|my_center|LOCUS_02240 46596 47414 gene locus_tag LOCUS_02250 gene panB 46596 47414 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_02250 47569 48483 gene locus_tag LOCUS_02260 gene nusB 47569 48483 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_02260 48574 49530 gene locus_tag LOCUS_02270 gene metF 48574 49530 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_02270 51136 49508 gene locus_tag LOCUS_02280 51136 49508 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202103.1 protein_id gnl|my_center|LOCUS_02280 51373 54012 gene locus_tag LOCUS_02290 51373 54012 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_02290 54084 55715 gene locus_tag LOCUS_02300 54084 55715 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928693.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence005 2227 482 gene locus_tag LOCUS_02310 gene aspS 2227 482 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202848.1 protein_id gnl|my_center|LOCUS_02310 3418 2288 gene locus_tag LOCUS_02320 3418 2288 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_02320 3984 3619 gene locus_tag LOCUS_02330 3984 3619 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_02330 4809 3985 gene locus_tag LOCUS_02340 4809 3985 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206965.1 protein_id gnl|my_center|LOCUS_02340 6229 4811 gene locus_tag LOCUS_02350 6229 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 6468 6920 gene locus_tag LOCUS_02360 6468 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 8249 6939 gene locus_tag LOCUS_02370 gene der 8249 6939 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_02370 9850 8330 gene locus_tag LOCUS_02380 9850 8330 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_02380 10366 9914 gene locus_tag LOCUS_02390 10366 9914 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_02390 11876 10338 gene locus_tag LOCUS_02400 11876 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 12766 11900 gene locus_tag LOCUS_02410 12766 11900 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_02410 13624 12800 gene locus_tag LOCUS_02420 13624 12800 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_02420 13819 14412 gene locus_tag LOCUS_02430 gene hisH 13819 14412 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_02430 14507 15646 gene locus_tag LOCUS_02440 14507 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 15583 16320 gene locus_tag LOCUS_02450 15583 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 17813 16317 gene locus_tag LOCUS_02460 17813 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 18195 17818 gene locus_tag LOCUS_02470 gene gcvH 18195 17818 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_02470 25610 18258 gene locus_tag LOCUS_02480 gene sprA 25610 18258 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_02480 26263 25667 gene locus_tag LOCUS_02490 gene ruvA 26263 25667 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_02490 28152 26281 gene locus_tag LOCUS_02500 28152 26281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 28564 28349 gene locus_tag LOCUS_02510 28564 28349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 29016 28636 gene locus_tag LOCUS_02520 29016 28636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 29069 29506 gene locus_tag LOCUS_02530 29069 29506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 30092 29514 gene locus_tag LOCUS_02540 30092 29514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_02540 30169 31320 gene locus_tag LOCUS_02550 30169 31320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 32241 31330 gene locus_tag LOCUS_02560 32241 31330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 33460 32408 gene locus_tag LOCUS_02570 gene lpxB 33460 32408 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089240244.1 protein_id gnl|my_center|LOCUS_02570 33581 35854 gene locus_tag LOCUS_02580 33581 35854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 35907 37466 gene locus_tag LOCUS_02590 35907 37466 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_02590 37471 38094 gene locus_tag LOCUS_02600 37471 38094 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529467.1 protein_id gnl|my_center|LOCUS_02600 38166 39512 gene locus_tag LOCUS_02610 gene hemL 38166 39512 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444486.1 protein_id gnl|my_center|LOCUS_02610 40369 39521 gene locus_tag LOCUS_02620 40369 39521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 41124 40378 gene locus_tag LOCUS_02630 41124 40378 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_02630 41349 41570 gene locus_tag LOCUS_02640 41349 41570 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_02640 43214 41631 gene locus_tag LOCUS_02650 43214 41631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 44264 43218 gene locus_tag LOCUS_02660 44264 43218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence006 134 910 gene locus_tag LOCUS_02670 134 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 998 1399 gene locus_tag LOCUS_02680 998 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 2099 2374 gene locus_tag LOCUS_02690 2099 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3022 2474 gene locus_tag LOCUS_02700 gene infC 3022 2474 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_02700 4986 3061 gene locus_tag LOCUS_02710 gene thrS 4986 3061 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421565.1 protein_id gnl|my_center|LOCUS_02710 5186 5563 gene locus_tag LOCUS_02720 5186 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_02720 5581 6471 gene locus_tag LOCUS_02730 5581 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 6537 8588 gene locus_tag LOCUS_02740 6537 8588 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_02740 9501 8599 gene locus_tag LOCUS_02750 9501 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 10477 9539 gene locus_tag LOCUS_02760 10477 9539 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_02760 10643 11767 gene locus_tag LOCUS_02770 10643 11767 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_02770 11873 12226 gene locus_tag LOCUS_02780 gene gldC 11873 12226 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_02780 12219 13253 gene locus_tag LOCUS_02790 12219 13253 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_02790 14003 13272 gene locus_tag LOCUS_02800 14003 13272 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_02800 14137 14433 gene locus_tag LOCUS_02810 14137 14433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 14529 17129 gene locus_tag LOCUS_02820 14529 17129 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_02820 17190 18209 gene locus_tag LOCUS_02830 17190 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 19037 18231 gene locus_tag LOCUS_02840 19037 18231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 20429 19158 gene locus_tag LOCUS_02850 20429 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 20545 21003 gene locus_tag LOCUS_02860 gene lysM 20545 21003 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_02860 21389 21066 gene locus_tag LOCUS_02870 21389 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 22336 21437 gene locus_tag LOCUS_02880 22336 21437 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_02880 24196 22430 gene locus_tag LOCUS_02890 24196 22430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 24271 25194 gene locus_tag LOCUS_02900 24271 25194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 25269 25571 gene locus_tag LOCUS_02910 25269 25571 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761179.1 protein_id gnl|my_center|LOCUS_02910 27474 25639 gene locus_tag LOCUS_02920 27474 25639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 28714 27524 gene locus_tag LOCUS_02930 28714 27524 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373755.1 protein_id gnl|my_center|LOCUS_02930 28810 32310 gene locus_tag LOCUS_02940 28810 32310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_02940 32537 33085 gene locus_tag LOCUS_02950 32537 33085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 33088 33432 gene locus_tag LOCUS_02960 gene arsC 33088 33432 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_02960 33568 36420 gene locus_tag LOCUS_02970 gene gcvP 33568 36420 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_02970 36802 38238 gene locus_tag LOCUS_02980 36802 38238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 38319 39215 gene locus_tag LOCUS_02990 38319 39215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 39593 39201 gene locus_tag LOCUS_03000 39593 39201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 <41068 39667 gene locus_tag LOCUS_03010 <41068 39667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962704.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence007 1569 496 gene locus_tag LOCUS_03020 1569 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2599 1550 gene locus_tag LOCUS_03030 2599 1550 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_03030 3590 2592 gene locus_tag LOCUS_03040 gene dcm 3590 2592 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690264.1 protein_id gnl|my_center|LOCUS_03040 3920 3594 gene locus_tag LOCUS_03050 3920 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 4926 4141 gene locus_tag LOCUS_03060 4926 4141 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_03060 6075 4939 gene locus_tag LOCUS_03070 6075 4939 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_03070 6592 6149 gene locus_tag LOCUS_03080 6592 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 8082 6703 gene locus_tag LOCUS_03090 8082 6703 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108842.1 protein_id gnl|my_center|LOCUS_03090 8961 8164 gene locus_tag LOCUS_03100 8961 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 10077 9166 gene locus_tag LOCUS_03110 10077 9166 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_03110 11343 10090 gene locus_tag LOCUS_03120 11343 10090 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_03120 11985 11407 gene locus_tag LOCUS_03130 gene leuD 11985 11407 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_03130 13402 12017 gene locus_tag LOCUS_03140 gene leuC 13402 12017 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_03140 14307 13528 gene locus_tag LOCUS_03150 gene trpC 14307 13528 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_03150 15020 14310 gene locus_tag LOCUS_03160 15020 14310 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_03160 15181 15020 gene locus_tag LOCUS_03170 15181 15020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 16394 15414 gene locus_tag LOCUS_03180 gene trpD 16394 15414 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_03180 18027 16399 gene locus_tag LOCUS_03190 18027 16399 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_03190 18115 19107 gene locus_tag LOCUS_03200 18115 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 20486 19236 gene locus_tag LOCUS_03210 gene porV 20486 19236 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_03210 24315 20542 gene locus_tag LOCUS_03220 gene porU 24315 20542 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_03220 24520 26010 gene locus_tag LOCUS_03230 gene gldJ 24520 26010 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_03230 26080 27366 gene locus_tag LOCUS_03240 26080 27366 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_03240 27873 27490 gene locus_tag LOCUS_03250 27873 27490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 28073 27858 gene locus_tag LOCUS_03260 28073 27858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 28395 28562 gene locus_tag LOCUS_03270 28395 28562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 29166 28648 gene locus_tag LOCUS_03280 29166 28648 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969554.1 protein_id gnl|my_center|LOCUS_03280 29245 30315 gene locus_tag LOCUS_03290 29245 30315 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_03290 30306 30872 gene locus_tag LOCUS_03300 30306 30872 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_03300 31171 31665 gene locus_tag LOCUS_03310 31171 31665 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 protein_id gnl|my_center|LOCUS_03310 31698 34085 gene locus_tag LOCUS_03320 31698 34085 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_03320 34160 34516 gene locus_tag LOCUS_03330 34160 34516 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_03330 34548 35726 gene locus_tag LOCUS_03340 34548 35726 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_03340 37516 36464 gene locus_tag LOCUS_03350 37516 36464 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_03350 >Feature sequence008 1252 2835 gene locus_tag LOCUS_03360 1252 2835 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_03360 2963 3733 gene locus_tag LOCUS_03370 2963 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 5178 3895 gene locus_tag LOCUS_03380 5178 3895 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_03380 6578 5337 gene locus_tag LOCUS_03390 6578 5337 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962416.1 protein_id gnl|my_center|LOCUS_03390 8254 6614 gene locus_tag LOCUS_03400 8254 6614 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_03400 8914 8351 gene locus_tag LOCUS_03410 8914 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 10520 8988 gene locus_tag LOCUS_03420 gene lysS 10520 8988 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_03420 11930 10614 gene locus_tag LOCUS_03430 11930 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 12144 12446 gene locus_tag LOCUS_03440 12144 12446 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_03440 12580 13263 gene locus_tag LOCUS_03450 12580 13263 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927180.1 protein_id gnl|my_center|LOCUS_03450 13308 15284 gene locus_tag LOCUS_03460 13308 15284 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_03460 15335 16099 gene locus_tag LOCUS_03470 15335 16099 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_03470 16132 16887 gene locus_tag LOCUS_03480 16132 16887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 18151 16931 gene locus_tag LOCUS_03490 18151 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 18911 18237 gene locus_tag LOCUS_03500 18911 18237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 19574 18996 gene locus_tag LOCUS_03510 19574 18996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 22167 19687 gene locus_tag LOCUS_03520 22167 19687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 25159 22367 gene locus_tag LOCUS_03530 gene polA 25159 22367 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_03530 25341 26687 gene locus_tag LOCUS_03540 gene argH 25341 26687 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_03540 26757 27572 gene locus_tag LOCUS_03550 26757 27572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 27670 28872 gene locus_tag LOCUS_03560 27670 28872 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_03560 28909 29883 gene locus_tag LOCUS_03570 gene meaB 28909 29883 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932480.1 protein_id gnl|my_center|LOCUS_03570 30668 29952 gene locus_tag LOCUS_03580 gene bshB1 30668 29952 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_03580 30811 31335 gene locus_tag LOCUS_03590 30811 31335 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_03590 32734 31343 gene locus_tag LOCUS_03600 gene lpdA 32734 31343 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_03600 32840 33661 gene locus_tag LOCUS_03610 32840 33661 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530170.1 protein_id gnl|my_center|LOCUS_03610 33914 34921 gene locus_tag LOCUS_03620 gene trpS 33914 34921 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_03620 34970 35626 gene locus_tag LOCUS_03630 34970 35626 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence009 1510 590 gene locus_tag LOCUS_03640 1510 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 1673 2008 gene locus_tag LOCUS_03650 1673 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_03650 2034 2696 gene locus_tag LOCUS_03660 2034 2696 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_03660 3201 3061 gene locus_tag LOCUS_03670 3201 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3215 3739 gene locus_tag LOCUS_03680 3215 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 6419 3783 gene locus_tag LOCUS_03690 6419 3783 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_03690 7794 6526 gene locus_tag LOCUS_03700 7794 6526 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_03700 9255 7825 gene locus_tag LOCUS_03710 9255 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 9857 9318 gene locus_tag LOCUS_03720 9857 9318 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964878.1 protein_id gnl|my_center|LOCUS_03720 10347 9751 gene locus_tag LOCUS_03730 10347 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 11449 10481 gene locus_tag LOCUS_03740 11449 10481 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_03740 11554 12207 gene locus_tag LOCUS_03750 11554 12207 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_03750 12986 12219 gene locus_tag LOCUS_03760 12986 12219 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_03760 13147 13500 gene locus_tag LOCUS_03770 gene rpsF 13147 13500 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_03770 13503 13769 gene locus_tag LOCUS_03780 gene rpsR 13503 13769 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_03780 13779 14225 gene locus_tag LOCUS_03790 gene rplI 13779 14225 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_03790 15855 14665 gene locus_tag LOCUS_03800 15855 14665 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_03800 16362 15865 gene locus_tag LOCUS_03810 16362 15865 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964320.1 protein_id gnl|my_center|LOCUS_03810 16928 16374 gene locus_tag LOCUS_03820 16928 16374 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_03820 17319 16966 gene locus_tag LOCUS_03830 gene ndhC 17319 16966 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 protein_id gnl|my_center|LOCUS_03830 17538 17462 gene locus_tag LOCUS_t00050 17538 17462 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 19718 17679 gene locus_tag LOCUS_03840 gene rnr 19718 17679 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_03840 21061 19772 gene locus_tag LOCUS_03850 21061 19772 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_03850 21152 22060 gene locus_tag LOCUS_03860 21152 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 22434 22063 gene locus_tag LOCUS_03870 gene crcB 22434 22063 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963905.1 protein_id gnl|my_center|LOCUS_03870 22683 22450 gene locus_tag LOCUS_03880 gene yidD 22683 22450 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721423.1 protein_id gnl|my_center|LOCUS_03880 24599 22710 gene locus_tag LOCUS_03890 24599 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 25235 24663 gene locus_tag LOCUS_03900 25235 24663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 25303 26487 gene locus_tag LOCUS_03910 25303 26487 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_03910 26640 29153 gene locus_tag LOCUS_03920 gene topA 26640 29153 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964077.1 protein_id gnl|my_center|LOCUS_03920 29291 30178 gene locus_tag LOCUS_03930 29291 30178 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_03930 30239 31126 gene locus_tag LOCUS_03940 30239 31126 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 protein_id gnl|my_center|LOCUS_03940 31157 31879 gene locus_tag LOCUS_03950 31157 31879 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_03950 32712 31966 gene locus_tag LOCUS_03960 32712 31966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427172.1 protein_id gnl|my_center|LOCUS_03960 33209 32889 gene locus_tag LOCUS_03970 33209 32889 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786368.1 protein_id gnl|my_center|LOCUS_03970 34586 33216 gene locus_tag LOCUS_03980 gene hemN 34586 33216 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence010 3226 2588 gene locus_tag LOCUS_03990 3226 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3480 3959 gene locus_tag LOCUS_04000 3480 3959 CDS product DNA N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203018.1 protein_id gnl|my_center|LOCUS_04000 4154 3951 gene locus_tag LOCUS_04010 4154 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4921 4151 gene locus_tag LOCUS_04020 4921 4151 CDS product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418960.1 protein_id gnl|my_center|LOCUS_04020 5894 4923 gene locus_tag LOCUS_04030 5894 4923 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_04030 6157 9036 gene locus_tag LOCUS_04040 gene uvrA 6157 9036 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_04040 9093 9770 gene locus_tag LOCUS_04050 9093 9770 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_04050 9801 10367 gene locus_tag LOCUS_04060 9801 10367 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_04060 10364 10846 gene locus_tag LOCUS_04070 10364 10846 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_04070 10956 12146 gene locus_tag LOCUS_04080 10956 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 12311 13612 gene locus_tag LOCUS_04090 12311 13612 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986762.1 protein_id gnl|my_center|LOCUS_04090 14500 13574 gene locus_tag LOCUS_04100 14500 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 14960 14511 gene locus_tag LOCUS_04110 14960 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 15784 15191 gene locus_tag LOCUS_04120 15784 15191 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461136.1 protein_id gnl|my_center|LOCUS_04120 15856 16719 gene locus_tag LOCUS_04130 15856 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 16907 16992 gene locus_tag LOCUS_t00060 16907 16992 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17125 17598 gene locus_tag LOCUS_04140 gene greA 17125 17598 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_04140 18477 17653 gene locus_tag LOCUS_04150 18477 17653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 19228 18488 gene locus_tag LOCUS_04160 19228 18488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 19350 19892 gene locus_tag LOCUS_04170 19350 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 19934 21175 gene locus_tag LOCUS_04180 19934 21175 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_04180 21246 23267 gene locus_tag LOCUS_04190 21246 23267 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_04190 23297 24526 gene locus_tag LOCUS_04200 23297 24526 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_04200 24998 24549 gene locus_tag LOCUS_04210 24998 24549 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_04210 26724 25069 gene locus_tag LOCUS_04220 26724 25069 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_04220 26808 27185 gene locus_tag LOCUS_04230 26808 27185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 27245 28267 gene locus_tag LOCUS_04240 gene gldB 27245 28267 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_04240 29414 28341 gene locus_tag LOCUS_04250 29414 28341 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_04250 29694 30905 gene locus_tag LOCUS_04260 29694 30905 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962199.1 protein_id gnl|my_center|LOCUS_04260 33260 31707 gene locus_tag LOCUS_04270 33260 31707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 33613 33407 gene locus_tag LOCUS_04280 33613 33407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 34000 34320 gene locus_tag LOCUS_04290 34000 34320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence011 493 92 gene locus_tag LOCUS_04300 493 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 668 1096 gene locus_tag LOCUS_04310 668 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 1314 2558 gene locus_tag LOCUS_04320 1314 2558 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_04320 2555 2779 gene locus_tag LOCUS_04330 2555 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3029 3844 gene locus_tag LOCUS_04340 3029 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3844 4608 gene locus_tag LOCUS_04350 3844 4608 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_04350 4624 7299 gene locus_tag LOCUS_04360 4624 7299 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_04360 7310 7822 gene locus_tag LOCUS_04370 7310 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7877 8422 gene locus_tag LOCUS_04380 7877 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 8438 9253 gene locus_tag LOCUS_04390 gene murI 8438 9253 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931976.1 protein_id gnl|my_center|LOCUS_04390 9870 9268 gene locus_tag LOCUS_04400 9870 9268 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_04400 11428 9884 gene locus_tag LOCUS_04410 11428 9884 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_04410 12376 11555 gene locus_tag LOCUS_04420 12376 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 12673 12380 gene locus_tag LOCUS_04430 12673 12380 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_04430 12764 13801 gene locus_tag LOCUS_04440 gene mutY 12764 13801 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_04440 13836 14267 gene locus_tag LOCUS_04450 gene ssb 13836 14267 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_04450 14397 15614 gene locus_tag LOCUS_04460 14397 15614 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_04460 15620 16222 gene locus_tag LOCUS_04470 gene gldD 15620 16222 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_04470 16353 17285 gene locus_tag LOCUS_04480 gene mdh 16353 17285 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760830.1 protein_id gnl|my_center|LOCUS_04480 18620 17352 gene locus_tag LOCUS_04490 gene icd 18620 17352 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_04490 18853 19716 gene locus_tag LOCUS_04500 18853 19716 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056709.1 protein_id gnl|my_center|LOCUS_04500 19782 20108 gene locus_tag LOCUS_04510 19782 20108 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_04510 20689 20111 gene locus_tag LOCUS_04520 20689 20111 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_04520 20844 23618 gene locus_tag LOCUS_04530 gene uvrA 20844 23618 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_04530 23653 24786 gene locus_tag LOCUS_04540 gene hisB 23653 24786 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_04540 26106 24793 gene locus_tag LOCUS_04550 26106 24793 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_04550 27001 26171 gene locus_tag LOCUS_04560 27001 26171 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782748.1 protein_id gnl|my_center|LOCUS_04560 27219 27494 gene locus_tag LOCUS_04570 27219 27494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 27524 27970 gene locus_tag LOCUS_04580 27524 27970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 28031 28381 gene locus_tag LOCUS_04590 28031 28381 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_04590 28411 30063 gene locus_tag LOCUS_04600 28411 30063 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_04600 30179 30880 gene locus_tag LOCUS_04610 30179 30880 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_04610 30939 32345 gene locus_tag LOCUS_04620 30939 32345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence012 278 205 gene locus_tag LOCUS_t00070 278 205 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 347 1054 gene locus_tag LOCUS_04630 gene ung 347 1054 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465920.1 protein_id gnl|my_center|LOCUS_04630 1608 1072 gene locus_tag LOCUS_04640 gene dcd 1608 1072 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_04640 2363 1707 gene locus_tag LOCUS_04650 2363 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5011 2504 gene locus_tag LOCUS_04660 5011 2504 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_04660 5406 5011 gene locus_tag LOCUS_04670 5406 5011 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 protein_id gnl|my_center|LOCUS_04670 6778 5486 gene locus_tag LOCUS_04680 6778 5486 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_04680 8046 6793 gene locus_tag LOCUS_04690 8046 6793 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_04690 8269 8481 gene locus_tag LOCUS_04700 8269 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 8659 10221 gene locus_tag LOCUS_04710 8659 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 10289 11749 gene locus_tag LOCUS_04720 10289 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 13650 11752 gene locus_tag LOCUS_04730 gene asnB 13650 11752 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 protein_id gnl|my_center|LOCUS_04730 16981 13724 gene locus_tag LOCUS_04740 16981 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 17191 19044 gene locus_tag LOCUS_04750 17191 19044 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_04750 19093 19710 gene locus_tag LOCUS_04760 19093 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 19827 22934 gene locus_tag LOCUS_04770 19827 22934 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_04770 22962 23153 gene locus_tag LOCUS_04780 22962 23153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04780 23215 23340 gene locus_tag LOCUS_04790 23215 23340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 24039 23392 gene locus_tag LOCUS_04800 24039 23392 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932940.1 protein_id gnl|my_center|LOCUS_04800 26320 24083 gene locus_tag LOCUS_04810 26320 24083 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_04810 29459 26313 gene locus_tag LOCUS_04820 29459 26313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 29678 31705 gene locus_tag LOCUS_04830 29678 31705 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_04830 31699 32859 gene locus_tag LOCUS_04840 31699 32859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 33559 32861 gene locus_tag LOCUS_04850 33559 32861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence013 104 1120 gene locus_tag LOCUS_04860 104 1120 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183337994.1 protein_id gnl|my_center|LOCUS_04860 1909 1139 gene locus_tag LOCUS_04870 gene trpA 1909 1139 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_04870 2951 1923 gene locus_tag LOCUS_04880 2951 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3628 2954 gene locus_tag LOCUS_04890 3628 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4316 3720 gene locus_tag LOCUS_04900 4316 3720 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_04900 7000 4319 gene locus_tag LOCUS_04910 7000 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 8126 7083 gene locus_tag LOCUS_04920 8126 7083 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 protein_id gnl|my_center|LOCUS_04920 8886 8155 gene locus_tag LOCUS_04930 8886 8155 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_04930 10328 8910 gene locus_tag LOCUS_04940 10328 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 10381 11661 gene locus_tag LOCUS_04950 10381 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 11692 12648 gene locus_tag LOCUS_04960 11692 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 13565 12651 gene locus_tag LOCUS_04970 gene xerD 13565 12651 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_04970 13825 13565 gene locus_tag LOCUS_04980 13825 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 14019 13828 gene locus_tag LOCUS_04990 14019 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 14960 14487 gene locus_tag LOCUS_05000 14960 14487 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_05000 15296 14976 gene locus_tag LOCUS_05010 gene trxA 15296 14976 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_05010 15660 15370 gene locus_tag LOCUS_05020 15660 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 16761 15664 gene locus_tag LOCUS_05030 gene recF 16761 15664 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_05030 16839 17519 gene locus_tag LOCUS_05040 16839 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 17623 18096 gene locus_tag LOCUS_05050 gene ribH 17623 18096 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_05050 18264 19679 gene locus_tag LOCUS_05060 18264 19679 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_05060 20912 19740 gene locus_tag LOCUS_05070 20912 19740 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_05070 21421 20978 gene locus_tag LOCUS_05080 21421 20978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 22681 21488 gene locus_tag LOCUS_05090 22681 21488 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_05090 23441 22704 gene locus_tag LOCUS_05100 23441 22704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 23538 24377 gene locus_tag LOCUS_05110 gene lgt 23538 24377 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_05110 24463 26310 gene locus_tag LOCUS_05120 24463 26310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 26322 26936 gene locus_tag LOCUS_05130 gene bstA 26322 26936 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_05130 27008 28894 gene locus_tag LOCUS_05140 gene yidC 27008 28894 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence014 1566 307 gene locus_tag LOCUS_05150 1566 307 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_05150 2016 1567 gene locus_tag LOCUS_05160 gene umuD 2016 1567 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_05160 2849 2184 gene locus_tag LOCUS_05170 2849 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3001 3603 gene locus_tag LOCUS_05180 3001 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3681 5909 gene locus_tag LOCUS_05190 3681 5909 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_05190 6449 5910 gene locus_tag LOCUS_05200 6449 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7564 6497 gene locus_tag LOCUS_05210 7564 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 8835 7567 gene locus_tag LOCUS_05220 8835 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8977 9465 gene locus_tag LOCUS_05230 gene dfrA 8977 9465 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_05230 9472 10314 gene locus_tag LOCUS_05240 9472 10314 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727351.1 protein_id gnl|my_center|LOCUS_05240 16424 10320 gene locus_tag LOCUS_05250 16424 10320 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_05250 17396 16446 gene locus_tag LOCUS_05260 17396 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 18986 17511 gene locus_tag LOCUS_05270 18986 17511 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_05270 19128 19904 gene locus_tag LOCUS_05280 gene dapF 19128 19904 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_05280 19906 20853 gene locus_tag LOCUS_05290 19906 20853 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721765.1 protein_id gnl|my_center|LOCUS_05290 21937 20855 gene locus_tag LOCUS_05300 21937 20855 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_05300 22069 22770 gene locus_tag LOCUS_05310 22069 22770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 22915 23553 gene locus_tag LOCUS_05320 22915 23553 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_05320 24951 23587 gene locus_tag LOCUS_05330 24951 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 26845 25094 gene locus_tag LOCUS_05340 26845 25094 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_05340 27069 28064 gene locus_tag LOCUS_05350 27069 28064 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_05350 28233 29720 gene locus_tag LOCUS_05360 gene rpoN 28233 29720 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence015 454 1452 gene locus_tag LOCUS_05370 gene dusB 454 1452 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_05370 1623 1949 gene locus_tag LOCUS_05380 1623 1949 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963013.1 protein_id gnl|my_center|LOCUS_05380 1946 2971 gene locus_tag LOCUS_05390 1946 2971 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080803342.1 protein_id gnl|my_center|LOCUS_05390 3966 2968 gene locus_tag LOCUS_05400 3966 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4175 3969 gene locus_tag LOCUS_05410 4175 3969 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_05410 4440 5618 gene locus_tag LOCUS_05420 4440 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 7288 5804 gene locus_tag LOCUS_05430 7288 5804 CDS product IS1634-like element ISMsm6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727513.1 protein_id gnl|my_center|LOCUS_05430 7912 7355 gene locus_tag LOCUS_05440 7912 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 9575 8145 gene locus_tag LOCUS_05450 9575 8145 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963349.1 protein_id gnl|my_center|LOCUS_05450 10488 9619 gene locus_tag LOCUS_05460 10488 9619 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_05460 10608 12044 gene locus_tag LOCUS_05470 10608 12044 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_05470 12041 13183 gene locus_tag LOCUS_05480 12041 13183 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_05480 13185 14381 gene locus_tag LOCUS_05490 13185 14381 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_05490 14486 15049 gene locus_tag LOCUS_05500 14486 15049 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_05500 15077 15151 gene locus_tag LOCUS_t00080 15077 15151 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16941 15295 gene locus_tag LOCUS_05510 gene rny 16941 15295 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963284.1 protein_id gnl|my_center|LOCUS_05510 17268 16969 gene locus_tag LOCUS_05520 17268 16969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 17675 17268 gene locus_tag LOCUS_05530 17675 17268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 20098 17675 gene locus_tag LOCUS_05540 gene pheT 20098 17675 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_05540 22297 20411 gene locus_tag LOCUS_05550 gene rpsA 22297 20411 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_05550 23701 22448 gene locus_tag LOCUS_05560 23701 22448 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_05560 23773 24771 gene locus_tag LOCUS_05570 gene fbp 23773 24771 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216946.1 protein_id gnl|my_center|LOCUS_05570 24790 25164 gene locus_tag LOCUS_05580 24790 25164 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_05580 25390 25923 gene locus_tag LOCUS_05590 gene ftnA 25390 25923 CDS product H-type ferritin FtnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830392.1 protein_id gnl|my_center|LOCUS_05590 25969 26904 gene locus_tag LOCUS_05600 gene queG 25969 26904 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_05600 26901 27524 gene locus_tag LOCUS_05610 26901 27524 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962673.1 protein_id gnl|my_center|LOCUS_05610 <29248 27576 gene locus_tag LOCUS_05620 <29248 27576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458327.1:endonuclease >Feature sequence016 4185 3808 gene locus_tag LOCUS_05630 gene rplL 4185 3808 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_05630 4734 4213 gene locus_tag LOCUS_05640 gene rplJ 4734 4213 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_05640 5454 4759 gene locus_tag LOCUS_05650 gene rplA 5454 4759 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_05650 5980 5537 gene locus_tag LOCUS_05660 gene rplK 5980 5537 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_05660 6556 5984 gene locus_tag LOCUS_05670 gene nusG 6556 5984 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_05670 6746 6549 gene locus_tag LOCUS_05680 6746 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6834 6761 gene locus_tag LOCUS_t00090 6834 6761 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8070 6883 gene locus_tag LOCUS_05690 gene tuf 8070 6883 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_05690 8194 8122 gene locus_tag LOCUS_t00100 8194 8122 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8322 8249 gene locus_tag LOCUS_t00110 8322 8249 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8450 8367 gene locus_tag LOCUS_t00120 8450 8367 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8575 8501 gene locus_tag LOCUS_t00130 8575 8501 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9409 8801 gene locus_tag LOCUS_05700 9409 8801 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_05700 9860 9411 gene locus_tag LOCUS_05710 9860 9411 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_05710 9923 10921 gene locus_tag LOCUS_05720 gene holA 9923 10921 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_05720 11803 11162 gene locus_tag LOCUS_05730 11803 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 12567 11845 gene locus_tag LOCUS_05740 gene ubiE 12567 11845 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_05740 12659 13285 gene locus_tag LOCUS_05750 gene yihA 12659 13285 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_05750 14711 13278 gene locus_tag LOCUS_05760 14711 13278 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_05760 14794 15933 gene locus_tag LOCUS_05770 14794 15933 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_05770 16070 16480 gene locus_tag LOCUS_05780 16070 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 16498 17466 gene locus_tag LOCUS_05790 gene argC 16498 17466 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_05790 17964 17467 gene locus_tag LOCUS_05800 17964 17467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 19713 18046 gene locus_tag LOCUS_05810 19713 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 21274 19745 gene locus_tag LOCUS_05820 gene dnaB 21274 19745 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_05820 21502 22164 gene locus_tag LOCUS_05830 21502 22164 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_05830 22286 23278 gene locus_tag LOCUS_05840 22286 23278 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198481065.1 protein_id gnl|my_center|LOCUS_05840 23344 24228 gene locus_tag LOCUS_05850 gene era 23344 24228 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_05850 26799 24238 gene locus_tag LOCUS_05860 26799 24238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 27446 26916 gene locus_tag LOCUS_05870 gene hpt 27446 26916 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_05870 27995 27465 gene locus_tag LOCUS_05880 27995 27465 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107759.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence017 2115 2759 gene locus_tag LOCUS_05890 2115 2759 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_05890 2935 3567 gene locus_tag LOCUS_05900 2935 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047726.1 protein_id gnl|my_center|LOCUS_05900 3750 5261 gene locus_tag LOCUS_05910 3750 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5351 6238 gene locus_tag LOCUS_05920 5351 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6284 7123 gene locus_tag LOCUS_05930 6284 7123 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_05930 7425 7207 gene locus_tag LOCUS_05940 7425 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176339772.1 protein_id gnl|my_center|LOCUS_05940 7520 9469 gene locus_tag LOCUS_05950 7520 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9972 9472 gene locus_tag LOCUS_05960 9972 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 11659 10055 gene locus_tag LOCUS_05970 gene bshC 11659 10055 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_05970 12976 11663 gene locus_tag LOCUS_05980 gene rimO 12976 11663 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_05980 13085 13882 gene locus_tag LOCUS_05990 13085 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 13905 14567 gene locus_tag LOCUS_06000 13905 14567 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_06000 15891 14572 gene locus_tag LOCUS_06010 15891 14572 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_06010 16524 16024 gene locus_tag LOCUS_06020 16524 16024 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108272.1 protein_id gnl|my_center|LOCUS_06020 18090 16633 gene locus_tag LOCUS_06030 18090 16633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 18221 19744 gene locus_tag LOCUS_06040 18221 19744 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_06040 20552 19731 gene locus_tag LOCUS_06050 20552 19731 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619395.1 protein_id gnl|my_center|LOCUS_06050 21889 20594 gene locus_tag LOCUS_06060 21889 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946837.1 protein_id gnl|my_center|LOCUS_06060 22291 21998 gene locus_tag LOCUS_06070 22291 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 23181 22399 gene locus_tag LOCUS_06080 23181 22399 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_06080 24554 23184 gene locus_tag LOCUS_06090 24554 23184 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964308.1 protein_id gnl|my_center|LOCUS_06090 25960 24557 gene locus_tag LOCUS_06100 25960 24557 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_06100 <27683 26051 gene locus_tag LOCUS_06110 <27683 26051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964310.1:NADH-quinone oxidoreductase subunit L >Feature sequence018 1906 1046 gene locus_tag LOCUS_06120 1906 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3605 1890 gene locus_tag LOCUS_06130 3605 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3828 4979 gene locus_tag LOCUS_06140 gene hemW 3828 4979 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_06140 4957 5805 gene locus_tag LOCUS_06150 4957 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5906 6844 gene locus_tag LOCUS_06160 5906 6844 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226530.1 protein_id gnl|my_center|LOCUS_06160 6962 7549 gene locus_tag LOCUS_06170 6962 7549 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_06170 8216 7551 gene locus_tag LOCUS_06180 8216 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8273 8947 gene locus_tag LOCUS_06190 8273 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 9573 8968 gene locus_tag LOCUS_06200 9573 8968 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_06200 10601 9654 gene locus_tag LOCUS_06210 10601 9654 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_06210 11052 10603 gene locus_tag LOCUS_06220 11052 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 12000 11077 gene locus_tag LOCUS_06230 12000 11077 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_06230 12769 11990 gene locus_tag LOCUS_06240 gene rsmA 12769 11990 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_06240 12869 14545 gene locus_tag LOCUS_06250 12869 14545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 14520 15581 gene locus_tag LOCUS_06260 14520 15581 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109958.1 protein_id gnl|my_center|LOCUS_06260 15641 16789 gene locus_tag LOCUS_06270 15641 16789 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_06270 16847 16935 gene locus_tag LOCUS_t00140 16847 16935 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17018 19993 gene locus_tag LOCUS_06280 17018 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 20434 20009 gene locus_tag LOCUS_06290 20434 20009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 21440 20436 gene locus_tag LOCUS_06300 gene tsaD 21440 20436 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence019 564 1391 gene locus_tag LOCUS_06310 564 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 1394 2326 gene locus_tag LOCUS_06320 1394 2326 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257108.1 protein_id gnl|my_center|LOCUS_06320 2433 3857 gene locus_tag LOCUS_06330 2433 3857 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046312529.1 protein_id gnl|my_center|LOCUS_06330 3871 4191 gene locus_tag LOCUS_06340 3871 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5643 4192 gene locus_tag LOCUS_06350 5643 4192 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_06350 7053 5725 gene locus_tag LOCUS_06360 7053 5725 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040550.1 protein_id gnl|my_center|LOCUS_06360 7755 7183 gene locus_tag LOCUS_06370 7755 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 8611 7757 gene locus_tag LOCUS_06380 8611 7757 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689183.1 protein_id gnl|my_center|LOCUS_06380 9686 8631 gene locus_tag LOCUS_06390 gene nirK 9686 8631 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_06390 11065 9707 gene locus_tag LOCUS_06400 11065 9707 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_06400 11734 11324 gene locus_tag LOCUS_06410 11734 11324 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_06410 15125 11844 gene locus_tag LOCUS_06420 15125 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 19622 15129 gene locus_tag LOCUS_06430 19622 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 <26132 19619 gene locus_tag LOCUS_06440 <26132 19619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966627.1:type I polyketide synthase >Feature sequence020 1784 1140 gene locus_tag LOCUS_06450 1784 1140 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_06450 3291 1903 gene locus_tag LOCUS_06460 3291 1903 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_06460 4175 3318 gene locus_tag LOCUS_06470 4175 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 4819 4415 gene locus_tag LOCUS_06480 gene spoIIAB 4819 4415 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_06480 6739 4967 gene locus_tag LOCUS_06490 6739 4967 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_06490 8615 6753 gene locus_tag LOCUS_06500 gene mnmG 8615 6753 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_06500 10197 9163 gene locus_tag LOCUS_06510 10197 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 11472 10207 gene locus_tag LOCUS_06520 11472 10207 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047913.1 protein_id gnl|my_center|LOCUS_06520 11537 12286 gene locus_tag LOCUS_06530 11537 12286 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_06530 12347 12856 gene locus_tag LOCUS_06540 12347 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 12875 14041 gene locus_tag LOCUS_06550 12875 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161816838.1 protein_id gnl|my_center|LOCUS_06550 14038 14613 gene locus_tag LOCUS_06560 gene nadD 14038 14613 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_06560 15219 16241 gene locus_tag LOCUS_06570 gene nadA 15219 16241 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_06570 16249 16842 gene locus_tag LOCUS_06580 16249 16842 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_06580 16846 18033 gene locus_tag LOCUS_06590 16846 18033 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_06590 19126 18044 gene locus_tag LOCUS_06600 19126 18044 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_06600 19297 21504 gene locus_tag LOCUS_06610 gene recQ 19297 21504 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_06610 21592 23373 gene locus_tag LOCUS_06620 21592 23373 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_06620 23492 24178 gene locus_tag LOCUS_06630 23492 24178 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_06630 24288 25319 gene locus_tag LOCUS_06640 gene fni 24288 25319 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599487.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence021 556 68 gene locus_tag LOCUS_06650 556 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3544 944 gene locus_tag LOCUS_06660 gene clpB 3544 944 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_06660 4464 3754 gene locus_tag LOCUS_06670 4464 3754 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_06670 4542 4973 gene locus_tag LOCUS_06680 4542 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5887 4976 gene locus_tag LOCUS_06690 5887 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 7143 5893 gene locus_tag LOCUS_06700 7143 5893 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_06700 7889 7449 gene locus_tag LOCUS_06710 7889 7449 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 protein_id gnl|my_center|LOCUS_06710 8879 7896 gene locus_tag LOCUS_06720 gene ftsY 8879 7896 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_06720 9132 8962 gene locus_tag LOCUS_06730 9132 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 9324 9139 gene locus_tag LOCUS_06740 gene rpmG 9324 9139 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_06740 9582 9337 gene locus_tag LOCUS_06750 gene rpmB 9582 9337 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_06750 9738 9664 gene locus_tag LOCUS_t00150 9738 9664 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10039 10452 gene locus_tag LOCUS_06760 10039 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 10469 11131 gene locus_tag LOCUS_06770 10469 11131 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_06770 12258 11128 gene locus_tag LOCUS_06780 gene iscS 12258 11128 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_06780 12315 12713 gene locus_tag LOCUS_06790 gene mce 12315 12713 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_06790 13118 12768 gene locus_tag LOCUS_06800 13118 12768 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_06800 13196 14197 gene locus_tag LOCUS_06810 13196 14197 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_06810 14376 14864 gene locus_tag LOCUS_06820 14376 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 15332 14856 gene locus_tag LOCUS_06830 gene rnhA 15332 14856 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_06830 15369 16001 gene locus_tag LOCUS_06840 15369 16001 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_06840 16057 17163 gene locus_tag LOCUS_06850 16057 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 17231 17710 gene locus_tag LOCUS_06860 17231 17710 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_06860 17936 17754 gene locus_tag LOCUS_06870 17936 17754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 18530 17967 gene locus_tag LOCUS_06880 18530 17967 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963543.1 protein_id gnl|my_center|LOCUS_06880 19465 18533 gene locus_tag LOCUS_06890 19465 18533 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_06890 20024 19527 gene locus_tag LOCUS_06900 20024 19527 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_06900 21000 20029 gene locus_tag LOCUS_06910 21000 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 22646 21018 gene locus_tag LOCUS_06920 22646 21018 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218596.1 protein_id gnl|my_center|LOCUS_06920 <23853 22780 gene locus_tag LOCUS_06930 <23853 22780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883676.1:pyridoxal phosphate-dependent aminotransferase family protein >Feature sequence022 394 1725 gene locus_tag LOCUS_06940 gene nhaA 394 1725 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788084.1 protein_id gnl|my_center|LOCUS_06940 2268 1726 gene locus_tag LOCUS_06950 2268 1726 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 protein_id gnl|my_center|LOCUS_06950 2895 2299 gene locus_tag LOCUS_06960 2895 2299 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963926.1 protein_id gnl|my_center|LOCUS_06960 3302 2892 gene locus_tag LOCUS_06970 3302 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3454 5403 gene locus_tag LOCUS_06980 gene gyrB 3454 5403 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_06980 5427 7076 gene locus_tag LOCUS_06990 gene recN 5427 7076 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_06990 7148 7771 gene locus_tag LOCUS_07000 7148 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 8952 7768 gene locus_tag LOCUS_07010 8952 7768 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_07010 9267 9019 gene locus_tag LOCUS_07020 9267 9019 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_07020 10282 9371 gene locus_tag LOCUS_07030 10282 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 11315 10374 gene locus_tag LOCUS_07040 11315 10374 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_07040 11526 12143 gene locus_tag LOCUS_07050 gene recR 11526 12143 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963432.1 protein_id gnl|my_center|LOCUS_07050 12297 13802 gene locus_tag LOCUS_07060 12297 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 13881 14441 gene locus_tag LOCUS_07070 13881 14441 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_07070 14564 17851 gene locus_tag LOCUS_07080 14564 17851 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_07080 17855 18544 gene locus_tag LOCUS_07090 17855 18544 CDS product SMUG2 DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 protein_id gnl|my_center|LOCUS_07090 18622 20205 gene locus_tag LOCUS_07100 18622 20205 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_07100 20374 22044 gene locus_tag LOCUS_07110 20374 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 22171 22932 gene locus_tag LOCUS_07120 22171 22932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence023 839 234 gene locus_tag LOCUS_07130 839 234 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_07130 1738 845 gene locus_tag LOCUS_07140 gene cyoE 1738 845 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_07140 3545 1758 gene locus_tag LOCUS_07150 3545 1758 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_07150 5044 3572 gene locus_tag LOCUS_07160 5044 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 6953 5634 gene locus_tag LOCUS_07170 6953 5634 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_07170 7594 6995 gene locus_tag LOCUS_07180 7594 6995 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_07180 8125 7604 gene locus_tag LOCUS_07190 8125 7604 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_07190 9598 8153 gene locus_tag LOCUS_07200 gene nrfD 9598 8153 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_07200 12678 9643 gene locus_tag LOCUS_07210 12678 9643 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_07210 13966 12710 gene locus_tag LOCUS_07220 13966 12710 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_07220 14291 14896 gene locus_tag LOCUS_07230 gene rsmG 14291 14896 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_07230 15746 14898 gene locus_tag LOCUS_07240 15746 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 15897 16640 gene locus_tag LOCUS_07250 15897 16640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 17485 16700 gene locus_tag LOCUS_07260 17485 16700 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_07260 18868 17528 gene locus_tag LOCUS_07270 18868 17528 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_07270 18897 19079 gene locus_tag LOCUS_07280 18897 19079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 21961 19175 gene locus_tag LOCUS_07290 21961 19175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 <22723 22001 gene locus_tag LOCUS_07300 <22723 22001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763665.1:transcription termination factor NusA >Feature sequence024 <1 1335 gene locus_tag LOCUS_07310 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164931100.1:radical SAM protein 1418 2386 gene locus_tag LOCUS_07320 1418 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2584 3867 gene locus_tag LOCUS_07330 gene aceA 2584 3867 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787351.1 protein_id gnl|my_center|LOCUS_07330 3994 4752 gene locus_tag LOCUS_07340 3994 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4890 6539 gene locus_tag LOCUS_07350 4890 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 6822 9002 gene locus_tag LOCUS_07360 6822 9002 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_07360 9264 13796 gene locus_tag LOCUS_07370 gene gltB 9264 13796 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 protein_id gnl|my_center|LOCUS_07370 13820 15310 gene locus_tag LOCUS_07380 13820 15310 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_07380 15435 16019 gene locus_tag LOCUS_07390 gene scpB 15435 16019 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_07390 15979 16866 gene locus_tag LOCUS_07400 15979 16866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 17109 17927 gene locus_tag LOCUS_07410 gene pyrF 17109 17927 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_07410 17940 18914 gene locus_tag LOCUS_07420 gene galT 17940 18914 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080138.1 protein_id gnl|my_center|LOCUS_07420 20234 18966 gene locus_tag LOCUS_07430 20234 18966 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_07430 20745 20335 gene locus_tag LOCUS_07440 20745 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 21079 20876 gene locus_tag LOCUS_07450 21079 20876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 21505 21275 gene locus_tag LOCUS_07460 21505 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 21614 22156 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atctacaatagtagaaattatcggccattttcagac >Feature sequence025 1791 3056 gene locus_tag LOCUS_07470 gene dcm 1791 3056 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_07470 3058 3681 gene locus_tag LOCUS_07480 3058 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4775 3984 gene locus_tag LOCUS_07490 4775 3984 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962308.1 protein_id gnl|my_center|LOCUS_07490 5770 4772 gene locus_tag LOCUS_07500 5770 4772 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_07500 6777 5770 gene locus_tag LOCUS_07510 6777 5770 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_07510 7755 6787 gene locus_tag LOCUS_07520 7755 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8618 7755 gene locus_tag LOCUS_07530 8618 7755 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_07530 9691 8699 gene locus_tag LOCUS_07540 9691 8699 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_07540 9906 10325 gene locus_tag LOCUS_07550 9906 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 11627 10389 gene locus_tag LOCUS_07560 11627 10389 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_07560 12022 11624 gene locus_tag LOCUS_07570 gene rbfA 12022 11624 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931934.1 protein_id gnl|my_center|LOCUS_07570 12174 13892 gene locus_tag LOCUS_07580 12174 13892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_07580 13961 14479 gene locus_tag LOCUS_07590 13961 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 14615 16408 gene locus_tag LOCUS_07600 14615 16408 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416279.1 protein_id gnl|my_center|LOCUS_07600 16513 16965 gene locus_tag LOCUS_07610 16513 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 17111 19864 gene locus_tag LOCUS_07620 17111 19864 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_07620 20940 19870 gene locus_tag LOCUS_07630 20940 19870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence026 2416 899 gene locus_tag LOCUS_07640 gene purH 2416 899 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_07640 3904 2642 gene locus_tag LOCUS_07650 3904 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4833 4450 gene locus_tag LOCUS_07660 4833 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6652 5216 gene locus_tag LOCUS_07670 gene dnaA 6652 5216 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_07670 7648 6740 gene locus_tag LOCUS_07680 7648 6740 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_07680 8375 7638 gene locus_tag LOCUS_07690 8375 7638 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_07690 8910 8356 gene locus_tag LOCUS_07700 8910 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_07700 9021 9368 gene locus_tag LOCUS_07710 9021 9368 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_07710 9513 9797 gene locus_tag LOCUS_07720 9513 9797 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_07720 9877 11124 gene locus_tag LOCUS_07730 9877 11124 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_07730 12244 11135 gene locus_tag LOCUS_07740 12244 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 13953 12388 gene locus_tag LOCUS_07750 13953 12388 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229262.1 protein_id gnl|my_center|LOCUS_07750 15098 14112 gene locus_tag LOCUS_07760 15098 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 15721 15170 gene locus_tag LOCUS_07770 15721 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 18027 15727 gene locus_tag LOCUS_07780 18027 15727 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_07780 18211 18684 gene locus_tag LOCUS_07790 18211 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 18718 19404 gene locus_tag LOCUS_07800 18718 19404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_07800 19455 20021 gene locus_tag LOCUS_07810 19455 20021 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence027 <1 603 gene locus_tag LOCUS_07820 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964159.1:phospho-N-acetylmuramoyl-pentapeptide-transferase 610 1953 gene locus_tag LOCUS_07830 gene murD 610 1953 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_07830 1978 3192 gene locus_tag LOCUS_07840 gene ftsW 1978 3192 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_07840 3206 4315 gene locus_tag LOCUS_07850 gene murG 3206 4315 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_07850 4325 5704 gene locus_tag LOCUS_07860 gene murC 4325 5704 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_07860 5697 6461 gene locus_tag LOCUS_07870 5697 6461 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_07870 6497 7918 gene locus_tag LOCUS_07880 gene ftsA 6497 7918 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_07880 7966 9540 gene locus_tag LOCUS_07890 7966 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 9631 10236 gene locus_tag LOCUS_07900 gene pnuC 9631 10236 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_07900 10233 10754 gene locus_tag LOCUS_07910 10233 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 11947 10757 gene locus_tag LOCUS_07920 11947 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 14452 12023 gene locus_tag LOCUS_07930 14452 12023 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797093.1 protein_id gnl|my_center|LOCUS_07930 14721 15797 gene locus_tag LOCUS_07940 gene gcvT 14721 15797 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_07940 15830 17356 gene locus_tag LOCUS_07950 15830 17356 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_07950 19322 17364 gene locus_tag LOCUS_07960 19322 17364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 19395 20906 gene locus_tag LOCUS_07970 19395 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence028 1915 872 gene locus_tag LOCUS_07980 gene ilvC 1915 872 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_07980 2243 1959 gene locus_tag LOCUS_07990 2243 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2382 3296 gene locus_tag LOCUS_08000 2382 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3382 4299 gene locus_tag LOCUS_08010 3382 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4286 5494 gene locus_tag LOCUS_08020 4286 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5502 6506 gene locus_tag LOCUS_08030 5502 6506 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_08030 7713 6574 gene locus_tag LOCUS_08040 7713 6574 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_08040 8709 7855 gene locus_tag LOCUS_08050 gene prmC 8709 7855 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_08050 8731 9762 gene locus_tag LOCUS_08060 gene ribD 8731 9762 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_08060 9841 10392 gene locus_tag LOCUS_08070 9841 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 10508 11887 gene locus_tag LOCUS_08080 gene glmM 10508 11887 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_08080 11987 14140 gene locus_tag LOCUS_08090 11987 14140 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926991.1 protein_id gnl|my_center|LOCUS_08090 14251 15201 gene locus_tag LOCUS_08100 14251 15201 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_08100 15280 16131 gene locus_tag LOCUS_08110 15280 16131 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_08110 16133 17395 gene locus_tag LOCUS_08120 gene nreB 16133 17395 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_08120 18432 17491 gene locus_tag LOCUS_08130 18432 17491 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114936010.1 protein_id gnl|my_center|LOCUS_08130 19505 18432 gene locus_tag LOCUS_08140 19505 18432 CDS product HindVP family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038499775.1 protein_id gnl|my_center|LOCUS_08140 20416 19979 gene locus_tag LOCUS_08150 20416 19979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence029 28 2211 gene locus_tag LOCUS_08160 28 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2229 2675 gene locus_tag LOCUS_08170 2229 2675 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_08170 2982 4742 gene locus_tag LOCUS_08180 2982 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4752 5408 gene locus_tag LOCUS_08190 4752 5408 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_08190 5564 5481 gene locus_tag LOCUS_t00160 5564 5481 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5695 5622 gene locus_tag LOCUS_t00170 5695 5622 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6565 5783 gene locus_tag LOCUS_08200 6565 5783 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_08200 6567 7586 gene locus_tag LOCUS_08210 gene hemE 6567 7586 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933694.1 protein_id gnl|my_center|LOCUS_08210 7593 8729 gene locus_tag LOCUS_08220 gene nspC 7593 8729 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_08220 8739 9767 gene locus_tag LOCUS_08230 8739 9767 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_08230 10407 9775 gene locus_tag LOCUS_08240 10407 9775 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 protein_id gnl|my_center|LOCUS_08240 11418 10492 gene locus_tag LOCUS_08250 11418 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 11542 13104 gene locus_tag LOCUS_08260 11542 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 13109 13972 gene locus_tag LOCUS_08270 13109 13972 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_08270 14660 14034 gene locus_tag LOCUS_08280 14660 14034 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_08280 15205 14675 gene locus_tag LOCUS_08290 15205 14675 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_08290 15900 15208 gene locus_tag LOCUS_08300 15900 15208 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_08300 17226 16021 gene locus_tag LOCUS_08310 17226 16021 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_08310 17673 17236 gene locus_tag LOCUS_08320 17673 17236 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822735.1 protein_id gnl|my_center|LOCUS_08320 18389 17742 gene locus_tag LOCUS_08330 18389 17742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 19474 18482 gene locus_tag LOCUS_08340 19474 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 <20710 19583 gene locus_tag LOCUS_08350 <20710 19583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114226.1:ceramidase CerN >Feature sequence030 532 98 gene locus_tag LOCUS_08360 532 98 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_08360 1994 630 gene locus_tag LOCUS_08370 1994 630 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_08370 3361 2006 gene locus_tag LOCUS_08380 3361 2006 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_08380 3442 4257 gene locus_tag LOCUS_08390 3442 4257 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_08390 4267 4896 gene locus_tag LOCUS_08400 4267 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 6512 4899 gene locus_tag LOCUS_08410 6512 4899 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_08410 7533 6571 gene locus_tag LOCUS_08420 gene pfkA 7533 6571 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_08420 8387 7533 gene locus_tag LOCUS_08430 8387 7533 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_08430 9374 8418 gene locus_tag LOCUS_08440 9374 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10378 9530 gene locus_tag LOCUS_08450 10378 9530 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_08450 11231 10380 gene locus_tag LOCUS_08460 11231 10380 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_08460 13359 11461 gene locus_tag LOCUS_08470 13359 11461 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_08470 13521 13928 gene locus_tag LOCUS_08480 13521 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 13925 14401 gene locus_tag LOCUS_08490 13925 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 14633 15937 gene locus_tag LOCUS_08500 14633 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 15945 17249 gene locus_tag LOCUS_08510 15945 17249 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_08510 17262 18125 gene locus_tag LOCUS_08520 17262 18125 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794809.1 protein_id gnl|my_center|LOCUS_08520 <19381 18386 gene locus_tag LOCUS_08530 <19381 18386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962759.1:cysteine--tRNA ligase >Feature sequence031 909 439 gene locus_tag LOCUS_08540 gene accB 909 439 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_08540 2168 948 gene locus_tag LOCUS_08550 2168 948 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_08550 2620 2168 gene locus_tag LOCUS_08560 gene dtd 2620 2168 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_08560 2787 4985 gene locus_tag LOCUS_08570 2787 4985 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_08570 4992 5894 gene locus_tag LOCUS_08580 4992 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 5904 7061 gene locus_tag LOCUS_08590 5904 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7153 8718 gene locus_tag LOCUS_08600 7153 8718 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_08600 9834 8722 gene locus_tag LOCUS_08610 9834 8722 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_08610 10932 9874 gene locus_tag LOCUS_08620 10932 9874 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_08620 11088 12122 gene locus_tag LOCUS_08630 gene thiL 11088 12122 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_08630 12156 13265 gene locus_tag LOCUS_08640 12156 13265 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_08640 13296 13757 gene locus_tag LOCUS_08650 13296 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 13764 14177 gene locus_tag LOCUS_08660 13764 14177 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_08660 14767 14174 gene locus_tag LOCUS_08670 14767 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 16139 14757 gene locus_tag LOCUS_08680 16139 14757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 17013 16189 gene locus_tag LOCUS_08690 17013 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 17602 17036 gene locus_tag LOCUS_08700 gene pth 17602 17036 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_08700 19224 17737 gene locus_tag LOCUS_08710 gene guaB 19224 17737 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence032 967 299 gene locus_tag LOCUS_08720 967 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1614 973 gene locus_tag LOCUS_08730 gene folE 1614 973 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_08730 2274 1618 gene locus_tag LOCUS_08740 2274 1618 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402683.1 protein_id gnl|my_center|LOCUS_08740 2689 2309 gene locus_tag LOCUS_08750 2689 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2941 5523 gene locus_tag LOCUS_08760 2941 5523 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_08760 6453 5548 gene locus_tag LOCUS_08770 gene hemF 6453 5548 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_08770 7954 6554 gene locus_tag LOCUS_08780 gene fumC 7954 6554 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_08780 8663 8061 gene locus_tag LOCUS_08790 8663 8061 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_08790 8782 10008 gene locus_tag LOCUS_08800 8782 10008 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_08800 10182 10697 gene locus_tag LOCUS_08810 10182 10697 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_08810 10714 11817 gene locus_tag LOCUS_08820 10714 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 11822 12481 gene locus_tag LOCUS_08830 11822 12481 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_08830 12493 13992 gene locus_tag LOCUS_08840 gene glpK 12493 13992 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_08840 14101 14298 gene locus_tag LOCUS_08850 14101 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 14420 14614 gene locus_tag LOCUS_08860 14420 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 14745 17111 gene locus_tag LOCUS_08870 14745 17111 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_08870 <19213 17120 gene locus_tag LOCUS_08880 <19213 17120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703586.1:enterotoxin >Feature sequence033 944 1945 gene locus_tag LOCUS_08890 944 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2063 3748 gene locus_tag LOCUS_08900 2063 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6906 4012 gene locus_tag LOCUS_08910 6906 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 8190 7090 gene locus_tag LOCUS_08920 8190 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 9169 8129 gene locus_tag LOCUS_08930 9169 8129 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 protein_id gnl|my_center|LOCUS_08930 9517 10437 gene locus_tag LOCUS_08940 9517 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 10509 10859 gene locus_tag LOCUS_08950 gene panD 10509 10859 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490184.1 protein_id gnl|my_center|LOCUS_08950 10955 11899 gene locus_tag LOCUS_08960 10955 11899 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_08960 11883 12341 gene locus_tag LOCUS_08970 11883 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 12893 12342 gene locus_tag LOCUS_08980 12893 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 13427 12894 gene locus_tag LOCUS_08990 13427 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 13630 13701 gene locus_tag LOCUS_t00180 13630 13701 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13861 18234 gene locus_tag LOCUS_09000 13861 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 <18784 18236 gene locus_tag LOCUS_09010 <18784 18236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767893.1:nucleotidyltransferase family protein >Feature sequence034 520 915 gene locus_tag LOCUS_09020 520 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1078 2127 gene locus_tag LOCUS_09030 1078 2127 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_09030 2151 5390 gene locus_tag LOCUS_09040 2151 5390 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_09040 5486 6925 gene locus_tag LOCUS_09050 5486 6925 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_09050 7022 7678 gene locus_tag LOCUS_09060 7022 7678 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_09060 7662 8972 gene locus_tag LOCUS_09070 7662 8972 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_09070 8983 10086 gene locus_tag LOCUS_09080 8983 10086 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_09080 10108 11688 gene locus_tag LOCUS_09090 10108 11688 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_09090 11939 14521 gene locus_tag LOCUS_09100 gene gyrA 11939 14521 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_09100 14523 15818 gene locus_tag LOCUS_09110 14523 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 17049 15934 gene locus_tag LOCUS_09120 17049 15934 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence035 1927 923 gene locus_tag LOCUS_09130 1927 923 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_09130 1969 2730 gene locus_tag LOCUS_09140 1969 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2727 3020 gene locus_tag LOCUS_09150 2727 3020 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_09150 4523 3015 gene locus_tag LOCUS_09160 4523 3015 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_09160 5589 4582 gene locus_tag LOCUS_09170 5589 4582 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_09170 5823 7028 gene locus_tag LOCUS_09180 gene megL 5823 7028 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_09180 7884 7060 gene locus_tag LOCUS_09190 7884 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 10118 7995 gene locus_tag LOCUS_09200 10118 7995 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_09200 11734 10322 gene locus_tag LOCUS_09210 11734 10322 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728400.1 protein_id gnl|my_center|LOCUS_09210 12004 12861 gene locus_tag LOCUS_09220 gene hisG 12004 12861 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_09220 12872 14167 gene locus_tag LOCUS_09230 gene hisD 12872 14167 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_09230 14145 15251 gene locus_tag LOCUS_09240 gene hisC 14145 15251 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_09240 15348 16610 gene locus_tag LOCUS_09250 gene metK 15348 16610 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_09250 16681 16872 gene locus_tag LOCUS_09260 gene rpsU 16681 16872 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_09260 16931 17842 gene locus_tag LOCUS_09270 gene xerC 16931 17842 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_09270 17869 18168 gene locus_tag LOCUS_09280 gene raiA 17869 18168 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence036 1312 53 gene locus_tag LOCUS_09290 1312 53 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963440.1 protein_id gnl|my_center|LOCUS_09290 2277 1402 gene locus_tag LOCUS_09300 2277 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2476 2267 gene locus_tag LOCUS_09310 2476 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3368 2538 gene locus_tag LOCUS_09320 3368 2538 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_09320 3959 3393 gene locus_tag LOCUS_09330 3959 3393 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_09330 4616 3981 gene locus_tag LOCUS_09340 4616 3981 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763544.1 protein_id gnl|my_center|LOCUS_09340 5428 4640 gene locus_tag LOCUS_09350 5428 4640 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763543.1 protein_id gnl|my_center|LOCUS_09350 5576 6280 gene locus_tag LOCUS_09360 5576 6280 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172947.1 protein_id gnl|my_center|LOCUS_09360 7166 7005 gene locus_tag LOCUS_09370 gene rpmH 7166 7005 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_09370 7656 7267 gene locus_tag LOCUS_09380 7656 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 7719 9257 gene locus_tag LOCUS_09390 gene gpmI 7719 9257 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_09390 9288 9848 gene locus_tag LOCUS_09400 9288 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 9871 11217 gene locus_tag LOCUS_09410 9871 11217 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870580.1 protein_id gnl|my_center|LOCUS_09410 12817 11327 gene locus_tag LOCUS_09420 12817 11327 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_09420 13686 12943 gene locus_tag LOCUS_09430 13686 12943 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_09430 15485 13767 gene locus_tag LOCUS_09440 15485 13767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 16896 15475 gene locus_tag LOCUS_09450 16896 15475 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766006.1 protein_id gnl|my_center|LOCUS_09450 17107 18114 gene locus_tag LOCUS_09460 gene recA 17107 18114 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence037 773 3337 gene locus_tag LOCUS_09470 773 3337 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_09470 3362 4705 gene locus_tag LOCUS_09480 3362 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4860 6191 gene locus_tag LOCUS_09490 4860 6191 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732325.1 protein_id gnl|my_center|LOCUS_09490 6351 6272 gene locus_tag LOCUS_t00190 6351 6272 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7836 6478 gene locus_tag LOCUS_09500 gene rseP 7836 6478 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_09500 10014 8080 gene locus_tag LOCUS_09510 gene dnaG 10014 8080 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_09510 11113 10088 gene locus_tag LOCUS_09520 11113 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 13246 11288 gene locus_tag LOCUS_09530 13246 11288 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_09530 14044 13340 gene locus_tag LOCUS_09540 gene purQ 14044 13340 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_09540 15288 14203 gene locus_tag LOCUS_09550 15288 14203 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_09550 15864 15289 gene locus_tag LOCUS_09560 15864 15289 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_09560 16820 15882 gene locus_tag LOCUS_09570 16820 15882 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_09570 17675 16824 gene locus_tag LOCUS_09580 17675 16824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence038 389 463 gene locus_tag LOCUS_t00200 389 463 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3175 503 gene locus_tag LOCUS_09590 3175 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09590 4220 3222 gene locus_tag LOCUS_09600 4220 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4833 6650 gene locus_tag LOCUS_09610 4833 6650 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_09610 6658 7920 gene locus_tag LOCUS_09620 6658 7920 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_09620 7936 8376 gene locus_tag LOCUS_09630 7936 8376 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_09630 8556 8392 gene locus_tag LOCUS_09640 8556 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09640 8748 8620 gene locus_tag LOCUS_09650 8748 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9305 10396 gene locus_tag LOCUS_09660 9305 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 10424 11719 gene locus_tag LOCUS_09670 10424 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 11727 12371 gene locus_tag LOCUS_09680 11727 12371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 12384 13298 gene locus_tag LOCUS_09690 12384 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 13310 13651 gene locus_tag LOCUS_09700 13310 13651 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249910.1 protein_id gnl|my_center|LOCUS_09700 13677 14459 gene locus_tag LOCUS_09710 13677 14459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 14622 15263 gene locus_tag LOCUS_09720 14622 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 15402 16022 gene locus_tag LOCUS_09730 15402 16022 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765089.1 protein_id gnl|my_center|LOCUS_09730 16149 17909 gene locus_tag LOCUS_09740 16149 17909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence039 802 981 gene locus_tag LOCUS_09750 802 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3495 3325 gene locus_tag LOCUS_09760 3495 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 11492 11310 gene locus_tag LOCUS_09770 11492 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 12096 11914 gene locus_tag LOCUS_09780 12096 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 13170 12853 gene locus_tag LOCUS_09790 13170 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 14428 14775 gene locus_tag LOCUS_09800 14428 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 15709 15524 gene locus_tag LOCUS_09810 15709 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 16054 15737 gene locus_tag LOCUS_09820 16054 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 16918 16571 gene locus_tag LOCUS_09830 16918 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence040 87 980 gene locus_tag LOCUS_09840 87 980 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_09840 1086 3575 gene locus_tag LOCUS_09850 1086 3575 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_09850 5163 3841 gene locus_tag LOCUS_09860 gene ahcY 5163 3841 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_09860 8189 5274 gene locus_tag LOCUS_09870 8189 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 9516 8329 gene locus_tag LOCUS_09880 9516 8329 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_09880 9539 9901 gene locus_tag LOCUS_09890 gene folB 9539 9901 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_09890 9963 10036 gene locus_tag LOCUS_t00210 9963 10036 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 12538 10106 gene locus_tag LOCUS_09900 12538 10106 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_09900 12713 13135 gene locus_tag LOCUS_09910 12713 13135 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_09910 13217 14422 gene locus_tag LOCUS_09920 13217 14422 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_09920 15184 14423 gene locus_tag LOCUS_09930 15184 14423 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_09930 15495 15217 gene locus_tag LOCUS_09940 15495 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 15857 16591 gene locus_tag LOCUS_09950 15857 16591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 16616 17623 gene locus_tag LOCUS_09960 16616 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence041 <1 538 gene locus_tag LOCUS_09970 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203525.1:single-stranded-DNA-specific exonuclease RecJ 542 1270 gene locus_tag LOCUS_09980 gene lptB 542 1270 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_09980 2504 1329 gene locus_tag LOCUS_09990 2504 1329 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_09990 4133 2634 gene locus_tag LOCUS_10000 gene gltX 4133 2634 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964585.1 protein_id gnl|my_center|LOCUS_10000 4282 5397 gene locus_tag LOCUS_10010 4282 5397 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_10010 7015 5450 gene locus_tag LOCUS_10020 7015 5450 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071266.1 protein_id gnl|my_center|LOCUS_10020 7632 7048 gene locus_tag LOCUS_10030 7632 7048 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_10030 8333 7641 gene locus_tag LOCUS_10040 8333 7641 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_10040 8728 8333 gene locus_tag LOCUS_10050 8728 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 9397 8732 gene locus_tag LOCUS_10060 9397 8732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 10589 9411 gene locus_tag LOCUS_10070 10589 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_10070 11406 10801 gene locus_tag LOCUS_10080 11406 10801 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_10080 13113 11413 gene locus_tag LOCUS_10090 13113 11413 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868765.1 protein_id gnl|my_center|LOCUS_10090 13931 13143 gene locus_tag LOCUS_10100 13931 13143 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_10100 14074 14739 gene locus_tag LOCUS_10110 14074 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 14739 16136 gene locus_tag LOCUS_10120 14739 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 16188 16532 gene locus_tag LOCUS_10130 16188 16532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence042 <1 504 gene locus_tag LOCUS_10140 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837305.1:site-specific DNA-methyltransferase 793 1830 gene locus_tag LOCUS_10150 793 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1943 2362 gene locus_tag LOCUS_10160 1943 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2359 3273 gene locus_tag LOCUS_10170 2359 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10170 3535 4443 gene locus_tag LOCUS_10180 3535 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7094 5292 gene locus_tag LOCUS_10190 7094 5292 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_10190 7183 8061 gene locus_tag LOCUS_10200 gene rfbD 7183 8061 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_10200 8074 9288 gene locus_tag LOCUS_10210 gene rocD 8074 9288 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_10210 9444 10052 gene locus_tag LOCUS_10220 9444 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 10053 10547 gene locus_tag LOCUS_10230 10053 10547 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_10230 10553 11089 gene locus_tag LOCUS_10240 10553 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 11091 11897 gene locus_tag LOCUS_10250 11091 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 13400 11946 gene locus_tag LOCUS_10260 13400 11946 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_10260 13937 13593 gene locus_tag LOCUS_10270 gene rplT 13937 13593 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_10270 14215 14018 gene locus_tag LOCUS_10280 gene rpmI 14215 14018 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_10280 15568 14333 gene locus_tag LOCUS_10290 15568 14333 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence043 3 5135 gene locus_tag LOCUS_10300 3 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 5141 5797 gene locus_tag LOCUS_10310 gene mnmD 5141 5797 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_10310 5935 7224 gene locus_tag LOCUS_10320 5935 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8542 7238 gene locus_tag LOCUS_10330 gene ffh 8542 7238 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_10330 8940 8614 gene locus_tag LOCUS_10340 8940 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 9149 8940 gene locus_tag LOCUS_10350 9149 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 11742 9127 gene locus_tag LOCUS_10360 11742 9127 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_10360 11889 13121 gene locus_tag LOCUS_10370 11889 13121 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_10370 13154 14194 gene locus_tag LOCUS_10380 13154 14194 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840178.1 protein_id gnl|my_center|LOCUS_10380 14234 15895 gene locus_tag LOCUS_10390 14234 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 16067 16717 gene locus_tag LOCUS_10400 16067 16717 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence044 <1 508 gene locus_tag LOCUS_10410 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962185.1:class I SAM-dependent methyltransferase 869 687 gene locus_tag LOCUS_10420 869 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1409 918 gene locus_tag LOCUS_10430 1409 918 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_10430 1533 3317 gene locus_tag LOCUS_10440 gene uvrC 1533 3317 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_10440 3788 3462 gene locus_tag LOCUS_10450 3788 3462 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_10450 4322 3837 gene locus_tag LOCUS_10460 gene purE 4322 3837 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_10460 4898 4326 gene locus_tag LOCUS_10470 4898 4326 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_10470 6750 5038 gene locus_tag LOCUS_10480 6750 5038 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_10480 7169 6762 gene locus_tag LOCUS_10490 7169 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 8326 7253 gene locus_tag LOCUS_10500 gene prfA 8326 7253 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_10500 8440 8946 gene locus_tag LOCUS_10510 8440 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 9052 9651 gene locus_tag LOCUS_10520 9052 9651 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_10520 9675 10823 gene locus_tag LOCUS_10530 gene dnaJ 9675 10823 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405069.1 protein_id gnl|my_center|LOCUS_10530 11579 10830 gene locus_tag LOCUS_10540 11579 10830 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_10540 12335 11613 gene locus_tag LOCUS_10550 12335 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 13153 12398 gene locus_tag LOCUS_10560 13153 12398 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_10560 13665 13195 gene locus_tag LOCUS_10570 13665 13195 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_10570 13778 14362 gene locus_tag LOCUS_10580 gene gmk 13778 14362 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_10580 14391 15425 gene locus_tag LOCUS_10590 gene proB 14391 15425 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836904.1 protein_id gnl|my_center|LOCUS_10590 16699 15452 gene locus_tag LOCUS_10600 16699 15452 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528855.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence045 1017 1583 gene locus_tag LOCUS_10610 1017 1583 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_10610 1593 2105 gene locus_tag LOCUS_10620 1593 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2121 2537 gene locus_tag LOCUS_10630 gene aroQ 2121 2537 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_10630 2544 2945 gene locus_tag LOCUS_10640 2544 2945 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_10640 3034 3510 gene locus_tag LOCUS_10650 3034 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4198 3527 gene locus_tag LOCUS_10660 4198 3527 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_10660 4725 4255 gene locus_tag LOCUS_10670 4725 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5147 4725 gene locus_tag LOCUS_10680 5147 4725 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206600.1 protein_id gnl|my_center|LOCUS_10680 5271 5759 gene locus_tag LOCUS_10690 gene rraA 5271 5759 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_10690 7781 5760 gene locus_tag LOCUS_10700 7781 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 7900 8790 gene locus_tag LOCUS_10710 7900 8790 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_10710 8852 9682 gene locus_tag LOCUS_10720 8852 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 11084 9831 gene locus_tag LOCUS_10730 11084 9831 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_10730 11598 11086 gene locus_tag LOCUS_10740 11598 11086 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_10740 11673 11749 gene locus_tag LOCUS_t00220 11673 11749 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11763 12644 gene locus_tag LOCUS_10750 11763 12644 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_10750 12634 13224 gene locus_tag LOCUS_10760 12634 13224 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_10760 13620 13228 gene locus_tag LOCUS_10770 13620 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 13739 15484 gene locus_tag LOCUS_10780 13739 15484 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204480.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence046 871 500 gene locus_tag LOCUS_10790 871 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10790 1962 1159 gene locus_tag LOCUS_10800 gene proC 1962 1159 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804294.1 protein_id gnl|my_center|LOCUS_10800 2813 1959 gene locus_tag LOCUS_10810 gene panC 2813 1959 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_10810 2902 3711 gene locus_tag LOCUS_10820 2902 3711 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_10820 3717 5084 gene locus_tag LOCUS_10830 3717 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5096 6943 gene locus_tag LOCUS_10840 gene glmS 5096 6943 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_10840 7124 11443 gene locus_tag LOCUS_10850 gene rpoC 7124 11443 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963311.1 protein_id gnl|my_center|LOCUS_10850 11509 11811 gene locus_tag LOCUS_10860 11509 11811 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_10860 11893 14841 gene locus_tag LOCUS_10870 11893 14841 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence047 2475 205 gene locus_tag LOCUS_10880 2475 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4093 2462 gene locus_tag LOCUS_10890 4093 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5850 4588 gene locus_tag LOCUS_10900 5850 4588 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 protein_id gnl|my_center|LOCUS_10900 6023 7651 gene locus_tag LOCUS_10910 6023 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 8847 7660 gene locus_tag LOCUS_10920 8847 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 9487 8927 gene locus_tag LOCUS_10930 9487 8927 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_10930 9697 9624 gene locus_tag LOCUS_t00230 9697 9624 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9874 10446 gene locus_tag LOCUS_10940 9874 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 11164 10451 gene locus_tag LOCUS_10950 11164 10451 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_10950 11264 13027 gene locus_tag LOCUS_10960 gene argS 11264 13027 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_10960 13069 14016 gene locus_tag LOCUS_10970 13069 14016 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_10970 14047 14949 gene locus_tag LOCUS_10980 14047 14949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_10980 14946 16247 gene locus_tag LOCUS_10990 14946 16247 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence048 347 811 gene locus_tag LOCUS_11000 347 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 826 1317 gene locus_tag LOCUS_11010 826 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1384 2370 gene locus_tag LOCUS_11020 1384 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2460 2816 gene locus_tag LOCUS_11030 2460 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4587 2818 gene locus_tag LOCUS_11040 4587 2818 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_11040 5425 4634 gene locus_tag LOCUS_11050 5425 4634 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_11050 6786 5440 gene locus_tag LOCUS_11060 gene tilS 6786 5440 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_11060 7764 6787 gene locus_tag LOCUS_11070 gene lpxD 7764 6787 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_11070 7839 8267 gene locus_tag LOCUS_11080 7839 8267 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_11080 9019 8330 gene locus_tag LOCUS_11090 9019 8330 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_11090 9585 9025 gene locus_tag LOCUS_11100 9585 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 10152 9667 gene locus_tag LOCUS_11110 10152 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_11110 10947 10186 gene locus_tag LOCUS_11120 10947 10186 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_11120 12245 11013 gene locus_tag LOCUS_11130 gene lysA 12245 11013 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_11130 12693 12322 gene locus_tag LOCUS_11140 12693 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 14328 12784 gene locus_tag LOCUS_11150 14328 12784 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 protein_id gnl|my_center|LOCUS_11150 15130 14339 gene locus_tag LOCUS_11160 15130 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence049 4863 52 gene locus_tag LOCUS_11170 4863 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5647 4868 gene locus_tag LOCUS_11180 5647 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6294 5644 gene locus_tag LOCUS_11190 6294 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7070 6291 gene locus_tag LOCUS_11200 7070 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 9860 7098 gene locus_tag LOCUS_11210 9860 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 10812 9862 gene locus_tag LOCUS_11220 10812 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 12457 10880 gene locus_tag LOCUS_11230 12457 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 13497 12490 gene locus_tag LOCUS_11240 13497 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 14503 13559 gene locus_tag LOCUS_11250 14503 13559 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869866.1 protein_id gnl|my_center|LOCUS_11250 14819 15040 gene locus_tag LOCUS_11260 14819 15040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence050 60 1472 gene locus_tag LOCUS_11270 gene ccoG 60 1472 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_11270 1480 1926 gene locus_tag LOCUS_11280 1480 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1926 2645 gene locus_tag LOCUS_11290 1926 2645 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_11290 2690 3562 gene locus_tag LOCUS_11300 2690 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4287 3559 gene locus_tag LOCUS_11310 4287 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4443 5516 gene locus_tag LOCUS_11320 gene serC 4443 5516 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_11320 5559 6158 gene locus_tag LOCUS_11330 5559 6158 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816248.1 protein_id gnl|my_center|LOCUS_11330 6161 7417 gene locus_tag LOCUS_11340 gene bioA 6161 7417 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_11340 9367 7625 gene locus_tag LOCUS_11350 9367 7625 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853121.1 protein_id gnl|my_center|LOCUS_11350 9905 9573 gene locus_tag LOCUS_11360 9905 9573 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_11360 10248 9889 gene locus_tag LOCUS_11370 10248 9889 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_11370 11266 10502 gene locus_tag LOCUS_11380 11266 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 12249 11449 gene locus_tag LOCUS_11390 12249 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13194 12415 gene locus_tag LOCUS_11400 13194 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 13330 13160 gene locus_tag LOCUS_11410 13330 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 14353 13346 gene locus_tag LOCUS_11420 14353 13346 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964247.1 protein_id gnl|my_center|LOCUS_11420 15236 14340 gene locus_tag LOCUS_11430 15236 14340 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964246.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence051 1131 211 gene locus_tag LOCUS_11440 1131 211 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_11440 1674 1132 gene locus_tag LOCUS_11450 gene pyrR 1674 1132 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_11450 1751 2161 gene locus_tag LOCUS_11460 1751 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2270 3850 gene locus_tag LOCUS_11470 2270 3850 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_11470 3911 4699 gene locus_tag LOCUS_11480 3911 4699 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_11480 5497 4706 gene locus_tag LOCUS_11490 5497 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6273 5494 gene locus_tag LOCUS_11500 6273 5494 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_11500 6405 6977 gene locus_tag LOCUS_11510 6405 6977 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764107.1 protein_id gnl|my_center|LOCUS_11510 6999 7190 gene locus_tag LOCUS_11520 gene rpmF 6999 7190 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_11520 7230 7793 gene locus_tag LOCUS_11530 gene efp 7230 7793 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_11530 7918 8904 gene locus_tag LOCUS_11540 7918 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 8916 9314 gene locus_tag LOCUS_11550 8916 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 10523 9528 gene locus_tag LOCUS_11560 10523 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 11843 10524 gene locus_tag LOCUS_11570 gene mtaB 11843 10524 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_11570 11930 12880 gene locus_tag LOCUS_11580 11930 12880 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583191.1 protein_id gnl|my_center|LOCUS_11580 13480 12869 gene locus_tag LOCUS_11590 13480 12869 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_11590 15162 13564 gene locus_tag LOCUS_11600 15162 13564 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence052 722 1729 gene locus_tag LOCUS_11610 722 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1916 3277 gene locus_tag LOCUS_11620 1916 3277 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_11620 3277 4356 gene locus_tag LOCUS_11630 3277 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 6514 4394 gene locus_tag LOCUS_11640 6514 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 9059 6570 gene locus_tag LOCUS_11650 9059 6570 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_11650 9033 9764 gene locus_tag LOCUS_11660 9033 9764 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_11660 10080 9865 gene locus_tag LOCUS_11670 10080 9865 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_11670 10405 10103 gene locus_tag LOCUS_11680 10405 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 13634 10425 gene locus_tag LOCUS_11690 13634 10425 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_11690 14794 13694 gene locus_tag LOCUS_11700 14794 13694 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_11700 <15368 14815 gene locus_tag LOCUS_11710 <15368 14815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963918.1:TolC family protein >Feature sequence053 1364 867 gene locus_tag LOCUS_11720 1364 867 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_11720 2438 1377 gene locus_tag LOCUS_11730 2438 1377 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868767.1 protein_id gnl|my_center|LOCUS_11730 3588 2440 gene locus_tag LOCUS_11740 3588 2440 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_11740 4161 3601 gene locus_tag LOCUS_11750 4161 3601 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_11750 4259 5113 gene locus_tag LOCUS_11760 gene folP 4259 5113 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_11760 5202 5519 gene locus_tag LOCUS_11770 5202 5519 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_11770 5597 6178 gene locus_tag LOCUS_11780 5597 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6179 6391 gene locus_tag LOCUS_11790 6179 6391 CDS product DUF6132 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788321.1 protein_id gnl|my_center|LOCUS_11790 6453 7247 gene locus_tag LOCUS_11800 6453 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 7660 7244 gene locus_tag LOCUS_11810 7660 7244 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962451.1 protein_id gnl|my_center|LOCUS_11810 7780 8856 gene locus_tag LOCUS_11820 7780 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 10273 8939 gene locus_tag LOCUS_11830 gene purD 10273 8939 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_11830 11291 10275 gene locus_tag LOCUS_11840 11291 10275 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_11840 12271 11297 gene locus_tag LOCUS_11850 12271 11297 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_11850 12437 13084 gene locus_tag LOCUS_11860 12437 13084 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_11860 13160 13987 gene locus_tag LOCUS_11870 13160 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 14735 13989 gene locus_tag LOCUS_11880 14735 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence054 <1 536 gene locus_tag LOCUS_11890 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964327.1:endonuclease 2437 545 gene locus_tag LOCUS_11900 2437 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3111 2452 gene locus_tag LOCUS_11910 3111 2452 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364322.1 protein_id gnl|my_center|LOCUS_11910 4106 3117 gene locus_tag LOCUS_11920 4106 3117 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_11920 4970 4134 gene locus_tag LOCUS_11930 4970 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 5289 6143 gene locus_tag LOCUS_11940 gene nadC 5289 6143 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_11940 6162 6542 gene locus_tag LOCUS_11950 6162 6542 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_11950 6645 8696 gene locus_tag LOCUS_11960 gene scpA 6645 8696 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_11960 8720 10480 gene locus_tag LOCUS_11970 8720 10480 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_11970 10487 12250 gene locus_tag LOCUS_11980 10487 12250 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_11980 12850 12257 gene locus_tag LOCUS_11990 12850 12257 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796757.1 protein_id gnl|my_center|LOCUS_11990 13878 12871 gene locus_tag LOCUS_12000 13878 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence055 461 535 gene locus_tag LOCUS_t00240 461 535 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 551 625 gene locus_tag LOCUS_t00250 551 625 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 704 3563 gene locus_tag LOCUS_r00010 704 3563 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3617 3719 gene locus_tag LOCUS_r00020 3617 3719 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4493 3873 gene locus_tag LOCUS_12010 4493 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 6769 4601 gene locus_tag LOCUS_12020 6769 4601 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_12020 7082 7483 gene locus_tag LOCUS_12030 7082 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7580 10510 gene locus_tag LOCUS_12040 7580 10510 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_12040 11753 10539 gene locus_tag LOCUS_12050 11753 10539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 12357 11755 gene locus_tag LOCUS_12060 12357 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 12979 12479 gene locus_tag LOCUS_12070 gene azu 12979 12479 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071104.1 protein_id gnl|my_center|LOCUS_12070 13735 13013 gene locus_tag LOCUS_12080 gene ric 13735 13013 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_12080 14161 13763 gene locus_tag LOCUS_12090 14161 13763 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 protein_id gnl|my_center|LOCUS_12090 14458 14228 gene locus_tag LOCUS_12100 14458 14228 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143643.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence056 1601 1203 gene locus_tag LOCUS_12110 1601 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 3211 1613 gene locus_tag LOCUS_12120 3211 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3941 3414 gene locus_tag LOCUS_12130 3941 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 4408 4085 gene locus_tag LOCUS_12140 4408 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4743 4411 gene locus_tag LOCUS_12150 4743 4411 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282554.1 protein_id gnl|my_center|LOCUS_12150 5017 4805 gene locus_tag LOCUS_12160 5017 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5970 5269 gene locus_tag LOCUS_12170 5970 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7552 6017 gene locus_tag LOCUS_12180 7552 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8797 7946 gene locus_tag LOCUS_12190 8797 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 12483 8797 gene locus_tag LOCUS_12200 12483 8797 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203140.1 protein_id gnl|my_center|LOCUS_12200 13039 12467 gene locus_tag LOCUS_12210 13039 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788879.1 protein_id gnl|my_center|LOCUS_12210 14240 13044 gene locus_tag LOCUS_12220 14240 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788880.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence057 113 544 gene locus_tag LOCUS_12230 113 544 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240402.1 protein_id gnl|my_center|LOCUS_12230 1064 606 gene locus_tag LOCUS_12240 1064 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1219 1599 gene locus_tag LOCUS_12250 1219 1599 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_12250 1603 4026 gene locus_tag LOCUS_12260 gene ccsA 1603 4026 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_12260 4013 4819 gene locus_tag LOCUS_12270 4013 4819 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_12270 5197 4991 gene locus_tag LOCUS_12280 5197 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5792 5493 gene locus_tag LOCUS_12290 5792 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6022 5792 gene locus_tag LOCUS_12300 6022 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 6478 6146 gene locus_tag LOCUS_12310 6478 6146 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_12310 7706 6504 gene locus_tag LOCUS_12320 7706 6504 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_12320 7796 9346 gene locus_tag LOCUS_12330 7796 9346 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_12330 10198 9362 gene locus_tag LOCUS_12340 10198 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 10288 11436 gene locus_tag LOCUS_12350 10288 11436 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_12350 11630 11875 gene locus_tag LOCUS_12360 11630 11875 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_12360 11875 12279 gene locus_tag LOCUS_12370 11875 12279 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_12370 12472 14079 gene locus_tag LOCUS_12380 12472 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence058 987 313 gene locus_tag LOCUS_12390 gene ccsA 987 313 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_12390 1656 1000 gene locus_tag LOCUS_12400 1656 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1701 3116 gene locus_tag LOCUS_12410 gene accC 1701 3116 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_12410 3130 4089 gene locus_tag LOCUS_12420 3130 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 7547 4149 gene locus_tag LOCUS_12430 7547 4149 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964044.1 protein_id gnl|my_center|LOCUS_12430 7831 8046 gene locus_tag LOCUS_12440 7831 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 8043 8318 gene locus_tag LOCUS_12450 8043 8318 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676650.1 protein_id gnl|my_center|LOCUS_12450 8713 9243 gene locus_tag LOCUS_12460 8713 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 12087 9316 gene locus_tag LOCUS_12470 12087 9316 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_12470 12252 12656 gene locus_tag LOCUS_12480 12252 12656 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_12480 12724 13020 gene locus_tag LOCUS_12490 12724 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 13070 13576 gene locus_tag LOCUS_12500 13070 13576 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_12500 13614 14189 gene locus_tag LOCUS_12510 13614 14189 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence059 414 1856 gene locus_tag LOCUS_12520 gene miaB 414 1856 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_12520 2262 1858 gene locus_tag LOCUS_12530 2262 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4403 2259 gene locus_tag LOCUS_12540 gene ligA 4403 2259 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880378.1 protein_id gnl|my_center|LOCUS_12540 5706 4447 gene locus_tag LOCUS_12550 5706 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 8563 5993 gene locus_tag LOCUS_12560 8563 5993 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_12560 8877 9275 gene locus_tag LOCUS_12570 8877 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 9739 9272 gene locus_tag LOCUS_12580 gene rlmH 9739 9272 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_12580 9812 10276 gene locus_tag LOCUS_12590 9812 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 10288 11277 gene locus_tag LOCUS_12600 gene floA 10288 11277 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_12600 11282 11944 gene locus_tag LOCUS_12610 11282 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 11965 12525 gene locus_tag LOCUS_12620 11965 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 <14011 12528 gene locus_tag LOCUS_12630 <14011 12528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943387.1:monovalent cation:proton antiporter-2 (CPA2) family protein >Feature sequence060 <1 1702 gene locus_tag LOCUS_12640 <1 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941639.1:ATP-binding protein 1677 2261 gene locus_tag LOCUS_12650 1677 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2419 3990 gene locus_tag LOCUS_12660 2419 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 4008 4373 gene locus_tag LOCUS_12670 4008 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4511 5449 gene locus_tag LOCUS_12680 4511 5449 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962714.1 protein_id gnl|my_center|LOCUS_12680 5762 6847 gene locus_tag LOCUS_12690 5762 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 7869 6865 gene locus_tag LOCUS_12700 7869 6865 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047667.1 protein_id gnl|my_center|LOCUS_12700 8007 9092 gene locus_tag LOCUS_12710 8007 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12710 9139 10911 gene locus_tag LOCUS_12720 9139 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12720 12623 10953 gene locus_tag LOCUS_12730 12623 10953 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_12730 12842 12767 gene locus_tag LOCUS_t00260 12842 12767 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12938 12851 gene locus_tag LOCUS_t00270 12938 12851 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <14006 13068 gene locus_tag LOCUS_12740 <14006 13068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964332.1:translation elongation factor 4 >Feature sequence061 1917 871 gene locus_tag LOCUS_12750 gene rlmN 1917 871 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_12750 2665 1955 gene locus_tag LOCUS_12760 2665 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3105 2710 gene locus_tag LOCUS_12770 3105 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3227 3409 gene locus_tag LOCUS_12780 3227 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 3902 3411 gene locus_tag LOCUS_12790 3902 3411 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338413.1 protein_id gnl|my_center|LOCUS_12790 4379 3909 gene locus_tag LOCUS_12800 4379 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4476 4886 gene locus_tag LOCUS_12810 gene tsaE 4476 4886 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_12810 5386 6381 gene locus_tag LOCUS_12820 5386 6381 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 protein_id gnl|my_center|LOCUS_12820 7163 6738 gene locus_tag LOCUS_12830 gene ssb 7163 6738 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_12830 9979 7511 gene locus_tag LOCUS_12840 9979 7511 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_12840 11934 10078 gene locus_tag LOCUS_12850 gene htpG 11934 10078 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_12850 13591 12056 gene locus_tag LOCUS_12860 13591 12056 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence062 1517 312 gene locus_tag LOCUS_12870 1517 312 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966338.1 protein_id gnl|my_center|LOCUS_12870 3366 1510 gene locus_tag LOCUS_12880 3366 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4466 3417 gene locus_tag LOCUS_12890 gene lpxK 4466 3417 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_12890 5289 4522 gene locus_tag LOCUS_12900 5289 4522 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_12900 6385 5291 gene locus_tag LOCUS_12910 6385 5291 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963351.1 protein_id gnl|my_center|LOCUS_12910 6666 7406 gene locus_tag LOCUS_12920 6666 7406 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_12920 7536 8594 gene locus_tag LOCUS_12930 gene desE 7536 8594 CDS product fatty acid desaturase DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399588.1 protein_id gnl|my_center|LOCUS_12930 10638 9097 gene locus_tag LOCUS_12940 10638 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 <13799 10682 gene locus_tag LOCUS_12950 <13799 10682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169313288.1:Calx-beta domain-containing protein >Feature sequence063 2678 558 gene locus_tag LOCUS_12960 gene metG 2678 558 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962236.1 protein_id gnl|my_center|LOCUS_12960 2889 4061 gene locus_tag LOCUS_12970 2889 4061 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_12970 4629 4078 gene locus_tag LOCUS_12980 4629 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4683 5720 gene locus_tag LOCUS_12990 4683 5720 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729232.1 protein_id gnl|my_center|LOCUS_12990 5730 6626 gene locus_tag LOCUS_13000 5730 6626 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_13000 6630 7130 gene locus_tag LOCUS_13010 6630 7130 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_13010 8223 7153 gene locus_tag LOCUS_13020 gene pdxA 8223 7153 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760044.1 protein_id gnl|my_center|LOCUS_13020 9655 8174 gene locus_tag LOCUS_13030 9655 8174 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932852.1 protein_id gnl|my_center|LOCUS_13030 9837 10997 gene locus_tag LOCUS_13040 9837 10997 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_13040 11007 11990 gene locus_tag LOCUS_13050 11007 11990 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_13050 11977 13017 gene locus_tag LOCUS_13060 11977 13017 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_13060 13019 13609 gene locus_tag LOCUS_13070 13019 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence064 1528 488 gene locus_tag LOCUS_13080 1528 488 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690326.1 protein_id gnl|my_center|LOCUS_13080 1851 1525 gene locus_tag LOCUS_13090 1851 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2145 5525 gene locus_tag LOCUS_13100 gene mfd 2145 5525 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_13100 6395 5529 gene locus_tag LOCUS_13110 6395 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 7738 6485 gene locus_tag LOCUS_13120 7738 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230324.1 protein_id gnl|my_center|LOCUS_13120 8184 7792 gene locus_tag LOCUS_13130 8184 7792 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_13130 8309 9589 gene locus_tag LOCUS_13140 8309 9589 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_13140 9611 9865 gene locus_tag LOCUS_13150 9611 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10429 9911 gene locus_tag LOCUS_13160 10429 9911 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112942.1 protein_id gnl|my_center|LOCUS_13160 10964 10446 gene locus_tag LOCUS_13170 10964 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 11525 11001 gene locus_tag LOCUS_13180 11525 11001 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_13180 11614 12177 gene locus_tag LOCUS_13190 11614 12177 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_13190 12181 12897 gene locus_tag LOCUS_13200 12181 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence065 160 615 gene locus_tag LOCUS_13210 160 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1251 640 gene locus_tag LOCUS_13220 1251 640 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_13220 3964 1331 gene locus_tag LOCUS_13230 3964 1331 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_13230 4169 6838 gene locus_tag LOCUS_13240 4169 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6907 7695 gene locus_tag LOCUS_13250 6907 7695 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_13250 7738 8853 gene locus_tag LOCUS_13260 7738 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 8906 9523 gene locus_tag LOCUS_13270 8906 9523 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_13270 10063 9518 gene locus_tag LOCUS_13280 10063 9518 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963538.1 protein_id gnl|my_center|LOCUS_13280 10280 11707 gene locus_tag LOCUS_13290 10280 11707 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence066 574 1560 gene locus_tag LOCUS_13300 574 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1629 2201 gene locus_tag LOCUS_13310 1629 2201 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_13310 2888 2205 gene locus_tag LOCUS_13320 2888 2205 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_13320 3370 2969 gene locus_tag LOCUS_13330 3370 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3546 5117 gene locus_tag LOCUS_13340 3546 5117 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_13340 6053 5118 gene locus_tag LOCUS_13350 6053 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6065 6988 gene locus_tag LOCUS_13360 6065 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6988 8796 gene locus_tag LOCUS_13370 6988 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8800 9945 gene locus_tag LOCUS_13380 8800 9945 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386588.1 protein_id gnl|my_center|LOCUS_13380 9999 11246 gene locus_tag LOCUS_13390 9999 11246 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083543.1 protein_id gnl|my_center|LOCUS_13390 11317 11547 gene locus_tag LOCUS_13400 11317 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence067 <1 516 gene locus_tag LOCUS_13410 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964521.1:membrane protein 534 1859 gene locus_tag LOCUS_13420 534 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2003 4318 gene locus_tag LOCUS_13430 2003 4318 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_13430 4524 5348 gene locus_tag LOCUS_13440 4524 5348 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_13440 5354 7750 gene locus_tag LOCUS_13450 5354 7750 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_13450 7757 8518 gene locus_tag LOCUS_13460 7757 8518 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_13460 8857 8507 gene locus_tag LOCUS_13470 8857 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 9547 8930 gene locus_tag LOCUS_13480 9547 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 9616 10431 gene locus_tag LOCUS_13490 9616 10431 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_13490 11524 10442 gene locus_tag LOCUS_13500 11524 10442 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence068 <1 1446 gene locus_tag LOCUS_13510 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963094.1:DEAD/DEAH box helicase family protein 1532 3022 gene locus_tag LOCUS_13520 1532 3022 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962400.1 protein_id gnl|my_center|LOCUS_13520 3054 3635 gene locus_tag LOCUS_13530 3054 3635 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_13530 3662 4114 gene locus_tag LOCUS_13540 3662 4114 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_13540 4118 4906 gene locus_tag LOCUS_13550 4118 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4989 6002 gene locus_tag LOCUS_13560 gene mltG 4989 6002 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_13560 6002 6406 gene locus_tag LOCUS_13570 6002 6406 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_13570 6530 6949 gene locus_tag LOCUS_13580 6530 6949 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_13580 8093 7059 gene locus_tag LOCUS_13590 8093 7059 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925592.1 protein_id gnl|my_center|LOCUS_13590 9030 8119 gene locus_tag LOCUS_13600 9030 8119 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_13600 9661 9404 gene locus_tag LOCUS_13610 9661 9404 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_13610 9917 9663 gene locus_tag LOCUS_13620 9917 9663 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_13620 10443 10117 gene locus_tag LOCUS_13630 10443 10117 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_13630 10793 10446 gene locus_tag LOCUS_13640 10793 10446 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_13640 11529 10885 gene locus_tag LOCUS_13650 11529 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 12229 11531 gene locus_tag LOCUS_13660 12229 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence069 1408 146 gene locus_tag LOCUS_13670 gene fabF 1408 146 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_13670 1676 1443 gene locus_tag LOCUS_13680 1676 1443 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_13680 2313 3176 gene locus_tag LOCUS_13690 2313 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3425 4183 gene locus_tag LOCUS_13700 3425 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4202 5077 gene locus_tag LOCUS_13710 4202 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5094 5774 gene locus_tag LOCUS_13720 5094 5774 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948310.1 protein_id gnl|my_center|LOCUS_13720 5925 5719 gene locus_tag LOCUS_13730 5925 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 7282 6182 gene locus_tag LOCUS_13740 gene ychF 7282 6182 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_13740 7542 8084 gene locus_tag LOCUS_13750 7542 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 8897 8253 gene locus_tag LOCUS_13760 gene trmB 8897 8253 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_13760 9036 9614 gene locus_tag LOCUS_13770 gene folE 9036 9614 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_13770 10667 9600 gene locus_tag LOCUS_13780 10667 9600 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_13780 11461 10667 gene locus_tag LOCUS_13790 gene argB 11461 10667 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_13790 <12168 11454 gene locus_tag LOCUS_13800 <12168 11454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403707.1:alpha/beta fold hydrolase >Feature sequence070 <1 695 gene locus_tag LOCUS_13810 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202237.1:insulinase family protein 887 2242 gene locus_tag LOCUS_13820 gene accC 887 2242 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_13820 2324 3991 gene locus_tag LOCUS_13830 2324 3991 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_13830 3991 4680 gene locus_tag LOCUS_13840 gene tsaB 3991 4680 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_13840 4793 5128 gene locus_tag LOCUS_13850 4793 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6043 5150 gene locus_tag LOCUS_13860 6043 5150 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_13860 6547 6059 gene locus_tag LOCUS_13870 6547 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 7452 6547 gene locus_tag LOCUS_13880 7452 6547 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_13880 7523 8143 gene locus_tag LOCUS_13890 gene udk 7523 8143 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883373.1 protein_id gnl|my_center|LOCUS_13890 9123 8140 gene locus_tag LOCUS_13900 9123 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 9311 9910 gene locus_tag LOCUS_13910 9311 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 9931 11025 gene locus_tag LOCUS_13920 9931 11025 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence071 1219 3438 gene locus_tag LOCUS_13930 gene purL 1219 3438 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_13930 4583 3435 gene locus_tag LOCUS_13940 4583 3435 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_13940 4696 5271 gene locus_tag LOCUS_13950 4696 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5932 5273 gene locus_tag LOCUS_13960 5932 5273 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_13960 6362 5925 gene locus_tag LOCUS_13970 6362 5925 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_13970 6488 8173 gene locus_tag LOCUS_13980 6488 8173 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113882.1 protein_id gnl|my_center|LOCUS_13980 8241 10391 gene locus_tag LOCUS_13990 8241 10391 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_13990 11467 10406 gene locus_tag LOCUS_14000 11467 10406 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence072 <1 668 gene locus_tag LOCUS_14010 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964480.1:Fe-S cluster assembly protein SufD 671 1225 gene locus_tag LOCUS_14020 671 1225 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386953.1 protein_id gnl|my_center|LOCUS_14020 1225 2442 gene locus_tag LOCUS_14030 1225 2442 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_14030 2449 2871 gene locus_tag LOCUS_14040 2449 2871 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_14040 2873 3205 gene locus_tag LOCUS_14050 2873 3205 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_14050 3270 3683 gene locus_tag LOCUS_14060 3270 3683 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_14060 3781 3972 gene locus_tag LOCUS_14070 3781 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4972 4124 gene locus_tag LOCUS_14080 4972 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5219 6064 gene locus_tag LOCUS_14090 5219 6064 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_14090 6084 7253 gene locus_tag LOCUS_14100 6084 7253 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962425.1 protein_id gnl|my_center|LOCUS_14100 7292 8134 gene locus_tag LOCUS_14110 7292 8134 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_14110 8141 8437 gene locus_tag LOCUS_14120 8141 8437 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810207.1 protein_id gnl|my_center|LOCUS_14120 8502 9593 gene locus_tag LOCUS_14130 8502 9593 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_14130 <11626 9671 gene locus_tag LOCUS_14140 <11626 9671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964459.1:TonB-dependent receptor >Feature sequence073 3449 1185 gene locus_tag LOCUS_14150 3449 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5578 3461 gene locus_tag LOCUS_14160 5578 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5847 5575 gene locus_tag LOCUS_14170 5847 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 6385 5837 gene locus_tag LOCUS_14180 6385 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6941 6474 gene locus_tag LOCUS_14190 6941 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence074 1664 3427 gene locus_tag LOCUS_14200 1664 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3424 5172 gene locus_tag LOCUS_14210 3424 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5251 6585 gene locus_tag LOCUS_14220 gene purB 5251 6585 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_14220 6766 7647 gene locus_tag LOCUS_14230 6766 7647 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_14230 9013 7715 gene locus_tag LOCUS_14240 9013 7715 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_14240 9341 10063 gene locus_tag LOCUS_14250 9341 10063 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence075 1416 1147 gene locus_tag LOCUS_14260 1416 1147 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588503.1 protein_id gnl|my_center|LOCUS_14260 1637 1413 gene locus_tag LOCUS_14270 1637 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3138 1921 gene locus_tag LOCUS_14280 3138 1921 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928505.1 protein_id gnl|my_center|LOCUS_14280 4404 3208 gene locus_tag LOCUS_14290 gene trpB 4404 3208 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_14290 5359 4493 gene locus_tag LOCUS_14300 5359 4493 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_14300 8600 5457 gene locus_tag LOCUS_14310 gene secDF 8600 5457 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_14310 10047 8752 gene locus_tag LOCUS_14320 10047 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 <11287 10079 gene locus_tag LOCUS_14330 <11287 10079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_124903406.1:glutamine-hydrolyzing GMP synthase >Feature sequence076 1147 539 gene locus_tag LOCUS_14340 1147 539 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_14340 1572 1222 gene locus_tag LOCUS_14350 gene rplS 1572 1222 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_14350 2326 1637 gene locus_tag LOCUS_14360 gene trmD 2326 1637 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_14360 2829 2323 gene locus_tag LOCUS_14370 2829 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3386 2889 gene locus_tag LOCUS_14380 3386 2889 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763025.1 protein_id gnl|my_center|LOCUS_14380 5124 3526 gene locus_tag LOCUS_14390 gene aceB 5124 3526 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107325.1 protein_id gnl|my_center|LOCUS_14390 6385 5264 gene locus_tag LOCUS_14400 6385 5264 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_14400 6575 7366 gene locus_tag LOCUS_14410 6575 7366 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_14410 7372 7701 gene locus_tag LOCUS_14420 7372 7701 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 protein_id gnl|my_center|LOCUS_14420 8493 7735 gene locus_tag LOCUS_14430 8493 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 9709 8633 gene locus_tag LOCUS_14440 9709 8633 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_14440 10127 10921 gene locus_tag LOCUS_14450 10127 10921 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence077 1281 904 gene locus_tag LOCUS_14460 1281 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1971 1564 gene locus_tag LOCUS_14470 1971 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2782 2279 gene locus_tag LOCUS_14480 2782 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 4411 3644 gene locus_tag LOCUS_14490 4411 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 5148 4702 gene locus_tag LOCUS_14500 5148 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 7444 5723 gene locus_tag LOCUS_14510 7444 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8944 7958 gene locus_tag LOCUS_14520 8944 7958 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_14520 10400 8946 gene locus_tag LOCUS_14530 10400 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence078 931 1013 gene locus_tag LOCUS_t00280 931 1013 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1092 2450 gene locus_tag LOCUS_14540 gene tig 1092 2450 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_14540 2457 3134 gene locus_tag LOCUS_14550 gene clpP 2457 3134 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_14550 3213 4454 gene locus_tag LOCUS_14560 gene clpX 3213 4454 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964183.1 protein_id gnl|my_center|LOCUS_14560 4800 4462 gene locus_tag LOCUS_14570 4800 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 4850 5623 gene locus_tag LOCUS_14580 4850 5623 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_14580 6074 5658 gene locus_tag LOCUS_14590 6074 5658 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_14590 6640 6083 gene locus_tag LOCUS_14600 6640 6083 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_14600 7054 6755 gene locus_tag LOCUS_14610 gene trxA 7054 6755 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_14610 7316 7065 gene locus_tag LOCUS_14620 7316 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 7922 7323 gene locus_tag LOCUS_14630 7922 7323 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_14630 8262 7924 gene locus_tag LOCUS_14640 8262 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 8317 8700 gene locus_tag LOCUS_14650 8317 8700 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_14650 8810 9115 gene locus_tag LOCUS_14660 8810 9115 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 protein_id gnl|my_center|LOCUS_14660 9198 10988 gene locus_tag LOCUS_14670 9198 10988 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence079 114 707 gene locus_tag LOCUS_14680 gene coaE 114 707 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_14680 742 1674 gene locus_tag LOCUS_14690 gene trxB 742 1674 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_14690 1739 2224 gene locus_tag LOCUS_14700 1739 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2786 2292 gene locus_tag LOCUS_14710 2786 2292 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_14710 3213 2845 gene locus_tag LOCUS_14720 3213 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3375 4733 gene locus_tag LOCUS_14730 3375 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4796 6400 gene locus_tag LOCUS_14740 4796 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6456 8081 gene locus_tag LOCUS_14750 6456 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 8196 9527 gene locus_tag LOCUS_14760 8196 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 9535 11019 gene locus_tag LOCUS_14770 9535 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence080 <1 1022 gene locus_tag LOCUS_14780 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963836.1:acyl-CoA dehydrogenase family protein 1807 1079 gene locus_tag LOCUS_14790 1807 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2608 2033 gene locus_tag LOCUS_14800 2608 2033 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084585.1 protein_id gnl|my_center|LOCUS_14800 3264 2722 gene locus_tag LOCUS_14810 3264 2722 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_14810 3793 3314 gene locus_tag LOCUS_14820 3793 3314 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_14820 3882 4817 gene locus_tag LOCUS_14830 3882 4817 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_14830 4876 5817 gene locus_tag LOCUS_14840 4876 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 6583 5885 gene locus_tag LOCUS_14850 gene radC 6583 5885 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_14850 6898 6641 gene locus_tag LOCUS_14860 gene rpsT 6898 6641 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_14860 7074 9806 gene locus_tag LOCUS_14870 7074 9806 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_14870 9835 10758 gene locus_tag LOCUS_14880 9835 10758 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence081 1124 441 gene locus_tag LOCUS_14890 1124 441 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_14890 2830 1349 gene locus_tag LOCUS_14900 2830 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 4145 2904 gene locus_tag LOCUS_14910 4145 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4291 5232 gene locus_tag LOCUS_14920 4291 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 5886 5233 gene locus_tag LOCUS_14930 5886 5233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_14930 6992 5892 gene locus_tag LOCUS_14940 6992 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 8704 7004 gene locus_tag LOCUS_14950 8704 7004 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765321.1 protein_id gnl|my_center|LOCUS_14950 <11000 8729 gene locus_tag LOCUS_14960 <11000 8729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108497.1:tetratricopeptide repeat protein >Feature sequence082 1366 617 gene locus_tag LOCUS_14970 gene pstB 1366 617 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788575.1 protein_id gnl|my_center|LOCUS_14970 2235 1378 gene locus_tag LOCUS_14980 gene pstA 2235 1378 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538554.1 protein_id gnl|my_center|LOCUS_14980 3428 2232 gene locus_tag LOCUS_14990 gene pstC 3428 2232 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788582.1 protein_id gnl|my_center|LOCUS_14990 4279 3464 gene locus_tag LOCUS_15000 4279 3464 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538556.1 protein_id gnl|my_center|LOCUS_15000 5642 4386 gene locus_tag LOCUS_15010 5642 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 7135 5798 gene locus_tag LOCUS_15020 7135 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 7288 7761 gene locus_tag LOCUS_15030 7288 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15030 7791 8135 gene locus_tag LOCUS_15040 7791 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15040 8993 8292 gene locus_tag LOCUS_15050 8993 8292 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_15050 9147 9554 gene locus_tag LOCUS_15060 9147 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 10855 9551 gene locus_tag LOCUS_15070 10855 9551 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence083 2650 257 gene locus_tag LOCUS_15080 2650 257 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_15080 2794 3444 gene locus_tag LOCUS_15090 2794 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3441 4907 gene locus_tag LOCUS_15100 gene crtI 3441 4907 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_15100 4986 5747 gene locus_tag LOCUS_15110 4986 5747 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_15110 5747 6202 gene locus_tag LOCUS_15120 5747 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 6205 6663 gene locus_tag LOCUS_15130 6205 6663 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_15130 6703 7125 gene locus_tag LOCUS_15140 6703 7125 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_15140 7122 7811 gene locus_tag LOCUS_15150 7122 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7808 8101 gene locus_tag LOCUS_15160 7808 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15160 8165 8371 gene locus_tag LOCUS_15170 8165 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15170 8361 9665 gene locus_tag LOCUS_15180 8361 9665 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_15180 9662 10561 gene locus_tag LOCUS_15190 9662 10561 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684417.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence084 <1 860 gene locus_tag LOCUS_15200 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092499.1:OmpA family protein 1529 867 gene locus_tag LOCUS_15210 1529 867 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_15210 1672 2241 gene locus_tag LOCUS_15220 1672 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2249 3379 gene locus_tag LOCUS_15230 2249 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3456 4187 gene locus_tag LOCUS_15240 3456 4187 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346532.1 protein_id gnl|my_center|LOCUS_15240 4212 4946 gene locus_tag LOCUS_15250 gene fkpA 4212 4946 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_15250 5161 5805 gene locus_tag LOCUS_15260 5161 5805 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_15260 5854 7521 gene locus_tag LOCUS_15270 5854 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 8578 7565 gene locus_tag LOCUS_15280 gene murB 8578 7565 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_15280 9861 8575 gene locus_tag LOCUS_15290 9861 8575 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_15290 10182 9868 gene locus_tag LOCUS_15300 10182 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence085 1405 2541 gene locus_tag LOCUS_15310 1405 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3050 2598 gene locus_tag LOCUS_15320 3050 2598 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_15320 3856 3110 gene locus_tag LOCUS_15330 3856 3110 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460971.1 protein_id gnl|my_center|LOCUS_15330 4479 3916 gene locus_tag LOCUS_15340 4479 3916 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528197.1 protein_id gnl|my_center|LOCUS_15340 6579 4552 gene locus_tag LOCUS_15350 6579 4552 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_15350 6792 8765 gene locus_tag LOCUS_15360 6792 8765 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_15360 9311 10237 gene locus_tag LOCUS_15370 9311 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 10242 10544 gene locus_tag LOCUS_15380 10242 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence086 1167 739 gene locus_tag LOCUS_15390 gene rplV 1167 739 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296344.1 protein_id gnl|my_center|LOCUS_15390 1443 1177 gene locus_tag LOCUS_15400 gene rpsS 1443 1177 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_15400 2280 1453 gene locus_tag LOCUS_15410 gene rplB 2280 1453 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_15410 2592 2302 gene locus_tag LOCUS_15420 gene rplW 2592 2302 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963467.1 protein_id gnl|my_center|LOCUS_15420 3228 2596 gene locus_tag LOCUS_15430 gene rplD 3228 2596 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762035.1 protein_id gnl|my_center|LOCUS_15430 3884 3267 gene locus_tag LOCUS_15440 gene rplC 3884 3267 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_15440 4195 3890 gene locus_tag LOCUS_15450 gene rpsJ 4195 3890 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_15450 6305 4200 gene locus_tag LOCUS_15460 gene fusA 6305 4200 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_15460 6809 6342 gene locus_tag LOCUS_15470 gene rpsG 6809 6342 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_15470 7244 6837 gene locus_tag LOCUS_15480 gene rpsL 7244 6837 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142321.1 protein_id gnl|my_center|LOCUS_15480 8856 7558 gene locus_tag LOCUS_15490 gene tyrS 8856 7558 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962338.1 protein_id gnl|my_center|LOCUS_15490 9004 10092 gene locus_tag LOCUS_15500 9004 10092 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence087 <1 801 gene locus_tag LOCUS_15510 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:type IX secretion system sortase PorU 927 1931 gene locus_tag LOCUS_15520 927 1931 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_15520 2049 2846 gene locus_tag LOCUS_15530 2049 2846 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_15530 6491 2856 gene locus_tag LOCUS_15540 6491 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 7261 6497 gene locus_tag LOCUS_15550 gene mazG 7261 6497 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_15550 7373 8632 gene locus_tag LOCUS_15560 7373 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 8640 9338 gene locus_tag LOCUS_15570 8640 9338 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence088 238 1086 gene locus_tag LOCUS_15580 238 1086 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_15580 1271 2380 gene locus_tag LOCUS_15590 1271 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2370 3725 gene locus_tag LOCUS_15600 2370 3725 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_15600 3793 5898 gene locus_tag LOCUS_15610 3793 5898 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_15610 5970 7046 gene locus_tag LOCUS_15620 5970 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7060 8430 gene locus_tag LOCUS_15630 7060 8430 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963595.1 protein_id gnl|my_center|LOCUS_15630 9094 8585 gene locus_tag LOCUS_15640 9094 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence089 835 611 gene locus_tag LOCUS_15650 835 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1343 837 gene locus_tag LOCUS_15660 1343 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1845 1345 gene locus_tag LOCUS_15670 1845 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2078 3157 gene locus_tag LOCUS_15680 2078 3157 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_15680 3479 6256 gene locus_tag LOCUS_15690 gene acnA 3479 6256 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 protein_id gnl|my_center|LOCUS_15690 6259 6708 gene locus_tag LOCUS_15700 6259 6708 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_15700 6718 7431 gene locus_tag LOCUS_15710 6718 7431 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_15710 7470 8018 gene locus_tag LOCUS_15720 7470 8018 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_15720 8120 9379 gene locus_tag LOCUS_15730 8120 9379 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895366.1 protein_id gnl|my_center|LOCUS_15730 9456 10499 gene locus_tag LOCUS_15740 9456 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence090 505 3597 gene locus_tag LOCUS_15750 505 3597 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_15750 3651 5027 gene locus_tag LOCUS_15760 3651 5027 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764022.1 protein_id gnl|my_center|LOCUS_15760 5039 5482 gene locus_tag LOCUS_15770 5039 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5817 6881 gene locus_tag LOCUS_15780 5817 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7651 6896 gene locus_tag LOCUS_15790 7651 6896 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667090.1 protein_id gnl|my_center|LOCUS_15790 8958 7702 gene locus_tag LOCUS_15800 8958 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence091 1528 539 gene locus_tag LOCUS_15810 1528 539 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_15810 1679 3406 gene locus_tag LOCUS_15820 gene ilvB 1679 3406 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_15820 4127 3471 gene locus_tag LOCUS_15830 4127 3471 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_15830 4246 5094 gene locus_tag LOCUS_15840 4246 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_15840 5098 5673 gene locus_tag LOCUS_15850 5098 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 5666 6355 gene locus_tag LOCUS_15860 gene rsmI 5666 6355 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_15860 9504 6358 gene locus_tag LOCUS_15870 9504 6358 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141537.1 protein_id gnl|my_center|LOCUS_15870 9903 9541 gene locus_tag LOCUS_15880 9903 9541 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence092 2190 139 gene locus_tag LOCUS_15890 2190 139 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_15890 2395 2784 gene locus_tag LOCUS_15900 2395 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2871 3767 gene locus_tag LOCUS_15910 2871 3767 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_15910 4230 3772 gene locus_tag LOCUS_15920 4230 3772 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_15920 6119 4311 gene locus_tag LOCUS_15930 gene typA 6119 4311 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_15930 6487 6413 gene locus_tag LOCUS_t00290 6487 6413 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7668 6589 gene locus_tag LOCUS_15940 7668 6589 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524106.1 protein_id gnl|my_center|LOCUS_15940 8736 7741 gene locus_tag LOCUS_15950 8736 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 9927 8809 gene locus_tag LOCUS_15960 gene dnaN 9927 8809 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence093 329 838 gene locus_tag LOCUS_15970 329 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15970 1054 1452 gene locus_tag LOCUS_15980 1054 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1580 2143 gene locus_tag LOCUS_15990 gene frr 1580 2143 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_15990 2226 2534 gene locus_tag LOCUS_16000 gene rplU 2226 2534 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640343.1 protein_id gnl|my_center|LOCUS_16000 2548 2796 gene locus_tag LOCUS_16010 gene rpmA 2548 2796 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_16010 2930 4858 gene locus_tag LOCUS_16020 2930 4858 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_16020 5546 4866 gene locus_tag LOCUS_16030 5546 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 7011 5755 gene locus_tag LOCUS_16040 gene ilvA 7011 5755 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250222.1 protein_id gnl|my_center|LOCUS_16040 8089 7043 gene locus_tag LOCUS_16050 8089 7043 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_16050 8158 8988 gene locus_tag LOCUS_16060 8158 8988 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence094 1675 242 gene locus_tag LOCUS_16070 1675 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3007 1766 gene locus_tag LOCUS_16080 3007 1766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_16080 4432 3011 gene locus_tag LOCUS_16090 4432 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6209 4437 gene locus_tag LOCUS_16100 6209 4437 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_16100 8232 6343 gene locus_tag LOCUS_16110 8232 6343 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_16110 9409 8378 gene locus_tag LOCUS_16120 gene rsgA 9409 8378 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence095 3168 1789 gene locus_tag LOCUS_16130 3168 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4054 3218 gene locus_tag LOCUS_16140 4054 3218 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891912.1 protein_id gnl|my_center|LOCUS_16140 4775 4035 gene locus_tag LOCUS_16150 4775 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4818 5807 gene locus_tag LOCUS_16160 4818 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 5820 7274 gene locus_tag LOCUS_16170 5820 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7413 8342 gene locus_tag LOCUS_16180 7413 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 8367 8798 gene locus_tag LOCUS_16190 8367 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8851 9315 gene locus_tag LOCUS_16200 8851 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence096 2 550 gene locus_tag LOCUS_16210 2 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 620 1567 gene locus_tag LOCUS_16220 620 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1570 2529 gene locus_tag LOCUS_16230 1570 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2644 5061 gene locus_tag LOCUS_16240 2644 5061 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_16240 5308 5562 gene locus_tag LOCUS_16250 5308 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 5601 6017 gene locus_tag LOCUS_16260 5601 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6079 6420 gene locus_tag LOCUS_16270 6079 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 6429 8735 gene locus_tag LOCUS_16280 6429 8735 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_16280 8977 9159 gene locus_tag LOCUS_16290 8977 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 9409 9645 gene locus_tag LOCUS_16300 9409 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence097 452 808 gene locus_tag LOCUS_16310 452 808 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071772.1 protein_id gnl|my_center|LOCUS_16310 1031 2086 gene locus_tag LOCUS_16320 1031 2086 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_16320 2180 3313 gene locus_tag LOCUS_16330 2180 3313 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_16330 3861 3310 gene locus_tag LOCUS_16340 3861 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5890 3851 gene locus_tag LOCUS_16350 5890 3851 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_16350 7182 5914 gene locus_tag LOCUS_16360 7182 5914 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_16360 <9686 7190 gene locus_tag LOCUS_16370 <9686 7190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963036.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence098 <1 3107 gene locus_tag LOCUS_16380 <1 3107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000092456.1:Gly-Xaa-Xaa repeat protein 3594 4958 gene locus_tag LOCUS_16390 3594 4958 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021108.1 protein_id gnl|my_center|LOCUS_16390 5071 7251 gene locus_tag LOCUS_16400 gene fadJ 5071 7251 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661366.1 protein_id gnl|my_center|LOCUS_16400 7358 8125 gene locus_tag LOCUS_16410 7358 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 8860 8126 gene locus_tag LOCUS_16420 gene rlmB 8860 8126 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762416.1 protein_id gnl|my_center|LOCUS_16420 <9683 8925 gene locus_tag LOCUS_16430 <9683 8925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090998.1:long-chain-acyl-CoA synthetase >Feature sequence099 1486 1160 gene locus_tag LOCUS_16440 1486 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1955 1497 gene locus_tag LOCUS_16450 1955 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2621 1965 gene locus_tag LOCUS_16460 gene fsa 2621 1965 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_16460 3219 2683 gene locus_tag LOCUS_16470 3219 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3393 4976 gene locus_tag LOCUS_16480 3393 4976 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797168.1 protein_id gnl|my_center|LOCUS_16480 4980 6113 gene locus_tag LOCUS_16490 4980 6113 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_16490 6698 6123 gene locus_tag LOCUS_16500 6698 6123 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_16500 7349 6702 gene locus_tag LOCUS_16510 7349 6702 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208082.1 protein_id gnl|my_center|LOCUS_16510 8098 7361 gene locus_tag LOCUS_16520 8098 7361 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_16520 <9477 8102 gene locus_tag LOCUS_16530 <9477 8102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679079.1:MBL fold metallo-hydrolase >Feature sequence100 3 176 gene locus_tag LOCUS_16540 3 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 462 1451 gene locus_tag LOCUS_16550 462 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1435 3132 gene locus_tag LOCUS_16560 gene menD 1435 3132 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_16560 3137 3979 gene locus_tag LOCUS_16570 3137 3979 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962642.1 protein_id gnl|my_center|LOCUS_16570 3985 4887 gene locus_tag LOCUS_16580 3985 4887 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819265.1 protein_id gnl|my_center|LOCUS_16580 4907 5947 gene locus_tag LOCUS_16590 4907 5947 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_16590 5944 7008 gene locus_tag LOCUS_16600 5944 7008 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_16600 7671 6991 gene locus_tag LOCUS_16610 gene truB 7671 6991 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_16610 8820 7690 gene locus_tag LOCUS_16620 8820 7690 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence101 1081 113 gene locus_tag LOCUS_16630 1081 113 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_16630 1826 1083 gene locus_tag LOCUS_16640 1826 1083 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_16640 1897 2223 gene locus_tag LOCUS_16650 1897 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2532 3035 gene locus_tag LOCUS_16660 2532 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 3198 5588 gene locus_tag LOCUS_16670 3198 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 5724 8123 gene locus_tag LOCUS_16680 5724 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 8323 9135 gene locus_tag LOCUS_16690 8323 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence102 1466 522 gene locus_tag LOCUS_16700 1466 522 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_16700 1782 1468 gene locus_tag LOCUS_16710 1782 1468 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_16710 1985 1779 gene locus_tag LOCUS_16720 1985 1779 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_16720 3690 2302 gene locus_tag LOCUS_16730 gene mnmE 3690 2302 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_16730 3764 5344 gene locus_tag LOCUS_16740 3764 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 5442 7928 gene locus_tag LOCUS_16750 5442 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 7932 9008 gene locus_tag LOCUS_16760 7932 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence103 1222 2007 gene locus_tag LOCUS_16770 1222 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1997 2536 gene locus_tag LOCUS_16780 1997 2536 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_16780 2538 3017 gene locus_tag LOCUS_16790 gene coaD 2538 3017 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_16790 5449 3317 gene locus_tag LOCUS_16800 gene pnp 5449 3317 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_16800 5787 5518 gene locus_tag LOCUS_16810 gene rpsO 5787 5518 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_16810 6013 7050 gene locus_tag LOCUS_16820 6013 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 7054 7731 gene locus_tag LOCUS_16830 gene cmk 7054 7731 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_16830 7801 8517 gene locus_tag LOCUS_16840 7801 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 8900 8514 gene locus_tag LOCUS_16850 8900 8514 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence104 96 2117 gene locus_tag LOCUS_16860 96 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2224 3456 gene locus_tag LOCUS_16870 gene serA 2224 3456 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071152.1 protein_id gnl|my_center|LOCUS_16870 3533 3898 gene locus_tag LOCUS_16880 3533 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3900 4439 gene locus_tag LOCUS_16890 3900 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 5924 4464 gene locus_tag LOCUS_16900 5924 4464 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_16900 7206 6010 gene locus_tag LOCUS_16910 7206 6010 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_16910 8542 7229 gene locus_tag LOCUS_16920 gene murA 8542 7229 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_16920 <9061 8546 gene locus_tag LOCUS_16930 <9061 8546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964113.1:DUF4290 domain-containing protein >Feature sequence105 1053 475 gene locus_tag LOCUS_16940 gene rfbC 1053 475 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_16940 2107 1034 gene locus_tag LOCUS_16950 2107 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4777 2108 gene locus_tag LOCUS_16960 4777 2108 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838258.1 protein_id gnl|my_center|LOCUS_16960 5834 4779 gene locus_tag LOCUS_16970 gene rfbB 5834 4779 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_16970 7132 5834 gene locus_tag LOCUS_16980 7132 5834 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_16980 7294 8397 gene locus_tag LOCUS_16990 7294 8397 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence106 548 1189 gene locus_tag LOCUS_17000 548 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1360 1863 gene locus_tag LOCUS_17010 1360 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964397.1 protein_id gnl|my_center|LOCUS_17010 2530 3084 gene locus_tag LOCUS_17020 2530 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3182 4537 gene locus_tag LOCUS_17030 3182 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 4543 5265 gene locus_tag LOCUS_17040 4543 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 6561 5266 gene locus_tag LOCUS_17050 6561 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 6745 8757 gene locus_tag LOCUS_17060 gene uvrB 6745 8757 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence107 1082 537 gene locus_tag LOCUS_17070 1082 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1256 2209 gene locus_tag LOCUS_17080 gene fmt 1256 2209 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_17080 2284 3138 gene locus_tag LOCUS_17090 2284 3138 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082887.1 protein_id gnl|my_center|LOCUS_17090 3210 4115 gene locus_tag LOCUS_17100 3210 4115 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207824.1 protein_id gnl|my_center|LOCUS_17100 4324 5613 gene locus_tag LOCUS_17110 4324 5613 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726889.1 protein_id gnl|my_center|LOCUS_17110 5817 5623 gene locus_tag LOCUS_17120 5817 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 5816 7072 gene locus_tag LOCUS_17130 5816 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence108 104 373 gene locus_tag LOCUS_17140 104 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 523 1335 gene locus_tag LOCUS_17150 523 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1337 1660 gene locus_tag LOCUS_17160 1337 1660 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_17160 1665 2867 gene locus_tag LOCUS_17170 gene coaBC 1665 2867 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_17170 2864 3769 gene locus_tag LOCUS_17180 2864 3769 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_17180 4216 3809 gene locus_tag LOCUS_17190 4216 3809 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_17190 4903 4241 gene locus_tag LOCUS_17200 4903 4241 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_17200 5740 4943 gene locus_tag LOCUS_17210 5740 4943 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_17210 6722 5844 gene locus_tag LOCUS_17220 6722 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 7943 6732 gene locus_tag LOCUS_17230 7943 6732 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_17230 8276 7986 gene locus_tag LOCUS_17240 8276 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 8790 8278 gene locus_tag LOCUS_17250 8790 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence109 <1 631 gene locus_tag LOCUS_17260 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186345.1:peroxiredoxin 697 1110 gene locus_tag LOCUS_17270 gene ruvX 697 1110 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_17270 1134 1697 gene locus_tag LOCUS_17280 gene def 1134 1697 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_17280 1743 2276 gene locus_tag LOCUS_17290 1743 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2278 3006 gene locus_tag LOCUS_17300 2278 3006 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674311.1 protein_id gnl|my_center|LOCUS_17300 3229 3672 gene locus_tag LOCUS_17310 gene rplM 3229 3672 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_17310 3692 4084 gene locus_tag LOCUS_17320 gene rpsI 3692 4084 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933442.1 protein_id gnl|my_center|LOCUS_17320 4121 4861 gene locus_tag LOCUS_17330 gene rpsB 4121 4861 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_17330 4913 5749 gene locus_tag LOCUS_17340 gene tsf 4913 5749 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_17340 5802 6092 gene locus_tag LOCUS_17350 5802 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 6127 6837 gene locus_tag LOCUS_17360 gene pyrH 6127 6837 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_17360 8521 6905 gene locus_tag LOCUS_17370 8521 6905 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence110 <1 1647 gene locus_tag LOCUS_17380 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108843.1:tetratricopeptide repeat protein 1665 2465 gene locus_tag LOCUS_17390 1665 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2458 3801 gene locus_tag LOCUS_17400 2458 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3882 4700 gene locus_tag LOCUS_17410 3882 4700 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222203.1 protein_id gnl|my_center|LOCUS_17410 4821 5543 gene locus_tag LOCUS_17420 4821 5543 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207067.1 protein_id gnl|my_center|LOCUS_17420 7677 5644 gene locus_tag LOCUS_17430 gene ftsH 7677 5644 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_17430 8080 7694 gene locus_tag LOCUS_17440 gene rsfS 8080 7694 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645187.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence111 236 1015 gene locus_tag LOCUS_17450 236 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1028 2245 gene locus_tag LOCUS_17460 1028 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2642 3097 gene locus_tag LOCUS_17470 gene mraZ 2642 3097 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_17470 3108 4004 gene locus_tag LOCUS_17480 gene rsmH 3108 4004 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172605046.1 protein_id gnl|my_center|LOCUS_17480 4004 4387 gene locus_tag LOCUS_17490 4004 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4399 6501 gene locus_tag LOCUS_17500 4399 6501 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_17500 6507 7964 gene locus_tag LOCUS_17510 6507 7964 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence112 404 1288 gene locus_tag LOCUS_17520 404 1288 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_17520 2248 1316 gene locus_tag LOCUS_17530 2248 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2364 4997 gene locus_tag LOCUS_17540 2364 4997 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_17540 4990 5904 gene locus_tag LOCUS_17550 4990 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 5913 6770 gene locus_tag LOCUS_17560 5913 6770 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_17560 7079 6783 gene locus_tag LOCUS_17570 7079 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 7848 7072 gene locus_tag LOCUS_17580 gene surE 7848 7072 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence113 1306 710 gene locus_tag LOCUS_17590 1306 710 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_17590 1775 1347 gene locus_tag LOCUS_17600 gene bcp 1775 1347 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_17600 3400 1799 gene locus_tag LOCUS_17610 gene pckA 3400 1799 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813680.1 protein_id gnl|my_center|LOCUS_17610 3577 4716 gene locus_tag LOCUS_17620 gene bshA 3577 4716 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_17620 5709 4708 gene locus_tag LOCUS_17630 gene asnA 5709 4708 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_17630 6879 5827 gene locus_tag LOCUS_17640 gene aroB 6879 5827 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_17640 7206 6895 gene locus_tag LOCUS_17650 7206 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence114 63 1064 gene locus_tag LOCUS_17660 63 1064 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_17660 1085 1417 gene locus_tag LOCUS_17670 1085 1417 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_17670 3131 1473 gene locus_tag LOCUS_17680 3131 1473 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_17680 4082 3156 gene locus_tag LOCUS_17690 4082 3156 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_17690 4762 4091 gene locus_tag LOCUS_17700 4762 4091 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563863.1 protein_id gnl|my_center|LOCUS_17700 6155 5211 gene locus_tag LOCUS_17710 6155 5211 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_17710 7121 6285 gene locus_tag LOCUS_17720 gene gldN 7121 6285 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_17720 <7750 7135 gene locus_tag LOCUS_17730 <7750 7135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964073.1:gliding motility protein GldM >Feature sequence115 646 1404 gene locus_tag LOCUS_17740 646 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1420 3318 gene locus_tag LOCUS_17750 1420 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5081 3315 gene locus_tag LOCUS_17760 5081 3315 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_17760 5648 5097 gene locus_tag LOCUS_17770 5648 5097 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_17770 7391 5664 gene locus_tag LOCUS_17780 gene ilvB 7391 5664 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692228.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence116 1267 248 gene locus_tag LOCUS_17790 1267 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3328 1319 gene locus_tag LOCUS_17800 3328 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 4530 3358 gene locus_tag LOCUS_17810 4530 3358 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_17810 7166 4527 gene locus_tag LOCUS_17820 7166 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039747.1 protein_id gnl|my_center|LOCUS_17820 7368 7159 gene locus_tag LOCUS_17830 7368 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence117 1417 665 gene locus_tag LOCUS_17840 1417 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2265 1429 gene locus_tag LOCUS_17850 2265 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2858 2409 gene locus_tag LOCUS_17860 2858 2409 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670499.1 protein_id gnl|my_center|LOCUS_17860 4066 3020 gene locus_tag LOCUS_17870 gene selD 4066 3020 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169286.1 protein_id gnl|my_center|LOCUS_17870 4166 4924 gene locus_tag LOCUS_17880 4166 4924 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_17880 5121 6377 gene locus_tag LOCUS_17890 5121 6377 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_17890 6714 6388 gene locus_tag LOCUS_17900 6714 6388 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036026449.1 protein_id gnl|my_center|LOCUS_17900 <7654 6727 gene locus_tag LOCUS_17910 <7654 6727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166151256.1:ABC transporter permease >Feature sequence118 956 1990 gene locus_tag LOCUS_17920 956 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838772.1 protein_id gnl|my_center|LOCUS_17920 3366 2140 gene locus_tag LOCUS_17930 3366 2140 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_17930 3447 4508 gene locus_tag LOCUS_17940 gene mvaD 3447 4508 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_17940 4514 5464 gene locus_tag LOCUS_17950 4514 5464 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_17950 6063 5479 gene locus_tag LOCUS_17960 6063 5479 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence119 627 55 gene locus_tag LOCUS_17970 627 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1165 647 gene locus_tag LOCUS_17980 1165 647 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_17980 1361 1624 gene locus_tag LOCUS_17990 1361 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1617 3731 gene locus_tag LOCUS_18000 gene feoB 1617 3731 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_18000 5595 3733 gene locus_tag LOCUS_18010 5595 3733 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_18010 5781 6359 gene locus_tag LOCUS_18020 5781 6359 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214821.1 protein_id gnl|my_center|LOCUS_18020 6363 6980 gene locus_tag LOCUS_18030 gene ccmA 6363 6980 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence120 810 1385 gene locus_tag LOCUS_18040 810 1385 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_18040 2139 1468 gene locus_tag LOCUS_18050 2139 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3346 2141 gene locus_tag LOCUS_18060 3346 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3939 4238 gene locus_tag LOCUS_18070 3939 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4310 4969 gene locus_tag LOCUS_18080 4310 4969 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828382.1 protein_id gnl|my_center|LOCUS_18080 6114 4954 gene locus_tag LOCUS_18090 6114 4954 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803796.1 protein_id gnl|my_center|LOCUS_18090 6782 6126 gene locus_tag LOCUS_18100 6782 6126 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467005.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence121 <1 523 gene locus_tag LOCUS_18110 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947336.1:glutamate-5-semialdehyde dehydrogenase 546 1295 gene locus_tag LOCUS_18120 gene bla2 546 1295 CDS product BcII family subclass B1 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799227.1 protein_id gnl|my_center|LOCUS_18120 2661 1288 gene locus_tag LOCUS_18130 2661 1288 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_18130 2828 6145 gene locus_tag LOCUS_18140 gene secA 2828 6145 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_18140 6261 6611 gene locus_tag LOCUS_18150 6261 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 7188 6742 gene locus_tag LOCUS_18160 7188 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18160 >Feature sequence122 1976 537 gene locus_tag LOCUS_18170 1976 537 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 protein_id gnl|my_center|LOCUS_18170 3111 1966 gene locus_tag LOCUS_18180 3111 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3983 3087 gene locus_tag LOCUS_18190 3983 3087 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118888.1 protein_id gnl|my_center|LOCUS_18190 4579 3980 gene locus_tag LOCUS_18200 4579 3980 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161817388.1 protein_id gnl|my_center|LOCUS_18200 5355 4582 gene locus_tag LOCUS_18210 5355 4582 CDS product TylF/MycF/NovP-related O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062154.1 protein_id gnl|my_center|LOCUS_18210 6394 5348 gene locus_tag LOCUS_18220 6394 5348 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963396.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence123 529 1713 gene locus_tag LOCUS_18230 529 1713 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963373.1 protein_id gnl|my_center|LOCUS_18230 2927 1740 gene locus_tag LOCUS_18240 2927 1740 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_18240 3045 3584 gene locus_tag LOCUS_18250 3045 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3676 4086 gene locus_tag LOCUS_18260 3676 4086 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962565.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence124 3220 3714 gene locus_tag LOCUS_18270 3220 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3704 6124 gene locus_tag LOCUS_18280 3704 6124 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence125 1135 401 gene locus_tag LOCUS_18290 1135 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2715 1198 gene locus_tag LOCUS_18300 2715 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2854 3318 gene locus_tag LOCUS_18310 gene smpB 2854 3318 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_18310 4234 3332 gene locus_tag LOCUS_18320 4234 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 4633 6177 gene locus_tag LOCUS_18330 4633 6177 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933539.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence126 397 1608 gene locus_tag LOCUS_18340 397 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 2644 1691 gene locus_tag LOCUS_18350 2644 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2729 3436 gene locus_tag LOCUS_18360 2729 3436 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_18360 3493 5268 gene locus_tag LOCUS_18370 3493 5268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_18370 5311 6030 gene locus_tag LOCUS_18380 5311 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 6032 6358 gene locus_tag LOCUS_18390 6032 6358 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_18390 <7017 6355 gene locus_tag LOCUS_18400 <7017 6355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963367.1:twin-arginine translocase subunit TatC >Feature sequence127 910 2241 gene locus_tag LOCUS_18410 910 2241 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_18410 2251 3276 gene locus_tag LOCUS_18420 2251 3276 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_18420 3806 4948 gene locus_tag LOCUS_18430 3806 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 4977 5666 gene locus_tag LOCUS_18440 4977 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 5680 5850 gene locus_tag LOCUS_18450 5680 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 6104 6727 gene locus_tag LOCUS_18460 6104 6727 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence128 <1 890 gene locus_tag LOCUS_18470 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951082.1:aspartate ammonia-lyase 2053 1241 gene locus_tag LOCUS_18480 2053 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2621 2115 gene locus_tag LOCUS_18490 2621 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2670 3968 gene locus_tag LOCUS_18500 gene ricT 2670 3968 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_18500 4214 6043 gene locus_tag LOCUS_18510 gene mutL 4214 6043 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence129 56 1261 gene locus_tag LOCUS_18520 56 1261 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_18520 1439 3244 gene locus_tag LOCUS_18530 1439 3244 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_18530 6448 3581 gene locus_tag LOCUS_18540 6448 3581 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898759.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence130 520 1998 gene locus_tag LOCUS_18550 520 1998 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_18550 2137 3726 gene locus_tag LOCUS_18560 2137 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3716 5278 gene locus_tag LOCUS_18570 3716 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5635 5288 gene locus_tag LOCUS_18580 5635 5288 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_18580 6557 5649 gene locus_tag LOCUS_18590 6557 5649 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence131 915 460 gene locus_tag LOCUS_18600 915 460 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_18600 1135 908 gene locus_tag LOCUS_18610 1135 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1774 3000 gene locus_tag LOCUS_18620 1774 3000 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_18620 3638 4054 gene locus_tag LOCUS_18630 3638 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 4660 4058 gene locus_tag LOCUS_18640 4660 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5235 4657 gene locus_tag LOCUS_18650 5235 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 <6668 5253 gene locus_tag LOCUS_18660 <6668 5253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583285.1:xylulokinase >Feature sequence132 418 4941 gene locus_tag LOCUS_18670 418 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4948 5598 gene locus_tag LOCUS_18680 4948 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence133 1158 187 gene locus_tag LOCUS_18690 gene bioB 1158 187 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_18690 1538 1155 gene locus_tag LOCUS_18700 1538 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1661 2356 gene locus_tag LOCUS_18710 1661 2356 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_18710 2758 2357 gene locus_tag LOCUS_18720 2758 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3555 2776 gene locus_tag LOCUS_18730 3555 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 5050 3659 gene locus_tag LOCUS_18740 5050 3659 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence134 2359 1418 gene locus_tag LOCUS_18750 2359 1418 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_18750 3693 2356 gene locus_tag LOCUS_18760 3693 2356 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020726.1 protein_id gnl|my_center|LOCUS_18760 3824 4819 gene locus_tag LOCUS_18770 3824 4819 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_18770 4822 5811 gene locus_tag LOCUS_18780 4822 5811 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765092.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence135 2546 141 gene locus_tag LOCUS_18790 gene lon 2546 141 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_18790 3180 2743 gene locus_tag LOCUS_18800 3180 2743 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048201672.1 protein_id gnl|my_center|LOCUS_18800 3326 3177 gene locus_tag LOCUS_18810 3326 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4363 3587 gene locus_tag LOCUS_18820 4363 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4604 5596 gene locus_tag LOCUS_18830 4604 5596 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence136 1 252 gene locus_tag LOCUS_18840 1 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1460 330 gene locus_tag LOCUS_18850 1460 330 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 protein_id gnl|my_center|LOCUS_18850 2926 1646 gene locus_tag LOCUS_18860 2926 1646 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_18860 3204 4307 gene locus_tag LOCUS_18870 3204 4307 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_18870 4337 4642 gene locus_tag LOCUS_18880 4337 4642 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_18880 4724 6115 gene locus_tag LOCUS_18890 4724 6115 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence137 1979 327 gene locus_tag LOCUS_18900 1979 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 4089 2464 gene locus_tag LOCUS_18910 4089 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 4694 4080 gene locus_tag LOCUS_18920 4694 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 5786 4761 gene locus_tag LOCUS_18930 5786 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence138 1181 351 gene locus_tag LOCUS_18940 1181 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1920 3062 gene locus_tag LOCUS_18950 1920 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3184 4974 gene locus_tag LOCUS_18960 3184 4974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_18960 5053 5454 gene locus_tag LOCUS_18970 5053 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence139 196 1071 gene locus_tag LOCUS_18980 196 1071 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_18980 1168 2304 gene locus_tag LOCUS_18990 1168 2304 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_18990 2356 4221 gene locus_tag LOCUS_19000 2356 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 5059 4625 gene locus_tag LOCUS_19010 5059 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 5533 5177 gene locus_tag LOCUS_19020 5533 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 <6120 5535 gene locus_tag LOCUS_19030 <6120 5535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964084.1:tetratricopeptide repeat protein >Feature sequence140 978 157 gene locus_tag LOCUS_19040 978 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1295 1020 gene locus_tag LOCUS_19050 1295 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3073 1322 gene locus_tag LOCUS_19060 3073 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3529 3221 gene locus_tag LOCUS_19070 3529 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19070 4191 3652 gene locus_tag LOCUS_19080 4191 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19080 6065 4269 gene locus_tag LOCUS_19090 6065 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence141 41 904 gene locus_tag LOCUS_19100 41 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1217 912 gene locus_tag LOCUS_19110 1217 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1915 1229 gene locus_tag LOCUS_19120 1915 1229 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_19120 2015 3259 gene locus_tag LOCUS_19130 2015 3259 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_19130 3627 3301 gene locus_tag LOCUS_19140 3627 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 3850 3599 gene locus_tag LOCUS_19150 3850 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 4013 5011 gene locus_tag LOCUS_19160 4013 5011 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_19160 <6084 5023 gene locus_tag LOCUS_19170 <6084 5023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022291.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence142 996 1244 gene locus_tag LOCUS_19180 996 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1478 2506 gene locus_tag LOCUS_19190 1478 2506 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_19190 2506 3534 gene locus_tag LOCUS_19200 gene nuoH 2506 3534 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_19200 3540 4160 gene locus_tag LOCUS_19210 3540 4160 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_19210 4173 4676 gene locus_tag LOCUS_19220 4173 4676 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_19220 4676 4996 gene locus_tag LOCUS_19230 gene nuoK 4676 4996 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_19230 5004 5900 gene locus_tag LOCUS_19240 5004 5900 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence143 1302 208 gene locus_tag LOCUS_19250 gene carA 1302 208 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_19250 1917 1414 gene locus_tag LOCUS_19260 gene rplQ 1917 1414 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963444.1 protein_id gnl|my_center|LOCUS_19260 2946 1951 gene locus_tag LOCUS_19270 2946 1951 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_19270 3596 2988 gene locus_tag LOCUS_19280 gene rpsD 3596 2988 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_19280 4040 3651 gene locus_tag LOCUS_19290 gene rpsK 4040 3651 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_19290 4442 4065 gene locus_tag LOCUS_19300 gene rpsM 4442 4065 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_19300 4791 4573 gene locus_tag LOCUS_19310 gene infA 4791 4573 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356224.1 protein_id gnl|my_center|LOCUS_19310 5617 4820 gene locus_tag LOCUS_19320 gene map 5617 4820 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence144 52 990 gene locus_tag LOCUS_19330 52 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1002 2003 gene locus_tag LOCUS_19340 1002 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2785 2177 gene locus_tag LOCUS_19350 2785 2177 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_19350 2962 4617 gene locus_tag LOCUS_19360 2962 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 4618 5592 gene locus_tag LOCUS_19370 4618 5592 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122320241.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence145 <1 1322 gene locus_tag LOCUS_19380 <1 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114226.1:ceramidase CerN 1439 2896 gene locus_tag LOCUS_19390 1439 2896 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_19390 2899 3603 gene locus_tag LOCUS_19400 2899 3603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_19400 3802 5202 gene locus_tag LOCUS_19410 3802 5202 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_19410 <5823 5281 gene locus_tag LOCUS_19420 <5823 5281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225087.1:M23 family metallopeptidase >Feature sequence146 <1 1263 gene locus_tag LOCUS_19430 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_119656495.1:efflux RND transporter permease subunit 1274 2581 gene locus_tag LOCUS_19440 1274 2581 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_19440 2744 4192 gene locus_tag LOCUS_19450 gene sufB 2744 4192 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_19450 4294 5037 gene locus_tag LOCUS_19460 gene sufC 4294 5037 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence147 1726 2268 gene locus_tag LOCUS_19470 1726 2268 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_19470 3355 2285 gene locus_tag LOCUS_19480 3355 2285 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926811.1 protein_id gnl|my_center|LOCUS_19480 3782 3348 gene locus_tag LOCUS_19490 3782 3348 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_19490 3897 4106 gene locus_tag LOCUS_19500 3897 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4955 4065 gene locus_tag LOCUS_19510 4955 4065 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence148 1451 792 gene locus_tag LOCUS_19520 1451 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2624 1464 gene locus_tag LOCUS_19530 2624 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 3100 5226 gene locus_tag LOCUS_19540 3100 5226 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence149 2366 141 gene locus_tag LOCUS_19550 2366 141 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303097.1 protein_id gnl|my_center|LOCUS_19550 2988 2482 gene locus_tag LOCUS_19560 2988 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 5142 2995 gene locus_tag LOCUS_19570 5142 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence150 367 2406 gene locus_tag LOCUS_19580 367 2406 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_19580 2467 3225 gene locus_tag LOCUS_19590 2467 3225 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_19590 3999 3226 gene locus_tag LOCUS_19600 gene kdsA 3999 3226 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_19600 4959 4069 gene locus_tag LOCUS_19610 gene dapA 4959 4069 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_19610 5254 5328 gene locus_tag LOCUS_t00300 5254 5328 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence151 112 282 gene locus_tag LOCUS_19620 112 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 269 1312 gene locus_tag LOCUS_19630 269 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1408 2331 gene locus_tag LOCUS_19640 1408 2331 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970774.1 protein_id gnl|my_center|LOCUS_19640 2333 2854 gene locus_tag LOCUS_19650 2333 2854 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775170.1 protein_id gnl|my_center|LOCUS_19650 3017 2787 gene locus_tag LOCUS_19660 3017 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 3061 3297 gene locus_tag LOCUS_19670 3061 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3299 3589 gene locus_tag LOCUS_19680 3299 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3590 4429 gene locus_tag LOCUS_19690 3590 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4429 4932 gene locus_tag LOCUS_19700 4429 4932 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656267.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence152 <1 740 gene locus_tag LOCUS_19710 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962374.1:PfkB family carbohydrate kinase 898 2331 gene locus_tag LOCUS_19720 898 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 2385 2633 gene locus_tag LOCUS_19730 2385 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2672 3679 gene locus_tag LOCUS_19740 2672 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3743 4870 gene locus_tag LOCUS_19750 gene tgt 3743 4870 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761519.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence153 1307 60 gene locus_tag LOCUS_19760 1307 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2210 1323 gene locus_tag LOCUS_19770 2210 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3696 2188 gene locus_tag LOCUS_19780 3696 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 4610 3696 gene locus_tag LOCUS_19790 4610 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4993 4607 gene locus_tag LOCUS_19800 4993 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence154 603 325 gene locus_tag LOCUS_19810 gene cas2 603 325 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037618070.1 protein_id gnl|my_center|LOCUS_19810 1567 596 gene locus_tag LOCUS_19820 1567 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2126 1554 gene locus_tag LOCUS_19830 2126 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3207 2179 gene locus_tag LOCUS_19840 3207 2179 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence155 555 136 gene locus_tag LOCUS_19850 555 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2913 559 gene locus_tag LOCUS_19860 2913 559 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_19860 3167 3817 gene locus_tag LOCUS_19870 3167 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 5105 3819 gene locus_tag LOCUS_19880 5105 3819 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165153.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence156 197 502 gene locus_tag LOCUS_19890 gene rpsJ 197 502 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_19890 567 1214 gene locus_tag LOCUS_19900 gene rplC 567 1214 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 protein_id gnl|my_center|LOCUS_19900 1248 1868 gene locus_tag LOCUS_19910 gene rplD 1248 1868 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931565.1 protein_id gnl|my_center|LOCUS_19910 1865 2197 gene locus_tag LOCUS_19920 gene rplW 1865 2197 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_19920 2199 3032 gene locus_tag LOCUS_19930 gene rplB 2199 3032 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690083.1 protein_id gnl|my_center|LOCUS_19930 3041 3325 gene locus_tag LOCUS_19940 gene rpsS 3041 3325 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_19940 3342 3677 gene locus_tag LOCUS_19950 gene rplV 3342 3677 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555485.1 protein_id gnl|my_center|LOCUS_19950 3692 4366 gene locus_tag LOCUS_19960 gene rpsC 3692 4366 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_19960 4426 4842 gene locus_tag LOCUS_19970 gene rplP 4426 4842 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_19970 4849 5025 gene locus_tag LOCUS_19980 4849 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence157 1909 2664 gene locus_tag LOCUS_19990 1909 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence158 1075 719 gene locus_tag LOCUS_20000 1075 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 1961 1086 gene locus_tag LOCUS_20010 1961 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3108 2005 gene locus_tag LOCUS_20020 3108 2005 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084677518.1 protein_id gnl|my_center|LOCUS_20020 3219 3893 gene locus_tag LOCUS_20030 3219 3893 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_20030 4872 3895 gene locus_tag LOCUS_20040 gene ftcD 4872 3895 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080786.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence159 647 12 gene locus_tag LOCUS_20050 647 12 CDS product ApaLI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012859081.1 protein_id gnl|my_center|LOCUS_20050 2054 762 gene locus_tag LOCUS_20060 2054 762 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_20060 2285 3502 gene locus_tag LOCUS_20070 gene trpB 2285 3502 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908238.1 protein_id gnl|my_center|LOCUS_20070 3658 4143 gene locus_tag LOCUS_20080 3658 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_20080 <4979 4162 gene locus_tag LOCUS_20090 <4979 4162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964089.1:carbamoyl-phosphate synthase large subunit >Feature sequence160 <1 1364 gene locus_tag LOCUS_20100 <1 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905837.1:dihydroxy-acid dehydratase 1417 2487 gene locus_tag LOCUS_20110 1417 2487 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_20110 2588 3460 gene locus_tag LOCUS_20120 2588 3460 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490863.1 protein_id gnl|my_center|LOCUS_20120 3595 4689 gene locus_tag LOCUS_20130 3595 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence161 <1 663 gene locus_tag LOCUS_20140 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992125.1:DNA polymerase III subunit alpha 1979 933 gene locus_tag LOCUS_20150 1979 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2775 2089 gene locus_tag LOCUS_20160 gene lipB 2775 2089 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_20160 3769 2777 gene locus_tag LOCUS_20170 3769 2777 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_20170 3879 4232 gene locus_tag LOCUS_20180 3879 4232 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence162 344 571 gene locus_tag LOCUS_20190 344 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 574 1803 gene locus_tag LOCUS_20200 gene dcm 574 1803 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044036390.1 protein_id gnl|my_center|LOCUS_20200 1808 2830 gene locus_tag LOCUS_20210 gene dcm 1808 2830 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044036390.1 protein_id gnl|my_center|LOCUS_20210 2820 4304 gene locus_tag LOCUS_20220 2820 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence163 2493 178 gene locus_tag LOCUS_20230 2493 178 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_20230 2758 3063 gene locus_tag LOCUS_20240 2758 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3053 4423 gene locus_tag LOCUS_20250 3053 4423 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223735.1 protein_id gnl|my_center|LOCUS_20250 4775 4413 gene locus_tag LOCUS_20260 4775 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence164 1349 1870 gene locus_tag LOCUS_20270 1349 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2234 2677 gene locus_tag LOCUS_20280 2234 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2800 3288 gene locus_tag LOCUS_20290 2800 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3663 4514 gene locus_tag LOCUS_20300 3663 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4486 4836 gene locus_tag LOCUS_20310 4486 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence165 1 498 gene locus_tag LOCUS_20320 1 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1752 505 gene locus_tag LOCUS_20330 1752 505 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_20330 2006 3133 gene locus_tag LOCUS_20340 2006 3133 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237280.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence166 2677 3924 gene locus_tag LOCUS_20350 2677 3924 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_20350 3921 4460 gene locus_tag LOCUS_20360 3921 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence167 707 453 gene locus_tag LOCUS_20370 707 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1203 844 gene locus_tag LOCUS_20380 1203 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1743 1369 gene locus_tag LOCUS_20390 1743 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2985 2134 gene locus_tag LOCUS_20400 2985 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3582 3193 gene locus_tag LOCUS_20410 3582 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4040 3585 gene locus_tag LOCUS_20420 4040 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 4259 4393 gene locus_tag LOCUS_20430 4259 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence168 1179 1 gene locus_tag LOCUS_20440 1179 1 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_20440 1502 1257 gene locus_tag LOCUS_20450 1502 1257 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_20450 2599 1514 gene locus_tag LOCUS_20460 2599 1514 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933445.1 protein_id gnl|my_center|LOCUS_20460 <4633 2675 gene locus_tag LOCUS_20470 <4633 2675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein >Feature sequence169 1644 1285 gene locus_tag LOCUS_20480 1644 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2144 1707 gene locus_tag LOCUS_20490 2144 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2403 2149 gene locus_tag LOCUS_20500 2403 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2589 2984 gene locus_tag LOCUS_20510 2589 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 4255 3074 gene locus_tag LOCUS_20520 gene hflX 4255 3074 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence170 494 72 gene locus_tag LOCUS_20530 494 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 708 1319 gene locus_tag LOCUS_20540 708 1319 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_20540 1485 2531 gene locus_tag LOCUS_20550 1485 2531 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_20550 2544 3428 gene locus_tag LOCUS_20560 2544 3428 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292463.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence171 520 128 gene locus_tag LOCUS_20570 520 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 693 2876 gene locus_tag LOCUS_20580 693 2876 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_20580 3836 2865 gene locus_tag LOCUS_20590 3836 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 4197 3817 gene locus_tag LOCUS_20600 4197 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence172 99 2093 gene locus_tag LOCUS_20610 99 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2097 2873 gene locus_tag LOCUS_20620 2097 2873 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_20620 4174 2885 gene locus_tag LOCUS_20630 4174 2885 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence173 495 82 gene locus_tag LOCUS_20640 495 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 722 2134 gene locus_tag LOCUS_20650 722 2134 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931971.1 protein_id gnl|my_center|LOCUS_20650 2127 3284 gene locus_tag LOCUS_20660 2127 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 <4212 3281 gene locus_tag LOCUS_20670 <4212 3281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963200.1:glycosyltransferase family 2 protein >Feature sequence174 440 1183 gene locus_tag LOCUS_20680 gene dapB 440 1183 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_20680 2520 1234 gene locus_tag LOCUS_20690 2520 1234 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256882.1 protein_id gnl|my_center|LOCUS_20690 <4199 2625 gene locus_tag LOCUS_20700 <4199 2625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962609.1:DUF5686 family protein >Feature sequence175 1 282 gene locus_tag LOCUS_20710 1 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 869 291 gene locus_tag LOCUS_20720 869 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3888 937 gene locus_tag LOCUS_20730 gene leuS 3888 937 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964452.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence176 1026 610 gene locus_tag LOCUS_20740 1026 610 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_20740 2057 1023 gene locus_tag LOCUS_20750 gene arsB 2057 1023 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162498585.1 protein_id gnl|my_center|LOCUS_20750 2460 2047 gene locus_tag LOCUS_20760 2460 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 3310 2471 gene locus_tag LOCUS_20770 3310 2471 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_20770 3665 3339 gene locus_tag LOCUS_20780 3665 3339 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence177 <1 848 gene locus_tag LOCUS_20790 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072879556.1:ATP-binding protein 2027 843 gene locus_tag LOCUS_20800 2027 843 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_20800 2897 2124 gene locus_tag LOCUS_20810 2897 2124 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_20810 3279 2923 gene locus_tag LOCUS_20820 3279 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_20820 <4026 3350 gene locus_tag LOCUS_20830 <4026 3350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962906.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence178 3026 981 gene locus_tag LOCUS_20840 3026 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence179 2187 952 gene locus_tag LOCUS_20850 2187 952 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_20850 3212 2235 gene locus_tag LOCUS_20860 3212 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence180 822 1439 gene locus_tag LOCUS_20870 822 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2724 1447 gene locus_tag LOCUS_20880 gene rodA 2724 1447 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_20880 <3959 2725 gene locus_tag LOCUS_20890 <3959 2725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964508.1:penicillin-binding protein 2 >Feature sequence181 964 2658 gene locus_tag LOCUS_20900 964 2658 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_20900 2728 3774 gene locus_tag LOCUS_20910 2728 3774 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence182 <1 999 gene locus_tag LOCUS_20920 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005777736.1:TraR/DksA C4-type zinc finger protein 1054 3012 gene locus_tag LOCUS_20930 1054 3012 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_20930 3291 3217 gene locus_tag LOCUS_t00310 3291 3217 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence183 755 339 gene locus_tag LOCUS_20940 755 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20940 1417 806 gene locus_tag LOCUS_20950 1417 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20950 2190 1420 gene locus_tag LOCUS_20960 2190 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2903 2187 gene locus_tag LOCUS_20970 gene ric 2903 2187 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_20970 3214 2915 gene locus_tag LOCUS_20980 3214 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3665 3231 gene locus_tag LOCUS_20990 3665 3231 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence184 1 417 gene locus_tag LOCUS_21000 1 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1063 443 gene locus_tag LOCUS_21010 1063 443 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393261.1 protein_id gnl|my_center|LOCUS_21010 1707 1069 gene locus_tag LOCUS_21020 gene pyrE 1707 1069 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_21020 1706 2359 gene locus_tag LOCUS_21030 1706 2359 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_21030 3304 2375 gene locus_tag LOCUS_21040 3304 2375 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence185 789 55 gene locus_tag LOCUS_21050 789 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21050 1290 895 gene locus_tag LOCUS_21060 1290 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21060 2063 1293 gene locus_tag LOCUS_21070 2063 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2787 2071 gene locus_tag LOCUS_21080 gene ric 2787 2071 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_21080 3098 2799 gene locus_tag LOCUS_21090 3098 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 3548 3114 gene locus_tag LOCUS_21100 3548 3114 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence186 2021 687 gene locus_tag LOCUS_21110 2021 687 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_21110 2142 3074 gene locus_tag LOCUS_21120 2142 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence187 3 1628 gene locus_tag LOCUS_21130 gene recG 3 1628 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_21130 1782 1937 gene locus_tag LOCUS_21140 1782 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3565 1970 gene locus_tag LOCUS_21150 gene nadB 3565 1970 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108697.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence188 290 613 gene locus_tag LOCUS_21160 290 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 617 3340 gene locus_tag LOCUS_21170 617 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3347 3625 gene locus_tag LOCUS_21180 3347 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence189 1285 671 gene locus_tag LOCUS_21190 1285 671 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962600.1 protein_id gnl|my_center|LOCUS_21190 2041 1286 gene locus_tag LOCUS_21200 2041 1286 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962599.1 protein_id gnl|my_center|LOCUS_21200 2667 2044 gene locus_tag LOCUS_21210 2667 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2961 2677 gene locus_tag LOCUS_21220 2961 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3160 2942 gene locus_tag LOCUS_21230 3160 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence190 817 242 gene locus_tag LOCUS_21240 817 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1843 968 gene locus_tag LOCUS_21250 1843 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2743 2111 gene locus_tag LOCUS_21260 2743 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2866 3216 gene locus_tag LOCUS_21270 2866 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3255 3479 gene locus_tag LOCUS_21280 3255 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence191 600 151 gene locus_tag LOCUS_21290 gene ybeY 600 151 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_21290 1098 604 gene locus_tag LOCUS_21300 1098 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1309 2028 gene locus_tag LOCUS_21310 1309 2028 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_21310 2021 3448 gene locus_tag LOCUS_21320 2021 3448 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence192 1324 197 gene locus_tag LOCUS_21330 1324 197 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028668.1 protein_id gnl|my_center|LOCUS_21330 1613 2392 gene locus_tag LOCUS_21340 1613 2392 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310179.1 protein_id gnl|my_center|LOCUS_21340 2506 2730 gene locus_tag LOCUS_21350 2506 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2779 2898 gene locus_tag LOCUS_21360 2779 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2923 3066 gene locus_tag LOCUS_21370 2923 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 3063 3500 gene locus_tag LOCUS_21380 3063 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence193 1036 44 gene locus_tag LOCUS_21390 1036 44 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362004.1 protein_id gnl|my_center|LOCUS_21390 3383 1587 gene locus_tag LOCUS_21400 3383 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence194 740 366 gene locus_tag LOCUS_21410 740 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1040 747 gene locus_tag LOCUS_21420 1040 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1908 1222 gene locus_tag LOCUS_21430 1908 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2504 1926 gene locus_tag LOCUS_21440 2504 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence195 470 171 gene locus_tag LOCUS_21450 470 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1450 764 gene locus_tag LOCUS_21460 1450 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2183 1842 gene locus_tag LOCUS_21470 2183 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 <3291 2180 gene locus_tag LOCUS_21480 <3291 2180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105447.1:DGQHR domain-containing protein >Feature sequence196 353 1651 gene locus_tag LOCUS_21490 353 1651 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124952.1 protein_id gnl|my_center|LOCUS_21490 1683 2699 gene locus_tag LOCUS_21500 gene metX 1683 2699 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_21500 2783 3103 gene locus_tag LOCUS_21510 2783 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 3219 3100 gene locus_tag LOCUS_21520 3219 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence197 >Feature sequence198 491 93 gene locus_tag LOCUS_21530 gene rpsH 491 93 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_21530 793 524 gene locus_tag LOCUS_21540 gene rpsN 793 524 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_21540 1359 808 gene locus_tag LOCUS_21550 gene rplE 1359 808 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_21550 1699 1361 gene locus_tag LOCUS_21560 gene rplX 1699 1361 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_21560 2070 1702 gene locus_tag LOCUS_21570 gene rplN 2070 1702 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_21570 2344 2072 gene locus_tag LOCUS_21580 gene rpsQ 2344 2072 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403804.1 protein_id gnl|my_center|LOCUS_21580 2568 2356 gene locus_tag LOCUS_21590 2568 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3003 2581 gene locus_tag LOCUS_21600 gene rplP 3003 2581 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence199 135 443 gene locus_tag LOCUS_21610 135 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 979 1884 gene locus_tag LOCUS_21620 979 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1894 2931 gene locus_tag LOCUS_21630 1894 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence200 395 1276 gene locus_tag LOCUS_21640 395 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2142 1285 gene locus_tag LOCUS_21650 2142 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3032 2142 gene locus_tag LOCUS_21660 3032 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence201 1878 1018 gene locus_tag LOCUS_21670 gene rfbA 1878 1018 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_21670 2014 2706 gene locus_tag LOCUS_21680 2014 2706 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence202 <1 572 gene locus_tag LOCUS_21690 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962227.1:ferrochelatase 1245 586 gene locus_tag LOCUS_21700 1245 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2173 1262 gene locus_tag LOCUS_21710 2173 1262 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_21710 2572 2186 gene locus_tag LOCUS_21720 2572 2186 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence203 275 1162 gene locus_tag LOCUS_21730 275 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1222 1941 gene locus_tag LOCUS_21740 gene cobA 1222 1941 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060761.1 protein_id gnl|my_center|LOCUS_21740 1946 2521 gene locus_tag LOCUS_21750 1946 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence204 781 392 gene locus_tag LOCUS_21760 781 392 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454259.1 protein_id gnl|my_center|LOCUS_21760 1236 805 gene locus_tag LOCUS_21770 1236 805 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_21770 1562 1239 gene locus_tag LOCUS_21780 1562 1239 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence205 1146 187 gene locus_tag LOCUS_21790 1146 187 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_21790 2094 1153 gene locus_tag LOCUS_21800 2094 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2196 2798 gene locus_tag LOCUS_21810 2196 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence206 141 770 gene locus_tag LOCUS_21820 141 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence207 1048 317 gene locus_tag LOCUS_21830 gene gldF 1048 317 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_21830 1972 1058 gene locus_tag LOCUS_21840 gene gldA 1972 1058 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_21840 2035 2751 gene locus_tag LOCUS_21850 2035 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence208 1388 975 gene locus_tag LOCUS_21860 1388 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2310 1483 gene locus_tag LOCUS_21870 gene mreC 2310 1483 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657455.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence209 1705 833 gene locus_tag LOCUS_21880 1705 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2513 1725 gene locus_tag LOCUS_21890 2513 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence210 349 104 gene locus_tag LOCUS_21900 349 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 896 354 gene locus_tag LOCUS_21910 896 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1399 896 gene locus_tag LOCUS_21920 1399 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2478 1396 gene locus_tag LOCUS_21930 2478 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence211 >Feature sequence212 1034 1783 gene locus_tag LOCUS_21940 1034 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1767 1985 gene locus_tag LOCUS_21950 1767 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence213 32 922 gene locus_tag LOCUS_21960 32 922 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_21960