>Feature sequence001 <1 669 gene locus_tag LOCUS_00010 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390174.1:N-acetyl-gamma-glutamyl-phosphate reductase 682 1209 gene locus_tag LOCUS_00020 682 1209 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_00020 1245 2921 gene locus_tag LOCUS_00030 1245 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2927 4303 gene locus_tag LOCUS_00040 2927 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390314.1 protein_id gnl|my_center|LOCUS_00040 4354 4524 gene locus_tag LOCUS_00050 4354 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5217 4849 gene locus_tag LOCUS_00060 5217 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5567 5229 gene locus_tag LOCUS_00070 5567 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6019 5777 gene locus_tag LOCUS_00080 6019 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6377 6027 gene locus_tag LOCUS_00090 6377 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6663 6394 gene locus_tag LOCUS_00100 6663 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7112 6666 gene locus_tag LOCUS_00110 7112 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7342 7109 gene locus_tag LOCUS_00120 7342 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7694 7347 gene locus_tag LOCUS_00130 7694 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 8068 7691 gene locus_tag LOCUS_00140 8068 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 9399 8053 gene locus_tag LOCUS_00150 9399 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 9571 9392 gene locus_tag LOCUS_00160 9571 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 9963 9568 gene locus_tag LOCUS_00170 9963 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 10433 9966 gene locus_tag LOCUS_00180 10433 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 11086 10472 gene locus_tag LOCUS_00190 11086 10472 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 protein_id gnl|my_center|LOCUS_00190 >Feature sequence002 <1 1032 gene locus_tag LOCUS_00200 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941440.1:sigma-54 dependent transcriptional regulator 1060 3909 gene locus_tag LOCUS_00210 1060 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 3918 4895 gene locus_tag LOCUS_00220 3918 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 4898 5524 gene locus_tag LOCUS_00230 4898 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 6681 5518 gene locus_tag LOCUS_00240 6681 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 7283 6678 gene locus_tag LOCUS_00250 7283 6678 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_00250 8200 7283 gene locus_tag LOCUS_00260 gene msrP 8200 7283 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920589.1 protein_id gnl|my_center|LOCUS_00260 9242 8376 gene locus_tag LOCUS_00270 9242 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 9858 9277 gene locus_tag LOCUS_00280 gene napC 9858 9277 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815830.1 protein_id gnl|my_center|LOCUS_00280 10514 9855 gene locus_tag LOCUS_00290 10514 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 >Feature sequence003 <1 1587 gene locus_tag LOCUS_00300 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064738.1:asparagine synthase (glutamine-hydrolyzing) 1589 2749 gene locus_tag LOCUS_00310 1589 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 2746 3888 gene locus_tag LOCUS_00320 2746 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 3942 5210 gene locus_tag LOCUS_00330 3942 5210 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_00330 5216 6172 gene locus_tag LOCUS_00340 5216 6172 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_00340 7421 6159 gene locus_tag LOCUS_00350 7421 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 7504 8490 gene locus_tag LOCUS_00360 gene moaA 7504 8490 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence004 2064 199 gene locus_tag LOCUS_00370 gene htpG 2064 199 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387833.1 protein_id gnl|my_center|LOCUS_00370 2370 2726 gene locus_tag LOCUS_00380 2370 2726 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387834.1 protein_id gnl|my_center|LOCUS_00380 2999 3856 gene locus_tag LOCUS_00390 2999 3856 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082145856.1 protein_id gnl|my_center|LOCUS_00390 4178 3942 gene locus_tag LOCUS_00400 4178 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 4399 5280 gene locus_tag LOCUS_00410 4399 5280 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470590.1 protein_id gnl|my_center|LOCUS_00410 5851 5282 gene locus_tag LOCUS_00420 gene ddpX 5851 5282 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391509.1 protein_id gnl|my_center|LOCUS_00420 5908 6585 gene locus_tag LOCUS_00430 gene tsaB 5908 6585 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_00430 6585 7073 gene locus_tag LOCUS_00440 6585 7073 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917947.1 protein_id gnl|my_center|LOCUS_00440 7305 7054 gene locus_tag LOCUS_00450 7305 7054 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391512.1 protein_id gnl|my_center|LOCUS_00450 >Feature sequence005 2883 1738 gene locus_tag LOCUS_00460 2883 1738 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_00460 4262 2880 gene locus_tag LOCUS_00470 4262 2880 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_00470 4429 5055 gene locus_tag LOCUS_00480 4429 5055 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_00480 5105 5434 gene locus_tag LOCUS_00490 5105 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 5464 5736 gene locus_tag LOCUS_00500 5464 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 5768 6061 gene locus_tag LOCUS_00510 5768 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 >Feature sequence006 1193 549 gene locus_tag LOCUS_00520 1193 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 1697 1200 gene locus_tag LOCUS_00530 1697 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 4684 1694 gene locus_tag LOCUS_00540 4684 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4999 4814 gene locus_tag LOCUS_00550 4999 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 5541 5026 gene locus_tag LOCUS_00560 5541 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence007 2770 407 gene locus_tag LOCUS_00570 2770 407 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_00570 3096 5738 gene locus_tag LOCUS_00580 gene ndvB 3096 5738 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_00580 >Feature sequence008 3641 1608 gene locus_tag LOCUS_00590 3641 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 5720 3756 gene locus_tag LOCUS_00600 5720 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 >Feature sequence009 570 1460 gene locus_tag LOCUS_00610 gene gcvA 570 1460 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 protein_id gnl|my_center|LOCUS_00610 2978 1461 gene locus_tag LOCUS_00620 2978 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 3080 4936 gene locus_tag LOCUS_00630 3080 4936 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852913.1 protein_id gnl|my_center|LOCUS_00630 <5760 5137 gene locus_tag LOCUS_00640 <5760 5137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337301.1:methylmalonyl-CoA mutase >Feature sequence010 1808 687 gene locus_tag LOCUS_00650 1808 687 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_00650 2604 1825 gene locus_tag LOCUS_00660 2604 1825 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266698.1 protein_id gnl|my_center|LOCUS_00660 3617 2601 gene locus_tag LOCUS_00670 3617 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 5229 3586 gene locus_tag LOCUS_00680 5229 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 >Feature sequence011 1142 675 gene locus_tag LOCUS_00690 1142 675 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942521.1 protein_id gnl|my_center|LOCUS_00690 1964 1152 gene locus_tag LOCUS_00700 1964 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 3577 2414 gene locus_tag LOCUS_00710 gene alkT 3577 2414 CDS product rubredoxin-NAD(+) reductase AlkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114369.1 protein_id gnl|my_center|LOCUS_00710 3746 3582 gene locus_tag LOCUS_00720 3746 3582 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763586.1 protein_id gnl|my_center|LOCUS_00720 4254 3775 gene locus_tag LOCUS_00730 4254 3775 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143723.1 protein_id gnl|my_center|LOCUS_00730 4687 4367 gene locus_tag LOCUS_00740 4687 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 >Feature sequence012 <1 695 gene locus_tag LOCUS_00750 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388177.1:beta-ketoacyl-ACP synthase II 768 1751 gene locus_tag LOCUS_00760 768 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 1860 2123 gene locus_tag LOCUS_00770 1860 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 3449 2163 gene locus_tag LOCUS_00780 gene glgC 3449 2163 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_00780 3639 5099 gene locus_tag LOCUS_00790 gene glgA 3639 5099 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_00790 >Feature sequence013 2160 370 gene locus_tag LOCUS_00800 2160 370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_00800 2278 2910 gene locus_tag LOCUS_00810 2278 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 2955 3503 gene locus_tag LOCUS_00820 gene rfbC 2955 3503 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 protein_id gnl|my_center|LOCUS_00820 3533 4387 gene locus_tag LOCUS_00830 gene rfbD 3533 4387 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence014 905 141 gene locus_tag LOCUS_00840 905 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1570 971 gene locus_tag LOCUS_00850 1570 971 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731839.1 protein_id gnl|my_center|LOCUS_00850 3952 1655 gene locus_tag LOCUS_00860 gene nosZ 3952 1655 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_00860 4119 4676 gene locus_tag LOCUS_00870 4119 4676 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 protein_id gnl|my_center|LOCUS_00870 4673 5248 gene locus_tag LOCUS_00880 4673 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 >Feature sequence015 3314 3075 gene locus_tag LOCUS_00890 3314 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 3415 3858 gene locus_tag LOCUS_00900 3415 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3968 4606 gene locus_tag LOCUS_00910 3968 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 4874 4563 gene locus_tag LOCUS_00920 4874 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 4892 5188 gene locus_tag LOCUS_00930 4892 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 >Feature sequence016 <1 537 gene locus_tag LOCUS_00940 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387816.1:VacJ family lipoprotein 544 1188 gene locus_tag LOCUS_00950 544 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 1674 1327 gene locus_tag LOCUS_00960 1674 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 3483 1807 gene locus_tag LOCUS_00970 3483 1807 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 protein_id gnl|my_center|LOCUS_00970 3791 3480 gene locus_tag LOCUS_00980 3791 3480 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence017 1625 636 gene locus_tag LOCUS_00990 gene moaA 1625 636 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388276.1 protein_id gnl|my_center|LOCUS_00990 2033 1686 gene locus_tag LOCUS_01000 2033 1686 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465043.1 protein_id gnl|my_center|LOCUS_01000 2737 2030 gene locus_tag LOCUS_01010 2737 2030 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528826.1 protein_id gnl|my_center|LOCUS_01010 2987 2739 gene locus_tag LOCUS_01020 2987 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 3161 4039 gene locus_tag LOCUS_01030 3161 4039 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399088.1 protein_id gnl|my_center|LOCUS_01030 4480 4641 gene locus_tag LOCUS_01040 4480 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 >Feature sequence018 949 1431 gene locus_tag LOCUS_01050 949 1431 CDS product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 protein_id gnl|my_center|LOCUS_01050 1718 3334 gene locus_tag LOCUS_01060 1718 3334 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626330.1 protein_id gnl|my_center|LOCUS_01060 3927 3442 gene locus_tag LOCUS_01070 3927 3442 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_01070 >Feature sequence019 2478 1855 gene locus_tag LOCUS_01080 2478 1855 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_01080 2745 3632 gene locus_tag LOCUS_01090 2745 3632 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_01090 3782 4834 gene locus_tag LOCUS_01100 3782 4834 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence020 484 1176 gene locus_tag LOCUS_01110 484 1176 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087296.1 protein_id gnl|my_center|LOCUS_01110 1703 1867 gene locus_tag LOCUS_01120 1703 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1875 2915 gene locus_tag LOCUS_01130 1875 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 3501 4781 gene locus_tag LOCUS_01140 3501 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 >Feature sequence021 2900 4312 gene locus_tag LOCUS_01150 2900 4312 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947970.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence022 <1 1280 gene locus_tag LOCUS_01160 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388017.1:tetratricopeptide repeat protein 1288 2142 gene locus_tag LOCUS_01170 1288 2142 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388016.1 protein_id gnl|my_center|LOCUS_01170 2215 2289 gene locus_tag LOCUS_t00010 2215 2289 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3116 2667 gene locus_tag LOCUS_01180 3116 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4121 3201 gene locus_tag LOCUS_01190 4121 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence023 <1 619 gene locus_tag LOCUS_01200 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004597389.1:FAD-dependent thymidylate synthase 2590 668 gene locus_tag LOCUS_01210 2590 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 3717 2692 gene locus_tag LOCUS_01220 3717 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 protein_id gnl|my_center|LOCUS_01220 3906 4919 gene locus_tag LOCUS_01230 3906 4919 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625873.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence024 1536 169 gene locus_tag LOCUS_01240 1536 169 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_01240 2402 1674 gene locus_tag LOCUS_01250 2402 1674 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_01250 2565 3917 gene locus_tag LOCUS_01260 gene fliI 2565 3917 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_01260 3978 4418 gene locus_tag LOCUS_01270 3978 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence025 4607 2778 gene locus_tag LOCUS_01280 4607 2778 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389479.1 protein_id gnl|my_center|LOCUS_01280 >Feature sequence026 1888 38 gene locus_tag LOCUS_01290 gene asnB 1888 38 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533124.1 protein_id gnl|my_center|LOCUS_01290 2999 1926 gene locus_tag LOCUS_01300 2999 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4165 3146 gene locus_tag LOCUS_01310 4165 3146 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387894.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence027 432 1007 gene locus_tag LOCUS_01320 432 1007 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055723718.1 protein_id gnl|my_center|LOCUS_01320 1173 2096 gene locus_tag LOCUS_01330 1173 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 3736 2093 gene locus_tag LOCUS_01340 3736 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 <4699 3837 gene locus_tag LOCUS_01350 <4699 3837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626092.1:potassium/proton antiporter >Feature sequence028 581 78 gene locus_tag LOCUS_01360 581 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 1279 578 gene locus_tag LOCUS_01370 1279 578 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230052.1 protein_id gnl|my_center|LOCUS_01370 2301 1276 gene locus_tag LOCUS_01380 2301 1276 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_01380 3302 2298 gene locus_tag LOCUS_01390 gene gmd 3302 2298 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771834.1 protein_id gnl|my_center|LOCUS_01390 4495 3299 gene locus_tag LOCUS_01400 gene rfbH 4495 3299 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_01400 >Feature sequence029 578 231 gene locus_tag LOCUS_01410 578 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2880 730 gene locus_tag LOCUS_01420 2880 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence030 1602 2039 gene locus_tag LOCUS_01430 1602 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 4162 2036 gene locus_tag LOCUS_01440 4162 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4671 4174 gene locus_tag LOCUS_01450 4671 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 >Feature sequence031 1 1650 gene locus_tag LOCUS_01460 1 1650 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 protein_id gnl|my_center|LOCUS_01460 1720 1905 gene locus_tag LOCUS_01470 1720 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 1921 3645 gene locus_tag LOCUS_01480 1921 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3626 3988 gene locus_tag LOCUS_01490 3626 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 3985 4371 gene locus_tag LOCUS_01500 3985 4371 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948236.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence032 280 1161 gene locus_tag LOCUS_01510 280 1161 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_01510 1165 3234 gene locus_tag LOCUS_01520 gene glyS 1165 3234 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390705.1 protein_id gnl|my_center|LOCUS_01520 >Feature sequence033 661 17 gene locus_tag LOCUS_01530 gene aat 661 17 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401515.1 protein_id gnl|my_center|LOCUS_01530 2214 871 gene locus_tag LOCUS_01540 gene accC 2214 871 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390188.1 protein_id gnl|my_center|LOCUS_01540 2680 2222 gene locus_tag LOCUS_01550 2680 2222 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390187.1 protein_id gnl|my_center|LOCUS_01550 3135 2689 gene locus_tag LOCUS_01560 gene aroQ 3135 2689 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_01560 3305 4063 gene locus_tag LOCUS_01570 3305 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 >Feature sequence034 1385 1041 gene locus_tag LOCUS_01580 1385 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 2529 1510 gene locus_tag LOCUS_01590 gene ilvC 2529 1510 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388228.1 protein_id gnl|my_center|LOCUS_01590 3108 2593 gene locus_tag LOCUS_01600 gene ilvN 3108 2593 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_01600 <4637 3138 gene locus_tag LOCUS_01610 <4637 3138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388226.1:acetolactate synthase 3 large subunit >Feature sequence035 <1 1848 gene locus_tag LOCUS_01620 <1 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389296.1:glycogen debranching protein GlgX 1848 3653 gene locus_tag LOCUS_01630 gene treZ 1848 3653 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence036 298 456 gene locus_tag LOCUS_01640 298 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 1628 453 gene locus_tag LOCUS_01650 1628 453 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_01650 2347 1721 gene locus_tag LOCUS_01660 2347 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2771 2394 gene locus_tag LOCUS_01670 2771 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3620 3081 gene locus_tag LOCUS_01680 3620 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 <4569 3630 gene locus_tag LOCUS_01690 <4569 3630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125776.1:adenosylmethionine--8-amino-7-oxononanoate transaminase >Feature sequence037 2393 702 gene locus_tag LOCUS_01700 2393 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 <4532 2616 gene locus_tag LOCUS_01710 <4532 2616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390504.1:DNA-directed RNA polymerase subunit beta' >Feature sequence038 315 1190 gene locus_tag LOCUS_01720 gene mtrA 315 1190 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_01720 1209 3365 gene locus_tag LOCUS_01730 1209 3365 CDS product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071630.1 protein_id gnl|my_center|LOCUS_01730 >Feature sequence039 192 485 gene locus_tag LOCUS_01740 192 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 487 645 gene locus_tag LOCUS_01750 487 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 664 831 gene locus_tag LOCUS_01760 664 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 1047 766 gene locus_tag LOCUS_01770 1047 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 1163 3820 gene locus_tag LOCUS_01780 1163 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 >Feature sequence040 275 787 gene locus_tag LOCUS_01790 275 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 792 1529 gene locus_tag LOCUS_01800 792 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 protein_id gnl|my_center|LOCUS_01800 1659 2048 gene locus_tag LOCUS_01810 1659 2048 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_01810 2065 2706 gene locus_tag LOCUS_01820 2065 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 >Feature sequence041 495 2366 gene locus_tag LOCUS_01830 495 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2363 2614 gene locus_tag LOCUS_01840 gene moaD 2363 2614 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_01840 2634 2798 gene locus_tag LOCUS_01850 2634 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 3293 2940 gene locus_tag LOCUS_01860 3293 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 3559 3404 gene locus_tag LOCUS_01870 3559 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3990 3514 gene locus_tag LOCUS_01880 3990 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 4430 3993 gene locus_tag LOCUS_01890 4430 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938800.1 protein_id gnl|my_center|LOCUS_01890 >Feature sequence042 <1 993 gene locus_tag LOCUS_01900 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640386.1:beta-N-acetylhexosaminidase 990 1676 gene locus_tag LOCUS_01910 990 1676 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_01910 1682 2485 gene locus_tag LOCUS_01920 1682 2485 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_01920 2482 3135 gene locus_tag LOCUS_01930 gene scpB 2482 3135 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389527.1 protein_id gnl|my_center|LOCUS_01930 3292 3519 gene locus_tag LOCUS_01940 3292 3519 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314389.1 protein_id gnl|my_center|LOCUS_01940 3568 3960 gene locus_tag LOCUS_01950 gene tatB 3568 3960 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389525.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence043 1807 362 gene locus_tag LOCUS_01960 gene pyk 1807 362 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_01960 2537 1926 gene locus_tag LOCUS_01970 2537 1926 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942270.1 protein_id gnl|my_center|LOCUS_01970 3594 2719 gene locus_tag LOCUS_01980 3594 2719 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066636.1 protein_id gnl|my_center|LOCUS_01980 <4449 3591 gene locus_tag LOCUS_01990 <4449 3591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200879.1:ureidoglycolate lyase >Feature sequence044 179 1558 gene locus_tag LOCUS_02000 179 1558 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_02000 1622 2752 gene locus_tag LOCUS_02010 gene ald 1622 2752 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531466.1 protein_id gnl|my_center|LOCUS_02010 2758 3297 gene locus_tag LOCUS_02020 gene ppa 2758 3297 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387907.1 protein_id gnl|my_center|LOCUS_02020 3766 3996 gene locus_tag LOCUS_02030 3766 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence045 204 617 gene locus_tag LOCUS_02040 204 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 843 628 gene locus_tag LOCUS_02050 843 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2121 907 gene locus_tag LOCUS_02060 2121 907 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205497.1 protein_id gnl|my_center|LOCUS_02060 2412 2879 gene locus_tag LOCUS_02070 gene rplM 2412 2879 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720164.1 protein_id gnl|my_center|LOCUS_02070 2885 3355 gene locus_tag LOCUS_02080 gene rpsI 2885 3355 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312739.1 protein_id gnl|my_center|LOCUS_02080 3444 3848 gene locus_tag LOCUS_02090 3444 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 <4433 3855 gene locus_tag LOCUS_02100 <4433 3855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391395.1:fructosamine kinase family protein >Feature sequence046 1388 2170 gene locus_tag LOCUS_02110 1388 2170 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389168.1 protein_id gnl|my_center|LOCUS_02110 3943 2300 gene locus_tag LOCUS_02120 3943 2300 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389163.1 protein_id gnl|my_center|LOCUS_02120 4122 4412 gene locus_tag LOCUS_02130 4122 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence047 <1 848 gene locus_tag LOCUS_02140 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973141.1:glycosyltransferase family 4 protein 845 1597 gene locus_tag LOCUS_02150 845 1597 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_02150 1602 2639 gene locus_tag LOCUS_02160 1602 2639 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390689.1 protein_id gnl|my_center|LOCUS_02160 2636 3739 gene locus_tag LOCUS_02170 2636 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 3885 3736 gene locus_tag LOCUS_02180 3885 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence048 125 970 gene locus_tag LOCUS_02190 gene pssA 125 970 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_02190 1458 1045 gene locus_tag LOCUS_02200 1458 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 1871 1464 gene locus_tag LOCUS_02210 1871 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 3471 1984 gene locus_tag LOCUS_02220 3471 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 4159 3464 gene locus_tag LOCUS_02230 4159 3464 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170303643.1 protein_id gnl|my_center|LOCUS_02230 >Feature sequence049 463 732 gene locus_tag LOCUS_02240 463 732 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643418.1 protein_id gnl|my_center|LOCUS_02240 1922 813 gene locus_tag LOCUS_02250 1922 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 protein_id gnl|my_center|LOCUS_02250 2191 2267 gene locus_tag LOCUS_t00020 2191 2267 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2511 2699 gene locus_tag LOCUS_02260 2511 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence050 2647 1466 gene locus_tag LOCUS_02270 2647 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3066 2776 gene locus_tag LOCUS_02280 3066 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 3672 3070 gene locus_tag LOCUS_02290 3672 3070 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence051 <4360 3315 gene locus_tag LOCUS_02300 <4360 3315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391376.1:DNA polymerase III subunit delta >Feature sequence052 1033 119 gene locus_tag LOCUS_02310 1033 119 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_02310 1848 1030 gene locus_tag LOCUS_02320 1848 1030 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_02320 2446 1829 gene locus_tag LOCUS_02330 gene rsmG 2446 1829 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391373.1 protein_id gnl|my_center|LOCUS_02330 <4358 2513 gene locus_tag LOCUS_02340 <4358 2513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391372.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG >Feature sequence053 217 1005 gene locus_tag LOCUS_02350 217 1005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_02350 1396 3288 gene locus_tag LOCUS_02360 gene uvrC 1396 3288 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_02360 3382 3978 gene locus_tag LOCUS_02370 gene pgsA 3382 3978 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence054 535 41 gene locus_tag LOCUS_02380 535 41 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_02380 1247 705 gene locus_tag LOCUS_02390 1247 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1864 1313 gene locus_tag LOCUS_02400 gene thpR 1864 1313 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067279.1 protein_id gnl|my_center|LOCUS_02400 3009 1864 gene locus_tag LOCUS_02410 3009 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3581 3006 gene locus_tag LOCUS_02420 3581 3006 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence055 3278 1176 gene locus_tag LOCUS_02430 3278 1176 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_02430 3724 3350 gene locus_tag LOCUS_02440 3724 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3996 3847 gene locus_tag LOCUS_02450 3996 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4294 4064 gene locus_tag LOCUS_02460 4294 4064 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626541.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence056 320 1393 gene locus_tag LOCUS_02470 gene flhB 320 1393 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_02470 1383 3776 gene locus_tag LOCUS_02480 1383 3776 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390447.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence057 2311 851 gene locus_tag LOCUS_02490 gene gatB 2311 851 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_02490 3785 2313 gene locus_tag LOCUS_02500 gene gatA 3785 2313 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390924.1 protein_id gnl|my_center|LOCUS_02500 4084 3785 gene locus_tag LOCUS_02510 gene gatC 4084 3785 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390925.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence058 2124 187 gene locus_tag LOCUS_02520 2124 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2826 2380 gene locus_tag LOCUS_02530 2826 2380 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389911.1 protein_id gnl|my_center|LOCUS_02530 <4241 2935 gene locus_tag LOCUS_02540 <4241 2935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390685.1:PAS domain-containing protein >Feature sequence059 2119 1523 gene locus_tag LOCUS_02550 2119 1523 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_02550 2624 2124 gene locus_tag LOCUS_02560 gene lspA 2624 2124 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_02560 <4238 2633 gene locus_tag LOCUS_02570 <4238 2633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390714.1:isoleucine--tRNA ligase >Feature sequence060 112 1107 gene locus_tag LOCUS_02580 gene rfbB 112 1107 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387761.1 protein_id gnl|my_center|LOCUS_02580 1104 1958 gene locus_tag LOCUS_02590 gene rfbD 1104 1958 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_02590 1955 2851 gene locus_tag LOCUS_02600 gene rfbA 1955 2851 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815331.1 protein_id gnl|my_center|LOCUS_02600 2911 3549 gene locus_tag LOCUS_02610 2911 3549 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313741.1 protein_id gnl|my_center|LOCUS_02610 >Feature sequence061 331 1152 gene locus_tag LOCUS_02620 331 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1923 1222 gene locus_tag LOCUS_02630 1923 1222 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence062 3 1853 gene locus_tag LOCUS_02640 3 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1967 2965 gene locus_tag LOCUS_02650 1967 2965 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675255.1 protein_id gnl|my_center|LOCUS_02650 2971 3645 gene locus_tag LOCUS_02660 2971 3645 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence063 1147 413 gene locus_tag LOCUS_02670 1147 413 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388164.1 protein_id gnl|my_center|LOCUS_02670 2554 1181 gene locus_tag LOCUS_02680 gene radA 2554 1181 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_02680 3513 2725 gene locus_tag LOCUS_02690 3513 2725 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_02690 <4143 3510 gene locus_tag LOCUS_02700 <4143 3510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388167.1:ABC transporter permease >Feature sequence064 571 3267 gene locus_tag LOCUS_02710 gene secA 571 3267 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence065 195 1679 gene locus_tag LOCUS_02720 195 1679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119278.1 protein_id gnl|my_center|LOCUS_02720 1822 2637 gene locus_tag LOCUS_02730 1822 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 2720 3418 gene locus_tag LOCUS_02740 2720 3418 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_02740 3431 4021 gene locus_tag LOCUS_02750 3431 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence066 719 78 gene locus_tag LOCUS_02760 gene rpsE 719 78 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390421.1 protein_id gnl|my_center|LOCUS_02760 1094 732 gene locus_tag LOCUS_02770 gene rplR 1094 732 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390422.1 protein_id gnl|my_center|LOCUS_02770 1639 1106 gene locus_tag LOCUS_02780 gene rplF 1639 1106 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390423.1 protein_id gnl|my_center|LOCUS_02780 2051 1653 gene locus_tag LOCUS_02790 gene rpsH 2051 1653 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_02790 2372 2067 gene locus_tag LOCUS_02800 gene rpsN 2372 2067 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531430.1 protein_id gnl|my_center|LOCUS_02800 2930 2388 gene locus_tag LOCUS_02810 gene rplE 2930 2388 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390426.1 protein_id gnl|my_center|LOCUS_02810 3268 2948 gene locus_tag LOCUS_02820 gene rplX 3268 2948 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_02820 3636 3268 gene locus_tag LOCUS_02830 gene rplN 3636 3268 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_02830 3913 3677 gene locus_tag LOCUS_02840 gene rpsQ 3913 3677 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390429.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence067 381 1823 gene locus_tag LOCUS_02850 381 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1840 2319 gene locus_tag LOCUS_02860 1840 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2319 3242 gene locus_tag LOCUS_02870 2319 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 3248 3547 gene locus_tag LOCUS_02880 3248 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence068 400 484 gene locus_tag LOCUS_t00030 400 484 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 582 1163 gene locus_tag LOCUS_02890 582 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 1160 2590 gene locus_tag LOCUS_02900 1160 2590 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939668.1 protein_id gnl|my_center|LOCUS_02900 2931 2701 gene locus_tag LOCUS_02910 2931 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3095 3835 gene locus_tag LOCUS_02920 3095 3835 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390008.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence069 2499 262 gene locus_tag LOCUS_02930 2499 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3400 2504 gene locus_tag LOCUS_02940 3400 2504 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389859.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence070 <1 574 gene locus_tag LOCUS_02950 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930182.1:response regulator transcription factor 586 1890 gene locus_tag LOCUS_02960 586 1890 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388311.1 protein_id gnl|my_center|LOCUS_02960 1887 2633 gene locus_tag LOCUS_02970 1887 2633 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707640.1 protein_id gnl|my_center|LOCUS_02970 2745 3299 gene locus_tag LOCUS_02980 gene siaB 2745 3299 CDS product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_02980 3308 3694 gene locus_tag LOCUS_02990 gene siaC 3308 3694 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_02990 3694 3927 gene locus_tag LOCUS_03000 3694 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence071 834 538 gene locus_tag LOCUS_03010 834 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 1856 834 gene locus_tag LOCUS_03020 1856 834 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 protein_id gnl|my_center|LOCUS_03020 2259 1870 gene locus_tag LOCUS_03030 2259 1870 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339610.1 protein_id gnl|my_center|LOCUS_03030 3521 2262 gene locus_tag LOCUS_03040 3521 2262 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339479.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence072 <1 749 gene locus_tag LOCUS_03050 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391017.1:methyltransferase domain-containing protein 1356 733 gene locus_tag LOCUS_03060 gene metW 1356 733 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_03060 2543 1362 gene locus_tag LOCUS_03070 2543 1362 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_03070 2672 3532 gene locus_tag LOCUS_03080 2672 3532 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence073 432 851 gene locus_tag LOCUS_03090 432 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 986 1345 gene locus_tag LOCUS_03100 986 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 1907 1608 gene locus_tag LOCUS_03110 1907 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 2964 2891 gene locus_tag LOCUS_t00040 2964 2891 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 2053 1709 gene locus_tag LOCUS_03120 2053 1709 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917957.1 protein_id gnl|my_center|LOCUS_03120 2681 2274 gene locus_tag LOCUS_03130 2681 2274 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_03130 2953 2678 gene locus_tag LOCUS_03140 2953 2678 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 protein_id gnl|my_center|LOCUS_03140 3972 2980 gene locus_tag LOCUS_03150 3972 2980 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391318.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence075 <1 971 gene locus_tag LOCUS_03160 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948400.1:class I SAM-dependent DNA methyltransferase 1442 2152 gene locus_tag LOCUS_03170 1442 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2156 2371 gene locus_tag LOCUS_03180 2156 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 3019 2672 gene locus_tag LOCUS_03190 3019 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence076 1624 374 gene locus_tag LOCUS_03200 1624 374 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_03200 1933 2271 gene locus_tag LOCUS_03210 1933 2271 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_03210 2662 3063 gene locus_tag LOCUS_03220 2662 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence077 1413 199 gene locus_tag LOCUS_03230 1413 199 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067077.1 protein_id gnl|my_center|LOCUS_03230 2184 1474 gene locus_tag LOCUS_03240 2184 1474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 protein_id gnl|my_center|LOCUS_03240 2941 2177 gene locus_tag LOCUS_03250 2941 2177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391052.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence078 <1 1112 gene locus_tag LOCUS_03260 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942194.1:tetratricopeptide repeat protein 1109 1345 gene locus_tag LOCUS_03270 1109 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 2382 1342 gene locus_tag LOCUS_03280 2382 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3553 2504 gene locus_tag LOCUS_03290 3553 2504 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_03290 >Feature sequence079 115 1074 gene locus_tag LOCUS_03300 115 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 1078 3294 gene locus_tag LOCUS_03310 1078 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 3298 3804 gene locus_tag LOCUS_03320 3298 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence080 996 1277 gene locus_tag LOCUS_03330 996 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1318 1602 gene locus_tag LOCUS_03340 1318 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1609 3336 gene locus_tag LOCUS_03350 gene yidC 1609 3336 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_03350 >Feature sequence081 402 1451 gene locus_tag LOCUS_03360 402 1451 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937525.1 protein_id gnl|my_center|LOCUS_03360 1445 2041 gene locus_tag LOCUS_03370 1445 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 2038 2511 gene locus_tag LOCUS_03380 2038 2511 CDS product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940118.1 protein_id gnl|my_center|LOCUS_03380 2501 3568 gene locus_tag LOCUS_03390 2501 3568 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937528.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence082 572 2464 gene locus_tag LOCUS_03400 572 2464 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_03400 2457 3404 gene locus_tag LOCUS_03410 2457 3404 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390838.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence083 324 1628 gene locus_tag LOCUS_03420 324 1628 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_03420 1677 2321 gene locus_tag LOCUS_03430 1677 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2435 2689 gene locus_tag LOCUS_03440 2435 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 2693 2998 gene locus_tag LOCUS_03450 2693 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence084 679 1914 gene locus_tag LOCUS_03460 679 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3017 1926 gene locus_tag LOCUS_03470 3017 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 3450 3130 gene locus_tag LOCUS_03480 3450 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence085 455 2260 gene locus_tag LOCUS_03490 455 2260 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence086 1840 833 gene locus_tag LOCUS_03500 1840 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 1912 2064 gene locus_tag LOCUS_03510 1912 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3164 2061 gene locus_tag LOCUS_03520 3164 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence087 37 378 gene locus_tag LOCUS_03530 37 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389500.1 protein_id gnl|my_center|LOCUS_03530 487 1596 gene locus_tag LOCUS_03540 487 1596 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_03540 1677 2027 gene locus_tag LOCUS_03550 1677 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence088 94 726 gene locus_tag LOCUS_03560 94 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1743 733 gene locus_tag LOCUS_03570 1743 733 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence089 655 2013 gene locus_tag LOCUS_03580 gene nifB 655 2013 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533511.1 protein_id gnl|my_center|LOCUS_03580 2048 2236 gene locus_tag LOCUS_03590 2048 2236 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388750.1 protein_id gnl|my_center|LOCUS_03590 2350 2613 gene locus_tag LOCUS_03600 2350 2613 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606399.1 protein_id gnl|my_center|LOCUS_03600 2610 2822 gene locus_tag LOCUS_03610 gene nifT 2610 2822 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388753.1 protein_id gnl|my_center|LOCUS_03610 2822 3694 gene locus_tag LOCUS_03620 2822 3694 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388754.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence090 1060 236 gene locus_tag LOCUS_03630 gene lptB 1060 236 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_03630 1973 1071 gene locus_tag LOCUS_03640 1973 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_03640 2650 1970 gene locus_tag LOCUS_03650 gene lptC 2650 1970 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387774.1 protein_id gnl|my_center|LOCUS_03650 3641 2661 gene locus_tag LOCUS_03660 3641 2661 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence091 832 1482 gene locus_tag LOCUS_03670 832 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1657 1992 gene locus_tag LOCUS_03680 1657 1992 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390473.1 protein_id gnl|my_center|LOCUS_03680 1996 2757 gene locus_tag LOCUS_03690 1996 2757 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707832.1 protein_id gnl|my_center|LOCUS_03690 2766 3509 gene locus_tag LOCUS_03700 2766 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence092 935 252 gene locus_tag LOCUS_03710 935 252 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030618.1 protein_id gnl|my_center|LOCUS_03710 1631 960 gene locus_tag LOCUS_03720 1631 960 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_03720 2168 1704 gene locus_tag LOCUS_03730 gene ptsN 2168 1704 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_03730 <3771 2333 gene locus_tag LOCUS_03740 <3771 2333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387771.1:RNA polymerase factor sigma-54 >Feature sequence093 486 118 gene locus_tag LOCUS_03750 486 118 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391348.1 protein_id gnl|my_center|LOCUS_03750 1040 483 gene locus_tag LOCUS_03760 1040 483 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 protein_id gnl|my_center|LOCUS_03760 1580 1044 gene locus_tag LOCUS_03770 1580 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1752 1967 gene locus_tag LOCUS_03780 1752 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3160 1973 gene locus_tag LOCUS_03790 3160 1973 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391354.1 protein_id gnl|my_center|LOCUS_03790 <3763 3168 gene locus_tag LOCUS_03800 <3763 3168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391355.1:Tim44/TimA family putative adaptor protein >Feature sequence094 39 1487 gene locus_tag LOCUS_03810 39 1487 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_03810 1522 2826 gene locus_tag LOCUS_03820 1522 2826 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence095 <1 1205 gene locus_tag LOCUS_03830 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391288.1:DNA mismatch repair protein MutS >Feature sequence096 <1 2482 gene locus_tag LOCUS_03840 <1 2482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390505.1:DNA-directed RNA polymerase subunit beta >Feature sequence097 1512 805 gene locus_tag LOCUS_03850 1512 805 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073551.1 protein_id gnl|my_center|LOCUS_03850 1773 1558 gene locus_tag LOCUS_03860 1773 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 <3682 2761 gene locus_tag LOCUS_03870 <3682 2761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189867.1:class II fumarate hydratase >Feature sequence098 1369 863 gene locus_tag LOCUS_03880 1369 863 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067251.1 protein_id gnl|my_center|LOCUS_03880 1505 1579 gene locus_tag LOCUS_t00050 1505 1579 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1670 2011 gene locus_tag LOCUS_03890 1670 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2560 2081 gene locus_tag LOCUS_03900 2560 2081 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389735.1 protein_id gnl|my_center|LOCUS_03900 2922 2575 gene locus_tag LOCUS_03910 2922 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 3068 3637 gene locus_tag LOCUS_03920 3068 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence099 <1 1157 gene locus_tag LOCUS_03930 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389877.1:molybdopterin molybdotransferase MoeA 1154 1405 gene locus_tag LOCUS_03940 gene moaD 1154 1405 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_03940 1410 1865 gene locus_tag LOCUS_03950 1410 1865 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 protein_id gnl|my_center|LOCUS_03950 2241 2501 gene locus_tag LOCUS_03960 2241 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 3299 3586 gene locus_tag LOCUS_03970 3299 3586 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919220.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence100 56 1972 gene locus_tag LOCUS_03980 56 1972 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence101 918 205 gene locus_tag LOCUS_03990 gene recO 918 205 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389602.1 protein_id gnl|my_center|LOCUS_03990 1159 950 gene locus_tag LOCUS_04000 1159 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 2089 1178 gene locus_tag LOCUS_04010 gene era 2089 1178 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389604.1 protein_id gnl|my_center|LOCUS_04010 2772 2086 gene locus_tag LOCUS_04020 gene rnc 2772 2086 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_04020 3520 2777 gene locus_tag LOCUS_04030 gene lepB 3520 2777 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence102 634 879 gene locus_tag LOCUS_04040 634 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 876 1268 gene locus_tag LOCUS_04050 876 1268 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_04050 1477 2298 gene locus_tag LOCUS_04060 1477 2298 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence103 1963 278 gene locus_tag LOCUS_04070 1963 278 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 protein_id gnl|my_center|LOCUS_04070 2319 1963 gene locus_tag LOCUS_04080 2319 1963 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence104 303 821 gene locus_tag LOCUS_04090 303 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 847 1224 gene locus_tag LOCUS_04100 847 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 1295 3559 gene locus_tag LOCUS_04110 1295 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 >Feature sequence105 337 1674 gene locus_tag LOCUS_04120 337 1674 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_04120 1780 2259 gene locus_tag LOCUS_04130 1780 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2325 2723 gene locus_tag LOCUS_04140 2325 2723 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_04140 <3590 2763 gene locus_tag LOCUS_04150 <3590 2763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389284.1:methionine synthase >Feature sequence106 193 2481 gene locus_tag LOCUS_04160 gene maeB 193 2481 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence107 <1 512 gene locus_tag LOCUS_04170 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390694.1:ATP/GTP-binding protein 602 1900 gene locus_tag LOCUS_04180 602 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2818 1949 gene locus_tag LOCUS_04190 2818 1949 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence108 618 1256 gene locus_tag LOCUS_04200 gene ftsE 618 1256 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_04200 1256 2146 gene locus_tag LOCUS_04210 1256 2146 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_04210 2143 2805 gene locus_tag LOCUS_04220 2143 2805 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391004.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence109 1273 281 gene locus_tag LOCUS_04230 1273 281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390251.1 protein_id gnl|my_center|LOCUS_04230 2452 1415 gene locus_tag LOCUS_04240 2452 1415 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_04240 3500 2484 gene locus_tag LOCUS_04250 gene trpS 3500 2484 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence110 >Feature sequence111 281 357 gene locus_tag LOCUS_t00060 281 357 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 451 1134 gene locus_tag LOCUS_04260 451 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1450 1139 gene locus_tag LOCUS_04270 1450 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 1649 1957 gene locus_tag LOCUS_04280 1649 1957 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389336.1 protein_id gnl|my_center|LOCUS_04280 1985 2061 gene locus_tag LOCUS_t00070 1985 2061 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2309 2488 gene locus_tag LOCUS_04290 2309 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence112 26 376 gene locus_tag LOCUS_04300 26 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 400 1374 gene locus_tag LOCUS_04310 gene meaB 400 1374 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 protein_id gnl|my_center|LOCUS_04310 1516 2034 gene locus_tag LOCUS_04320 1516 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2212 2514 gene locus_tag LOCUS_04330 gene rpmB 2212 2514 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387963.1 protein_id gnl|my_center|LOCUS_04330 3456 2617 gene locus_tag LOCUS_04340 3456 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence113 >Feature sequence114 >Feature sequence115 260 1123 gene locus_tag LOCUS_04350 260 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 1259 2464 gene locus_tag LOCUS_04360 1259 2464 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389621.1 protein_id gnl|my_center|LOCUS_04360 2445 2888 gene locus_tag LOCUS_04370 2445 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence116 1128 631 gene locus_tag LOCUS_04380 1128 631 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_04380 2447 1128 gene locus_tag LOCUS_04390 2447 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3383 2454 gene locus_tag LOCUS_04400 3383 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence117 1220 12 gene locus_tag LOCUS_04410 1220 12 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391051.1 protein_id gnl|my_center|LOCUS_04410 2300 1368 gene locus_tag LOCUS_04420 2300 1368 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_04420 2443 3084 gene locus_tag LOCUS_04430 2443 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence118 876 1808 gene locus_tag LOCUS_04440 gene cas1 876 1808 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_04440 1834 2139 gene locus_tag LOCUS_04450 1834 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2204 2767 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtttagccgatggggaaatgcgggcaagccgcaac >Feature sequence119 1565 324 gene locus_tag LOCUS_04460 1565 324 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 protein_id gnl|my_center|LOCUS_04460 1831 3282 gene locus_tag LOCUS_04470 gene ccoN 1831 3282 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391079.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence120 <1 1712 gene locus_tag LOCUS_04480 <1 1712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391071.1:heavy metal translocating P-type ATPase metal-binding domain-containing protein 1709 1888 gene locus_tag LOCUS_04490 gene ccoS 1709 1888 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391070.1 protein_id gnl|my_center|LOCUS_04490 1901 2668 gene locus_tag LOCUS_04500 1901 2668 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence121 >Feature sequence122 1873 191 gene locus_tag LOCUS_04510 1873 191 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389831.1 protein_id gnl|my_center|LOCUS_04510 <3321 2026 gene locus_tag LOCUS_04520 <3321 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388895.1:elongation factor G >Feature sequence123 2404 383 gene locus_tag LOCUS_04530 2404 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2981 2538 gene locus_tag LOCUS_04540 2981 2538 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720120.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence124 2381 276 gene locus_tag LOCUS_04550 gene flhA 2381 276 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 protein_id gnl|my_center|LOCUS_04550 <3309 2411 gene locus_tag LOCUS_04560 <3309 2411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388298.1:sigma-54 dependent transcriptional regulator >Feature sequence125 1870 1244 gene locus_tag LOCUS_04570 gene hscB 1870 1244 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165441213.1 protein_id gnl|my_center|LOCUS_04570 2284 1952 gene locus_tag LOCUS_04580 2284 1952 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597725.1 protein_id gnl|my_center|LOCUS_04580 2771 2361 gene locus_tag LOCUS_04590 gene iscU 2771 2361 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299770.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence126 1231 419 gene locus_tag LOCUS_04600 1231 419 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389242.1 protein_id gnl|my_center|LOCUS_04600 1870 1376 gene locus_tag LOCUS_04610 1870 1376 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387840.1 protein_id gnl|my_center|LOCUS_04610 2502 2170 gene locus_tag LOCUS_04620 2502 2170 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387838.1 protein_id gnl|my_center|LOCUS_04620 3000 2542 gene locus_tag LOCUS_04630 3000 2542 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence127 1907 744 gene locus_tag LOCUS_04640 1907 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 2711 1983 gene locus_tag LOCUS_04650 2711 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 <3268 2708 gene locus_tag LOCUS_04660 <3268 2708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123535.1:aldo/keto reductase >Feature sequence128 43 648 gene locus_tag LOCUS_04670 43 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 1238 654 gene locus_tag LOCUS_04680 1238 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2121 1261 gene locus_tag LOCUS_04690 gene purU 2121 1261 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388314.1 protein_id gnl|my_center|LOCUS_04690 2354 2695 gene locus_tag LOCUS_04700 2354 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence129 <1 1261 gene locus_tag LOCUS_04710 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103710.1:TrkH family potassium uptake protein 1907 1317 gene locus_tag LOCUS_04720 1907 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2895 1972 gene locus_tag LOCUS_04730 2895 1972 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391023.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence130 <1 853 gene locus_tag LOCUS_04740 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257543.1:PP2C family protein-serine/threonine phosphatase 1799 1071 gene locus_tag LOCUS_04750 1799 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1940 2344 gene locus_tag LOCUS_04760 1940 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3119 2373 gene locus_tag LOCUS_04770 3119 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence131 2 865 gene locus_tag LOCUS_04780 2 865 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545144.1 protein_id gnl|my_center|LOCUS_04780 1613 885 gene locus_tag LOCUS_04790 1613 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2658 1765 gene locus_tag LOCUS_04800 2658 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 3076 2741 gene locus_tag LOCUS_04810 3076 2741 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920851.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence132 26 1390 gene locus_tag LOCUS_04820 gene ffh 26 1390 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388939.1 protein_id gnl|my_center|LOCUS_04820 1432 1806 gene locus_tag LOCUS_04830 1432 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 1813 2346 gene locus_tag LOCUS_04840 gene rimM 1813 2346 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388941.1 protein_id gnl|my_center|LOCUS_04840 2330 3052 gene locus_tag LOCUS_04850 gene trmD 2330 3052 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388942.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence133 1170 22 gene locus_tag LOCUS_04860 1170 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2564 1281 gene locus_tag LOCUS_04870 2564 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 <3205 2668 gene locus_tag LOCUS_04880 <3205 2668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388162.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence134 968 666 gene locus_tag LOCUS_04890 968 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1501 977 gene locus_tag LOCUS_04900 1501 977 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813582.1 protein_id gnl|my_center|LOCUS_04900 1914 1597 gene locus_tag LOCUS_04910 1914 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 <3192 2240 gene locus_tag LOCUS_04920 <3192 2240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056364.1:Fe(3+) ABC transporter substrate-binding protein >Feature sequence135 615 1880 gene locus_tag LOCUS_04930 615 1880 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640422.1 protein_id gnl|my_center|LOCUS_04930 2474 1980 gene locus_tag LOCUS_04940 2474 1980 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 protein_id gnl|my_center|LOCUS_04940 3096 2479 gene locus_tag LOCUS_04950 3096 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence136 <3187 1404 gene locus_tag LOCUS_04960 <3187 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390535.1:PAS domain-containing protein >Feature sequence137 814 77 gene locus_tag LOCUS_04970 814 77 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_04970 1658 846 gene locus_tag LOCUS_04980 1658 846 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378608.1 protein_id gnl|my_center|LOCUS_04980 2589 1666 gene locus_tag LOCUS_04990 2589 1666 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_04990 <3180 2583 gene locus_tag LOCUS_05000 <3180 2583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817265.1:circularly permuted type 2 ATP-grasp protein >Feature sequence138 553 1356 gene locus_tag LOCUS_05010 553 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 1611 2657 gene locus_tag LOCUS_05020 1611 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence139 <1 545 gene locus_tag LOCUS_05030 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389924.1:homocitrate synthase note possible pseudo, frameshifted 558 893 gene locus_tag LOCUS_05040 gene nifW 558 893 CDS product nitrogenase stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338296.1 protein_id gnl|my_center|LOCUS_05040 1042 1890 gene locus_tag LOCUS_05050 1042 1890 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389922.1 protein_id gnl|my_center|LOCUS_05050 1905 2999 gene locus_tag LOCUS_05060 1905 2999 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389921.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence140 300 2750 gene locus_tag LOCUS_05070 300 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence141 815 147 gene locus_tag LOCUS_05080 815 147 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842742.1 protein_id gnl|my_center|LOCUS_05080 964 1134 gene locus_tag LOCUS_05090 964 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence142 1465 680 gene locus_tag LOCUS_05100 1465 680 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_05100 1541 2176 gene locus_tag LOCUS_05110 1541 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2562 2209 gene locus_tag LOCUS_05120 gene erpA 2562 2209 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence143 3 611 gene locus_tag LOCUS_05130 3 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 1324 2310 gene locus_tag LOCUS_05140 1324 2310 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence144 2483 1176 gene locus_tag LOCUS_05150 2483 1176 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence145 347 727 gene locus_tag LOCUS_05160 347 727 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391439.1 protein_id gnl|my_center|LOCUS_05160 787 1389 gene locus_tag LOCUS_05170 787 1389 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470637.1 protein_id gnl|my_center|LOCUS_05170 1394 2203 gene locus_tag LOCUS_05180 1394 2203 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030075.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence146 <1 1002 gene locus_tag LOCUS_05190 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389160.1:chemotaxis response regulator protein-glutamate methylesterase 2895 1009 gene locus_tag LOCUS_05200 2895 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence147 <1 582 gene locus_tag LOCUS_05210 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255994.1:glycosyltransferase family 1 protein 575 1768 gene locus_tag LOCUS_05220 575 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1765 2874 gene locus_tag LOCUS_05230 1765 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence148 407 1567 gene locus_tag LOCUS_05240 407 1567 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 protein_id gnl|my_center|LOCUS_05240 1926 1663 gene locus_tag LOCUS_05250 1926 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2513 2028 gene locus_tag LOCUS_05260 2513 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence149 <1 2457 gene locus_tag LOCUS_05270 <1 2457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein 2454 2819 gene locus_tag LOCUS_05280 2454 2819 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence150 420 572 gene locus_tag LOCUS_05290 420 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 683 967 gene locus_tag LOCUS_05300 683 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 964 1164 gene locus_tag LOCUS_05310 964 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 1148 2560 gene locus_tag LOCUS_05320 1148 2560 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence151 958 338 gene locus_tag LOCUS_05330 958 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975736.1 protein_id gnl|my_center|LOCUS_05330 2147 972 gene locus_tag LOCUS_05340 2147 972 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255467.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence152 <1 879 gene locus_tag LOCUS_05350 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388802.1:ATP-dependent 6-phosphofructokinase 1467 898 gene locus_tag LOCUS_05360 1467 898 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086312.1 protein_id gnl|my_center|LOCUS_05360 1618 1794 gene locus_tag LOCUS_05370 1618 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence153 1281 709 gene locus_tag LOCUS_05380 1281 709 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 protein_id gnl|my_center|LOCUS_05380 1741 2556 gene locus_tag LOCUS_05390 1741 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence154 653 991 gene locus_tag LOCUS_05400 653 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2770 1094 gene locus_tag LOCUS_05410 gene actP 2770 1094 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209029.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence155 2 859 gene locus_tag LOCUS_05420 2 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 924 2015 gene locus_tag LOCUS_05430 924 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2438 2022 gene locus_tag LOCUS_05440 2438 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 2847 2449 gene locus_tag LOCUS_05450 2847 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence156 1316 621 gene locus_tag LOCUS_05460 1316 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2033 1686 gene locus_tag LOCUS_05470 2033 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2708 2166 gene locus_tag LOCUS_05480 2708 2166 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390991.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence157 284 535 gene locus_tag LOCUS_05490 284 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 652 1110 gene locus_tag LOCUS_05500 652 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2776 1166 gene locus_tag LOCUS_05510 2776 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence158 <1 1329 gene locus_tag LOCUS_05520 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114182.1:L-aspartate oxidase 1326 1718 gene locus_tag LOCUS_05530 1326 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1718 2092 gene locus_tag LOCUS_05540 1718 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2819 2190 gene locus_tag LOCUS_05550 2819 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence159 412 1665 gene locus_tag LOCUS_05560 412 1665 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_05560 1690 2613 gene locus_tag LOCUS_05570 1690 2613 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence160 165 1679 gene locus_tag LOCUS_05580 165 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 2005 1772 gene locus_tag LOCUS_05590 2005 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2127 2858 gene locus_tag LOCUS_05600 2127 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence161 <1 1628 gene locus_tag LOCUS_05610 <1 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388353.1:transketolase 1717 2781 gene locus_tag LOCUS_05620 gene fba 1717 2781 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763563.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence162 319 1212 gene locus_tag LOCUS_05630 319 1212 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_05630 <3035 1724 gene locus_tag LOCUS_05640 <3035 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929286.1:ATP-binding protein >Feature sequence163 <1 597 gene locus_tag LOCUS_05650 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089037.1:glycosyltransferase family 4 protein 625 1545 gene locus_tag LOCUS_05660 625 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1548 2843 gene locus_tag LOCUS_05670 1548 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence164 1638 400 gene locus_tag LOCUS_05680 1638 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2256 1780 gene locus_tag LOCUS_05690 gene secB 2256 1780 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391357.1 protein_id gnl|my_center|LOCUS_05690 2792 2325 gene locus_tag LOCUS_05700 2792 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence165 2 553 gene locus_tag LOCUS_05710 2 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 748 2601 gene locus_tag LOCUS_05720 748 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2878 2591 gene locus_tag LOCUS_05730 2878 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence166 >Feature sequence167 1 531 gene locus_tag LOCUS_05740 1 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 528 2924 gene locus_tag LOCUS_05750 gene pheT 528 2924 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence168 222 617 gene locus_tag LOCUS_05760 222 617 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566282.1 protein_id gnl|my_center|LOCUS_05760 614 2941 gene locus_tag LOCUS_05770 614 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence169 237 1064 gene locus_tag LOCUS_05780 gene coxB 237 1064 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886286.1 protein_id gnl|my_center|LOCUS_05780 1075 2685 gene locus_tag LOCUS_05790 gene ctaD 1075 2685 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083990.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence170 2 766 gene locus_tag LOCUS_05800 2 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 923 1483 gene locus_tag LOCUS_05810 923 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 <2986 1662 gene locus_tag LOCUS_05820 <2986 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_188106780.1:PAS domain S-box protein >Feature sequence171 <1 1031 gene locus_tag LOCUS_05830 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391534.1:nitronate monooxygenase 1175 1594 gene locus_tag LOCUS_05840 1175 1594 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_05840 2356 1766 gene locus_tag LOCUS_05850 2356 1766 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388157.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence172 1163 657 gene locus_tag LOCUS_05860 1163 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence173 336 611 gene locus_tag LOCUS_05870 336 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 792 2231 gene locus_tag LOCUS_05880 792 2231 CDS product IS1182-like element ISCc5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918162.1 protein_id gnl|my_center|LOCUS_05880 2922 2557 gene locus_tag LOCUS_05890 2922 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence174 >Feature sequence175 775 1563 gene locus_tag LOCUS_05900 775 1563 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391443.1 protein_id gnl|my_center|LOCUS_05900 2213 1560 gene locus_tag LOCUS_05910 2213 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 <2958 2297 gene locus_tag LOCUS_05920 <2958 2297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391336.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence176 234 908 gene locus_tag LOCUS_05930 234 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1010 1306 gene locus_tag LOCUS_05940 1010 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 2122 1364 gene locus_tag LOCUS_05950 2122 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 <2948 2145 gene locus_tag LOCUS_05960 <2948 2145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389829.1:methyl-accepting chemotaxis protein >Feature sequence177 1475 1038 gene locus_tag LOCUS_05970 gene paaI 1475 1038 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_05970 1784 2851 gene locus_tag LOCUS_05980 1784 2851 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence178 131 562 gene locus_tag LOCUS_05990 131 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 1965 571 gene locus_tag LOCUS_06000 1965 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2534 1962 gene locus_tag LOCUS_06010 2534 1962 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086720.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence179 1059 181 gene locus_tag LOCUS_06020 1059 181 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388114.1 protein_id gnl|my_center|LOCUS_06020 1949 1185 gene locus_tag LOCUS_06030 1949 1185 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388115.1 protein_id gnl|my_center|LOCUS_06030 <2911 1949 gene locus_tag LOCUS_06040 <2911 1949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388116.1:cytochrome b/b6 >Feature sequence180 2754 1519 gene locus_tag LOCUS_06050 2754 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence181 842 2167 gene locus_tag LOCUS_06060 842 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2171 2806 gene locus_tag LOCUS_06070 2171 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence182 1720 92 gene locus_tag LOCUS_06080 1720 92 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence183 168 953 gene locus_tag LOCUS_06090 168 953 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_06090 1029 1814 gene locus_tag LOCUS_06100 1029 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence184 <1 1155 gene locus_tag LOCUS_06110 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390950.1:type I DNA topoisomerase 2076 1204 gene locus_tag LOCUS_06120 2076 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence185 <1 750 gene locus_tag LOCUS_06130 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388019.1:uracil-DNA glycosylase 981 2810 gene locus_tag LOCUS_06140 981 2810 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence186 376 1962 gene locus_tag LOCUS_06150 376 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence187 793 104 gene locus_tag LOCUS_06160 793 104 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391142.1 protein_id gnl|my_center|LOCUS_06160 1195 1914 gene locus_tag LOCUS_06170 1195 1914 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388841.1 protein_id gnl|my_center|LOCUS_06170 2027 2527 gene locus_tag LOCUS_06180 gene ruvC 2027 2527 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence188 737 2374 gene locus_tag LOCUS_06190 737 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence189 1314 805 gene locus_tag LOCUS_06200 1314 805 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_06200 1946 1311 gene locus_tag LOCUS_06210 1946 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2749 1943 gene locus_tag LOCUS_06220 gene ccsA 2749 1943 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943519.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence190 1132 1890 gene locus_tag LOCUS_06230 1132 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1959 2198 gene locus_tag LOCUS_06240 1959 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence191 323 1360 gene locus_tag LOCUS_06250 gene ruvB 323 1360 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_06250 1357 1773 gene locus_tag LOCUS_06260 1357 1773 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388845.1 protein_id gnl|my_center|LOCUS_06260 1778 2503 gene locus_tag LOCUS_06270 1778 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence192 2139 946 gene locus_tag LOCUS_06280 2139 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2576 2148 gene locus_tag LOCUS_06290 2576 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence193 2329 572 gene locus_tag LOCUS_06300 2329 572 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975077.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence194 2 994 gene locus_tag LOCUS_06310 2 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 1120 1617 gene locus_tag LOCUS_06320 1120 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence195 1062 835 gene locus_tag LOCUS_06330 1062 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 2705 1131 gene locus_tag LOCUS_06340 2705 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence196 453 157 gene locus_tag LOCUS_06350 gene fdxB 453 157 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389937.1 protein_id gnl|my_center|LOCUS_06350 942 478 gene locus_tag LOCUS_06360 942 478 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_06360 1364 948 gene locus_tag LOCUS_06370 gene nifX 1364 948 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440142.1 protein_id gnl|my_center|LOCUS_06370 2784 1414 gene locus_tag LOCUS_06380 gene nifN 2784 1414 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence197 1255 152 gene locus_tag LOCUS_06390 1255 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1376 2599 gene locus_tag LOCUS_06400 1376 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence198 491 1057 gene locus_tag LOCUS_06410 491 1057 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172196.1 protein_id gnl|my_center|LOCUS_06410 1922 1011 gene locus_tag LOCUS_06420 1922 1011 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence199 1075 899 gene locus_tag LOCUS_06430 1075 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1263 1811 gene locus_tag LOCUS_06440 1263 1811 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920844.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence200 <1 715 gene locus_tag LOCUS_06450 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090136.1:phosphoglycerate dehydrogenase 935 2242 gene locus_tag LOCUS_06460 935 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence201 >Feature sequence202 43 396 gene locus_tag LOCUS_06470 43 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 396 608 gene locus_tag LOCUS_06480 396 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 605 1048 gene locus_tag LOCUS_06490 gene ccmE 605 1048 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence203 149 1168 gene locus_tag LOCUS_06500 gene lpxD 149 1168 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443878.1 protein_id gnl|my_center|LOCUS_06500 1234 1695 gene locus_tag LOCUS_06510 gene fabZ 1234 1695 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_06510 1695 2489 gene locus_tag LOCUS_06520 gene lpxA 1695 2489 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence204 <1 1124 gene locus_tag LOCUS_06530 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein 1140 1409 gene locus_tag LOCUS_06540 1140 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 1416 1748 gene locus_tag LOCUS_06550 1416 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1741 2265 gene locus_tag LOCUS_06560 1741 2265 CDS product DUF1833 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039679.1 protein_id gnl|my_center|LOCUS_06560 2685 2272 gene locus_tag LOCUS_06570 2685 2272 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085221.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence205 3 839 gene locus_tag LOCUS_06580 3 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2816 1020 gene locus_tag LOCUS_06590 2816 1020 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence206 110 913 gene locus_tag LOCUS_06600 110 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2095 920 gene locus_tag LOCUS_06610 2095 920 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 protein_id gnl|my_center|LOCUS_06610 2296 2601 gene locus_tag LOCUS_06620 gene ihfB 2296 2601 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence207 1700 459 gene locus_tag LOCUS_06630 1700 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 <2817 1697 gene locus_tag LOCUS_06640 <2817 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975533.1:glycosyltransferase family 1 protein >Feature sequence208 <1 698 gene locus_tag LOCUS_06650 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114560.1:23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ 798 1175 gene locus_tag LOCUS_06660 798 1175 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940930.1 protein_id gnl|my_center|LOCUS_06660 1799 1191 gene locus_tag LOCUS_06670 1799 1191 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_06670 2626 1796 gene locus_tag LOCUS_06680 gene cobS 2626 1796 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086039.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence209 669 394 gene locus_tag LOCUS_06690 669 394 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_06690 2468 771 gene locus_tag LOCUS_06700 2468 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390048.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence210 <1 793 gene locus_tag LOCUS_06710 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938317.1:HlyD family type I secretion periplasmic adaptor subunit 1617 835 gene locus_tag LOCUS_06720 1617 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2083 1712 gene locus_tag LOCUS_06730 2083 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence211 716 1774 gene locus_tag LOCUS_06740 716 1774 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937525.1 protein_id gnl|my_center|LOCUS_06740 1768 2322 gene locus_tag LOCUS_06750 1768 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence212 <1 782 gene locus_tag LOCUS_06760 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083994.1:cytochrome c oxidase subunit 3 1817 783 gene locus_tag LOCUS_06770 1817 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence213 611 1609 gene locus_tag LOCUS_06780 611 1609 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_06780 1687 2511 gene locus_tag LOCUS_06790 1687 2511 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence214 <1 1808 gene locus_tag LOCUS_06800 <1 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940273.1:asparagine synthase (glutamine-hydrolyzing) <2801 1820 gene locus_tag LOCUS_06810 <2801 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000613541.1:PG:teichoic acid D-alanyltransferase DltB >Feature sequence215 2008 1235 gene locus_tag LOCUS_06820 gene hisN 2008 1235 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_06820 2592 2182 gene locus_tag LOCUS_06830 2592 2182 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence216 2498 2115 gene locus_tag LOCUS_06840 2498 2115 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence217 27 518 gene locus_tag LOCUS_06850 27 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 2212 515 gene locus_tag LOCUS_06860 2212 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence218 205 789 gene locus_tag LOCUS_06870 205 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 953 765 gene locus_tag LOCUS_06880 953 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1226 957 gene locus_tag LOCUS_06890 1226 957 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_06890 1502 1293 gene locus_tag LOCUS_06900 1502 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1594 1758 gene locus_tag LOCUS_06910 1594 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1760 1969 gene locus_tag LOCUS_06920 1760 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 <2782 1956 gene locus_tag LOCUS_06930 <2782 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937502.1:DNA modification methylase >Feature sequence219 1343 339 gene locus_tag LOCUS_06940 gene narH 1343 339 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096514.1 protein_id gnl|my_center|LOCUS_06940 <2775 1446 gene locus_tag LOCUS_06950 <2775 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193487114.1:nitrate reductase subunit alpha >Feature sequence220 <1 932 gene locus_tag LOCUS_06960 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390885.1:bifunctional diguanylate cyclase/phosphodiesterase 1140 1361 gene locus_tag LOCUS_06970 1140 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 <2754 1527 gene locus_tag LOCUS_06980 <2754 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000862095.1:acetate--CoA ligase >Feature sequence221 223 549 gene locus_tag LOCUS_06990 223 549 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence222 383 138 gene locus_tag LOCUS_07000 383 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2132 1020 gene locus_tag LOCUS_07010 2132 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2260 2724 gene locus_tag LOCUS_07020 2260 2724 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388478.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence223 <1 550 gene locus_tag LOCUS_07030 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064935.1:indolepyruvate ferredoxin oxidoreductase family protein 636 1064 gene locus_tag LOCUS_07040 636 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1535 1077 gene locus_tag LOCUS_07050 1535 1077 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918320.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence224 557 1132 gene locus_tag LOCUS_07060 gene gmhA 557 1132 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566736.1 protein_id gnl|my_center|LOCUS_07060 1207 1644 gene locus_tag LOCUS_07070 1207 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1653 1802 gene locus_tag LOCUS_07080 1653 1802 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence225 619 703 gene locus_tag LOCUS_t00080 619 703 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 780 2171 gene locus_tag LOCUS_07090 gene tig 780 2171 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence226 124 477 gene locus_tag LOCUS_07100 124 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 501 1190 gene locus_tag LOCUS_07110 501 1190 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 protein_id gnl|my_center|LOCUS_07110 1208 1789 gene locus_tag LOCUS_07120 1208 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 <2711 1920 gene locus_tag LOCUS_07130 <2711 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145647357.1:acetate kinase >Feature sequence227 177 1193 gene locus_tag LOCUS_07140 177 1193 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence228 1267 1043 gene locus_tag LOCUS_07150 1267 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1154 1777 gene locus_tag LOCUS_07160 gene perB 1154 1777 CDS product GDP-perosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055391.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence229 469 1569 gene locus_tag LOCUS_07170 469 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1608 2498 gene locus_tag LOCUS_07180 1608 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence230 1545 469 gene locus_tag LOCUS_07190 1545 469 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383609.1 protein_id gnl|my_center|LOCUS_07190 2191 1625 gene locus_tag LOCUS_07200 2191 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2391 2221 gene locus_tag LOCUS_07210 2391 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence231 54 1697 gene locus_tag LOCUS_07220 54 1697 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence232 311 772 gene locus_tag LOCUS_07230 gene ruvX 311 772 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390926.1 protein_id gnl|my_center|LOCUS_07230 1234 689 gene locus_tag LOCUS_07240 1234 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 1604 1969 gene locus_tag LOCUS_07250 1604 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence233 298 1344 gene locus_tag LOCUS_07260 298 1344 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence234 2204 1626 gene locus_tag LOCUS_07270 2204 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence235 544 987 gene locus_tag LOCUS_07280 544 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1442 1020 gene locus_tag LOCUS_07290 1442 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2285 1455 gene locus_tag LOCUS_07300 2285 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence236 >Feature sequence237 276 776 gene locus_tag LOCUS_07310 gene rimP 276 776 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391525.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07310 785 2305 gene locus_tag LOCUS_07320 gene nusA 785 2305 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence238 318 1106 gene locus_tag LOCUS_07330 318 1106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 protein_id gnl|my_center|LOCUS_07330 1165 2445 gene locus_tag LOCUS_07340 1165 2445 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence239 1484 669 gene locus_tag LOCUS_07350 1484 669 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_07350 2612 1500 gene locus_tag LOCUS_07360 2612 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140948.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence240 1494 682 gene locus_tag LOCUS_07370 1494 682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_07370 1530 2075 gene locus_tag LOCUS_07380 1530 2075 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_07380 <2642 2072 gene locus_tag LOCUS_07390 <2642 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390820.1:mechanosensitive ion channel >Feature sequence241 57 1931 gene locus_tag LOCUS_07400 57 1931 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528580.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence242 2391 640 gene locus_tag LOCUS_07410 gene asnB 2391 640 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence243 958 287 gene locus_tag LOCUS_07420 958 287 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_07420 2372 951 gene locus_tag LOCUS_07430 2372 951 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389166.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence244 <1 983 gene locus_tag LOCUS_07440 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039300.1:tetratricopeptide repeat protein 2196 997 gene locus_tag LOCUS_07450 2196 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence245 471 1487 gene locus_tag LOCUS_07460 471 1487 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189384.1 protein_id gnl|my_center|LOCUS_07460 <2625 1553 gene locus_tag LOCUS_07470 <2625 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389644.1:anthranilate synthase component I >Feature sequence246 1302 244 gene locus_tag LOCUS_07480 1302 244 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269079.1 protein_id gnl|my_center|LOCUS_07480 1470 2186 gene locus_tag LOCUS_07490 1470 2186 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067323.1 protein_id gnl|my_center|LOCUS_07490 2543 2199 gene locus_tag LOCUS_07500 2543 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence247 366 211 gene locus_tag LOCUS_07510 366 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 504 890 gene locus_tag LOCUS_07520 504 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence248 <1 699 gene locus_tag LOCUS_07530 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162470656.1:SAM-dependent chlorinase/fluorinase 789 1616 gene locus_tag LOCUS_07540 789 1616 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_07540 2310 1645 gene locus_tag LOCUS_07550 2310 1645 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389560.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence249 1423 851 gene locus_tag LOCUS_07560 1423 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1447 2511 gene locus_tag LOCUS_07570 gene mutY 1447 2511 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence250 1124 111 gene locus_tag LOCUS_07580 1124 111 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_07580 1220 1810 gene locus_tag LOCUS_07590 1220 1810 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_07590 2348 1857 gene locus_tag LOCUS_07600 2348 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence251 82 1071 gene locus_tag LOCUS_07610 82 1071 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533012.1 protein_id gnl|my_center|LOCUS_07610 1439 1128 gene locus_tag LOCUS_07620 1439 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2163 1507 gene locus_tag LOCUS_07630 2163 1507 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966768.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence252 <2606 1483 gene locus_tag LOCUS_07640 <2606 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389349.1:EAL domain-containing protein >Feature sequence253 959 501 gene locus_tag LOCUS_07650 gene queF 959 501 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242701.1 protein_id gnl|my_center|LOCUS_07650 2427 961 gene locus_tag LOCUS_07660 gene rfaE1 2427 961 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence254 900 67 gene locus_tag LOCUS_07670 900 67 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_07670 1154 897 gene locus_tag LOCUS_07680 1154 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1954 1220 gene locus_tag LOCUS_07690 1954 1220 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence255 1422 136 gene locus_tag LOCUS_07700 1422 136 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_07700 2458 1805 gene locus_tag LOCUS_07710 2458 1805 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence256 1423 761 gene locus_tag LOCUS_07720 1423 761 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216474.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence257 1024 689 gene locus_tag LOCUS_07730 gene clpS 1024 689 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_07730 1976 1200 gene locus_tag LOCUS_07740 1976 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence258 2055 547 gene locus_tag LOCUS_07750 2055 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence259 1403 669 gene locus_tag LOCUS_07760 1403 669 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967173.1 protein_id gnl|my_center|LOCUS_07760 2325 1417 gene locus_tag LOCUS_07770 2325 1417 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267244.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence260 358 56 gene locus_tag LOCUS_07780 358 56 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228510.1 protein_id gnl|my_center|LOCUS_07780 1989 2246 gene locus_tag LOCUS_07790 1989 2246 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_07790 2243 2539 gene locus_tag LOCUS_07800 2243 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence261 471 2096 gene locus_tag LOCUS_07810 471 2096 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470630.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence262 747 1388 gene locus_tag LOCUS_07820 747 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1388 2404 gene locus_tag LOCUS_07830 1388 2404 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338244.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence263 1147 482 gene locus_tag LOCUS_07840 1147 482 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039537.1 protein_id gnl|my_center|LOCUS_07840 1426 2256 gene locus_tag LOCUS_07850 1426 2256 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence264 940 260 gene locus_tag LOCUS_07860 940 260 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975954.1 protein_id gnl|my_center|LOCUS_07860 1577 1023 gene locus_tag LOCUS_07870 1577 1023 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_07870 1694 2074 gene locus_tag LOCUS_07880 1694 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence265 918 436 gene locus_tag LOCUS_07890 918 436 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_07890 1700 936 gene locus_tag LOCUS_07900 1700 936 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440275.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence266 175 1485 gene locus_tag LOCUS_07910 175 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1743 1498 gene locus_tag LOCUS_07920 1743 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 <2554 1798 gene locus_tag LOCUS_07930 <2554 1798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028170938.1:dihydrodipicolinate synthase family protein >Feature sequence267 <1 1640 gene locus_tag LOCUS_07940 <1 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388108.1:glutamine-hydrolyzing GMP synthase 1892 1695 gene locus_tag LOCUS_07950 1892 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2400 2014 gene locus_tag LOCUS_07960 2400 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence268 531 1538 gene locus_tag LOCUS_07970 531 1538 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_07970 1671 1982 gene locus_tag LOCUS_07980 1671 1982 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389926.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence269 1097 1555 gene locus_tag LOCUS_07990 1097 1555 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence270 1834 983 gene locus_tag LOCUS_08000 gene speE 1834 983 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114619.1 protein_id gnl|my_center|LOCUS_08000 2313 1831 gene locus_tag LOCUS_08010 2313 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence271 <1 848 gene locus_tag LOCUS_08020 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389729.1:phenylacetate--CoA ligase 1086 862 gene locus_tag LOCUS_08030 1086 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence272 726 271 gene locus_tag LOCUS_08040 726 271 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 protein_id gnl|my_center|LOCUS_08040 <2537 736 gene locus_tag LOCUS_08050 <2537 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391369.1:thioredoxin domain-containing protein >Feature sequence273 1543 1055 gene locus_tag LOCUS_08060 1543 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1727 1536 gene locus_tag LOCUS_08070 1727 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2191 1724 gene locus_tag LOCUS_08080 2191 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence274 817 329 gene locus_tag LOCUS_08090 817 329 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_08090 837 1322 gene locus_tag LOCUS_08100 837 1322 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083044.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence275 <1 702 gene locus_tag LOCUS_08110 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389416.1:transcription-repair coupling factor 1365 718 gene locus_tag LOCUS_08120 1365 718 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_08120 <2532 1403 gene locus_tag LOCUS_08130 <2532 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971526.1:PleD family two-component system response regulator >Feature sequence276 968 1867 gene locus_tag LOCUS_08140 968 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 <2527 1915 gene locus_tag LOCUS_08150 <2527 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389048.1:methyl-accepting chemotaxis protein >Feature sequence277 928 785 gene locus_tag LOCUS_08160 928 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1145 2182 gene locus_tag LOCUS_08170 1145 2182 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085128.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence278 1324 686 gene locus_tag LOCUS_08180 1324 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence279 1167 346 gene locus_tag LOCUS_08190 1167 346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965188.1 protein_id gnl|my_center|LOCUS_08190 1248 1511 gene locus_tag LOCUS_08200 1248 1511 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252128.1 protein_id gnl|my_center|LOCUS_08200 <2524 1545 gene locus_tag LOCUS_08210 <2524 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387886.1:diguanylate phosphodiesterase >Feature sequence280 1077 412 gene locus_tag LOCUS_08220 gene ccmB 1077 412 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387800.1 protein_id gnl|my_center|LOCUS_08220 1745 1074 gene locus_tag LOCUS_08230 gene ccmA 1745 1074 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence281 >Feature sequence282 339 953 gene locus_tag LOCUS_08240 339 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 <2520 1374 gene locus_tag LOCUS_08250 <2520 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729175.1:mechanosensitive ion channel family protein >Feature sequence283 1183 554 gene locus_tag LOCUS_08260 1183 554 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390772.1 protein_id gnl|my_center|LOCUS_08260 2346 1216 gene locus_tag LOCUS_08270 2346 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence284 721 2343 gene locus_tag LOCUS_08280 gene pgi 721 2343 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence285 2293 779 gene locus_tag LOCUS_08290 2293 779 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence286 93 1190 gene locus_tag LOCUS_08300 93 1190 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816890.1 protein_id gnl|my_center|LOCUS_08300 1187 1597 gene locus_tag LOCUS_08310 1187 1597 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064846.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence287 1120 593 gene locus_tag LOCUS_08320 1120 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2172 1186 gene locus_tag LOCUS_08330 2172 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence288 54 548 gene locus_tag LOCUS_08340 54 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence289 <2498 1710 gene locus_tag LOCUS_08350 <2498 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937492.1:SPASM domain-containing protein >Feature sequence290 51 815 gene locus_tag LOCUS_08360 51 815 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_08360 1453 812 gene locus_tag LOCUS_08370 1453 812 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724650.1 protein_id gnl|my_center|LOCUS_08370 1765 2037 gene locus_tag LOCUS_08380 1765 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2052 2327 gene locus_tag LOCUS_08390 2052 2327 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173915017.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence291 <1 863 gene locus_tag LOCUS_08400 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072627.1:DUF935 domain-containing protein 864 2156 gene locus_tag LOCUS_08410 864 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence292 495 1379 gene locus_tag LOCUS_08420 gene cpaB 495 1379 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965364.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence293 407 829 gene locus_tag LOCUS_08430 407 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 905 1171 gene locus_tag LOCUS_08440 905 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 <2490 1284 gene locus_tag LOCUS_08450 <2490 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_183090287.1:EAL domain-containing protein >Feature sequence294 <1 1057 gene locus_tag LOCUS_08460 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038894.1:PQQ-dependent sugar dehydrogenase 2006 1074 gene locus_tag LOCUS_08470 2006 1074 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613252.1 protein_id gnl|my_center|LOCUS_08470 2269 2427 gene locus_tag LOCUS_08480 2269 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence295 <1 2342 gene locus_tag LOCUS_08490 <1 2342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_092687825.1:ATP-binding protein >Feature sequence296 <1 615 gene locus_tag LOCUS_08500 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038652.1:alpha/beta hydrolase 2483 645 gene locus_tag LOCUS_08510 2483 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence297 <1 2043 gene locus_tag LOCUS_08520 <1 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388279.1:chemotaxis protein CheW >Feature sequence298 <1 530 gene locus_tag LOCUS_08530 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089080.1:NADH-quinone oxidoreductase subunit H 530 1195 gene locus_tag LOCUS_08540 530 1195 CDS product hydrogenase-4 component E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548289.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence299 1270 473 gene locus_tag LOCUS_08550 1270 473 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_08550 1915 1352 gene locus_tag LOCUS_08560 gene efp 1915 1352 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388832.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence300 167 1078 gene locus_tag LOCUS_08570 gene rlmB 167 1078 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384991.1 protein_id gnl|my_center|LOCUS_08570 1200 1802 gene locus_tag LOCUS_08580 1200 1802 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927164.1 protein_id gnl|my_center|LOCUS_08580 1960 2035 gene locus_tag LOCUS_t00090 1960 2035 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence301 1287 421 gene locus_tag LOCUS_08590 1287 421 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_08590 1463 2395 gene locus_tag LOCUS_08600 1463 2395 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence302 1595 687 gene locus_tag LOCUS_08610 1595 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 <2463 1603 gene locus_tag LOCUS_08620 <2463 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115264.1:cytochrome c/FTR1 family iron permease >Feature sequence303 629 1243 gene locus_tag LOCUS_08630 gene nudF 629 1243 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_08630 1369 2373 gene locus_tag LOCUS_08640 1369 2373 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531459.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence304 >Feature sequence305 1956 616 gene locus_tag LOCUS_08650 1956 616 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389832.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence306 288 1397 gene locus_tag LOCUS_08660 gene ispG 288 1397 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388505.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence307 1428 481 gene locus_tag LOCUS_08670 gene cysK 1428 481 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626663.1 protein_id gnl|my_center|LOCUS_08670 1957 1502 gene locus_tag LOCUS_08680 1957 1502 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_08680 2420 1971 gene locus_tag LOCUS_08690 gene dut 2420 1971 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence308 1789 1022 gene locus_tag LOCUS_08700 1789 1022 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence309 1190 468 gene locus_tag LOCUS_08710 1190 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2361 1306 gene locus_tag LOCUS_08720 2361 1306 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085128.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence310 1752 421 gene locus_tag LOCUS_08730 1752 421 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 protein_id gnl|my_center|LOCUS_08730 <2446 1749 gene locus_tag LOCUS_08740 <2446 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004599398.1:type I secretion system permease/ATPase >Feature sequence311 >Feature sequence312 770 1045 gene locus_tag LOCUS_08750 770 1045 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722325.1 protein_id gnl|my_center|LOCUS_08750 1287 1784 gene locus_tag LOCUS_08760 1287 1784 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence313 736 5 gene locus_tag LOCUS_08770 736 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1298 729 gene locus_tag LOCUS_08780 1298 729 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258952.1 protein_id gnl|my_center|LOCUS_08780 2269 1295 gene locus_tag LOCUS_08790 2269 1295 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143781.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence314 489 1529 gene locus_tag LOCUS_08800 489 1529 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_08800 1526 2392 gene locus_tag LOCUS_08810 gene cysT 1526 2392 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence315 >Feature sequence316 287 1501 gene locus_tag LOCUS_08820 287 1501 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence317 629 84 gene locus_tag LOCUS_08830 629 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 756 1268 gene locus_tag LOCUS_08840 756 1268 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389313.1 protein_id gnl|my_center|LOCUS_08840 2420 1272 gene locus_tag LOCUS_08850 2420 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence318 1458 190 gene locus_tag LOCUS_08860 1458 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence319 <1 1139 gene locus_tag LOCUS_08870 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390962.1:O-succinylhomoserine sulfhydrylase 1248 2114 gene locus_tag LOCUS_08880 1248 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence320 1252 794 gene locus_tag LOCUS_08890 gene flbT 1252 794 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919334.1 protein_id gnl|my_center|LOCUS_08890 1938 1339 gene locus_tag LOCUS_08900 1938 1339 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_08900 2414 1965 gene locus_tag LOCUS_08910 2414 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence321 1133 549 gene locus_tag LOCUS_08920 1133 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 <2413 1144 gene locus_tag LOCUS_08930 <2413 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463552.1:PAS domain-containing protein >Feature sequence322 <1 595 gene locus_tag LOCUS_08940 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389370.1:sigma-54 dependent transcriptional regulator 618 1994 gene locus_tag LOCUS_08950 gene trkA 618 1994 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence323 <2411 1864 gene locus_tag LOCUS_08960 <2411 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390311.1:transglutaminase family protein >Feature sequence324 472 1476 gene locus_tag LOCUS_08970 gene gap 472 1476 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence325 >Feature sequence326 380 1024 gene locus_tag LOCUS_08980 380 1024 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389521.1 protein_id gnl|my_center|LOCUS_08980 1073 1633 gene locus_tag LOCUS_08990 1073 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1655 2176 gene locus_tag LOCUS_09000 1655 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09000 2173 2346 gene locus_tag LOCUS_09010 2173 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence327 <2387 1563 gene locus_tag LOCUS_09020 <2387 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388113.1:S-methyl-5-thioribose-1-phosphate isomerase >Feature sequence328 <1 1040 gene locus_tag LOCUS_09030 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389628.1:PAS domain-containing sensor histidine kinase 1859 1044 gene locus_tag LOCUS_09040 1859 1044 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence329 1733 1299 gene locus_tag LOCUS_09050 gene hemJ 1733 1299 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_09050 <2381 1730 gene locus_tag LOCUS_09060 <2381 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391364.1:ferrochelatase >Feature sequence330 805 299 gene locus_tag LOCUS_09070 805 299 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_09070 1539 970 gene locus_tag LOCUS_09080 1539 970 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_09080 <2380 1702 gene locus_tag LOCUS_09090 <2380 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720898.1:NAD(P)H-quinone oxidoreductase >Feature sequence331 1405 356 gene locus_tag LOCUS_09100 1405 356 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256737.1 protein_id gnl|my_center|LOCUS_09100 <2380 1402 gene locus_tag LOCUS_09110 <2380 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256740.1:hybrid sensor histidine kinase/response regulator >Feature sequence332 <1 1032 gene locus_tag LOCUS_09120 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391128.1:cobyric acid synthase <2372 1034 gene locus_tag LOCUS_09130 <2372 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229350.1:ATP-binding protein >Feature sequence333 943 20 gene locus_tag LOCUS_09140 943 20 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_09140 1543 956 gene locus_tag LOCUS_09150 gene pdxH 1543 956 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390377.1 protein_id gnl|my_center|LOCUS_09150 1705 2175 gene locus_tag LOCUS_09160 1705 2175 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence334 >Feature sequence335 >Feature sequence336 681 1301 gene locus_tag LOCUS_09170 681 1301 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence337 <1 552 gene locus_tag LOCUS_09180 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389356.1:phosphate acyltransferase PlsX 562 1536 gene locus_tag LOCUS_09190 562 1536 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087781.1 protein_id gnl|my_center|LOCUS_09190 1668 1988 gene locus_tag LOCUS_09200 1668 1988 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence338 <1 1076 gene locus_tag LOCUS_09210 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388995.1:GTPase ObgE 1051 2169 gene locus_tag LOCUS_09220 gene proB 1051 2169 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388994.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence339 1227 796 gene locus_tag LOCUS_09230 1227 796 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175129.1 protein_id gnl|my_center|LOCUS_09230 1449 1805 gene locus_tag LOCUS_09240 1449 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09240 1826 2011 gene locus_tag LOCUS_09250 1826 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2008 2274 gene locus_tag LOCUS_09260 2008 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 >Feature sequence340 >Feature sequence341 2004 1660 gene locus_tag LOCUS_09270 2004 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387861.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence342 182 562 gene locus_tag LOCUS_09280 182 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 559 1173 gene locus_tag LOCUS_09290 559 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence343 <1 799 gene locus_tag LOCUS_09300 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390133.1:MFS transporter 796 1959 gene locus_tag LOCUS_09310 796 1959 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence344 >Feature sequence345 136 702 gene locus_tag LOCUS_09320 136 702 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_09320 2325 676 gene locus_tag LOCUS_09330 2325 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence346 <1 1098 gene locus_tag LOCUS_09340 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029628877.1:glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase 2146 1100 gene locus_tag LOCUS_09350 2146 1100 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640467.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence347 <1 549 gene locus_tag LOCUS_09360 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389162.1:HAMP domain-containing methyl-accepting chemotaxis protein 1168 572 gene locus_tag LOCUS_09370 1168 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence348 1077 235 gene locus_tag LOCUS_09380 gene dapF 1077 235 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_09380 1814 1140 gene locus_tag LOCUS_09390 1814 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2263 1889 gene locus_tag LOCUS_09400 2263 1889 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence349 1010 1258 gene locus_tag LOCUS_09410 1010 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1275 2180 gene locus_tag LOCUS_09420 1275 2180 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence350 2045 1827 gene locus_tag LOCUS_09430 2045 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence351 <1 1283 gene locus_tag LOCUS_09440 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968887.1:class I SAM-dependent RNA methyltransferase 1285 1854 gene locus_tag LOCUS_09450 1285 1854 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence352 227 757 gene locus_tag LOCUS_09460 227 757 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_09460 1017 1685 gene locus_tag LOCUS_09470 1017 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2013 1795 gene locus_tag LOCUS_09480 2013 1795 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016841283.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence353 1039 317 gene locus_tag LOCUS_09490 1039 317 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920693.1 protein_id gnl|my_center|LOCUS_09490 2226 1036 gene locus_tag LOCUS_09500 gene pseC 2226 1036 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639919.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence354 <1 546 gene locus_tag LOCUS_09510 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387848.1:TIGR03862 family flavoprotein <2304 570 gene locus_tag LOCUS_09520 <2304 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940413.1:bacteriohemerythrin >Feature sequence355 467 928 gene locus_tag LOCUS_09530 467 928 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_09530 <2301 974 gene locus_tag LOCUS_09540 <2301 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965915.1:methyl-accepting chemotaxis protein >Feature sequence356 637 828 gene locus_tag LOCUS_09550 637 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence357 >Feature sequence358 <1 686 gene locus_tag LOCUS_09560 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093598.1:acyl-CoA synthetase 690 1439 gene locus_tag LOCUS_09570 690 1439 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390825.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence359 <2290 418 gene locus_tag LOCUS_09580 <2290 418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531011.1:AsmA family protein >Feature sequence360 1873 1475 gene locus_tag LOCUS_09590 1873 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence361 1471 275 gene locus_tag LOCUS_09600 1471 275 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 protein_id gnl|my_center|LOCUS_09600 2181 1468 gene locus_tag LOCUS_09610 2181 1468 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence362 <1 843 gene locus_tag LOCUS_09620 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389861.1:ATP-binding protein 1487 852 gene locus_tag LOCUS_09630 gene msrA 1487 852 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056729.1 protein_id gnl|my_center|LOCUS_09630 1602 1856 gene locus_tag LOCUS_09640 1602 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence363 1314 376 gene locus_tag LOCUS_09650 1314 376 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_09650 1547 1314 gene locus_tag LOCUS_09660 1547 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence364 1423 869 gene locus_tag LOCUS_09670 1423 869 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_09670 2274 1675 gene locus_tag LOCUS_09680 2274 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence365 3 272 gene locus_tag LOCUS_09690 3 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 259 1230 gene locus_tag LOCUS_09700 gene lpxK 259 1230 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_09700 1227 2099 gene locus_tag LOCUS_09710 1227 2099 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598029.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence366 959 621 gene locus_tag LOCUS_09720 959 621 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388885.1 protein_id gnl|my_center|LOCUS_09720 2031 1222 gene locus_tag LOCUS_09730 2031 1222 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975224.1 protein_id gnl|my_center|LOCUS_09730 2237 2037 gene locus_tag LOCUS_09740 2237 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence367 <2274 1147 gene locus_tag LOCUS_09750 <2274 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720913.1:diaminopimelate decarboxylase >Feature sequence368 140 1786 gene locus_tag LOCUS_09760 140 1786 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389349.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence369 1538 1738 gene locus_tag LOCUS_09770 1538 1738 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470633.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence370 954 427 gene locus_tag LOCUS_09780 954 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1295 954 gene locus_tag LOCUS_09790 1295 954 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence371 1688 933 gene locus_tag LOCUS_09800 1688 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 <2266 1725 gene locus_tag LOCUS_09810 <2266 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919030.1:SDR family oxidoreductase >Feature sequence372 >Feature sequence373 <1 860 gene locus_tag LOCUS_09820 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391503.1:ATP-binding protein 1245 844 gene locus_tag LOCUS_09830 1245 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1559 1858 gene locus_tag LOCUS_09840 1559 1858 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence374 2210 720 gene locus_tag LOCUS_09850 2210 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence375 674 267 gene locus_tag LOCUS_09860 674 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence376 1565 1110 gene locus_tag LOCUS_09870 1565 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1783 2229 gene locus_tag LOCUS_09880 1783 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence377 <2247 1246 gene locus_tag LOCUS_09890 <2247 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087426.1:GH1 family beta-glucosidase >Feature sequence378 <1 998 gene locus_tag LOCUS_09900 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536863.1:family 2A encapsulin nanocompartment cargo protein cysteine desulfurase 1022 1882 gene locus_tag LOCUS_09910 gene cysE 1022 1882 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388550.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence379 136 1311 gene locus_tag LOCUS_09920 gene egtB 136 1311 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence380 747 487 gene locus_tag LOCUS_09930 747 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1166 765 gene locus_tag LOCUS_09940 1166 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence381 551 904 gene locus_tag LOCUS_09950 551 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 914 1648 gene locus_tag LOCUS_09960 914 1648 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_09960 1708 1932 gene locus_tag LOCUS_09970 1708 1932 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390993.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence382 953 750 gene locus_tag LOCUS_09980 953 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1053 1460 gene locus_tag LOCUS_09990 1053 1460 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389917.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence383 291 1070 gene locus_tag LOCUS_10000 291 1070 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809257.1 protein_id gnl|my_center|LOCUS_10000 1825 1241 gene locus_tag LOCUS_10010 1825 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence384 <1 1115 gene locus_tag LOCUS_10020 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074000.1:alanine--glyoxylate aminotransferase family protein 2084 1236 gene locus_tag LOCUS_10030 2084 1236 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929879.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence385 1269 223 gene locus_tag LOCUS_10040 gene pdxA 1269 223 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388191.1 protein_id gnl|my_center|LOCUS_10040 <2240 1274 gene locus_tag LOCUS_10050 <2240 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640302.1:peptidylprolyl isomerase >Feature sequence386 <1 786 gene locus_tag LOCUS_10060 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390811.1:crotonyl-CoA carboxylase/reductase >Feature sequence387 202 840 gene locus_tag LOCUS_10070 202 840 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 protein_id gnl|my_center|LOCUS_10070 1045 824 gene locus_tag LOCUS_10080 1045 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1992 1345 gene locus_tag LOCUS_10090 1992 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence388 1246 791 gene locus_tag LOCUS_10100 1246 791 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972384.1 protein_id gnl|my_center|LOCUS_10100 1418 2107 gene locus_tag LOCUS_10110 1418 2107 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence389 <1 968 gene locus_tag LOCUS_10120 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390823.1:LPS export ABC transporter permease LptG >Feature sequence390 220 678 gene locus_tag LOCUS_10130 220 678 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_10130 678 1739 gene locus_tag LOCUS_10140 gene arsB 678 1739 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_10140 1736 2095 gene locus_tag LOCUS_10150 1736 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence391 <1 1682 gene locus_tag LOCUS_10160 <1 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704874.1:HD domain-containing protein 1706 1972 gene locus_tag LOCUS_10170 1706 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence392 907 173 gene locus_tag LOCUS_10180 907 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1199 1293 gene locus_tag LOCUS_t00100 1199 1293 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1624 2067 gene locus_tag LOCUS_10190 1624 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence393 <1 2031 gene locus_tag LOCUS_10200 <1 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391190.1:PAS domain-containing sensor histidine kinase >Feature sequence394 <1 2037 gene locus_tag LOCUS_10210 <1 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391452.1:DNA translocase FtsK 4TM domain-containing protein >Feature sequence395 73 609 gene locus_tag LOCUS_10220 73 609 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339116.1 protein_id gnl|my_center|LOCUS_10220 622 2121 gene locus_tag LOCUS_10230 gene rsxC 622 2121 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence396 <1 1524 gene locus_tag LOCUS_10240 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390796.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence397 557 1582 gene locus_tag LOCUS_10250 557 1582 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence398 586 1068 gene locus_tag LOCUS_10260 586 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1616 1152 gene locus_tag LOCUS_10270 1616 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1869 1690 gene locus_tag LOCUS_10280 1869 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence399 1089 619 gene locus_tag LOCUS_10290 gene rpsG 1089 619 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390502.1 protein_id gnl|my_center|LOCUS_10290 1472 1101 gene locus_tag LOCUS_10300 gene rpsL 1472 1101 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence400 837 79 gene locus_tag LOCUS_10310 837 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1814 834 gene locus_tag LOCUS_10320 1814 834 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937860.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence401 795 720 gene locus_tag LOCUS_t00110 795 720 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2176 809 gene locus_tag LOCUS_10330 2176 809 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528911.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence402 197 907 gene locus_tag LOCUS_10340 197 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence403 1 357 gene locus_tag LOCUS_10350 1 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 350 1135 gene locus_tag LOCUS_10360 gene znuB 350 1135 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence404 419 1024 gene locus_tag LOCUS_10370 gene cobO 419 1024 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391114.1 protein_id gnl|my_center|LOCUS_10370 1024 1698 gene locus_tag LOCUS_10380 1024 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence405 536 1030 gene locus_tag LOCUS_10390 536 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2085 1303 gene locus_tag LOCUS_10400 2085 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence406 <1 805 gene locus_tag LOCUS_10410 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968769.1:acetoacetate--CoA ligase 1344 853 gene locus_tag LOCUS_10420 1344 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2127 1408 gene locus_tag LOCUS_10430 2127 1408 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence407 297 503 gene locus_tag LOCUS_10440 297 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 524 724 gene locus_tag LOCUS_10450 524 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 <2182 721 gene locus_tag LOCUS_10460 <2182 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387835.1:helicase-related protein >Feature sequence408 490 1566 gene locus_tag LOCUS_10470 490 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence409 >Feature sequence410 658 1455 gene locus_tag LOCUS_10480 658 1455 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387778.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence411 928 647 gene locus_tag LOCUS_10490 928 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1583 921 gene locus_tag LOCUS_10500 1583 921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626425.1 protein_id gnl|my_center|LOCUS_10500 2173 1580 gene locus_tag LOCUS_10510 2173 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence412 1274 2161 gene locus_tag LOCUS_10520 1274 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence413 <2170 399 gene locus_tag LOCUS_10530 <2170 399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389643.1:SurA N-terminal domain-containing protein >Feature sequence414 372 1367 gene locus_tag LOCUS_10540 372 1367 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389350.1 protein_id gnl|my_center|LOCUS_10540 1367 1657 gene locus_tag LOCUS_10550 1367 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1739 2077 gene locus_tag LOCUS_10560 1739 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence415 <1 784 gene locus_tag LOCUS_10570 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086529.1:ATP-binding protein 835 1413 gene locus_tag LOCUS_10580 835 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence416 <1 1132 gene locus_tag LOCUS_10590 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390307.1:methyl-accepting chemotaxis protein 1873 1139 gene locus_tag LOCUS_10600 gene radC 1873 1139 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence417 591 1073 gene locus_tag LOCUS_10610 591 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1837 1070 gene locus_tag LOCUS_10620 1837 1070 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390386.1 protein_id gnl|my_center|LOCUS_10620 2163 1834 gene locus_tag LOCUS_10630 2163 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence418 1659 856 gene locus_tag LOCUS_10640 gene lgt 1659 856 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_10640 <2162 1660 gene locus_tag LOCUS_10650 <2162 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391026.1:ADP-glyceromanno-heptose 6-epimerase >Feature sequence419 409 780 gene locus_tag LOCUS_10660 409 780 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_10660 858 1592 gene locus_tag LOCUS_10670 858 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1589 1936 gene locus_tag LOCUS_10680 1589 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence420 1461 64 gene locus_tag LOCUS_10690 1461 64 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence421 <1 1321 gene locus_tag LOCUS_10700 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389349.1:EAL domain-containing protein >Feature sequence422 1769 579 gene locus_tag LOCUS_10710 1769 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence423 1356 964 gene locus_tag LOCUS_10720 1356 964 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence424 1463 1696 gene locus_tag LOCUS_10730 1463 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence425 <1 759 gene locus_tag LOCUS_10740 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388440.1:glutathione-disulfide reductase 762 1637 gene locus_tag LOCUS_10750 762 1637 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_10750 1653 2045 gene locus_tag LOCUS_10760 1653 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence426 >Feature sequence427 >Feature sequence428 98 781 gene locus_tag LOCUS_10770 98 781 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_10770 783 2108 gene locus_tag LOCUS_10780 783 2108 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence429 <1 520 gene locus_tag LOCUS_10790 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389473.1:UDP-2,3-diacylglucosamine diphosphatase LpxI 514 1680 gene locus_tag LOCUS_10800 gene lpxB 514 1680 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_10800 1677 2069 gene locus_tag LOCUS_10810 gene gloA 1677 2069 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence430 298 1611 gene locus_tag LOCUS_10820 gene tilS 298 1611 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338400.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence431 1454 984 gene locus_tag LOCUS_10830 1454 984 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389286.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence432 >Feature sequence433 2062 374 gene locus_tag LOCUS_10840 2062 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence434 541 1674 gene locus_tag LOCUS_10850 gene dprA 541 1674 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence435 3 434 gene locus_tag LOCUS_10860 3 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 <2115 445 gene locus_tag LOCUS_10870 <2115 445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390978.1:GGDEF domain-containing protein >Feature sequence436 380 1828 gene locus_tag LOCUS_10880 380 1828 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388889.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence437 198 1172 gene locus_tag LOCUS_10890 198 1172 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence438 >Feature sequence439 <2112 1387 gene locus_tag LOCUS_10900 <2112 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391503.1:ATP-binding protein >Feature sequence440 753 1196 gene locus_tag LOCUS_10910 753 1196 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388049.1 protein_id gnl|my_center|LOCUS_10910 1320 1395 gene locus_tag LOCUS_t00120 1320 1395 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1619 1694 gene locus_tag LOCUS_t00130 1619 1694 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence441 <2108 912 gene locus_tag LOCUS_10920 <2108 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389555.1:methyl-accepting chemotaxis protein >Feature sequence442 1494 733 gene locus_tag LOCUS_10930 1494 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence443 507 971 gene locus_tag LOCUS_10940 507 971 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942521.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence444 1 1212 gene locus_tag LOCUS_10950 1 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence445 <1 899 gene locus_tag LOCUS_10960 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087566.1:glutaminase A >Feature sequence446 >Feature sequence447 1008 208 gene locus_tag LOCUS_10970 gene mazG 1008 208 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_10970 <2095 1074 gene locus_tag LOCUS_10980 <2095 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389505.1:excinuclease ABC subunit UvrA >Feature sequence448 706 65 gene locus_tag LOCUS_10990 gene parA 706 65 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence449 1566 454 gene locus_tag LOCUS_11000 1566 454 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389856.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence450 255 722 gene locus_tag LOCUS_11010 gene tsaE 255 722 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_11010 719 1708 gene locus_tag LOCUS_11020 719 1708 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence451 <1 876 gene locus_tag LOCUS_11030 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389578.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD 890 1483 gene locus_tag LOCUS_11040 890 1483 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence452 226 909 gene locus_tag LOCUS_11050 226 909 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061513.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence453 1628 12 gene locus_tag LOCUS_11060 1628 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence454 228 500 gene locus_tag LOCUS_11070 228 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 515 1582 gene locus_tag LOCUS_11080 515 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1588 1884 gene locus_tag LOCUS_11090 1588 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence455 >Feature sequence456 1352 720 gene locus_tag LOCUS_11100 1352 720 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 protein_id gnl|my_center|LOCUS_11100 <2080 1452 gene locus_tag LOCUS_11110 <2080 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162890715.1:PAS domain-containing sensor histidine kinase >Feature sequence457 1185 955 gene locus_tag LOCUS_11120 1185 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1776 1279 gene locus_tag LOCUS_11130 1776 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence458 580 248 gene locus_tag LOCUS_11140 580 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1374 745 gene locus_tag LOCUS_11150 1374 745 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329401.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence459 1808 621 gene locus_tag LOCUS_11160 1808 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence460 >Feature sequence461 514 212 gene locus_tag LOCUS_11170 514 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence462 1 348 gene locus_tag LOCUS_11180 1 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 351 1436 gene locus_tag LOCUS_11190 351 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence463 410 691 gene locus_tag LOCUS_11200 410 691 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388607.1 protein_id gnl|my_center|LOCUS_11200 675 1844 gene locus_tag LOCUS_11210 675 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence464 1091 75 gene locus_tag LOCUS_11220 1091 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1171 1695 gene locus_tag LOCUS_11230 1171 1695 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391007.1 protein_id gnl|my_center|LOCUS_11230 2001 1666 gene locus_tag LOCUS_11240 2001 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence465 <1 630 gene locus_tag LOCUS_11250 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390042.1:AarF/UbiB family protein 1343 627 gene locus_tag LOCUS_11260 1343 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence466 <1 1619 gene locus_tag LOCUS_11270 <1 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein >Feature sequence467 <2066 389 gene locus_tag LOCUS_11280 <2066 389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051183743.1:tetratricopeptide repeat protein >Feature sequence468 >Feature sequence469 911 39 gene locus_tag LOCUS_11290 gene dapA 911 39 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence470 <1 1180 gene locus_tag LOCUS_11300 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545899.1:DUF1343 domain-containing protein >Feature sequence471 901 125 gene locus_tag LOCUS_11310 901 125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723689.1 protein_id gnl|my_center|LOCUS_11310 1911 904 gene locus_tag LOCUS_11320 1911 904 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266334.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence472 <1 502 gene locus_tag LOCUS_11330 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069810832.1:NAD(P)/FAD-dependent oxidoreductase 2052 511 gene locus_tag LOCUS_11340 2052 511 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625913.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence473 20 541 gene locus_tag LOCUS_11350 20 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 650 1591 gene locus_tag LOCUS_11360 gene fabD 650 1591 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence474 1443 754 gene locus_tag LOCUS_11370 1443 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence475 <1 983 gene locus_tag LOCUS_11380 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000017694.1:Ni/Fe-hydrogenase cytochrome b subunit >Feature sequence476 497 1873 gene locus_tag LOCUS_11390 gene ompQ 497 1873 CDS product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence477 <1 666 gene locus_tag LOCUS_11400 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812701.1:YihY family inner membrane protein 1997 672 gene locus_tag LOCUS_11410 1997 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence478 68 829 gene locus_tag LOCUS_11420 gene cysQ 68 829 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_11420 861 1823 gene locus_tag LOCUS_11430 861 1823 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence479 >Feature sequence480 <1 869 gene locus_tag LOCUS_11440 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929286.1:ATP-binding protein 1187 1543 gene locus_tag LOCUS_11450 1187 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence481 >Feature sequence482 >Feature sequence483 1359 1634 gene locus_tag LOCUS_11460 1359 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence484 >Feature sequence485 1191 727 gene locus_tag LOCUS_11470 1191 727 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529946.1 protein_id gnl|my_center|LOCUS_11470 <2021 1324 gene locus_tag LOCUS_11480 <2021 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390685.1:PAS domain-containing protein >Feature sequence486 275 907 gene locus_tag LOCUS_11490 275 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1115 1981 gene locus_tag LOCUS_11500 1115 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence487 <1 922 gene locus_tag LOCUS_11510 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391234.1:threonine--tRNA ligase 1033 1554 gene locus_tag LOCUS_11520 gene infC 1033 1554 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_11520 1671 1760 gene locus_tag LOCUS_t00140 1671 1760 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence488 405 707 gene locus_tag LOCUS_11530 405 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 704 1009 gene locus_tag LOCUS_11540 704 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1011 1424 gene locus_tag LOCUS_11550 1011 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence489 <1 646 gene locus_tag LOCUS_11560 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817177.1:hydrogenase 2 large subunit 708 1193 gene locus_tag LOCUS_11570 708 1193 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221953.1 protein_id gnl|my_center|LOCUS_11570 1199 1432 gene locus_tag LOCUS_11580 1199 1432 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence490 <1 1302 gene locus_tag LOCUS_11590 <1 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243547.1:nitrite reductase large subunit NirB 1302 1640 gene locus_tag LOCUS_11600 gene nirD 1302 1640 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence491 948 295 gene locus_tag LOCUS_11610 948 295 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061641.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence492 <1 592 gene locus_tag LOCUS_11620 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_237703763.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 666 1478 gene locus_tag LOCUS_11630 gene rsbQ 666 1478 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence493 648 67 gene locus_tag LOCUS_11640 648 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1613 723 gene locus_tag LOCUS_11650 1613 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence494 <1 663 gene locus_tag LOCUS_11660 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064255467.1:polysaccharide pyruvyl transferase family protein 674 1306 gene locus_tag LOCUS_11670 674 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence495 881 132 gene locus_tag LOCUS_11680 881 132 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390960.1 protein_id gnl|my_center|LOCUS_11680 1323 871 gene locus_tag LOCUS_11690 1323 871 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940930.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence496 1897 119 gene locus_tag LOCUS_11700 1897 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence497 1654 455 gene locus_tag LOCUS_11710 1654 455 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186349.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence498 <1 1730 gene locus_tag LOCUS_11720 <1 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976109.1:carbamoyltransferase >Feature sequence499 1185 187 gene locus_tag LOCUS_11730 1185 187 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940885.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence500 1928 198 gene locus_tag LOCUS_11740 1928 198 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence501 <1 1626 gene locus_tag LOCUS_11750 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257770.1:PBP1A family penicillin-binding protein >Feature sequence502 <1 1675 gene locus_tag LOCUS_11760 <1 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038915.1:bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA 1903 1709 gene locus_tag LOCUS_11770 1903 1709 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence503 727 14 gene locus_tag LOCUS_11780 727 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1735 821 gene locus_tag LOCUS_11790 1735 821 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085151.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence504 <1 737 gene locus_tag LOCUS_11800 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014625895.1:acetyl-CoA carboxylase carboxyltransferase subunit alpha 830 1570 gene locus_tag LOCUS_11810 830 1570 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence505 1067 360 gene locus_tag LOCUS_11820 1067 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1447 1232 gene locus_tag LOCUS_11830 1447 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence506 <1 616 gene locus_tag LOCUS_11840 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390917.1:ABC transporter ATP-binding protein 919 1308 gene locus_tag LOCUS_11850 919 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1305 1922 gene locus_tag LOCUS_11860 1305 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence507 631 38 gene locus_tag LOCUS_11870 gene recR 631 38 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639926.1 protein_id gnl|my_center|LOCUS_11870 971 648 gene locus_tag LOCUS_11880 971 648 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391219.1 protein_id gnl|my_center|LOCUS_11880 <1985 968 gene locus_tag LOCUS_11890 <1985 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391220.1:DNA polymerase III subunit gamma/tau >Feature sequence508 >Feature sequence509 186 977 gene locus_tag LOCUS_11900 186 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence510 1607 327 gene locus_tag LOCUS_11910 gene purD 1607 327 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence511 1302 811 gene locus_tag LOCUS_11920 1302 811 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391072.1 protein_id gnl|my_center|LOCUS_11920 <1975 1308 gene locus_tag LOCUS_11930 <1975 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626568.1:cytochrome c oxidase accessory protein CcoG >Feature sequence512 800 27 gene locus_tag LOCUS_11940 800 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1639 941 gene locus_tag LOCUS_11950 1639 941 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265848.1 protein_id gnl|my_center|LOCUS_11950 1974 1651 gene locus_tag LOCUS_11960 1974 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence513 2 373 gene locus_tag LOCUS_11970 2 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1761 421 gene locus_tag LOCUS_11980 gene rimO 1761 421 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390438.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence514 877 284 gene locus_tag LOCUS_11990 877 284 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_11990 1637 894 gene locus_tag LOCUS_12000 1637 894 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391108.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence515 323 652 gene locus_tag LOCUS_12010 323 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 894 1706 gene locus_tag LOCUS_12020 894 1706 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140366.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence516 1596 1267 gene locus_tag LOCUS_12030 1596 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence517 <1 895 gene locus_tag LOCUS_12040 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089709.1:HlyD family type I secretion periplasmic adaptor subunit >Feature sequence518 <1 596 gene locus_tag LOCUS_12050 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388922.1:nickel-dependent hydrogenase large subunit 589 933 gene locus_tag LOCUS_12060 gene hypA 589 933 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338274.1 protein_id gnl|my_center|LOCUS_12060 933 1856 gene locus_tag LOCUS_12070 gene hypB 933 1856 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337646.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence519 1 456 gene locus_tag LOCUS_12080 1 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 453 1151 gene locus_tag LOCUS_12090 453 1151 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_12090 <1965 1272 gene locus_tag LOCUS_12100 <1965 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531263.1:hybrid sensor histidine kinase/response regulator >Feature sequence520 <1 929 gene locus_tag LOCUS_12110 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391258.1:aconitate hydratase AcnA 1385 936 gene locus_tag LOCUS_12120 gene gpt 1385 936 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175425.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence521 212 790 gene locus_tag LOCUS_12130 212 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 <1962 798 gene locus_tag LOCUS_12140 <1962 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640543.1:DUF2336 domain-containing protein >Feature sequence522 1874 171 gene locus_tag LOCUS_12150 1874 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918991.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence523 <1 650 gene locus_tag LOCUS_12160 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065027.1:NAD(P)/FAD-dependent oxidoreductase 647 1867 gene locus_tag LOCUS_12170 647 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence524 23 886 gene locus_tag LOCUS_12180 23 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 998 1594 gene locus_tag LOCUS_12190 998 1594 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence525 <1 700 gene locus_tag LOCUS_12200 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388576.1:HPr kinase/phosphatase C-terminal domain-containing protein <1959 669 gene locus_tag LOCUS_12210 <1959 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388575.1:asparagine synthase-related protein >Feature sequence526 <1 884 gene locus_tag LOCUS_12220 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838402.1:6-phosphofructokinase <1956 963 gene locus_tag LOCUS_12230 <1956 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525384.1:NnrS family protein >Feature sequence527 1789 155 gene locus_tag LOCUS_12240 1789 155 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216298.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence528 >Feature sequence529 <1 1026 gene locus_tag LOCUS_12250 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388993.1:glutamate-5-semialdehyde dehydrogenase 1138 1788 gene locus_tag LOCUS_12260 1138 1788 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388992.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence530 253 1086 gene locus_tag LOCUS_12270 gene murI 253 1086 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938069.1 protein_id gnl|my_center|LOCUS_12270 1389 1808 gene locus_tag LOCUS_12280 1389 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence531 >Feature sequence532 964 368 gene locus_tag LOCUS_12290 964 368 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence533 1554 595 gene locus_tag LOCUS_12300 1554 595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence534 539 988 gene locus_tag LOCUS_12310 539 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1818 985 gene locus_tag LOCUS_12320 1818 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence535 >Feature sequence536 190 1398 gene locus_tag LOCUS_12330 190 1398 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence537 <1935 782 gene locus_tag LOCUS_12340 <1935 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_049560050.1:phage portal protein >Feature sequence538 1673 1299 gene locus_tag LOCUS_12350 1673 1299 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence539 >Feature sequence540 1273 227 gene locus_tag LOCUS_12360 1273 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence541 1191 247 gene locus_tag LOCUS_12370 1191 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12370 <1924 1188 gene locus_tag LOCUS_12380 <1924 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000549978.1:DegT/DnrJ/EryC1/StrS family aminotransferase note possible pseudo, frameshifted >Feature sequence542 739 74 gene locus_tag LOCUS_12390 739 74 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 protein_id gnl|my_center|LOCUS_12390 959 1819 gene locus_tag LOCUS_12400 959 1819 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence543 964 113 gene locus_tag LOCUS_12410 964 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12410 1616 861 gene locus_tag LOCUS_12420 1616 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12420 >Feature sequence544 947 1276 gene locus_tag LOCUS_12430 947 1276 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719280.1 protein_id gnl|my_center|LOCUS_12430 1354 1866 gene locus_tag LOCUS_12440 1354 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence545 456 1652 gene locus_tag LOCUS_12450 gene sucC 456 1652 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence546 1915 524 gene locus_tag LOCUS_12460 1915 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence547 552 346 gene locus_tag LOCUS_12470 552 346 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389274.1 protein_id gnl|my_center|LOCUS_12470 1160 747 gene locus_tag LOCUS_12480 1160 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 <1917 1251 gene locus_tag LOCUS_12490 <1917 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391207.1:cyclic nucleotide-binding domain-containing protein >Feature sequence548 153 1133 gene locus_tag LOCUS_12500 153 1133 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence549 <1913 183 gene locus_tag LOCUS_12510 <1913 183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067382.1:M3 family metallopeptidase >Feature sequence550 >Feature sequence551 1232 1594 gene locus_tag LOCUS_12520 1232 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence552 227 1903 gene locus_tag LOCUS_12530 gene rpsA 227 1903 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence553 >Feature sequence554 430 35 gene locus_tag LOCUS_12540 430 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1185 430 gene locus_tag LOCUS_12550 1185 430 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070969.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence555 142 984 gene locus_tag LOCUS_12560 142 984 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence556 >Feature sequence557 281 694 gene locus_tag LOCUS_12570 281 694 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_12570 768 1025 gene locus_tag LOCUS_12580 768 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1141 1067 gene locus_tag LOCUS_t00150 1141 1067 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1758 1204 gene locus_tag LOCUS_12590 1758 1204 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389495.1 protein_id gnl|my_center|LOCUS_12590 1893 1774 gene locus_tag LOCUS_12600 1893 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence558 556 1239 gene locus_tag LOCUS_12610 556 1239 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence559 1100 891 gene locus_tag LOCUS_12620 1100 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence560 <1902 1104 gene locus_tag LOCUS_12630 <1902 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003493576.1:2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase >Feature sequence561 809 306 gene locus_tag LOCUS_12640 gene rfaH 809 306 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_12640 1426 809 gene locus_tag LOCUS_12650 1426 809 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957830.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence562 913 1872 gene locus_tag LOCUS_12660 gene mdh 913 1872 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388965.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence563 1486 674 gene locus_tag LOCUS_12670 gene trpA 1486 674 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391175.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence564 1498 152 gene locus_tag LOCUS_12680 gene secY 1498 152 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence565 1307 510 gene locus_tag LOCUS_12690 1307 510 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence566 471 1322 gene locus_tag LOCUS_12700 471 1322 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529675.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence567 372 656 gene locus_tag LOCUS_12710 372 656 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 protein_id gnl|my_center|LOCUS_12710 672 1085 gene locus_tag LOCUS_12720 672 1085 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_12720 1355 1125 gene locus_tag LOCUS_12730 1355 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence568 1079 279 gene locus_tag LOCUS_12740 1079 279 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942362.1 protein_id gnl|my_center|LOCUS_12740 1755 1084 gene locus_tag LOCUS_12750 1755 1084 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919005.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence569 1472 93 gene locus_tag LOCUS_12760 1472 93 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence570 577 98 gene locus_tag LOCUS_12770 gene bfr 577 98 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_12770 1107 688 gene locus_tag LOCUS_12780 1107 688 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131763.1 protein_id gnl|my_center|LOCUS_12780 <1891 1186 gene locus_tag LOCUS_12790 <1891 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836200.1:ModD protein >Feature sequence571 <1890 1367 gene locus_tag LOCUS_12800 <1890 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein >Feature sequence572 391 819 gene locus_tag LOCUS_12810 gene flaF 391 819 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626463.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence573 846 202 gene locus_tag LOCUS_12820 846 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1585 857 gene locus_tag LOCUS_12830 1585 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence574 1271 360 gene locus_tag LOCUS_12840 1271 360 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088736.1 protein_id gnl|my_center|LOCUS_12840 <1886 1268 gene locus_tag LOCUS_12850 <1886 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088731.1:LegC family aminotransferase >Feature sequence575 1607 681 gene locus_tag LOCUS_12860 1607 681 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388403.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence576 1385 1837 gene locus_tag LOCUS_12870 1385 1837 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086201.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence577 45 899 gene locus_tag LOCUS_12880 45 899 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389159.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence578 1335 208 gene locus_tag LOCUS_12890 gene murG 1335 208 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_12890 <1884 1332 gene locus_tag LOCUS_12900 <1884 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388706.1:putative peptidoglycan glycosyltransferase FtsW >Feature sequence579 376 891 gene locus_tag LOCUS_12910 376 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 893 1285 gene locus_tag LOCUS_12920 893 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence580 <1 1625 gene locus_tag LOCUS_12930 <1 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206819987.1:DUF115 domain-containing protein >Feature sequence581 <1875 20 gene locus_tag LOCUS_12940 <1875 20 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162470599.1:bacteriohemerythrin >Feature sequence582 25 1290 gene locus_tag LOCUS_12950 25 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence583 >Feature sequence584 1142 174 gene locus_tag LOCUS_12960 1142 174 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_12960 <1870 1277 gene locus_tag LOCUS_12970 <1870 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391423.1:TRAP transporter large permease subunit >Feature sequence585 <1 1150 gene locus_tag LOCUS_12980 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207874.1:potassium transporter Kup 1841 1161 gene locus_tag LOCUS_12990 1841 1161 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388914.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence586 >Feature sequence587 439 1155 gene locus_tag LOCUS_13000 439 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1856 1200 gene locus_tag LOCUS_13010 1856 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence588 2 376 gene locus_tag LOCUS_13020 2 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 567 1472 gene locus_tag LOCUS_13030 567 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence589 3 656 gene locus_tag LOCUS_13040 3 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence590 <1 805 gene locus_tag LOCUS_13050 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391454.1:UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase 1258 824 gene locus_tag LOCUS_13060 1258 824 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_13060 1449 1255 gene locus_tag LOCUS_13070 1449 1255 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391456.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence591 1 237 gene locus_tag LOCUS_13080 1 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 234 1175 gene locus_tag LOCUS_13090 234 1175 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_13090 1175 1822 gene locus_tag LOCUS_13100 1175 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence592 <1 733 gene locus_tag LOCUS_13110 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389162.1:HAMP domain-containing methyl-accepting chemotaxis protein <1849 813 gene locus_tag LOCUS_13120 <1849 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388801.1:propionyl-CoA synthetase >Feature sequence593 1617 91 gene locus_tag LOCUS_13130 gene nifK 1617 91 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388767.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence594 3 509 gene locus_tag LOCUS_13140 3 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 715 1686 gene locus_tag LOCUS_13150 715 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence595 <1 666 gene locus_tag LOCUS_13160 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033446421.1:glutathione S-transferase N-terminal domain-containing protein >Feature sequence596 627 16 gene locus_tag LOCUS_13170 627 16 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_13170 1559 627 gene locus_tag LOCUS_13180 gene msrP 1559 627 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036770.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence597 1240 428 gene locus_tag LOCUS_13190 1240 428 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086000.1 protein_id gnl|my_center|LOCUS_13190 1840 1313 gene locus_tag LOCUS_13200 1840 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence598 <1842 630 gene locus_tag LOCUS_13210 <1842 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389443.1:NADH-quinone oxidoreductase subunit NuoN >Feature sequence599 954 643 gene locus_tag LOCUS_13220 gene nuoK 954 643 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531854.1 protein_id gnl|my_center|LOCUS_13220 1565 954 gene locus_tag LOCUS_13230 1565 954 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389439.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence600 >Feature sequence601 33 1187 gene locus_tag LOCUS_13240 33 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence602 1678 764 gene locus_tag LOCUS_13250 1678 764 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence603 465 1070 gene locus_tag LOCUS_13260 gene satP 465 1070 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_13260 1836 1111 gene locus_tag LOCUS_13270 1836 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence604 <1 1529 gene locus_tag LOCUS_13280 <1 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104537.1:phage terminase large subunit family protein 1535 1744 gene locus_tag LOCUS_13290 1535 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence605 136 828 gene locus_tag LOCUS_13300 136 828 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence606 375 1067 gene locus_tag LOCUS_13310 gene modB 375 1067 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence607 <1 1505 gene locus_tag LOCUS_13320 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838811.1:histidine kinase dimerization/phosphoacceptor domain -containing protein >Feature sequence608 541 693 gene locus_tag LOCUS_13330 541 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 881 708 gene locus_tag LOCUS_13340 881 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence609 <1 1232 gene locus_tag LOCUS_13350 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389638.1:phosphopyruvate hydratase 1516 1824 gene locus_tag LOCUS_13360 1516 1824 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626266.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence610 >Feature sequence611 >Feature sequence612 96 1580 gene locus_tag LOCUS_13370 96 1580 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence613 1818 1621 gene locus_tag LOCUS_13380 1818 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence614 21 221 gene locus_tag LOCUS_13390 21 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 218 847 gene locus_tag LOCUS_13400 gene cheD 218 847 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence615 244 993 gene locus_tag LOCUS_13410 244 993 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532201.1 protein_id gnl|my_center|LOCUS_13410 <1817 1114 gene locus_tag LOCUS_13420 <1817 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626618.1:molecular chaperone DnaJ >Feature sequence616 <1 587 gene locus_tag LOCUS_13430 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626582.1:sensor domain-containing diguanylate cyclase 654 1409 gene locus_tag LOCUS_13440 654 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence617 <1 1070 gene locus_tag LOCUS_13450 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388890.1:pyridoxal phosphate-dependent aminotransferase <1814 1123 gene locus_tag LOCUS_13460 <1814 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876085.1:response regulator >Feature sequence618 361 720 gene locus_tag LOCUS_13470 361 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1470 775 gene locus_tag LOCUS_13480 1470 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence619 <1813 818 gene locus_tag LOCUS_13490 <1813 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390479.1:flagellar hook-associated protein FlgK >Feature sequence620 190 543 gene locus_tag LOCUS_13500 190 543 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_13500 <1813 679 gene locus_tag LOCUS_13510 <1813 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532810.1:glycosyltransferase family 9 protein >Feature sequence621 38 1231 gene locus_tag LOCUS_13520 38 1231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_13520 1273 1467 gene locus_tag LOCUS_13530 1273 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence622 >Feature sequence623 343 432 gene locus_tag LOCUS_t00160 343 432 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence624 329 673 gene locus_tag LOCUS_13540 329 673 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_13540 803 1180 gene locus_tag LOCUS_13550 803 1180 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067237.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence625 331 981 gene locus_tag LOCUS_13560 331 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence626 >Feature sequence627 >Feature sequence628 1573 632 gene locus_tag LOCUS_13570 1573 632 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047962736.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence629 1796 1026 gene locus_tag LOCUS_13580 gene aguB 1796 1026 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141681.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence630 >Feature sequence631 692 1147 gene locus_tag LOCUS_13590 692 1147 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389582.1 protein_id gnl|my_center|LOCUS_13590 1402 1211 gene locus_tag LOCUS_13600 1402 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence632 >Feature sequence633 <1 1224 gene locus_tag LOCUS_13610 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388303.1:flagellar basal-body MS-ring/collar protein FliF >Feature sequence634 1047 229 gene locus_tag LOCUS_13620 1047 229 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625968.1 protein_id gnl|my_center|LOCUS_13620 <1785 1044 gene locus_tag LOCUS_13630 <1785 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389733.1:mitochondrial fission ELM1 family protein >Feature sequence635 >Feature sequence636 564 1154 gene locus_tag LOCUS_13640 gene phaR 564 1154 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_13640 1301 1747 gene locus_tag LOCUS_13650 1301 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence637 1103 75 gene locus_tag LOCUS_13660 1103 75 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222163.1 protein_id gnl|my_center|LOCUS_13660 <1780 1100 gene locus_tag LOCUS_13670 <1780 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222162.1:AMP-binding protein >Feature sequence638 >Feature sequence639 1252 743 gene locus_tag LOCUS_13680 1252 743 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389277.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence640 1437 88 gene locus_tag LOCUS_13690 1437 88 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence641 1640 1236 gene locus_tag LOCUS_13700 1640 1236 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387810.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence642 <1 881 gene locus_tag LOCUS_13710 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391315.1:hydroxymethylbilane synthase >Feature sequence643 >Feature sequence644 >Feature sequence645 461 174 gene locus_tag LOCUS_13720 461 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 713 1513 gene locus_tag LOCUS_13730 713 1513 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393449.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence646 <1 699 gene locus_tag LOCUS_13740 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338398.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD 702 1370 gene locus_tag LOCUS_13750 702 1370 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338145.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence647 <1 1150 gene locus_tag LOCUS_13760 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389426.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence648 >Feature sequence649 <1767 1176 gene locus_tag LOCUS_13770 <1767 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391390.1:nucleotide exchange factor GrpE >Feature sequence650 <1 1158 gene locus_tag LOCUS_13780 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338979.1:PLP-dependent aminotransferase family protein >Feature sequence651 >Feature sequence652 <1 720 gene locus_tag LOCUS_13790 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525354.1:NAD(+) synthase 756 1556 gene locus_tag LOCUS_13800 756 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence653 >Feature sequence654 414 13 gene locus_tag LOCUS_13810 414 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1414 632 gene locus_tag LOCUS_13820 1414 632 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 protein_id gnl|my_center|LOCUS_13820 1608 1426 gene locus_tag LOCUS_13830 1608 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence655 421 1386 gene locus_tag LOCUS_13840 421 1386 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence656 <1 1086 gene locus_tag LOCUS_13850 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087593.1:molybdopterin molybdotransferase MoeA >Feature sequence657 <1 885 gene locus_tag LOCUS_13860 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257384.1:O-antigen ligase family protein <1756 858 gene locus_tag LOCUS_13870 <1756 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089046.1:glycosyltransferase family 4 protein >Feature sequence658 >Feature sequence659 627 7 gene locus_tag LOCUS_13880 627 7 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390647.1 protein_id gnl|my_center|LOCUS_13880 <1755 796 gene locus_tag LOCUS_13890 <1755 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390307.1:methyl-accepting chemotaxis protein >Feature sequence660 <1 554 gene locus_tag LOCUS_13900 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389364.1:bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase 877 551 gene locus_tag LOCUS_13910 877 551 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence661 763 164 gene locus_tag LOCUS_13920 763 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1193 756 gene locus_tag LOCUS_13930 1193 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1490 1197 gene locus_tag LOCUS_13940 1490 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence662 362 739 gene locus_tag LOCUS_13950 362 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence663 >Feature sequence664 >Feature sequence665 <1 1371 gene locus_tag LOCUS_13960 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089799.1:methyl-accepting chemotaxis protein >Feature sequence666 1570 248 gene locus_tag LOCUS_13970 1570 248 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence667 109 195 gene locus_tag LOCUS_t00170 109 195 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 579 1490 gene locus_tag LOCUS_13980 579 1490 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391485.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence668 >Feature sequence669 1701 358 gene locus_tag LOCUS_13990 1701 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence670 <1739 922 gene locus_tag LOCUS_14000 <1739 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942001.1:sulfate ABC transporter permease subunit CysW >Feature sequence671 <1738 1228 gene locus_tag LOCUS_14010 <1738 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207107.1:ion transporter >Feature sequence672 <1737 1157 gene locus_tag LOCUS_14020 <1737 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388967.1:succinate--CoA ligase subunit alpha >Feature sequence673 204 428 gene locus_tag LOCUS_14030 gene tusA 204 428 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_14030 428 802 gene locus_tag LOCUS_14040 428 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086291.1 protein_id gnl|my_center|LOCUS_14040 1429 815 gene locus_tag LOCUS_14050 1429 815 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence674 >Feature sequence675 <1 876 gene locus_tag LOCUS_14060 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390799.1:glycine cleavage system aminomethyltransferase GcvT 888 1262 gene locus_tag LOCUS_14070 gene gcvH 888 1262 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390798.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence676 1600 701 gene locus_tag LOCUS_14080 1600 701 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970364.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence677 1258 485 gene locus_tag LOCUS_14090 1258 485 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence678 >Feature sequence679 1287 856 gene locus_tag LOCUS_14100 1287 856 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389850.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence680 <1 589 gene locus_tag LOCUS_14110 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084052.1:alpha/beta hydrolase <1730 570 gene locus_tag LOCUS_14120 <1730 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389064.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence681 121 1431 gene locus_tag LOCUS_14130 121 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence682 <1 785 gene locus_tag LOCUS_14140 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388273.1:TIGR01459 family HAD-type hydrolase >Feature sequence683 >Feature sequence684 <1 523 gene locus_tag LOCUS_14150 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390744.1:cobalt-precorrin-5B (C(1))-methyltransferase 520 1251 gene locus_tag LOCUS_14160 520 1251 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_14160 1636 1235 gene locus_tag LOCUS_14170 1636 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 >Feature sequence685 >Feature sequence686 >Feature sequence687 <1 1432 gene locus_tag LOCUS_14180 <1 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390371.1:S49 family peptidase >Feature sequence688 <1 1206 gene locus_tag LOCUS_14190 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388393.1:cation acetate symporter >Feature sequence689 520 23 gene locus_tag LOCUS_14200 520 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 649 1026 gene locus_tag LOCUS_14210 649 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1028 1708 gene locus_tag LOCUS_14220 1028 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence690 >Feature sequence691 1714 614 gene locus_tag LOCUS_14230 1714 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence692 >Feature sequence693 215 844 gene locus_tag LOCUS_14240 215 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1446 841 gene locus_tag LOCUS_14250 1446 841 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328752.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence694 >Feature sequence695 >Feature sequence696 1676 1317 gene locus_tag LOCUS_14260 1676 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence697 >Feature sequence698 >Feature sequence699 198 1067 gene locus_tag LOCUS_14270 198 1067 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705524.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence700 >Feature sequence701 446 174 gene locus_tag LOCUS_14280 446 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 <1701 513 gene locus_tag LOCUS_14290 <1701 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037402494.1:alpha/beta fold hydrolase >Feature sequence702 1410 547 gene locus_tag LOCUS_14300 gene ccoP 1410 547 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_14300 1576 1412 gene locus_tag LOCUS_14310 1576 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence703 458 1294 gene locus_tag LOCUS_14320 458 1294 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence704 <1 733 gene locus_tag LOCUS_14330 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056086.1:quinolinate synthase NadA 733 1584 gene locus_tag LOCUS_14340 gene nadC 733 1584 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence705 374 907 gene locus_tag LOCUS_14350 374 907 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence706 45 1121 gene locus_tag LOCUS_14360 gene mnmA 45 1121 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337613.1 protein_id gnl|my_center|LOCUS_14360 1200 1655 gene locus_tag LOCUS_14370 1200 1655 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390533.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence707 817 1068 gene locus_tag LOCUS_14380 817 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14380 >Feature sequence708 953 597 gene locus_tag LOCUS_14390 gene yajC 953 597 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626242.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence709 803 15 gene locus_tag LOCUS_14400 803 15 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_14400 <1691 800 gene locus_tag LOCUS_14410 <1691 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532214.1:COX15/CtaA family protein >Feature sequence710 606 1313 gene locus_tag LOCUS_14420 606 1313 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626143.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence711 >Feature sequence712 1158 190 gene locus_tag LOCUS_14430 1158 190 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391118.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence713 745 98 gene locus_tag LOCUS_14440 745 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1340 774 gene locus_tag LOCUS_14450 1340 774 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970512.1 protein_id gnl|my_center|LOCUS_14450 1686 1405 gene locus_tag LOCUS_14460 1686 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence714 <1684 1084 gene locus_tag LOCUS_14470 <1684 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006311298.1:response regulator transcription factor >Feature sequence715 217 603 gene locus_tag LOCUS_14480 gene rplV 217 603 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390433.1 protein_id gnl|my_center|LOCUS_14480 608 1291 gene locus_tag LOCUS_14490 gene rpsC 608 1291 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence716 >Feature sequence717 >Feature sequence718 1109 174 gene locus_tag LOCUS_14500 1109 174 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703174.1 protein_id gnl|my_center|LOCUS_14500 <1681 1097 gene locus_tag LOCUS_14510 <1681 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267533.1:methyl-accepting chemotaxis protein >Feature sequence719 329 129 gene locus_tag LOCUS_14520 329 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1204 326 gene locus_tag LOCUS_14530 gene hflC 1204 326 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence720 >Feature sequence721 1476 388 gene locus_tag LOCUS_14540 gene aroC 1476 388 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence722 >Feature sequence723 >Feature sequence724 <1676 772 gene locus_tag LOCUS_14550 <1676 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein >Feature sequence725 >Feature sequence726 1318 293 gene locus_tag LOCUS_14560 1318 293 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169265.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence727 2 616 gene locus_tag LOCUS_14570 2 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 613 897 gene locus_tag LOCUS_14580 613 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1078 851 gene locus_tag LOCUS_14590 1078 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence728 <1 775 gene locus_tag LOCUS_14600 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143816.1:iron-containing alcohol dehydrogenase 772 1212 gene locus_tag LOCUS_14610 772 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence729 1325 846 gene locus_tag LOCUS_14620 1325 846 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388009.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence730 160 1524 gene locus_tag LOCUS_14630 160 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence731 >Feature sequence732 160 1011 gene locus_tag LOCUS_14640 160 1011 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024691249.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence733 56 964 gene locus_tag LOCUS_14650 56 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence734 1659 739 gene locus_tag LOCUS_14660 1659 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence735 <1659 740 gene locus_tag LOCUS_14670 <1659 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339403.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase >Feature sequence736 <1 762 gene locus_tag LOCUS_14680 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390010.1:RNA degradosome polyphosphate kinase >Feature sequence737 <1654 946 gene locus_tag LOCUS_14690 <1654 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088468.1:phosphoribosylformylglycinamidine synthase subunit PurQ >Feature sequence738 2 163 gene locus_tag LOCUS_14700 2 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 174 575 gene locus_tag LOCUS_14710 174 575 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390031.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence739 783 163 gene locus_tag LOCUS_14720 783 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1151 780 gene locus_tag LOCUS_14730 1151 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence740 867 100 gene locus_tag LOCUS_14740 867 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1462 941 gene locus_tag LOCUS_14750 1462 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence741 3 1181 gene locus_tag LOCUS_14760 gene thrC 3 1181 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence742 149 487 gene locus_tag LOCUS_14770 149 487 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence743 <1641 377 gene locus_tag LOCUS_14780 <1641 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000972986.1:protein-disulfide reductase DsbD family protein >Feature sequence744 389 745 gene locus_tag LOCUS_14790 389 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 769 1545 gene locus_tag LOCUS_14800 769 1545 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence745 <1 1456 gene locus_tag LOCUS_14810 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012502785.1:tetratricopeptide repeat protein >Feature sequence746 94 555 gene locus_tag LOCUS_14820 gene smpB 94 555 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389617.1 protein_id gnl|my_center|LOCUS_14820 573 1238 gene locus_tag LOCUS_14830 573 1238 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence747 <1 504 gene locus_tag LOCUS_14840 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390939.1:dihydroorotase 504 1094 gene locus_tag LOCUS_14850 gene plsY 504 1094 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390940.1 protein_id gnl|my_center|LOCUS_14850 1175 1441 gene locus_tag LOCUS_14860 1175 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence748 >Feature sequence749 1613 1188 gene locus_tag LOCUS_14870 1613 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence750 >Feature sequence751 3 752 gene locus_tag LOCUS_14880 3 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence752 <1 1481 gene locus_tag LOCUS_14890 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390501.1:elongation factor G >Feature sequence753 >Feature sequence754 599 54 gene locus_tag LOCUS_14900 599 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence755 349 1107 gene locus_tag LOCUS_14910 gene cysE 349 1107 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence756 917 114 gene locus_tag LOCUS_14920 917 114 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389792.1 protein_id gnl|my_center|LOCUS_14920 <1623 993 gene locus_tag LOCUS_14930 <1623 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391322.1:acetate--CoA ligase >Feature sequence757 <1 1062 gene locus_tag LOCUS_14940 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387997.1:IMP dehydrogenase >Feature sequence758 >Feature sequence759 1124 159 gene locus_tag LOCUS_14950 1124 159 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920778.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence760 954 280 gene locus_tag LOCUS_14960 954 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence761 1519 929 gene locus_tag LOCUS_14970 1519 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence762 410 24 gene locus_tag LOCUS_14980 410 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence763 335 45 gene locus_tag LOCUS_14990 335 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 575 1306 gene locus_tag LOCUS_15000 575 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence764 >Feature sequence765 1246 404 gene locus_tag LOCUS_15010 1246 404 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929879.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence766 <1612 728 gene locus_tag LOCUS_15020 <1612 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009315212.1:type II secretion system secretin GspD >Feature sequence767 >Feature sequence768 238 1194 gene locus_tag LOCUS_15030 238 1194 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391458.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence769 >Feature sequence770 >Feature sequence771 602 6 gene locus_tag LOCUS_15040 602 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence772 24 404 gene locus_tag LOCUS_15050 24 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence773 1134 169 gene locus_tag LOCUS_15060 1134 169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_15060 1189 1386 gene locus_tag LOCUS_15070 1189 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence774 <1 553 gene locus_tag LOCUS_15080 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391277.1:DNA polymerase IV 628 858 gene locus_tag LOCUS_15090 628 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 <1595 928 gene locus_tag LOCUS_15100 <1595 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387777.1:complex I NDUFA9 subunit family protein >Feature sequence775 1193 186 gene locus_tag LOCUS_15110 gene pseG 1193 186 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence776 570 1505 gene locus_tag LOCUS_15120 gene pip 570 1505 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence777 >Feature sequence778 133 1029 gene locus_tag LOCUS_15130 133 1029 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence779 759 313 gene locus_tag LOCUS_15140 759 313 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_15140 1103 759 gene locus_tag LOCUS_15150 1103 759 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388255.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence780 457 203 gene locus_tag LOCUS_15160 457 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 <1586 483 gene locus_tag LOCUS_15170 <1586 483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391065.1:gamma-glutamyltransferase >Feature sequence781 <1 729 gene locus_tag LOCUS_15180 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192063.1:LysR family transcriptional regulator <1585 771 gene locus_tag LOCUS_15190 <1585 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880602.1:M48 family metallopeptidase >Feature sequence782 <1585 762 gene locus_tag LOCUS_15200 <1585 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640170.1:class I SAM-dependent methyltransferase >Feature sequence783 >Feature sequence784 728 336 gene locus_tag LOCUS_15210 728 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence785 1331 1426 gene locus_tag LOCUS_t00180 1331 1426 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence786 1136 432 gene locus_tag LOCUS_15220 gene pyrF 1136 432 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_15220 1550 1212 gene locus_tag LOCUS_15230 1550 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence787 <1583 113 gene locus_tag LOCUS_15240 <1583 113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037033.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase >Feature sequence788 >Feature sequence789 >Feature sequence790 <1 579 gene locus_tag LOCUS_15250 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391307.1:EAL domain-containing protein 622 1362 gene locus_tag LOCUS_15260 622 1362 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391306.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence791 <1579 904 gene locus_tag LOCUS_15270 <1579 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920160.1:O-antigen ligase >Feature sequence792 227 152 gene locus_tag LOCUS_t00190 227 152 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 410 706 gene locus_tag LOCUS_15280 410 706 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_15280 703 1065 gene locus_tag LOCUS_15290 703 1065 CDS product DUF167 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391273.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence793 2 430 gene locus_tag LOCUS_15300 2 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1110 454 gene locus_tag LOCUS_15310 1110 454 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence794 801 1514 gene locus_tag LOCUS_15320 801 1514 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence795 >Feature sequence796 >Feature sequence797 <1 733 gene locus_tag LOCUS_15330 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388508.1:peptide chain release factor 1 >Feature sequence798 394 684 gene locus_tag LOCUS_15340 394 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 <1574 739 gene locus_tag LOCUS_15350 <1574 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042440473.1:LysR family transcriptional regulator >Feature sequence799 >Feature sequence800 632 1132 gene locus_tag LOCUS_15360 632 1132 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence801 1366 551 gene locus_tag LOCUS_15370 1366 551 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence802 406 837 gene locus_tag LOCUS_15380 406 837 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_15380 899 1555 gene locus_tag LOCUS_15390 899 1555 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence803 1170 370 gene locus_tag LOCUS_15400 gene fabI 1170 370 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence804 27 863 gene locus_tag LOCUS_15410 27 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence805 1207 410 gene locus_tag LOCUS_15420 1207 410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088703.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence806 376 558 gene locus_tag LOCUS_15430 376 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 654 729 gene locus_tag LOCUS_t00200 654 729 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence807 >Feature sequence808 >Feature sequence809 >Feature sequence810 1547 1035 gene locus_tag LOCUS_15440 1547 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence811 3 590 gene locus_tag LOCUS_15450 3 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1318 632 gene locus_tag LOCUS_15460 1318 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence812 496 59 gene locus_tag LOCUS_15470 496 59 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391031.1 protein_id gnl|my_center|LOCUS_15470 1224 613 gene locus_tag LOCUS_15480 1224 613 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence813 532 1359 gene locus_tag LOCUS_15490 gene lgt 532 1359 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence814 <1554 172 gene locus_tag LOCUS_15500 <1554 172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122239.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence815 138 584 gene locus_tag LOCUS_15510 138 584 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_15510 589 981 gene locus_tag LOCUS_15520 589 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence816 592 287 gene locus_tag LOCUS_15530 592 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 <1550 741 gene locus_tag LOCUS_15540 <1550 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942432.1:6-bladed beta-propeller >Feature sequence817 >Feature sequence818 843 118 gene locus_tag LOCUS_15550 gene pyrH 843 118 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389463.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence819 872 564 gene locus_tag LOCUS_15560 872 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1090 1494 gene locus_tag LOCUS_15570 1090 1494 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389509.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence820 >Feature sequence821 1526 873 gene locus_tag LOCUS_15580 1526 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence822 1493 513 gene locus_tag LOCUS_15590 1493 513 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence823 1540 956 gene locus_tag LOCUS_15600 1540 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence824 <1 677 gene locus_tag LOCUS_15610 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324929.1:nitrate ABC transporter ATP-binding protein >Feature sequence825 <1 751 gene locus_tag LOCUS_15620 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482405.1:MgtC/SapB family protein 754 1431 gene locus_tag LOCUS_15630 754 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence826 >Feature sequence827 1366 296 gene locus_tag LOCUS_15640 1366 296 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence828 >Feature sequence829 >Feature sequence830 1012 425 gene locus_tag LOCUS_15650 1012 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence831 >Feature sequence832 <1 1272 gene locus_tag LOCUS_15660 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389451.1:proline--tRNA ligase >Feature sequence833 <1528 587 gene locus_tag LOCUS_15670 <1528 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388453.1:citramalate synthase >Feature sequence834 1399 302 gene locus_tag LOCUS_15680 1399 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence835 836 462 gene locus_tag LOCUS_15690 836 462 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_15690 1524 994 gene locus_tag LOCUS_15700 1524 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence836 >Feature sequence837 1063 56 gene locus_tag LOCUS_15710 1063 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1468 1175 gene locus_tag LOCUS_15720 1468 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence838 >Feature sequence839 531 256 gene locus_tag LOCUS_15730 531 256 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_15730 644 1213 gene locus_tag LOCUS_15740 644 1213 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence840 >Feature sequence841 <1 1198 gene locus_tag LOCUS_15750 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391446.1:efflux RND transporter permease subunit >Feature sequence842 <1 914 gene locus_tag LOCUS_15760 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387763.1:DNA polymerase III subunit beta >Feature sequence843 >Feature sequence844 3 338 gene locus_tag LOCUS_15770 3 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 373 1059 gene locus_tag LOCUS_15780 373 1059 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_15780 1241 1056 gene locus_tag LOCUS_15790 1241 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence845 814 371 gene locus_tag LOCUS_15800 814 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1182 811 gene locus_tag LOCUS_15810 1182 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence846 >Feature sequence847 1197 727 gene locus_tag LOCUS_15820 1197 727 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence848 1014 631 gene locus_tag LOCUS_15830 1014 631 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence849 >Feature sequence850 >Feature sequence851 1158 442 gene locus_tag LOCUS_15840 1158 442 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence852 <1 591 gene locus_tag LOCUS_15850 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626572.1:class I SAM-dependent rRNA methyltransferase 975 1358 gene locus_tag LOCUS_15860 975 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence853 >Feature sequence854 195 479 gene locus_tag LOCUS_15870 195 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence855 >Feature sequence856 <1 626 gene locus_tag LOCUS_15880 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390161.1:single-stranded-DNA-specific exonuclease RecJ 697 772 gene locus_tag LOCUS_t00210 697 772 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence857 434 1309 gene locus_tag LOCUS_15890 434 1309 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence858 >Feature sequence859 663 352 gene locus_tag LOCUS_15900 663 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1156 686 gene locus_tag LOCUS_15910 1156 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965271.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence860 >Feature sequence861 799 371 gene locus_tag LOCUS_15920 799 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1035 859 gene locus_tag LOCUS_15930 1035 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence862 >Feature sequence863 177 989 gene locus_tag LOCUS_15940 gene minD 177 989 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 protein_id gnl|my_center|LOCUS_15940 986 1255 gene locus_tag LOCUS_15950 gene minE 986 1255 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314830.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence864 234 800 gene locus_tag LOCUS_15960 gene thiE 234 800 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_15960 822 1403 gene locus_tag LOCUS_15970 822 1403 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence865 <1 840 gene locus_tag LOCUS_15980 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086679.1:multidrug efflux RND transporter permease subunit 1134 928 gene locus_tag LOCUS_15990 1134 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence866 252 533 gene locus_tag LOCUS_16000 252 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 887 558 gene locus_tag LOCUS_16010 gene hsbA 887 558 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence867 >Feature sequence868 55 474 gene locus_tag LOCUS_16020 55 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 579 1079 gene locus_tag LOCUS_16030 579 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1175 1399 gene locus_tag LOCUS_16040 1175 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence869 <1 762 gene locus_tag LOCUS_16050 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200682.1:GDL motif peptide-associated radical SAM/SPASM maturase >Feature sequence870 566 754 gene locus_tag LOCUS_16060 566 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence871 <1 894 gene locus_tag LOCUS_16070 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056091.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence872 <1 758 gene locus_tag LOCUS_16080 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537571.1:multicopper oxidase domain-containing protein 829 1272 gene locus_tag LOCUS_16090 829 1272 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508218.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence873 >Feature sequence874 44 1192 gene locus_tag LOCUS_16100 44 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence875 313 1155 gene locus_tag LOCUS_16110 313 1155 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence876 >Feature sequence877 2 481 gene locus_tag LOCUS_16120 2 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence878 >Feature sequence879 >Feature sequence880 >Feature sequence881 >Feature sequence882 >Feature sequence883 >Feature sequence884 385 59 gene locus_tag LOCUS_16130 385 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence885 >Feature sequence886 >Feature sequence887 <1037 227 gene locus_tag LOCUS_16140 <1037 227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111231.1:LysR family transcriptional regulator >Feature sequence888 733 152 gene locus_tag LOCUS_16150 gene kdpC 733 152 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence889 1031 423 gene locus_tag LOCUS_16160 1031 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence890 >Feature sequence891 <1 561 gene locus_tag LOCUS_16170 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257064.1:iron-sulfur cluster carrier protein ApbC