>Feature sequence0001 273 523 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctccacggcgatcccgccgtggctgaattgaagc 1683 466 gene locus_tag LOCUS_00010 1683 466 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00010 1570 1857 gene locus_tag LOCUS_00020 1570 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1975 2178 gene locus_tag LOCUS_00030 1975 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5714 2190 gene locus_tag LOCUS_00040 5714 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6343 5774 gene locus_tag LOCUS_00050 6343 5774 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_00050 6691 6936 gene locus_tag LOCUS_00060 6691 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7321 6986 gene locus_tag LOCUS_00070 7321 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7507 7767 gene locus_tag LOCUS_00080 7507 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9523 7838 gene locus_tag LOCUS_00090 9523 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10599 9760 gene locus_tag LOCUS_00100 10599 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11514 10849 gene locus_tag LOCUS_00110 11514 10849 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_00110 11889 11548 gene locus_tag LOCUS_00120 11889 11548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00120 12132 11917 gene locus_tag LOCUS_00130 12132 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12244 12429 gene locus_tag LOCUS_00140 12244 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12448 13641 gene locus_tag LOCUS_00150 12448 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14253 13648 gene locus_tag LOCUS_00160 14253 13648 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_00160 15273 14338 gene locus_tag LOCUS_00170 15273 14338 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_00170 15783 15316 gene locus_tag LOCUS_00180 15783 15316 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089945.1 protein_id gnl|my_center|LOCUS_00180 16340 15801 gene locus_tag LOCUS_00190 16340 15801 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_00190 16557 18161 gene locus_tag LOCUS_00200 16557 18161 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427788.1 protein_id gnl|my_center|LOCUS_00200 19008 18352 gene locus_tag LOCUS_00210 19008 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19106 19483 gene locus_tag LOCUS_00220 19106 19483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00220 19505 19867 gene locus_tag LOCUS_00230 19505 19867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00230 19872 20039 gene locus_tag LOCUS_00240 19872 20039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00240 20103 20702 gene locus_tag LOCUS_00250 20103 20702 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_00250 20873 21622 gene locus_tag LOCUS_00260 20873 21622 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_00260 21721 23607 gene locus_tag LOCUS_00270 21721 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 23642 23938 gene locus_tag LOCUS_00280 23642 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 23972 24832 gene locus_tag LOCUS_00290 23972 24832 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 protein_id gnl|my_center|LOCUS_00290 24894 26228 gene locus_tag LOCUS_00300 24894 26228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 26422 26237 gene locus_tag LOCUS_00310 26422 26237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00310 26919 26665 gene locus_tag LOCUS_00320 26919 26665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 27091 26888 gene locus_tag LOCUS_00330 27091 26888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 27774 27088 gene locus_tag LOCUS_00340 27774 27088 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_00340 28718 27771 gene locus_tag LOCUS_00350 28718 27771 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_00350 29303 28740 gene locus_tag LOCUS_00360 29303 28740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_00360 29735 29977 gene locus_tag LOCUS_00370 29735 29977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 31765 30176 gene locus_tag LOCUS_00380 31765 30176 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939632.1 protein_id gnl|my_center|LOCUS_00380 31971 32516 gene locus_tag LOCUS_00390 31971 32516 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947825.1 protein_id gnl|my_center|LOCUS_00390 32552 33283 gene locus_tag LOCUS_00400 32552 33283 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_00400 33341 34441 gene locus_tag LOCUS_00410 33341 34441 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256728.1 protein_id gnl|my_center|LOCUS_00410 35859 34498 gene locus_tag LOCUS_00420 35859 34498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 36469 35915 gene locus_tag LOCUS_00430 36469 35915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 36598 37494 gene locus_tag LOCUS_00440 36598 37494 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_00440 37545 38213 gene locus_tag LOCUS_00450 37545 38213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 38688 38152 gene locus_tag LOCUS_00460 38688 38152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 38808 39320 gene locus_tag LOCUS_00470 38808 39320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 39320 39835 gene locus_tag LOCUS_00480 39320 39835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00480 39887 40144 gene locus_tag LOCUS_00490 39887 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00490 40558 40157 gene locus_tag LOCUS_00500 40558 40157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 41534 40698 gene locus_tag LOCUS_00510 41534 40698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 42048 41521 gene locus_tag LOCUS_00520 42048 41521 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111736.1 protein_id gnl|my_center|LOCUS_00520 43394 42051 gene locus_tag LOCUS_00530 43394 42051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 44004 43423 gene locus_tag LOCUS_00540 44004 43423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 44747 44127 gene locus_tag LOCUS_00550 44747 44127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 44785 45144 gene locus_tag LOCUS_00560 44785 45144 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031578.1 protein_id gnl|my_center|LOCUS_00560 45720 45148 gene locus_tag LOCUS_00570 45720 45148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 46324 45944 gene locus_tag LOCUS_00580 46324 45944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 47734 46424 gene locus_tag LOCUS_00590 47734 46424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 48447 47746 gene locus_tag LOCUS_00600 48447 47746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 50117 48471 gene locus_tag LOCUS_00610 50117 48471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 50857 50114 gene locus_tag LOCUS_00620 50857 50114 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328055.1 protein_id gnl|my_center|LOCUS_00620 51183 50854 gene locus_tag LOCUS_00630 51183 50854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence0002 4 76 gene locus_tag LOCUS_t00010 4 76 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1787 15 gene locus_tag LOCUS_00640 1787 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 2170 1889 gene locus_tag LOCUS_00650 2170 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 2468 2151 gene locus_tag LOCUS_00660 2468 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 3389 2547 gene locus_tag LOCUS_00670 3389 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 4378 3386 gene locus_tag LOCUS_00680 4378 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 4837 4526 gene locus_tag LOCUS_00690 4837 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 6885 5176 gene locus_tag LOCUS_00700 6885 5176 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974229.1 protein_id gnl|my_center|LOCUS_00700 7770 6967 gene locus_tag LOCUS_00710 7770 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 8504 8004 gene locus_tag LOCUS_00720 8504 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 8830 8501 gene locus_tag LOCUS_00730 8830 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 8927 9955 gene locus_tag LOCUS_00740 8927 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 9838 10263 gene locus_tag LOCUS_00750 9838 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 10574 13060 gene locus_tag LOCUS_00760 10574 13060 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085450.1 protein_id gnl|my_center|LOCUS_00760 13192 14766 gene locus_tag LOCUS_00770 13192 14766 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087506.1 protein_id gnl|my_center|LOCUS_00770 15998 14826 gene locus_tag LOCUS_00780 15998 14826 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922245.1 protein_id gnl|my_center|LOCUS_00780 15997 16296 gene locus_tag LOCUS_00790 15997 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 17333 16488 gene locus_tag LOCUS_00800 17333 16488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00800 17641 17366 gene locus_tag LOCUS_00810 17641 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00810 19963 17918 gene locus_tag LOCUS_00820 19963 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 20596 20249 gene locus_tag LOCUS_00830 20596 20249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 21239 20589 gene locus_tag LOCUS_00840 21239 20589 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_00840 21972 21370 gene locus_tag LOCUS_00850 21972 21370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 24646 21962 gene locus_tag LOCUS_00860 24646 21962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 25260 24811 gene locus_tag LOCUS_00870 25260 24811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 25281 25490 gene locus_tag LOCUS_00880 25281 25490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 25543 25698 gene locus_tag LOCUS_00890 25543 25698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 25717 26070 gene locus_tag LOCUS_00900 25717 26070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 26067 26282 gene locus_tag LOCUS_00910 26067 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 26279 27058 gene locus_tag LOCUS_00920 26279 27058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 27159 27401 gene locus_tag LOCUS_00930 27159 27401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 27424 28257 gene locus_tag LOCUS_00940 27424 28257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974889.1 protein_id gnl|my_center|LOCUS_00940 28334 28693 gene locus_tag LOCUS_00950 28334 28693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 30164 29067 gene locus_tag LOCUS_00960 30164 29067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 30790 31452 gene locus_tag LOCUS_00970 30790 31452 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921701.1 protein_id gnl|my_center|LOCUS_00970 31449 31808 gene locus_tag LOCUS_00980 31449 31808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 32400 31789 gene locus_tag LOCUS_00990 32400 31789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 32967 33515 gene locus_tag LOCUS_01000 32967 33515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 33631 33948 gene locus_tag LOCUS_01010 33631 33948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 34077 39134 gene locus_tag LOCUS_01020 34077 39134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 39947 39384 gene locus_tag LOCUS_01030 39947 39384 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141166.1 protein_id gnl|my_center|LOCUS_01030 40678 40142 gene locus_tag LOCUS_01040 40678 40142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 42841 40943 gene locus_tag LOCUS_01050 42841 40943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 42944 43399 gene locus_tag LOCUS_01060 42944 43399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 43396 43656 gene locus_tag LOCUS_01070 43396 43656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 >Feature sequence0003 <1 667 gene locus_tag LOCUS_01080 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943559.1:putative metallopeptidase 695 973 gene locus_tag LOCUS_01090 695 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 970 1371 gene locus_tag LOCUS_01100 970 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 2514 1372 gene locus_tag LOCUS_01110 2514 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 3803 2511 gene locus_tag LOCUS_01120 3803 2511 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_01120 5410 3824 gene locus_tag LOCUS_01130 5410 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5590 6531 gene locus_tag LOCUS_01140 5590 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 8007 6544 gene locus_tag LOCUS_01150 8007 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 9393 8038 gene locus_tag LOCUS_01160 9393 8038 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_01160 10981 9617 gene locus_tag LOCUS_01170 10981 9617 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921791.1 protein_id gnl|my_center|LOCUS_01170 14341 11072 gene locus_tag LOCUS_01180 14341 11072 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_01180 16421 14478 gene locus_tag LOCUS_01190 16421 14478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 17983 17102 gene locus_tag LOCUS_01200 17983 17102 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_01200 18405 17953 gene locus_tag LOCUS_01210 18405 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 19456 18419 gene locus_tag LOCUS_01220 19456 18419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 20574 19453 gene locus_tag LOCUS_01230 20574 19453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 21142 20768 gene locus_tag LOCUS_01240 21142 20768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 22406 21288 gene locus_tag LOCUS_01250 22406 21288 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_01250 25169 22431 gene locus_tag LOCUS_01260 25169 22431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 25327 26670 gene locus_tag LOCUS_01270 25327 26670 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_01270 26667 27569 gene locus_tag LOCUS_01280 26667 27569 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067996.1 protein_id gnl|my_center|LOCUS_01280 27660 28922 gene locus_tag LOCUS_01290 27660 28922 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_01290 30517 28934 gene locus_tag LOCUS_01300 30517 28934 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 protein_id gnl|my_center|LOCUS_01300 30619 31599 gene locus_tag LOCUS_01310 30619 31599 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_01310 31596 32711 gene locus_tag LOCUS_01320 31596 32711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 32851 34386 gene locus_tag LOCUS_01330 32851 34386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 34390 35406 gene locus_tag LOCUS_01340 34390 35406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 35600 37543 gene locus_tag LOCUS_01350 35600 37543 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921710.1 protein_id gnl|my_center|LOCUS_01350 37561 37929 gene locus_tag LOCUS_01360 37561 37929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 38923 37952 gene locus_tag LOCUS_01370 38923 37952 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_01370 39387 38923 gene locus_tag LOCUS_01380 39387 38923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 39889 39410 gene locus_tag LOCUS_01390 39889 39410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence0004 452 1222 gene locus_tag LOCUS_01400 452 1222 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_01400 1530 1234 gene locus_tag LOCUS_01410 1530 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2459 1596 gene locus_tag LOCUS_01420 gene tsf 2459 1596 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_01420 3508 2588 gene locus_tag LOCUS_01430 gene rpsB 3508 2588 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_01430 4775 4221 gene locus_tag LOCUS_01440 4775 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4711 6237 gene locus_tag LOCUS_01450 4711 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 6662 6165 gene locus_tag LOCUS_01460 6662 6165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_01460 9996 7000 gene locus_tag LOCUS_01470 9996 7000 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119753.1 protein_id gnl|my_center|LOCUS_01470 10554 11366 gene locus_tag LOCUS_01480 10554 11366 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_01480 11465 11384 gene locus_tag LOCUS_t00020 11465 11384 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11728 11456 gene locus_tag LOCUS_01490 11728 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 12596 11997 gene locus_tag LOCUS_01500 12596 11997 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963038.1 protein_id gnl|my_center|LOCUS_01500 13979 12654 gene locus_tag LOCUS_01510 13979 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 14037 15245 gene locus_tag LOCUS_01520 14037 15245 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_01520 15372 16115 gene locus_tag LOCUS_01530 15372 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 16109 17191 gene locus_tag LOCUS_01540 16109 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 17202 18983 gene locus_tag LOCUS_01550 17202 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 19068 19838 gene locus_tag LOCUS_01560 gene surE 19068 19838 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_01560 21300 19984 gene locus_tag LOCUS_01570 21300 19984 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_01570 21402 22775 gene locus_tag LOCUS_01580 21402 22775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 23263 22910 gene locus_tag LOCUS_01590 23263 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 25562 23280 gene locus_tag LOCUS_01600 25562 23280 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615801.1 protein_id gnl|my_center|LOCUS_01600 27402 25627 gene locus_tag LOCUS_01610 27402 25627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 28520 27483 gene locus_tag LOCUS_01620 28520 27483 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_01620 28677 30275 gene locus_tag LOCUS_01630 28677 30275 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_01630 30309 30908 gene locus_tag LOCUS_01640 30309 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 30924 32486 gene locus_tag LOCUS_01650 gene crtI 30924 32486 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_01650 32565 33386 gene locus_tag LOCUS_01660 32565 33386 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123503.1 protein_id gnl|my_center|LOCUS_01660 33383 34519 gene locus_tag LOCUS_01670 33383 34519 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922473.1 protein_id gnl|my_center|LOCUS_01670 37580 34530 gene locus_tag LOCUS_01680 37580 34530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence0005 267 527 gene locus_tag LOCUS_01690 267 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 947 669 gene locus_tag LOCUS_01700 947 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 1014 1343 gene locus_tag LOCUS_01710 1014 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 1340 1633 gene locus_tag LOCUS_01720 1340 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 1672 2151 gene locus_tag LOCUS_01730 1672 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 2141 2368 gene locus_tag LOCUS_01740 2141 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 2365 3036 gene locus_tag LOCUS_01750 2365 3036 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310627.1 protein_id gnl|my_center|LOCUS_01750 3452 3213 gene locus_tag LOCUS_01760 3452 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 3649 3858 gene locus_tag LOCUS_01770 3649 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 3855 4112 gene locus_tag LOCUS_01780 3855 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 4100 4309 gene locus_tag LOCUS_01790 4100 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 4362 4736 gene locus_tag LOCUS_01800 4362 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 5200 5601 gene locus_tag LOCUS_01810 5200 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 5655 6146 gene locus_tag LOCUS_01820 5655 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 6197 6562 gene locus_tag LOCUS_01830 6197 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 6590 6949 gene locus_tag LOCUS_01840 6590 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6979 7203 gene locus_tag LOCUS_01850 6979 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7513 7719 gene locus_tag LOCUS_01860 7513 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 7729 8391 gene locus_tag LOCUS_01870 7729 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8640 8900 gene locus_tag LOCUS_01880 8640 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01880 9546 8932 gene locus_tag LOCUS_01890 9546 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 9971 9570 gene locus_tag LOCUS_01900 9971 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 14127 9880 gene locus_tag LOCUS_01910 14127 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 14979 14371 gene locus_tag LOCUS_01920 14979 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 15381 16625 gene locus_tag LOCUS_01930 15381 16625 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_01930 16710 17282 gene locus_tag LOCUS_01940 16710 17282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 19342 17378 gene locus_tag LOCUS_01950 19342 17378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 19579 20664 gene locus_tag LOCUS_01960 19579 20664 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121284.1 protein_id gnl|my_center|LOCUS_01960 20733 21176 gene locus_tag LOCUS_01970 20733 21176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 24320 21186 gene locus_tag LOCUS_01980 24320 21186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 24657 26681 gene locus_tag LOCUS_01990 24657 26681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 27211 30204 gene locus_tag LOCUS_02000 27211 30204 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_02000 30219 31607 gene locus_tag LOCUS_02010 30219 31607 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_02010 31869 33356 gene locus_tag LOCUS_02020 31869 33356 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_02020 33575 34024 gene locus_tag LOCUS_02030 33575 34024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 <35313 34036 gene locus_tag LOCUS_02040 <35313 34036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031481.1:S8 family serine peptidase >Feature sequence0006 2346 2029 gene locus_tag LOCUS_02050 gene nirD 2346 2029 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275366.1 protein_id gnl|my_center|LOCUS_02050 4892 2427 gene locus_tag LOCUS_02060 gene nirB 4892 2427 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_02060 5712 4924 gene locus_tag LOCUS_02070 5712 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 7794 6031 gene locus_tag LOCUS_02080 7794 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8250 7900 gene locus_tag LOCUS_02090 8250 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 8522 8250 gene locus_tag LOCUS_02100 8522 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 12521 8544 gene locus_tag LOCUS_02110 12521 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 13371 12772 gene locus_tag LOCUS_02120 13371 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 14480 13419 gene locus_tag LOCUS_02130 14480 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 15424 14474 gene locus_tag LOCUS_02140 15424 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 16281 15421 gene locus_tag LOCUS_02150 16281 15421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 17244 16384 gene locus_tag LOCUS_02160 17244 16384 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139456841.1 protein_id gnl|my_center|LOCUS_02160 18400 17357 gene locus_tag LOCUS_02170 18400 17357 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761573.1 protein_id gnl|my_center|LOCUS_02170 19989 18586 gene locus_tag LOCUS_02180 19989 18586 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_02180 21410 20106 gene locus_tag LOCUS_02190 21410 20106 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence0007 1505 441 gene locus_tag LOCUS_02200 1505 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_02200 5114 1593 gene locus_tag LOCUS_02210 5114 1593 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122837.1 protein_id gnl|my_center|LOCUS_02210 6228 5224 gene locus_tag LOCUS_02220 6228 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 7143 6403 gene locus_tag LOCUS_02230 7143 6403 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_02230 8750 7164 gene locus_tag LOCUS_02240 8750 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 9447 8866 gene locus_tag LOCUS_02250 9447 8866 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_02250 11854 10022 gene locus_tag LOCUS_02260 gene mnmG 11854 10022 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_02260 11998 13944 gene locus_tag LOCUS_02270 11998 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 13973 15943 gene locus_tag LOCUS_02280 13973 15943 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_02280 16141 16986 gene locus_tag LOCUS_02290 16141 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 17230 17607 gene locus_tag LOCUS_02300 17230 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 17714 19168 gene locus_tag LOCUS_02310 17714 19168 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_02310 19839 19102 gene locus_tag LOCUS_02320 19839 19102 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_02320 20324 22915 gene locus_tag LOCUS_02330 20324 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 22929 24413 gene locus_tag LOCUS_02340 22929 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 24410 25921 gene locus_tag LOCUS_02350 24410 25921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 25918 27093 gene locus_tag LOCUS_02360 25918 27093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 27297 27932 gene locus_tag LOCUS_02370 27297 27932 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_02370 30096 27982 gene locus_tag LOCUS_02380 30096 27982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 31706 30534 gene locus_tag LOCUS_02390 31706 30534 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922058.1 protein_id gnl|my_center|LOCUS_02390 31927 31703 gene locus_tag LOCUS_02400 31927 31703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 32160 31948 gene locus_tag LOCUS_02410 32160 31948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 32358 32194 gene locus_tag LOCUS_02420 32358 32194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 32615 32355 gene locus_tag LOCUS_02430 32615 32355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 34770 32896 gene locus_tag LOCUS_02440 34770 32896 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922881.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence0008 1712 870 gene locus_tag LOCUS_02450 1712 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 2551 1712 gene locus_tag LOCUS_02460 2551 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 2887 2555 gene locus_tag LOCUS_02470 2887 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 3081 2890 gene locus_tag LOCUS_02480 3081 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 3643 3104 gene locus_tag LOCUS_02490 3643 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 4075 3713 gene locus_tag LOCUS_02500 4075 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 4894 4085 gene locus_tag LOCUS_02510 4894 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 8210 4908 gene locus_tag LOCUS_02520 8210 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 8818 8207 gene locus_tag LOCUS_02530 8818 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 9434 8820 gene locus_tag LOCUS_02540 9434 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 12611 9435 gene locus_tag LOCUS_02550 12611 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 12915 12604 gene locus_tag LOCUS_02560 12915 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 13304 12972 gene locus_tag LOCUS_02570 13304 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 13992 13318 gene locus_tag LOCUS_02580 13992 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 13934 14092 gene locus_tag LOCUS_02590 13934 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 14501 14112 gene locus_tag LOCUS_02600 14501 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 14993 14505 gene locus_tag LOCUS_02610 14993 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 15310 14993 gene locus_tag LOCUS_02620 15310 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 15900 15310 gene locus_tag LOCUS_02630 15900 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 16437 15955 gene locus_tag LOCUS_02640 16437 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 17824 16502 gene locus_tag LOCUS_02650 17824 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 18621 18004 gene locus_tag LOCUS_02660 18621 18004 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385658.1 protein_id gnl|my_center|LOCUS_02660 21529 18644 gene locus_tag LOCUS_02670 21529 18644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 23295 21601 gene locus_tag LOCUS_02680 23295 21601 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_02680 23755 23285 gene locus_tag LOCUS_02690 23755 23285 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929175.1 protein_id gnl|my_center|LOCUS_02690 24128 23898 gene locus_tag LOCUS_02700 24128 23898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 24361 24125 gene locus_tag LOCUS_02710 24361 24125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 24621 24358 gene locus_tag LOCUS_02720 24621 24358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 24955 24728 gene locus_tag LOCUS_02730 24955 24728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 25259 24939 gene locus_tag LOCUS_02740 25259 24939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 25772 25272 gene locus_tag LOCUS_02750 25772 25272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 26046 25759 gene locus_tag LOCUS_02760 26046 25759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 26389 26036 gene locus_tag LOCUS_02770 26389 26036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 26975 26652 gene locus_tag LOCUS_02780 26975 26652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 27441 27046 gene locus_tag LOCUS_02790 27441 27046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 28401 27478 gene locus_tag LOCUS_02800 28401 27478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 28609 28391 gene locus_tag LOCUS_02810 28609 28391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 28975 28748 gene locus_tag LOCUS_02820 28975 28748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 29074 29400 gene locus_tag LOCUS_02830 29074 29400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 29384 29626 gene locus_tag LOCUS_02840 29384 29626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 29562 29756 gene locus_tag LOCUS_02850 29562 29756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 29753 29986 gene locus_tag LOCUS_02860 29753 29986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 30171 30659 gene locus_tag LOCUS_02870 30171 30659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 30656 30928 gene locus_tag LOCUS_02880 30656 30928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 30932 31237 gene locus_tag LOCUS_02890 30932 31237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 31215 31502 gene locus_tag LOCUS_02900 31215 31502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 31499 31876 gene locus_tag LOCUS_02910 31499 31876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence0009 1737 3824 gene locus_tag LOCUS_02920 1737 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3834 5111 gene locus_tag LOCUS_02930 3834 5111 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223912.1 protein_id gnl|my_center|LOCUS_02930 5212 6495 gene locus_tag LOCUS_02940 5212 6495 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_02940 6570 7616 gene locus_tag LOCUS_02950 6570 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 8421 7732 gene locus_tag LOCUS_02960 8421 7732 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337498.1 protein_id gnl|my_center|LOCUS_02960 8464 9138 gene locus_tag LOCUS_02970 8464 9138 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_02970 9135 10391 gene locus_tag LOCUS_02980 9135 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 11439 10459 gene locus_tag LOCUS_02990 11439 10459 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119138.1 protein_id gnl|my_center|LOCUS_02990 12851 11436 gene locus_tag LOCUS_03000 12851 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 14424 12940 gene locus_tag LOCUS_03010 14424 12940 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_03010 14345 14644 gene locus_tag LOCUS_03020 14345 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 14896 14735 gene locus_tag LOCUS_03030 14896 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 18233 15129 gene locus_tag LOCUS_03040 18233 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 18429 18504 gene locus_tag LOCUS_t00030 18429 18504 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24298 18572 gene locus_tag LOCUS_03050 24298 18572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 25576 24602 gene locus_tag LOCUS_03060 25576 24602 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_03060 25923 26738 gene locus_tag LOCUS_03070 25923 26738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 27010 27672 gene locus_tag LOCUS_03080 27010 27672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 27908 28771 gene locus_tag LOCUS_03090 27908 28771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_03090 28859 30775 gene locus_tag LOCUS_03100 28859 30775 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence0010 269 75 gene locus_tag LOCUS_03110 269 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 796 1017 gene locus_tag LOCUS_03120 796 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 1038 1538 gene locus_tag LOCUS_03130 1038 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2673 3176 gene locus_tag LOCUS_03140 2673 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3178 4776 gene locus_tag LOCUS_03150 3178 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4689 4925 gene locus_tag LOCUS_03160 4689 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4922 5605 gene locus_tag LOCUS_03170 4922 5605 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_03170 5608 6684 gene locus_tag LOCUS_03180 5608 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030867.1 protein_id gnl|my_center|LOCUS_03180 6692 7345 gene locus_tag LOCUS_03190 6692 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 8178 7507 gene locus_tag LOCUS_03200 8178 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 8298 8975 gene locus_tag LOCUS_03210 8298 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 8972 10216 gene locus_tag LOCUS_03220 8972 10216 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_03220 10224 13316 gene locus_tag LOCUS_03230 10224 13316 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_03230 13318 14769 gene locus_tag LOCUS_03240 13318 14769 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_03240 15121 14903 gene locus_tag LOCUS_03250 15121 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 16287 15286 gene locus_tag LOCUS_03260 16287 15286 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_03260 17528 16962 gene locus_tag LOCUS_03270 17528 16962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03270 18275 18832 gene locus_tag LOCUS_03280 18275 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 18883 20229 gene locus_tag LOCUS_03290 18883 20229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 20274 21491 gene locus_tag LOCUS_03300 20274 21491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 21724 21440 gene locus_tag LOCUS_03310 21724 21440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 22233 21721 gene locus_tag LOCUS_03320 22233 21721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 22747 22544 gene locus_tag LOCUS_03330 22747 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 22710 22919 gene locus_tag LOCUS_03340 22710 22919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 23379 23074 gene locus_tag LOCUS_03350 23379 23074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 23529 25502 gene locus_tag LOCUS_03360 23529 25502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 25492 25707 gene locus_tag LOCUS_03370 25492 25707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 25723 26016 gene locus_tag LOCUS_03380 25723 26016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 26221 26709 gene locus_tag LOCUS_03390 26221 26709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 27251 26763 gene locus_tag LOCUS_03400 27251 26763 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395796.1 protein_id gnl|my_center|LOCUS_03400 27568 27386 gene locus_tag LOCUS_03410 27568 27386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence0011 109 1464 gene locus_tag LOCUS_03420 109 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 1471 2529 gene locus_tag LOCUS_03430 1471 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2529 5348 gene locus_tag LOCUS_03440 2529 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 5358 6836 gene locus_tag LOCUS_03450 5358 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 6856 7194 gene locus_tag LOCUS_03460 6856 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 7194 10208 gene locus_tag LOCUS_03470 7194 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 10184 10324 gene locus_tag LOCUS_03480 10184 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 10325 10879 gene locus_tag LOCUS_03490 10325 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 11062 11310 gene locus_tag LOCUS_03500 11062 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 11307 11762 gene locus_tag LOCUS_03510 11307 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 11759 12031 gene locus_tag LOCUS_03520 11759 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 11968 12237 gene locus_tag LOCUS_03530 11968 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 12388 12606 gene locus_tag LOCUS_03540 12388 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 12630 12962 gene locus_tag LOCUS_03550 12630 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 12966 13190 gene locus_tag LOCUS_03560 12966 13190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 13223 13411 gene locus_tag LOCUS_03570 13223 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 13408 13587 gene locus_tag LOCUS_03580 13408 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 14565 13825 gene locus_tag LOCUS_03590 14565 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 15272 14697 gene locus_tag LOCUS_03600 15272 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 15607 15269 gene locus_tag LOCUS_03610 15607 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 15956 16543 gene locus_tag LOCUS_03620 15956 16543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 16702 17793 gene locus_tag LOCUS_03630 16702 17793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 17855 18313 gene locus_tag LOCUS_03640 17855 18313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 18467 19567 gene locus_tag LOCUS_03650 18467 19567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 19581 20516 gene locus_tag LOCUS_03660 19581 20516 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120258.1 protein_id gnl|my_center|LOCUS_03660 20575 21384 gene locus_tag LOCUS_03670 20575 21384 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_03670 21381 23129 gene locus_tag LOCUS_03680 21381 23129 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_03680 23423 25132 gene locus_tag LOCUS_03690 23423 25132 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_03690 25681 25184 gene locus_tag LOCUS_03700 25681 25184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 26988 25789 gene locus_tag LOCUS_03710 gene aroC 26988 25789 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_03710 27037 27654 gene locus_tag LOCUS_03720 27037 27654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence0012 76 264 gene locus_tag LOCUS_03730 76 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 297 644 gene locus_tag LOCUS_03740 297 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 755 1924 gene locus_tag LOCUS_03750 755 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 1998 2960 gene locus_tag LOCUS_03760 1998 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3119 3481 gene locus_tag LOCUS_03770 3119 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 3613 4317 gene locus_tag LOCUS_03780 3613 4317 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115027.1 protein_id gnl|my_center|LOCUS_03780 4380 6083 gene locus_tag LOCUS_03790 4380 6083 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_03790 6437 8200 gene locus_tag LOCUS_03800 6437 8200 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_03800 10561 8222 gene locus_tag LOCUS_03810 10561 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 10727 10954 gene locus_tag LOCUS_03820 10727 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 11045 13216 gene locus_tag LOCUS_03830 11045 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 13422 16172 gene locus_tag LOCUS_03840 gene acnA 13422 16172 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_03840 16259 16735 gene locus_tag LOCUS_03850 16259 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 17970 16756 gene locus_tag LOCUS_03860 17970 16756 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_03860 18867 18058 gene locus_tag LOCUS_03870 18867 18058 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948378.1 protein_id gnl|my_center|LOCUS_03870 19613 18906 gene locus_tag LOCUS_03880 19613 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 19862 19629 gene locus_tag LOCUS_03890 19862 19629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 20759 20103 gene locus_tag LOCUS_03900 20759 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 22171 20816 gene locus_tag LOCUS_03910 22171 20816 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_03910 22409 22903 gene locus_tag LOCUS_03920 gene bfr 22409 22903 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_03920 23225 22959 gene locus_tag LOCUS_03930 23225 22959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 24731 23301 gene locus_tag LOCUS_03940 24731 23301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532098.1 protein_id gnl|my_center|LOCUS_03940 24792 25148 gene locus_tag LOCUS_03950 24792 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 26086 25274 gene locus_tag LOCUS_03960 gene dapB 26086 25274 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_03960 26469 26083 gene locus_tag LOCUS_03970 26469 26083 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_03970 26708 26466 gene locus_tag LOCUS_03980 26708 26466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 >Feature sequence0013 2033 567 gene locus_tag LOCUS_03990 2033 567 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922622.1 protein_id gnl|my_center|LOCUS_03990 2165 3190 gene locus_tag LOCUS_04000 2165 3190 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063835.1 protein_id gnl|my_center|LOCUS_04000 3229 3302 gene locus_tag LOCUS_t00040 3229 3302 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3382 4398 gene locus_tag LOCUS_04010 3382 4398 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_04010 4577 6571 gene locus_tag LOCUS_04020 4577 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 6747 8411 gene locus_tag LOCUS_04030 6747 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 8619 8936 gene locus_tag LOCUS_04040 8619 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 10053 8959 gene locus_tag LOCUS_04050 10053 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 11420 10089 gene locus_tag LOCUS_04060 11420 10089 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727133.1 protein_id gnl|my_center|LOCUS_04060 12657 11542 gene locus_tag LOCUS_04070 12657 11542 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_04070 13541 12654 gene locus_tag LOCUS_04080 13541 12654 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_04080 14688 13570 gene locus_tag LOCUS_04090 14688 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 15809 14859 gene locus_tag LOCUS_04100 15809 14859 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969626.1 protein_id gnl|my_center|LOCUS_04100 16045 20103 gene locus_tag LOCUS_04110 16045 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 20280 21533 gene locus_tag LOCUS_04120 20280 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 21920 21654 gene locus_tag LOCUS_04130 21920 21654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 23448 22000 gene locus_tag LOCUS_04140 23448 22000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_04140 23702 24508 gene locus_tag LOCUS_04150 gene proC 23702 24508 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_04150 24517 26064 gene locus_tag LOCUS_04160 gene guaA 24517 26064 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_04160 26071 26322 gene locus_tag LOCUS_04170 26071 26322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence0014 680 1015 gene locus_tag LOCUS_04180 680 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 1247 3010 gene locus_tag LOCUS_04190 1247 3010 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_04190 3211 4590 gene locus_tag LOCUS_04200 3211 4590 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_04200 5844 4666 gene locus_tag LOCUS_04210 gene moeB 5844 4666 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_04210 6795 5863 gene locus_tag LOCUS_04220 6795 5863 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616128.1 protein_id gnl|my_center|LOCUS_04220 6853 7698 gene locus_tag LOCUS_04230 6853 7698 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246196.1 protein_id gnl|my_center|LOCUS_04230 7760 8242 gene locus_tag LOCUS_04240 7760 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 8312 9736 gene locus_tag LOCUS_04250 gene lpdA 8312 9736 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_04250 9939 12278 gene locus_tag LOCUS_04260 9939 12278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 12430 13845 gene locus_tag LOCUS_04270 12430 13845 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_04270 14050 15318 gene locus_tag LOCUS_04280 14050 15318 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_04280 15384 18932 gene locus_tag LOCUS_04290 15384 18932 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380455.1 protein_id gnl|my_center|LOCUS_04290 18987 22427 gene locus_tag LOCUS_04300 18987 22427 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393635.1 protein_id gnl|my_center|LOCUS_04300 23924 22395 gene locus_tag LOCUS_04310 23924 22395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 24735 23950 gene locus_tag LOCUS_04320 24735 23950 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_04320 24941 25960 gene locus_tag LOCUS_04330 24941 25960 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence0015 1326 73 gene locus_tag LOCUS_04340 1326 73 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_04340 2322 1498 gene locus_tag LOCUS_04350 2322 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 2653 2961 gene locus_tag LOCUS_04360 2653 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 3118 3993 gene locus_tag LOCUS_04370 3118 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 4068 5021 gene locus_tag LOCUS_04380 4068 5021 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921669.1 protein_id gnl|my_center|LOCUS_04380 6226 5018 gene locus_tag LOCUS_04390 6226 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 7471 6317 gene locus_tag LOCUS_04400 7471 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 7905 7681 gene locus_tag LOCUS_04410 7905 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9732 7927 gene locus_tag LOCUS_04420 9732 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 11051 9729 gene locus_tag LOCUS_04430 11051 9729 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_04430 12726 11110 gene locus_tag LOCUS_04440 12726 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 13080 12793 gene locus_tag LOCUS_04450 13080 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 13293 15953 gene locus_tag LOCUS_04460 13293 15953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 16628 16026 gene locus_tag LOCUS_04470 16628 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 17032 17295 gene locus_tag LOCUS_04480 17032 17295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 17350 18276 gene locus_tag LOCUS_04490 17350 18276 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_04490 18344 18637 gene locus_tag LOCUS_04500 18344 18637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 18794 20257 gene locus_tag LOCUS_04510 gene gabD 18794 20257 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358132.1 protein_id gnl|my_center|LOCUS_04510 21066 20353 gene locus_tag LOCUS_04520 21066 20353 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_04520 22572 21163 gene locus_tag LOCUS_04530 22572 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 24280 22676 gene locus_tag LOCUS_04540 gene rny 24280 22676 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325643.1 protein_id gnl|my_center|LOCUS_04540 24801 25898 gene locus_tag LOCUS_04550 24801 25898 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061140.1 protein_id gnl|my_center|LOCUS_04550 25910 26101 gene locus_tag LOCUS_04560 25910 26101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence0016 858 559 gene locus_tag LOCUS_04570 gene hlpB 858 559 CDS product HNH nuclease-like protein HlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245113.1 protein_id gnl|my_center|LOCUS_04570 1043 795 gene locus_tag LOCUS_04580 1043 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 1107 2156 gene locus_tag LOCUS_04590 1107 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2234 3163 gene locus_tag LOCUS_04600 2234 3163 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_04600 4920 3307 gene locus_tag LOCUS_04610 4920 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6634 5315 gene locus_tag LOCUS_04620 6634 5315 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142001.1 protein_id gnl|my_center|LOCUS_04620 7100 6717 gene locus_tag LOCUS_04630 7100 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 10002 7198 gene locus_tag LOCUS_04640 10002 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12048 10210 gene locus_tag LOCUS_04650 12048 10210 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_04650 13031 12072 gene locus_tag LOCUS_04660 13031 12072 CDS product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975020.1 protein_id gnl|my_center|LOCUS_04660 13185 13706 gene locus_tag LOCUS_04670 13185 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 13722 16589 gene locus_tag LOCUS_04680 13722 16589 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728610.1 protein_id gnl|my_center|LOCUS_04680 16775 16482 gene locus_tag LOCUS_04690 16775 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 18211 16838 gene locus_tag LOCUS_04700 18211 16838 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123471.1 protein_id gnl|my_center|LOCUS_04700 18768 18208 gene locus_tag LOCUS_04710 18768 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 18838 20361 gene locus_tag LOCUS_04720 18838 20361 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_04720 21416 20820 gene locus_tag LOCUS_04730 21416 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227635.1 protein_id gnl|my_center|LOCUS_04730 21725 21528 gene locus_tag LOCUS_04740 21725 21528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 22851 21760 gene locus_tag LOCUS_04750 22851 21760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 24154 22883 gene locus_tag LOCUS_04760 24154 22883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence0017 776 8926 gene locus_tag LOCUS_04770 776 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 9018 11186 gene locus_tag LOCUS_04780 9018 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 12394 12245 gene locus_tag LOCUS_04790 12394 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 12530 17413 gene locus_tag LOCUS_04800 12530 17413 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814813.1 protein_id gnl|my_center|LOCUS_04800 17791 18378 gene locus_tag LOCUS_04810 17791 18378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 18534 18752 gene locus_tag LOCUS_04820 18534 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 18803 20197 gene locus_tag LOCUS_04830 18803 20197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 20227 20565 gene locus_tag LOCUS_04840 20227 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 20562 20870 gene locus_tag LOCUS_04850 20562 20870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 20867 21166 gene locus_tag LOCUS_04860 20867 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 21180 21575 gene locus_tag LOCUS_04870 21180 21575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 21613 21969 gene locus_tag LOCUS_04880 21613 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 21921 22172 gene locus_tag LOCUS_04890 21921 22172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 22169 22630 gene locus_tag LOCUS_04900 22169 22630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 22777 23052 gene locus_tag LOCUS_04910 22777 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 23321 24331 gene locus_tag LOCUS_04920 23321 24331 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010044806.1 protein_id gnl|my_center|LOCUS_04920 24705 24547 gene locus_tag LOCUS_04930 24705 24547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 24841 25119 gene locus_tag LOCUS_04940 24841 25119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 25589 25077 gene locus_tag LOCUS_04950 25589 25077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence0018 1158 3497 gene locus_tag LOCUS_04960 1158 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3646 5952 gene locus_tag LOCUS_04970 3646 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 6749 5964 gene locus_tag LOCUS_04980 6749 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 7020 6763 gene locus_tag LOCUS_04990 7020 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 7265 7020 gene locus_tag LOCUS_05000 7265 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 8605 7295 gene locus_tag LOCUS_05010 8605 7295 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_05010 9526 8636 gene locus_tag LOCUS_05020 9526 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 9659 10729 gene locus_tag LOCUS_05030 9659 10729 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228739.1 protein_id gnl|my_center|LOCUS_05030 11327 10875 gene locus_tag LOCUS_05040 gene tnpA 11327 10875 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_05040 12348 11989 gene locus_tag LOCUS_05050 12348 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 13334 12345 gene locus_tag LOCUS_05060 13334 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 13589 15868 gene locus_tag LOCUS_05070 13589 15868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 17560 15962 gene locus_tag LOCUS_05080 17560 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 18709 17594 gene locus_tag LOCUS_05090 gene carA 18709 17594 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_05090 18944 20023 gene locus_tag LOCUS_05100 18944 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 22640 20208 gene locus_tag LOCUS_05110 22640 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 <23889 22823 gene locus_tag LOCUS_05120 <23889 22823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141450.1:FG-GAP-like repeat-containing protein >Feature sequence0019 1051 263 gene locus_tag LOCUS_05130 1051 263 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_05130 1783 3672 gene locus_tag LOCUS_05140 1783 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 3669 4061 gene locus_tag LOCUS_05150 3669 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4243 21960 gene locus_tag LOCUS_05160 4243 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6373 6294 gene locus_tag LOCUS_t00050 6373 6294 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22260 22673 gene locus_tag LOCUS_05170 22260 22673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 23102 23752 gene locus_tag LOCUS_05180 23102 23752 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616165.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence0020 3982 1466 gene locus_tag LOCUS_05190 3982 1466 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_05190 4595 4161 gene locus_tag LOCUS_05200 4595 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4832 6571 gene locus_tag LOCUS_05210 4832 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6681 8090 gene locus_tag LOCUS_05220 6681 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8217 9461 gene locus_tag LOCUS_05230 8217 9461 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550279.1 protein_id gnl|my_center|LOCUS_05230 10315 9473 gene locus_tag LOCUS_05240 10315 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 10859 10503 gene locus_tag LOCUS_05250 10859 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 11264 10974 gene locus_tag LOCUS_05260 11264 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 11441 13780 gene locus_tag LOCUS_05270 11441 13780 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_05270 14671 13895 gene locus_tag LOCUS_05280 14671 13895 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096187.1 protein_id gnl|my_center|LOCUS_05280 14744 15292 gene locus_tag LOCUS_05290 14744 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 15450 16292 gene locus_tag LOCUS_05300 15450 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 16289 16669 gene locus_tag LOCUS_05310 16289 16669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 16728 16862 gene locus_tag LOCUS_05320 16728 16862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 16966 17580 gene locus_tag LOCUS_05330 16966 17580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 17898 17683 gene locus_tag LOCUS_05340 17898 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 19249 18224 gene locus_tag LOCUS_05350 19249 18224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 19407 20123 gene locus_tag LOCUS_05360 19407 20123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 21206 20193 gene locus_tag LOCUS_05370 21206 20193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 22234 21404 gene locus_tag LOCUS_05380 22234 21404 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412965.1 protein_id gnl|my_center|LOCUS_05380 22626 22342 gene locus_tag LOCUS_05390 22626 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 22935 22630 gene locus_tag LOCUS_05400 22935 22630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 23636 22947 gene locus_tag LOCUS_05410 23636 22947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence0021 360 1295 gene locus_tag LOCUS_05420 360 1295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657419.1 protein_id gnl|my_center|LOCUS_05420 1298 2956 gene locus_tag LOCUS_05430 1298 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3532 4785 gene locus_tag LOCUS_05440 3532 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 5010 4798 gene locus_tag LOCUS_05450 5010 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5213 5007 gene locus_tag LOCUS_05460 5213 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5509 5282 gene locus_tag LOCUS_05470 5509 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 7591 5735 gene locus_tag LOCUS_05480 gene thrS 7591 5735 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608336.1 protein_id gnl|my_center|LOCUS_05480 8678 7710 gene locus_tag LOCUS_05490 gene pdxA 8678 7710 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121619.1 protein_id gnl|my_center|LOCUS_05490 9703 8702 gene locus_tag LOCUS_05500 9703 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 10116 9700 gene locus_tag LOCUS_05510 10116 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 10398 10135 gene locus_tag LOCUS_05520 10398 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 11732 10443 gene locus_tag LOCUS_05530 11732 10443 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_05530 13267 11744 gene locus_tag LOCUS_05540 13267 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 13203 13292 gene locus_tag LOCUS_t00060 13203 13292 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0022 192 1157 gene locus_tag LOCUS_05550 192 1157 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615923.1 protein_id gnl|my_center|LOCUS_05550 1308 1811 gene locus_tag LOCUS_05560 1308 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1947 3764 gene locus_tag LOCUS_05570 1947 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3806 4201 gene locus_tag LOCUS_05580 3806 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5665 4250 gene locus_tag LOCUS_05590 5665 4250 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_05590 8525 5814 gene locus_tag LOCUS_05600 8525 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9293 8604 gene locus_tag LOCUS_05610 9293 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 9577 10641 gene locus_tag LOCUS_05620 gene rlmN 9577 10641 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_05620 10638 10895 gene locus_tag LOCUS_05630 10638 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 10914 11552 gene locus_tag LOCUS_05640 10914 11552 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_05640 11549 12154 gene locus_tag LOCUS_05650 11549 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 12147 13793 gene locus_tag LOCUS_05660 12147 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 13942 14502 gene locus_tag LOCUS_05670 13942 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 14566 14871 gene locus_tag LOCUS_05680 14566 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 15726 14881 gene locus_tag LOCUS_05690 15726 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 18904 16109 gene locus_tag LOCUS_05700 18904 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 22173 18901 gene locus_tag LOCUS_05710 22173 18901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 22878 22273 gene locus_tag LOCUS_05720 22878 22273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence0023 1747 3216 gene locus_tag LOCUS_05730 1747 3216 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_05730 4028 3300 gene locus_tag LOCUS_05740 4028 3300 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_05740 4877 4113 gene locus_tag LOCUS_05750 4877 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 6135 5011 gene locus_tag LOCUS_05760 gene mqnC 6135 5011 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_05760 6913 6095 gene locus_tag LOCUS_05770 6913 6095 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_05770 7449 7012 gene locus_tag LOCUS_05780 7449 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 7760 7446 gene locus_tag LOCUS_05790 7760 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 8325 7909 gene locus_tag LOCUS_05800 8325 7909 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142681.1 protein_id gnl|my_center|LOCUS_05800 8558 8322 gene locus_tag LOCUS_05810 8558 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 9195 8635 gene locus_tag LOCUS_05820 9195 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 12626 9417 gene locus_tag LOCUS_05830 12626 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 13251 12802 gene locus_tag LOCUS_05840 13251 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 13648 13370 gene locus_tag LOCUS_05850 13648 13370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 14119 13880 gene locus_tag LOCUS_05860 14119 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 14678 14256 gene locus_tag LOCUS_05870 14678 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 14842 15138 gene locus_tag LOCUS_05880 14842 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 15143 15427 gene locus_tag LOCUS_05890 15143 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 17883 15913 gene locus_tag LOCUS_05900 17883 15913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118733.1 protein_id gnl|my_center|LOCUS_05900 18131 18985 gene locus_tag LOCUS_05910 18131 18985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329547.1 protein_id gnl|my_center|LOCUS_05910 19822 19082 gene locus_tag LOCUS_05920 19822 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 21438 19897 gene locus_tag LOCUS_05930 gene selA 21438 19897 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_05930 21665 21435 gene locus_tag LOCUS_05940 21665 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 21996 21763 gene locus_tag LOCUS_05950 21996 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 22137 23015 gene locus_tag LOCUS_05960 22137 23015 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249854.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence0024 2971 2768 gene locus_tag LOCUS_05970 2971 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2868 16496 gene locus_tag LOCUS_05980 2868 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 16695 17318 gene locus_tag LOCUS_05990 16695 17318 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838556.1 protein_id gnl|my_center|LOCUS_05990 17488 19074 gene locus_tag LOCUS_06000 17488 19074 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_06000 19114 19941 gene locus_tag LOCUS_06010 19114 19941 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876731.1 protein_id gnl|my_center|LOCUS_06010 20479 19952 gene locus_tag LOCUS_06020 20479 19952 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186620.1 protein_id gnl|my_center|LOCUS_06020 21120 20476 gene locus_tag LOCUS_06030 21120 20476 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538671.1 protein_id gnl|my_center|LOCUS_06030 21248 21481 gene locus_tag LOCUS_06040 21248 21481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 21518 22159 gene locus_tag LOCUS_06050 21518 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 22152 22658 gene locus_tag LOCUS_06060 22152 22658 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence0025 2509 719 gene locus_tag LOCUS_06070 2509 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2766 5102 gene locus_tag LOCUS_06080 2766 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 5205 5678 gene locus_tag LOCUS_06090 5205 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5698 8379 gene locus_tag LOCUS_06100 5698 8379 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_06100 8813 9475 gene locus_tag LOCUS_06110 8813 9475 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_06110 10317 9481 gene locus_tag LOCUS_06120 10317 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 10616 11569 gene locus_tag LOCUS_06130 10616 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 12802 11756 gene locus_tag LOCUS_06140 12802 11756 CDS product transaldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119230.1 protein_id gnl|my_center|LOCUS_06140 14001 12799 gene locus_tag LOCUS_06150 14001 12799 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975337.1 protein_id gnl|my_center|LOCUS_06150 13932 13838 gene locus_tag LOCUS_t00070 13932 13838 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15208 14096 gene locus_tag LOCUS_06160 gene dusB 15208 14096 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 protein_id gnl|my_center|LOCUS_06160 15265 15951 gene locus_tag LOCUS_06170 15265 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 15981 16712 gene locus_tag LOCUS_06180 15981 16712 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929236.1 protein_id gnl|my_center|LOCUS_06180 16709 17098 gene locus_tag LOCUS_06190 16709 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06190 16990 17640 gene locus_tag LOCUS_06200 16990 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06200 17912 17637 gene locus_tag LOCUS_06210 17912 17637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 18298 17909 gene locus_tag LOCUS_06220 18298 17909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 18597 18235 gene locus_tag LOCUS_06230 18597 18235 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532029.1 protein_id gnl|my_center|LOCUS_06230 19918 18683 gene locus_tag LOCUS_06240 19918 18683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 20024 20617 gene locus_tag LOCUS_06250 20024 20617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 20719 21012 gene locus_tag LOCUS_06260 20719 21012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 22008 21424 gene locus_tag LOCUS_06270 22008 21424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence0026 1578 244 gene locus_tag LOCUS_06280 1578 244 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_06280 2162 2842 gene locus_tag LOCUS_06290 2162 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2839 3264 gene locus_tag LOCUS_06300 2839 3264 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_06300 3578 4006 gene locus_tag LOCUS_06310 gene merR 3578 4006 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_06310 4234 5349 gene locus_tag LOCUS_06320 4234 5349 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918814.1 protein_id gnl|my_center|LOCUS_06320 5364 6653 gene locus_tag LOCUS_06330 5364 6653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_06330 6666 7388 gene locus_tag LOCUS_06340 6666 7388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_06340 7474 7908 gene locus_tag LOCUS_06350 7474 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7918 8934 gene locus_tag LOCUS_06360 7918 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 8994 11561 gene locus_tag LOCUS_06370 8994 11561 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_06370 11577 11825 gene locus_tag LOCUS_06380 11577 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 12115 12414 gene locus_tag LOCUS_06390 12115 12414 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030797.1 protein_id gnl|my_center|LOCUS_06390 12411 13874 gene locus_tag LOCUS_06400 gene hcnB 12411 13874 CDS product cyanide-forming glycine dehydrogenase subunit HcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113685.1 protein_id gnl|my_center|LOCUS_06400 13871 15088 gene locus_tag LOCUS_06410 gene hcnC 13871 15088 CDS product cyanide-forming glycine dehydrogenase subunit HcnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113686.1 protein_id gnl|my_center|LOCUS_06410 15645 15148 gene locus_tag LOCUS_06420 15645 15148 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395796.1 protein_id gnl|my_center|LOCUS_06420 16673 15756 gene locus_tag LOCUS_06430 16673 15756 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_06430 20118 16924 gene locus_tag LOCUS_06440 20118 16924 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729190.1 protein_id gnl|my_center|LOCUS_06440 20979 20122 gene locus_tag LOCUS_06450 20979 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence0027 621 121 gene locus_tag LOCUS_06460 621 121 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_06460 1405 764 gene locus_tag LOCUS_06470 1405 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2882 1521 gene locus_tag LOCUS_06480 2882 1521 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_06480 3633 3043 gene locus_tag LOCUS_06490 3633 3043 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_06490 5068 3641 gene locus_tag LOCUS_06500 5068 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6071 5079 gene locus_tag LOCUS_06510 6071 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 7156 6563 gene locus_tag LOCUS_06520 gene hisB 7156 6563 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_06520 8538 7153 gene locus_tag LOCUS_06530 8538 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_06530 9567 8542 gene locus_tag LOCUS_06540 gene hisC 9567 8542 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_06540 11065 9635 gene locus_tag LOCUS_06550 gene hisD 11065 9635 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118440.1 protein_id gnl|my_center|LOCUS_06550 13216 11312 gene locus_tag LOCUS_06560 13216 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 13422 14321 gene locus_tag LOCUS_06570 13422 14321 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228547.1 protein_id gnl|my_center|LOCUS_06570 16112 14448 gene locus_tag LOCUS_06580 16112 14448 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_06580 16777 16250 gene locus_tag LOCUS_06590 16777 16250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 17824 16907 gene locus_tag LOCUS_06600 17824 16907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06600 19321 17876 gene locus_tag LOCUS_06610 19321 17876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06610 19494 19318 gene locus_tag LOCUS_06620 19494 19318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 19711 20721 gene locus_tag LOCUS_06630 19711 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 20931 20794 gene locus_tag LOCUS_06640 20931 20794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence0028 382 1251 gene locus_tag LOCUS_06650 382 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1347 2039 gene locus_tag LOCUS_06660 1347 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2186 2785 gene locus_tag LOCUS_06670 2186 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2939 4594 gene locus_tag LOCUS_06680 2939 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4692 5009 gene locus_tag LOCUS_06690 4692 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5114 5494 gene locus_tag LOCUS_06700 5114 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5552 5905 gene locus_tag LOCUS_06710 5552 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 7702 6284 gene locus_tag LOCUS_06720 7702 6284 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_06720 7959 8411 gene locus_tag LOCUS_06730 7959 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 8656 9246 gene locus_tag LOCUS_06740 8656 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 9340 10215 gene locus_tag LOCUS_06750 9340 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10284 10418 gene locus_tag LOCUS_06760 10284 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 10476 10634 gene locus_tag LOCUS_06770 10476 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10702 11115 gene locus_tag LOCUS_06780 10702 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 11217 11573 gene locus_tag LOCUS_06790 11217 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 11908 12393 gene locus_tag LOCUS_06800 11908 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 12532 14724 gene locus_tag LOCUS_06810 12532 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 14739 18200 gene locus_tag LOCUS_06820 14739 18200 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_06820 18938 18696 gene locus_tag LOCUS_06830 18938 18696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 19465 18935 gene locus_tag LOCUS_06840 19465 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 19818 20504 gene locus_tag LOCUS_06850 19818 20504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 20441 20638 gene locus_tag LOCUS_06860 20441 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence0029 <1 1216 gene locus_tag LOCUS_06870 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123104.1:PQQ-like beta-propeller repeat protein 1811 1239 gene locus_tag LOCUS_06880 1811 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1932 2951 gene locus_tag LOCUS_06890 1932 2951 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_06890 3047 3691 gene locus_tag LOCUS_06900 3047 3691 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_06900 4283 3819 gene locus_tag LOCUS_06910 4283 3819 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083170.1 protein_id gnl|my_center|LOCUS_06910 4639 5244 gene locus_tag LOCUS_06920 4639 5244 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_06920 5241 7634 gene locus_tag LOCUS_06930 5241 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7731 8075 gene locus_tag LOCUS_06940 7731 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 8088 8354 gene locus_tag LOCUS_06950 8088 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 8773 9921 gene locus_tag LOCUS_06960 8773 9921 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 9984 10475 gene locus_tag LOCUS_06970 9984 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 10970 11974 gene locus_tag LOCUS_06980 10970 11974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_06980 12111 12896 gene locus_tag LOCUS_06990 12111 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 13567 12908 gene locus_tag LOCUS_07000 13567 12908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 15510 13570 gene locus_tag LOCUS_07010 15510 13570 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_07010 16671 16210 gene locus_tag LOCUS_07020 16671 16210 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392516.1 protein_id gnl|my_center|LOCUS_07020 16858 17709 gene locus_tag LOCUS_07030 16858 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 19586 17874 gene locus_tag LOCUS_07040 19586 17874 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_07040 20101 19631 gene locus_tag LOCUS_07050 20101 19631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence0030 1223 4255 gene locus_tag LOCUS_07060 1223 4255 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 protein_id gnl|my_center|LOCUS_07060 5273 4290 gene locus_tag LOCUS_07070 5273 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 6471 5860 gene locus_tag LOCUS_07080 6471 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 6780 7010 gene locus_tag LOCUS_07090 6780 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07090 7889 7017 gene locus_tag LOCUS_07100 7889 7017 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_07100 8128 8628 gene locus_tag LOCUS_07110 8128 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07110 8633 9178 gene locus_tag LOCUS_07120 8633 9178 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_07120 9676 9221 gene locus_tag LOCUS_07130 9676 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 10101 9673 gene locus_tag LOCUS_07140 10101 9673 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_07140 10216 10743 gene locus_tag LOCUS_07150 10216 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 10757 10954 gene locus_tag LOCUS_07160 10757 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 10990 11637 gene locus_tag LOCUS_07170 10990 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 11634 12704 gene locus_tag LOCUS_07180 11634 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 13138 12743 gene locus_tag LOCUS_07190 13138 12743 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_07190 13624 13169 gene locus_tag LOCUS_07200 13624 13169 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_07200 14335 13628 gene locus_tag LOCUS_07210 14335 13628 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_07210 14730 14332 gene locus_tag LOCUS_07220 14730 14332 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678450.1 protein_id gnl|my_center|LOCUS_07220 15481 14879 gene locus_tag LOCUS_07230 15481 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 16206 15499 gene locus_tag LOCUS_07240 16206 15499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 16717 16238 gene locus_tag LOCUS_07250 16717 16238 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533666.1 protein_id gnl|my_center|LOCUS_07250 17109 16714 gene locus_tag LOCUS_07260 17109 16714 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972193.1 protein_id gnl|my_center|LOCUS_07260 17986 17138 gene locus_tag LOCUS_07270 17986 17138 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467799.1 protein_id gnl|my_center|LOCUS_07270 18335 18006 gene locus_tag LOCUS_07280 18335 18006 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_07280 19985 18357 gene locus_tag LOCUS_07290 19985 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209759.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence0031 5666 447 gene locus_tag LOCUS_07300 5666 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 5722 6039 gene locus_tag LOCUS_07310 5722 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 7190 6012 gene locus_tag LOCUS_07320 gene nagA 7190 6012 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922541.1 protein_id gnl|my_center|LOCUS_07320 7294 8139 gene locus_tag LOCUS_07330 7294 8139 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121199.1 protein_id gnl|my_center|LOCUS_07330 8774 8145 gene locus_tag LOCUS_07340 8774 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 9577 8816 gene locus_tag LOCUS_07350 9577 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 10538 9630 gene locus_tag LOCUS_07360 10538 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 10658 12121 gene locus_tag LOCUS_07370 gene lysS 10658 12121 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_07370 12160 12567 gene locus_tag LOCUS_07380 12160 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 12580 13140 gene locus_tag LOCUS_07390 12580 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 14061 13150 gene locus_tag LOCUS_07400 14061 13150 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257902.1 protein_id gnl|my_center|LOCUS_07400 14137 15714 gene locus_tag LOCUS_07410 14137 15714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 15806 16066 gene locus_tag LOCUS_07420 15806 16066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 16130 17665 gene locus_tag LOCUS_07430 gene gatB 16130 17665 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122965.1 protein_id gnl|my_center|LOCUS_07430 17665 18282 gene locus_tag LOCUS_07440 17665 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 18296 19192 gene locus_tag LOCUS_07450 18296 19192 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_07450 19215 19739 gene locus_tag LOCUS_07460 19215 19739 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338731.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence0032 1123 281 gene locus_tag LOCUS_07470 1123 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1561 2274 gene locus_tag LOCUS_07480 1561 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2589 3296 gene locus_tag LOCUS_07490 2589 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3835 4542 gene locus_tag LOCUS_07500 3835 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4662 5975 gene locus_tag LOCUS_07510 4662 5975 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_07510 6798 6022 gene locus_tag LOCUS_07520 6798 6022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_07520 7500 6841 gene locus_tag LOCUS_07530 7500 6841 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530054.1 protein_id gnl|my_center|LOCUS_07530 7897 7514 gene locus_tag LOCUS_07540 7897 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9442 8390 gene locus_tag LOCUS_07550 gene ilvC 9442 8390 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_07550 9529 10023 gene locus_tag LOCUS_07560 9529 10023 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705436.1 protein_id gnl|my_center|LOCUS_07560 10561 10298 gene locus_tag LOCUS_07570 10561 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 10685 10858 gene locus_tag LOCUS_07580 10685 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 10892 11095 gene locus_tag LOCUS_07590 10892 11095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 11204 12739 gene locus_tag LOCUS_07600 11204 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 12772 14055 gene locus_tag LOCUS_07610 12772 14055 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665238.1 protein_id gnl|my_center|LOCUS_07610 14114 15490 gene locus_tag LOCUS_07620 14114 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 16179 15565 gene locus_tag LOCUS_07630 16179 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 16421 17746 gene locus_tag LOCUS_07640 16421 17746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 18763 17759 gene locus_tag LOCUS_07650 18763 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 19380 18772 gene locus_tag LOCUS_07660 19380 18772 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141208.1 protein_id gnl|my_center|LOCUS_07660 <20116 19406 gene locus_tag LOCUS_07670 <20116 19406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047812952.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence0033 63 1088 gene locus_tag LOCUS_07680 63 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1468 1109 gene locus_tag LOCUS_07690 1468 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1999 1475 gene locus_tag LOCUS_07700 1999 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3154 2030 gene locus_tag LOCUS_07710 3154 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4574 3288 gene locus_tag LOCUS_07720 4574 3288 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_07720 6711 4669 gene locus_tag LOCUS_07730 6711 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 7022 6783 gene locus_tag LOCUS_07740 7022 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7185 6997 gene locus_tag LOCUS_07750 7185 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7324 8724 gene locus_tag LOCUS_07760 7324 8724 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_07760 9237 8755 gene locus_tag LOCUS_07770 9237 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9942 9322 gene locus_tag LOCUS_07780 9942 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 10149 11696 gene locus_tag LOCUS_07790 10149 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 12324 12830 gene locus_tag LOCUS_07800 12324 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 12916 13974 gene locus_tag LOCUS_07810 12916 13974 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_07810 13978 14994 gene locus_tag LOCUS_07820 13978 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 15171 15419 gene locus_tag LOCUS_07830 15171 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 15407 15667 gene locus_tag LOCUS_07840 15407 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 15698 15940 gene locus_tag LOCUS_07850 15698 15940 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_07850 15942 16286 gene locus_tag LOCUS_07860 15942 16286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 16366 16626 gene locus_tag LOCUS_07870 16366 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 16626 17390 gene locus_tag LOCUS_07880 16626 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 18053 17400 gene locus_tag LOCUS_07890 18053 17400 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 protein_id gnl|my_center|LOCUS_07890 18158 19630 gene locus_tag LOCUS_07900 18158 19630 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039027.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence0034 953 123 gene locus_tag LOCUS_07910 953 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1259 1002 gene locus_tag LOCUS_07920 1259 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1863 1297 gene locus_tag LOCUS_07930 1863 1297 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582845.1 protein_id gnl|my_center|LOCUS_07930 2663 1860 gene locus_tag LOCUS_07940 2663 1860 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_07940 2207 2128 gene locus_tag LOCUS_t00080 2207 2128 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2995 2660 gene locus_tag LOCUS_07950 2995 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07950 4496 3075 gene locus_tag LOCUS_07960 4496 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07960 4607 6706 gene locus_tag LOCUS_07970 4607 6706 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_07970 6722 7117 gene locus_tag LOCUS_07980 6722 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7114 7326 gene locus_tag LOCUS_07990 7114 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7376 8803 gene locus_tag LOCUS_08000 7376 8803 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_08000 8818 9195 gene locus_tag LOCUS_08010 8818 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 9208 9744 gene locus_tag LOCUS_08020 9208 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 11048 9753 gene locus_tag LOCUS_08030 11048 9753 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_08030 12288 11098 gene locus_tag LOCUS_08040 12288 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 12556 14955 gene locus_tag LOCUS_08050 12556 14955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 15064 16419 gene locus_tag LOCUS_08060 15064 16419 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_08060 17297 16539 gene locus_tag LOCUS_08070 17297 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 17618 17343 gene locus_tag LOCUS_08080 17618 17343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 19154 17697 gene locus_tag LOCUS_08090 19154 17697 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_08090 19804 19151 gene locus_tag LOCUS_08100 19804 19151 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence0035 809 372 gene locus_tag LOCUS_08110 809 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2158 1166 gene locus_tag LOCUS_08120 2158 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2404 2958 gene locus_tag LOCUS_08130 2404 2958 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259161.1 protein_id gnl|my_center|LOCUS_08130 3158 4972 gene locus_tag LOCUS_08140 3158 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7529 5055 gene locus_tag LOCUS_08150 7529 5055 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615881.1 protein_id gnl|my_center|LOCUS_08150 9140 7539 gene locus_tag LOCUS_08160 9140 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10789 9137 gene locus_tag LOCUS_08170 10789 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 12339 10930 gene locus_tag LOCUS_08180 12339 10930 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_08180 13625 12474 gene locus_tag LOCUS_08190 13625 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 13859 14908 gene locus_tag LOCUS_08200 13859 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 15035 15988 gene locus_tag LOCUS_08210 gene rfbD 15035 15988 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_08210 16174 17001 gene locus_tag LOCUS_08220 16174 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 17161 17403 gene locus_tag LOCUS_08230 17161 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 17403 17630 gene locus_tag LOCUS_08240 17403 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 17773 19983 gene locus_tag LOCUS_08250 gene feoB 17773 19983 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943880.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence0036 552 926 gene locus_tag LOCUS_08260 552 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1943 972 gene locus_tag LOCUS_08270 gene hemH 1943 972 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529728.1 protein_id gnl|my_center|LOCUS_08270 2388 2083 gene locus_tag LOCUS_08280 2388 2083 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_08280 4033 2627 gene locus_tag LOCUS_08290 4033 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4608 4111 gene locus_tag LOCUS_08300 4608 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4987 4655 gene locus_tag LOCUS_08310 4987 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6233 5079 gene locus_tag LOCUS_08320 6233 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 6531 7286 gene locus_tag LOCUS_08330 6531 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8131 7397 gene locus_tag LOCUS_08340 8131 7397 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_08340 8393 9358 gene locus_tag LOCUS_08350 gene prfB 8393 9358 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205591.1 protein_id gnl|my_center|LOCUS_08350 9461 9997 gene locus_tag LOCUS_08360 gene tsaE 9461 9997 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_08360 10989 10018 gene locus_tag LOCUS_08370 10989 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 11162 12112 gene locus_tag LOCUS_08380 11162 12112 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_08380 12209 12715 gene locus_tag LOCUS_08390 12209 12715 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_08390 12708 13526 gene locus_tag LOCUS_08400 12708 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 13772 14482 gene locus_tag LOCUS_08410 13772 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 16909 14552 gene locus_tag LOCUS_08420 gene priA 16909 14552 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_08420 17553 16921 gene locus_tag LOCUS_08430 17553 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18084 17587 gene locus_tag LOCUS_08440 18084 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 18458 18264 gene locus_tag LOCUS_08450 gene yacG 18458 18264 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856332.1 protein_id gnl|my_center|LOCUS_08450 18808 18455 gene locus_tag LOCUS_08460 18808 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 19638 18886 gene locus_tag LOCUS_08470 19638 18886 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229010.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence0037 871 1623 gene locus_tag LOCUS_08480 871 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1771 2154 gene locus_tag LOCUS_08490 1771 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2212 2631 gene locus_tag LOCUS_08500 2212 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08500 2834 3349 gene locus_tag LOCUS_08510 2834 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3346 3933 gene locus_tag LOCUS_08520 3346 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4014 4442 gene locus_tag LOCUS_08530 4014 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4394 4768 gene locus_tag LOCUS_08540 4394 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08540 5524 5240 gene locus_tag LOCUS_08550 5524 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08550 5433 5678 gene locus_tag LOCUS_08560 5433 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 7520 5727 gene locus_tag LOCUS_08570 7520 5727 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089503.1 protein_id gnl|my_center|LOCUS_08570 8158 7817 gene locus_tag LOCUS_08580 8158 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 12291 8191 gene locus_tag LOCUS_08590 12291 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 12693 12307 gene locus_tag LOCUS_08600 12693 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 14780 12729 gene locus_tag LOCUS_08610 14780 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 15614 15072 gene locus_tag LOCUS_08620 15614 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 16388 15828 gene locus_tag LOCUS_08630 16388 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 16753 16628 gene locus_tag LOCUS_08640 16753 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 16904 17644 gene locus_tag LOCUS_08650 16904 17644 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922288.1 protein_id gnl|my_center|LOCUS_08650 18330 18091 gene locus_tag LOCUS_08660 18330 18091 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_08660 18402 18950 gene locus_tag LOCUS_08670 18402 18950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 19459 19016 gene locus_tag LOCUS_08680 19459 19016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08680 19824 19384 gene locus_tag LOCUS_08690 19824 19384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence0038 1558 2472 gene locus_tag LOCUS_08700 1558 2472 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327421.1 protein_id gnl|my_center|LOCUS_08700 2702 2469 gene locus_tag LOCUS_08710 2702 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3189 2692 gene locus_tag LOCUS_08720 3189 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 4132 3263 gene locus_tag LOCUS_08730 4132 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 4361 4888 gene locus_tag LOCUS_08740 4361 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 4984 5742 gene locus_tag LOCUS_08750 4984 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 5760 7043 gene locus_tag LOCUS_08760 5760 7043 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_08760 7106 7864 gene locus_tag LOCUS_08770 7106 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 8574 7918 gene locus_tag LOCUS_08780 8574 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 9593 8574 gene locus_tag LOCUS_08790 gene hpnH 9593 8574 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_08790 11612 9609 gene locus_tag LOCUS_08800 gene shc 11612 9609 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_08800 12736 11747 gene locus_tag LOCUS_08810 12736 11747 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_08810 13945 12821 gene locus_tag LOCUS_08820 13945 12821 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827458.1 protein_id gnl|my_center|LOCUS_08820 17990 14109 gene locus_tag LOCUS_08830 17990 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 18299 18075 gene locus_tag LOCUS_08840 18299 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 18904 18296 gene locus_tag LOCUS_08850 18904 18296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 19270 18998 gene locus_tag LOCUS_08860 19270 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence0039 203 2686 gene locus_tag LOCUS_08870 203 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2915 6379 gene locus_tag LOCUS_08880 gene mfd 2915 6379 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_08880 6477 7661 gene locus_tag LOCUS_08890 6477 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 7706 7951 gene locus_tag LOCUS_08900 7706 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9182 7956 gene locus_tag LOCUS_08910 9182 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 9285 10718 gene locus_tag LOCUS_08920 9285 10718 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_08920 15793 10790 gene locus_tag LOCUS_08930 15793 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 16513 15887 gene locus_tag LOCUS_08940 16513 15887 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_08940 17528 16863 gene locus_tag LOCUS_08950 17528 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 18076 17606 gene locus_tag LOCUS_08960 18076 17606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 18200 19171 gene locus_tag LOCUS_08970 18200 19171 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921965.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence0040 155 1702 gene locus_tag LOCUS_08980 gene trpE 155 1702 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_08980 1778 2842 gene locus_tag LOCUS_08990 1778 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 protein_id gnl|my_center|LOCUS_08990 3793 3446 gene locus_tag LOCUS_09000 3793 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6014 4125 gene locus_tag LOCUS_09010 6014 4125 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325434.1 protein_id gnl|my_center|LOCUS_09010 6365 7555 gene locus_tag LOCUS_09020 6365 7555 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_09020 7623 11996 gene locus_tag LOCUS_09030 7623 11996 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921311.1 protein_id gnl|my_center|LOCUS_09030 12011 12292 gene locus_tag LOCUS_09040 12011 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 12289 12777 gene locus_tag LOCUS_09050 12289 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393582.1 protein_id gnl|my_center|LOCUS_09050 12774 15332 gene locus_tag LOCUS_09060 12774 15332 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_09060 15376 16857 gene locus_tag LOCUS_09070 15376 16857 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_09070 16919 17014 gene locus_tag LOCUS_t00090 16919 17014 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 17786 17226 gene locus_tag LOCUS_09080 17786 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 18659 17940 gene locus_tag LOCUS_09090 18659 17940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence0041 651 223 gene locus_tag LOCUS_09100 651 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2673 676 gene locus_tag LOCUS_09110 2673 676 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_09110 2877 3278 gene locus_tag LOCUS_09120 2877 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3565 4704 gene locus_tag LOCUS_09130 3565 4704 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921857.1 protein_id gnl|my_center|LOCUS_09130 4695 5072 gene locus_tag LOCUS_09140 4695 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5072 6382 gene locus_tag LOCUS_09150 5072 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 6535 7773 gene locus_tag LOCUS_09160 6535 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 7901 9751 gene locus_tag LOCUS_09170 7901 9751 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_09170 9763 10407 gene locus_tag LOCUS_09180 9763 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 10637 14794 gene locus_tag LOCUS_09190 10637 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 15532 14867 gene locus_tag LOCUS_09200 15532 14867 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090769.1 protein_id gnl|my_center|LOCUS_09200 17662 15617 gene locus_tag LOCUS_09210 17662 15617 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_09210 <19339 18023 gene locus_tag LOCUS_09220 <19339 18023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389950.1:malto-oligosyltrehalose trehalohydrolase >Feature sequence0042 2 1003 gene locus_tag LOCUS_09230 2 1003 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380904.1 protein_id gnl|my_center|LOCUS_09230 1013 2266 gene locus_tag LOCUS_09240 1013 2266 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919597.1 protein_id gnl|my_center|LOCUS_09240 2737 3519 gene locus_tag LOCUS_09250 gene fabG 2737 3519 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_09250 4055 3528 gene locus_tag LOCUS_09260 4055 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7313 4089 gene locus_tag LOCUS_09270 7313 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 9650 7527 gene locus_tag LOCUS_09280 9650 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_09280 12373 9647 gene locus_tag LOCUS_09290 12373 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 14907 12370 gene locus_tag LOCUS_09300 14907 12370 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_09300 15275 14904 gene locus_tag LOCUS_09310 15275 14904 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_09310 15589 15272 gene locus_tag LOCUS_09320 15589 15272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_09320 16595 16062 gene locus_tag LOCUS_09330 16595 16062 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_09330 17988 16861 gene locus_tag LOCUS_09340 17988 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_09340 18355 17981 gene locus_tag LOCUS_09350 18355 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 19011 18352 gene locus_tag LOCUS_09360 19011 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence0043 174 593 gene locus_tag LOCUS_09370 174 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 827 1399 gene locus_tag LOCUS_09380 827 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1489 1932 gene locus_tag LOCUS_09390 1489 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1975 3273 gene locus_tag LOCUS_09400 1975 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3380 3718 gene locus_tag LOCUS_09410 3380 3718 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966950.1 protein_id gnl|my_center|LOCUS_09410 3840 4472 gene locus_tag LOCUS_09420 3840 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4552 4716 gene locus_tag LOCUS_09430 4552 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4880 5323 gene locus_tag LOCUS_09440 4880 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 5484 5957 gene locus_tag LOCUS_09450 5484 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5945 8185 gene locus_tag LOCUS_09460 5945 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 8369 8845 gene locus_tag LOCUS_09470 8369 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 9021 11366 gene locus_tag LOCUS_09480 9021 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_09480 11628 11535 gene locus_tag LOCUS_t00100 11628 11535 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11995 12333 gene locus_tag LOCUS_09490 11995 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 12462 13970 gene locus_tag LOCUS_09500 12462 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 14025 14759 gene locus_tag LOCUS_09510 14025 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 14882 15832 gene locus_tag LOCUS_09520 14882 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 15901 16107 gene locus_tag LOCUS_09530 15901 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 <18927 16096 gene locus_tag LOCUS_09540 <18927 16096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103123.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence0044 705 445 gene locus_tag LOCUS_09550 705 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1653 802 gene locus_tag LOCUS_09560 gene larE 1653 802 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_09560 2210 1758 gene locus_tag LOCUS_09570 2210 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3112 2207 gene locus_tag LOCUS_09580 gene ilvE 3112 2207 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_09580 3914 3189 gene locus_tag LOCUS_09590 3914 3189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331945.1 protein_id gnl|my_center|LOCUS_09590 5467 4013 gene locus_tag LOCUS_09600 5467 4013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_09600 6239 5592 gene locus_tag LOCUS_09610 6239 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 7034 6462 gene locus_tag LOCUS_09620 7034 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 7797 7183 gene locus_tag LOCUS_09630 7797 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 8431 7967 gene locus_tag LOCUS_09640 8431 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 9444 8644 gene locus_tag LOCUS_09650 9444 8644 CDS product DUF6065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969880.1 protein_id gnl|my_center|LOCUS_09650 11183 9573 gene locus_tag LOCUS_09660 11183 9573 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 protein_id gnl|my_center|LOCUS_09660 11570 12202 gene locus_tag LOCUS_09670 11570 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 12339 12980 gene locus_tag LOCUS_09680 12339 12980 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_09680 14084 13062 gene locus_tag LOCUS_09690 14084 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 14213 15604 gene locus_tag LOCUS_09700 gene hemG 14213 15604 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_09700 15887 17428 gene locus_tag LOCUS_09710 15887 17428 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_09710 17447 17971 gene locus_tag LOCUS_09720 17447 17971 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_09720 18063 18791 gene locus_tag LOCUS_09730 18063 18791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence0045 1082 72 gene locus_tag LOCUS_09740 gene rfbB 1082 72 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_09740 2556 1186 gene locus_tag LOCUS_09750 2556 1186 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_09750 3345 2587 gene locus_tag LOCUS_09760 3345 2587 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941295.1 protein_id gnl|my_center|LOCUS_09760 3763 3431 gene locus_tag LOCUS_09770 3763 3431 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_09770 4014 3742 gene locus_tag LOCUS_09780 4014 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4393 4046 gene locus_tag LOCUS_09790 4393 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5907 4390 gene locus_tag LOCUS_09800 5907 4390 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_09800 6116 7312 gene locus_tag LOCUS_09810 6116 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7309 8205 gene locus_tag LOCUS_09820 7309 8205 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_09820 8465 8208 gene locus_tag LOCUS_09830 8465 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 8555 9610 gene locus_tag LOCUS_09840 gene lpxK 8555 9610 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_09840 9628 10578 gene locus_tag LOCUS_09850 9628 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_09850 10590 12068 gene locus_tag LOCUS_09860 gene rfaE1 10590 12068 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_09860 12150 13223 gene locus_tag LOCUS_09870 gene waaF 12150 13223 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_09870 13213 14604 gene locus_tag LOCUS_09880 13213 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 14601 15467 gene locus_tag LOCUS_09890 14601 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 15467 16636 gene locus_tag LOCUS_09900 15467 16636 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_09900 16664 17224 gene locus_tag LOCUS_09910 16664 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 18380 17313 gene locus_tag LOCUS_09920 18380 17313 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence0046 161 370 gene locus_tag LOCUS_09930 161 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 515 961 gene locus_tag LOCUS_09940 515 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 958 2757 gene locus_tag LOCUS_09950 958 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09950 2773 3168 gene locus_tag LOCUS_09960 2773 3168 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935061.1 protein_id gnl|my_center|LOCUS_09960 3415 3792 gene locus_tag LOCUS_09970 3415 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3956 4501 gene locus_tag LOCUS_09980 3956 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4688 5164 gene locus_tag LOCUS_09990 4688 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 5360 7312 gene locus_tag LOCUS_10000 5360 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7351 7662 gene locus_tag LOCUS_10010 7351 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 7695 12068 gene locus_tag LOCUS_10020 7695 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 12065 12877 gene locus_tag LOCUS_10030 12065 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 12945 14132 gene locus_tag LOCUS_10040 12945 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 15388 14126 gene locus_tag LOCUS_10050 15388 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 15821 16093 gene locus_tag LOCUS_10060 15821 16093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 16029 16562 gene locus_tag LOCUS_10070 16029 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 17432 16605 gene locus_tag LOCUS_10080 gene nhoA 17432 16605 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366444.1 protein_id gnl|my_center|LOCUS_10080 18040 18366 gene locus_tag LOCUS_10090 18040 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 <18863 18363 gene locus_tag LOCUS_10100 <18863 18363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_155767756.1:IS3 family transposase >Feature sequence0047 978 2123 gene locus_tag LOCUS_10110 978 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2261 3268 gene locus_tag LOCUS_10120 2261 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3265 4407 gene locus_tag LOCUS_10130 3265 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4521 5501 gene locus_tag LOCUS_10140 4521 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5568 6869 gene locus_tag LOCUS_10150 5568 6869 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_10150 6885 8015 gene locus_tag LOCUS_10160 6885 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8229 9401 gene locus_tag LOCUS_10170 8229 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9555 10724 gene locus_tag LOCUS_10180 9555 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 11789 10959 gene locus_tag LOCUS_10190 11789 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 11943 12929 gene locus_tag LOCUS_10200 11943 12929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 13040 13528 gene locus_tag LOCUS_10210 13040 13528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 13556 14479 gene locus_tag LOCUS_10220 13556 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 15043 16077 gene locus_tag LOCUS_10230 15043 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 16114 17244 gene locus_tag LOCUS_10240 16114 17244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 17241 17651 gene locus_tag LOCUS_10250 17241 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 17661 18572 gene locus_tag LOCUS_10260 17661 18572 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence0048 2301 508 gene locus_tag LOCUS_10270 2301 508 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089503.1 protein_id gnl|my_center|LOCUS_10270 3546 2335 gene locus_tag LOCUS_10280 gene cax 3546 2335 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887018.1 protein_id gnl|my_center|LOCUS_10280 4838 3657 gene locus_tag LOCUS_10290 4838 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5521 4865 gene locus_tag LOCUS_10300 5521 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6120 5677 gene locus_tag LOCUS_10310 6120 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7022 6096 gene locus_tag LOCUS_10320 7022 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8211 8038 gene locus_tag LOCUS_10330 8211 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 8958 8269 gene locus_tag LOCUS_10340 8958 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 9188 8988 gene locus_tag LOCUS_10350 9188 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 12058 10169 gene locus_tag LOCUS_10360 12058 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 12616 14343 gene locus_tag LOCUS_10370 gene ilvB 12616 14343 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_10370 15653 14490 gene locus_tag LOCUS_10380 gene eboE 15653 14490 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028848.1 protein_id gnl|my_center|LOCUS_10380 17212 15698 gene locus_tag LOCUS_10390 17212 15698 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034322.1 protein_id gnl|my_center|LOCUS_10390 <18531 17375 gene locus_tag LOCUS_10400 <18531 17375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922542.1:DUF1553 domain-containing protein >Feature sequence0049 3419 1257 gene locus_tag LOCUS_10410 3419 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4408 3440 gene locus_tag LOCUS_10420 4408 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 6105 4405 gene locus_tag LOCUS_10430 6105 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7229 6102 gene locus_tag LOCUS_10440 7229 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 7696 8724 gene locus_tag LOCUS_10450 7696 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 8793 9821 gene locus_tag LOCUS_10460 8793 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 10004 11101 gene locus_tag LOCUS_10470 10004 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 11185 12201 gene locus_tag LOCUS_10480 11185 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 12314 13324 gene locus_tag LOCUS_10490 12314 13324 CDS product TerY-C metal binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087239.1 protein_id gnl|my_center|LOCUS_10490 13430 14077 gene locus_tag LOCUS_10500 13430 14077 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 protein_id gnl|my_center|LOCUS_10500 14096 16048 gene locus_tag LOCUS_10510 14096 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 16045 17472 gene locus_tag LOCUS_10520 16045 17472 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284313.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence0050 3 2321 gene locus_tag LOCUS_10530 3 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2330 5545 gene locus_tag LOCUS_10540 2330 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 5542 5817 gene locus_tag LOCUS_10550 5542 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5850 6713 gene locus_tag LOCUS_10560 5850 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 6760 7914 gene locus_tag LOCUS_10570 6760 7914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_10570 7979 8692 gene locus_tag LOCUS_10580 7979 8692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922047.1 protein_id gnl|my_center|LOCUS_10580 9662 8793 gene locus_tag LOCUS_10590 9662 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672291.1 protein_id gnl|my_center|LOCUS_10590 10728 9823 gene locus_tag LOCUS_10600 10728 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 10879 12750 gene locus_tag LOCUS_10610 10879 12750 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_10610 12838 13827 gene locus_tag LOCUS_10620 12838 13827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 14861 13920 gene locus_tag LOCUS_10630 gene mbfA 14861 13920 CDS product iron exporter MbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090619.1 protein_id gnl|my_center|LOCUS_10630 15852 14875 gene locus_tag LOCUS_10640 15852 14875 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence0051 154 3009 gene locus_tag LOCUS_10650 154 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4441 3032 gene locus_tag LOCUS_10660 4441 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5825 4560 gene locus_tag LOCUS_10670 5825 4560 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_10670 6501 5905 gene locus_tag LOCUS_10680 6501 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 6980 6495 gene locus_tag LOCUS_10690 6980 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 7212 7433 gene locus_tag LOCUS_10700 7212 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 7603 8628 gene locus_tag LOCUS_10710 7603 8628 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_10710 8966 8634 gene locus_tag LOCUS_10720 8966 8634 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_10720 9397 8963 gene locus_tag LOCUS_10730 9397 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10105 9455 gene locus_tag LOCUS_10740 10105 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 11001 10114 gene locus_tag LOCUS_10750 11001 10114 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_10750 11126 14074 gene locus_tag LOCUS_10760 11126 14074 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922491.1 protein_id gnl|my_center|LOCUS_10760 14276 15340 gene locus_tag LOCUS_10770 14276 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 15343 15936 gene locus_tag LOCUS_10780 15343 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 15976 17406 gene locus_tag LOCUS_10790 15976 17406 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence0052 806 33 gene locus_tag LOCUS_10800 gene cobB 806 33 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_10800 2198 849 gene locus_tag LOCUS_10810 gene glmM 2198 849 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_10810 3736 2351 gene locus_tag LOCUS_10820 3736 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4467 3985 gene locus_tag LOCUS_10830 4467 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4653 5537 gene locus_tag LOCUS_10840 4653 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5763 6914 gene locus_tag LOCUS_10850 5763 6914 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_10850 6971 7528 gene locus_tag LOCUS_10860 6971 7528 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_10860 7545 8744 gene locus_tag LOCUS_10870 7545 8744 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_10870 8759 9955 gene locus_tag LOCUS_10880 8759 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 10440 9886 gene locus_tag LOCUS_10890 gene mug 10440 9886 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_10890 11246 10437 gene locus_tag LOCUS_10900 11246 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 11560 11246 gene locus_tag LOCUS_10910 11560 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 11938 11678 gene locus_tag LOCUS_10920 11938 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 12355 12035 gene locus_tag LOCUS_10930 12355 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 12812 14854 gene locus_tag LOCUS_10940 12812 14854 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_10940 15571 15125 gene locus_tag LOCUS_10950 15571 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 15727 16827 gene locus_tag LOCUS_10960 15727 16827 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_10960 16840 17184 gene locus_tag LOCUS_10970 16840 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 17187 17501 gene locus_tag LOCUS_10980 17187 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence0053 2788 308 gene locus_tag LOCUS_10990 2788 308 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249708.1 protein_id gnl|my_center|LOCUS_10990 2906 3991 gene locus_tag LOCUS_11000 gene aroB 2906 3991 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_11000 3988 5235 gene locus_tag LOCUS_11010 3988 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5932 5600 gene locus_tag LOCUS_11020 5932 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5871 7067 gene locus_tag LOCUS_11030 5871 7067 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_11030 7462 7073 gene locus_tag LOCUS_11040 7462 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 8357 7497 gene locus_tag LOCUS_11050 8357 7497 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_11050 8532 11522 gene locus_tag LOCUS_11060 8532 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 11660 13363 gene locus_tag LOCUS_11070 gene ggt 11660 13363 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_11070 13571 13780 gene locus_tag LOCUS_11080 13571 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 13942 14364 gene locus_tag LOCUS_11090 13942 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 14429 15295 gene locus_tag LOCUS_11100 14429 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 15686 15300 gene locus_tag LOCUS_11110 gene acpS 15686 15300 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324752.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence0054 1789 800 gene locus_tag LOCUS_11120 1789 800 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_11120 1913 5632 gene locus_tag LOCUS_11130 1913 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 6991 5780 gene locus_tag LOCUS_11140 6991 5780 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006095218.1 protein_id gnl|my_center|LOCUS_11140 7433 7702 gene locus_tag LOCUS_11150 7433 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8087 8659 gene locus_tag LOCUS_11160 8087 8659 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008652955.1 protein_id gnl|my_center|LOCUS_11160 8631 9323 gene locus_tag LOCUS_11170 8631 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 9339 11060 gene locus_tag LOCUS_11180 9339 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 12224 11070 gene locus_tag LOCUS_11190 12224 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 13528 12338 gene locus_tag LOCUS_11200 13528 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_11200 14169 16871 gene locus_tag LOCUS_11210 14169 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143193.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence0055 287 778 gene locus_tag LOCUS_11220 287 778 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326693.1 protein_id gnl|my_center|LOCUS_11220 775 1539 gene locus_tag LOCUS_11230 gene fabG 775 1539 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 protein_id gnl|my_center|LOCUS_11230 1560 1949 gene locus_tag LOCUS_11240 1560 1949 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_11240 2031 2522 gene locus_tag LOCUS_11250 2031 2522 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_11250 2705 3982 gene locus_tag LOCUS_11260 gene fabF 2705 3982 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644335.1 protein_id gnl|my_center|LOCUS_11260 4032 5432 gene locus_tag LOCUS_11270 4032 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 5449 5931 gene locus_tag LOCUS_11280 5449 5931 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_11280 5983 7269 gene locus_tag LOCUS_11290 5983 7269 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_11290 7330 7479 gene locus_tag LOCUS_11300 7330 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7593 8579 gene locus_tag LOCUS_11310 7593 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 8637 10406 gene locus_tag LOCUS_11320 8637 10406 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_11320 11313 10417 gene locus_tag LOCUS_11330 11313 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 12560 11418 gene locus_tag LOCUS_11340 12560 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 13147 12704 gene locus_tag LOCUS_11350 13147 12704 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082981.1 protein_id gnl|my_center|LOCUS_11350 13849 13160 gene locus_tag LOCUS_11360 13849 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 13992 15089 gene locus_tag LOCUS_11370 13992 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 15794 15135 gene locus_tag LOCUS_11380 15794 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 16209 16709 gene locus_tag LOCUS_11390 16209 16709 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332309.1 protein_id gnl|my_center|LOCUS_11390 16728 17015 gene locus_tag LOCUS_11400 gene groES 16728 17015 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939263.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence0056 288 740 gene locus_tag LOCUS_11410 288 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4593 850 gene locus_tag LOCUS_11420 4593 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5245 4706 gene locus_tag LOCUS_11430 5245 4706 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_11430 6273 5248 gene locus_tag LOCUS_11440 6273 5248 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922273.1 protein_id gnl|my_center|LOCUS_11440 7788 6421 gene locus_tag LOCUS_11450 7788 6421 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_11450 8404 7898 gene locus_tag LOCUS_11460 8404 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 8759 8394 gene locus_tag LOCUS_11470 8759 8394 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 protein_id gnl|my_center|LOCUS_11470 9728 8799 gene locus_tag LOCUS_11480 9728 8799 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921397.1 protein_id gnl|my_center|LOCUS_11480 11108 9873 gene locus_tag LOCUS_11490 11108 9873 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_11490 12386 11172 gene locus_tag LOCUS_11500 12386 11172 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_11500 13891 12503 gene locus_tag LOCUS_11510 13891 12503 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_11510 14011 16017 gene locus_tag LOCUS_11520 14011 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 16508 16353 gene locus_tag LOCUS_11530 16508 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence0057 879 808 gene locus_tag LOCUS_t00110 879 808 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1665 994 gene locus_tag LOCUS_11540 gene phoU 1665 994 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_11540 1933 2943 gene locus_tag LOCUS_11550 1933 2943 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_11550 3087 3977 gene locus_tag LOCUS_11560 3087 3977 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_11560 3974 4525 gene locus_tag LOCUS_11570 3974 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4522 5319 gene locus_tag LOCUS_11580 4522 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5316 7529 gene locus_tag LOCUS_11590 5316 7529 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921453.1 protein_id gnl|my_center|LOCUS_11590 7669 10080 gene locus_tag LOCUS_11600 7669 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 10209 12260 gene locus_tag LOCUS_11610 10209 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 12495 15530 gene locus_tag LOCUS_11620 12495 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence0058 1198 1722 gene locus_tag LOCUS_11630 gene hoxE 1198 1722 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_11630 1709 3361 gene locus_tag LOCUS_11640 1709 3361 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_11640 3358 4074 gene locus_tag LOCUS_11650 gene hoxU 3358 4074 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_11650 4062 4619 gene locus_tag LOCUS_11660 4062 4619 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_11660 4665 6086 gene locus_tag LOCUS_11670 4665 6086 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_11670 6088 6534 gene locus_tag LOCUS_11680 6088 6534 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943352.1 protein_id gnl|my_center|LOCUS_11680 6527 6868 gene locus_tag LOCUS_11690 6527 6868 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 protein_id gnl|my_center|LOCUS_11690 6870 7556 gene locus_tag LOCUS_11700 gene hypB 6870 7556 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258628.1 protein_id gnl|my_center|LOCUS_11700 8582 7539 gene locus_tag LOCUS_11710 gene hypE 8582 7539 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_11710 9691 8588 gene locus_tag LOCUS_11720 gene hypD 9691 8588 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_11720 9950 9678 gene locus_tag LOCUS_11730 9950 9678 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 protein_id gnl|my_center|LOCUS_11730 12235 9941 gene locus_tag LOCUS_11740 gene hypF 12235 9941 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_11740 12321 15944 gene locus_tag LOCUS_11750 gene nifJ 12321 15944 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_11750 16066 16935 gene locus_tag LOCUS_11760 16066 16935 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11760 >Feature sequence0059 <1 1875 gene locus_tag LOCUS_11770 <1 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943302.1:efflux RND transporter permease subunit 2038 4230 gene locus_tag LOCUS_11780 2038 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 4343 4693 gene locus_tag LOCUS_11790 4343 4693 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921237.1 protein_id gnl|my_center|LOCUS_11790 4690 5697 gene locus_tag LOCUS_11800 4690 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 6493 5720 gene locus_tag LOCUS_11810 6493 5720 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839121.1 protein_id gnl|my_center|LOCUS_11810 6641 7549 gene locus_tag LOCUS_11820 6641 7549 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_11820 7589 8428 gene locus_tag LOCUS_11830 7589 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 8948 9514 gene locus_tag LOCUS_11840 8948 9514 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_11840 9609 10361 gene locus_tag LOCUS_11850 9609 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 10403 13462 gene locus_tag LOCUS_11860 10403 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 13861 14691 gene locus_tag LOCUS_11870 13861 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 14787 17120 gene locus_tag LOCUS_11880 14787 17120 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence0060 1347 241 gene locus_tag LOCUS_11890 1347 241 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_11890 1605 1351 gene locus_tag LOCUS_11900 1605 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2495 1734 gene locus_tag LOCUS_11910 2495 1734 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_11910 2587 3537 gene locus_tag LOCUS_11920 2587 3537 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 protein_id gnl|my_center|LOCUS_11920 3873 3541 gene locus_tag LOCUS_11930 3873 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3764 4171 gene locus_tag LOCUS_11940 3764 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5591 4191 gene locus_tag LOCUS_11950 5591 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5745 6209 gene locus_tag LOCUS_11960 5745 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6290 7009 gene locus_tag LOCUS_11970 6290 7009 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_11970 7098 8564 gene locus_tag LOCUS_11980 7098 8564 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_11980 8577 9821 gene locus_tag LOCUS_11990 8577 9821 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_11990 12204 9925 gene locus_tag LOCUS_12000 12204 9925 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_12000 13183 12302 gene locus_tag LOCUS_12010 13183 12302 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_12010 13313 15268 gene locus_tag LOCUS_12020 gene acs 13313 15268 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_12020 15293 17089 gene locus_tag LOCUS_12030 15293 17089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence0061 103 1008 gene locus_tag LOCUS_12040 103 1008 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_12040 1131 1325 gene locus_tag LOCUS_12050 1131 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1398 1907 gene locus_tag LOCUS_12060 1398 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1904 2539 gene locus_tag LOCUS_12070 1904 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 2575 2790 gene locus_tag LOCUS_12080 2575 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 3930 2881 gene locus_tag LOCUS_12090 3930 2881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_12090 4935 3994 gene locus_tag LOCUS_12100 4935 3994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_12100 5974 5045 gene locus_tag LOCUS_12110 gene cysW 5974 5045 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534651.1 protein_id gnl|my_center|LOCUS_12110 6788 5964 gene locus_tag LOCUS_12120 gene cysT 6788 5964 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_12120 7923 6877 gene locus_tag LOCUS_12130 7923 6877 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039484.1 protein_id gnl|my_center|LOCUS_12130 9422 8067 gene locus_tag LOCUS_12140 9422 8067 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_12140 10448 9555 gene locus_tag LOCUS_12150 10448 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 10597 11331 gene locus_tag LOCUS_12160 10597 11331 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_12160 11410 11482 gene locus_tag LOCUS_t00120 11410 11482 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 11721 13574 gene locus_tag LOCUS_12170 11721 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 14811 14047 gene locus_tag LOCUS_12180 14811 14047 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060896.1 protein_id gnl|my_center|LOCUS_12180 16271 14808 gene locus_tag LOCUS_12190 16271 14808 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728208.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence0062 949 1122 gene locus_tag LOCUS_12200 949 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2588 1269 gene locus_tag LOCUS_12210 gene aroA 2588 1269 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_12210 3455 2652 gene locus_tag LOCUS_12220 gene truA 3455 2652 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_12220 4614 3598 gene locus_tag LOCUS_12230 gene asd 4614 3598 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_12230 4765 5733 gene locus_tag LOCUS_12240 4765 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 6226 5747 gene locus_tag LOCUS_12250 6226 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 7193 6324 gene locus_tag LOCUS_12260 7193 6324 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_12260 7473 8114 gene locus_tag LOCUS_12270 7473 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 8221 8721 gene locus_tag LOCUS_12280 8221 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8670 8939 gene locus_tag LOCUS_12290 8670 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 8970 9251 gene locus_tag LOCUS_12300 8970 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 9351 10574 gene locus_tag LOCUS_12310 9351 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 10650 11297 gene locus_tag LOCUS_12320 10650 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 11329 11583 gene locus_tag LOCUS_12330 11329 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 11786 14053 gene locus_tag LOCUS_12340 gene katG 11786 14053 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_12340 14359 14871 gene locus_tag LOCUS_12350 14359 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 15915 14941 gene locus_tag LOCUS_12360 15915 14941 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence0063 2696 93 gene locus_tag LOCUS_12370 2696 93 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_12370 2974 2693 gene locus_tag LOCUS_12380 2974 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 3472 3047 gene locus_tag LOCUS_12390 3472 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12390 3911 3459 gene locus_tag LOCUS_12400 3911 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5318 3915 gene locus_tag LOCUS_12410 5318 3915 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_12410 5468 5549 gene locus_tag LOCUS_t00130 5468 5549 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12547 5567 gene locus_tag LOCUS_12420 12547 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 13347 12616 gene locus_tag LOCUS_12430 13347 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 13656 14243 gene locus_tag LOCUS_12440 13656 14243 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_12440 14368 16593 gene locus_tag LOCUS_12450 14368 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence0064 3 428 gene locus_tag LOCUS_12460 3 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 781 425 gene locus_tag LOCUS_12470 781 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 947 1855 gene locus_tag LOCUS_12480 947 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2560 1934 gene locus_tag LOCUS_12490 2560 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2738 3172 gene locus_tag LOCUS_12500 gene rplM 2738 3172 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_12500 3205 3822 gene locus_tag LOCUS_12510 3205 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 5163 3955 gene locus_tag LOCUS_12520 5163 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 5229 5302 gene locus_tag LOCUS_t00140 5229 5302 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5600 6838 gene locus_tag LOCUS_12530 5600 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_12530 8101 6899 gene locus_tag LOCUS_12540 gene rffA 8101 6899 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_12540 9028 8117 gene locus_tag LOCUS_12550 9028 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911545.1 protein_id gnl|my_center|LOCUS_12550 9993 9025 gene locus_tag LOCUS_12560 9993 9025 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407612.1 protein_id gnl|my_center|LOCUS_12560 10583 9969 gene locus_tag LOCUS_12570 10583 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 11398 10601 gene locus_tag LOCUS_12580 11398 10601 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114948346.1 protein_id gnl|my_center|LOCUS_12580 12065 11400 gene locus_tag LOCUS_12590 12065 11400 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_12590 12698 12087 gene locus_tag LOCUS_12600 12698 12087 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902091.1 protein_id gnl|my_center|LOCUS_12600 13411 12695 gene locus_tag LOCUS_12610 13411 12695 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963400.1 protein_id gnl|my_center|LOCUS_12610 13561 15387 gene locus_tag LOCUS_12620 13561 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence0065 42 497 gene locus_tag LOCUS_12630 42 497 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227025.1 protein_id gnl|my_center|LOCUS_12630 920 3286 gene locus_tag LOCUS_12640 920 3286 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_12640 3283 3660 gene locus_tag LOCUS_12650 3283 3660 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707451.1 protein_id gnl|my_center|LOCUS_12650 3709 5355 gene locus_tag LOCUS_12660 3709 5355 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083724.1 protein_id gnl|my_center|LOCUS_12660 5604 6371 gene locus_tag LOCUS_12670 5604 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 6465 6629 gene locus_tag LOCUS_12680 6465 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6647 8800 gene locus_tag LOCUS_12690 6647 8800 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909312.1 protein_id gnl|my_center|LOCUS_12690 8790 9194 gene locus_tag LOCUS_12700 8790 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12700 9327 10088 gene locus_tag LOCUS_12710 9327 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12710 10147 11205 gene locus_tag LOCUS_12720 10147 11205 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_12720 12190 11294 gene locus_tag LOCUS_12730 12190 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 12438 12154 gene locus_tag LOCUS_12740 12438 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 13334 12792 gene locus_tag LOCUS_12750 13334 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 14579 13377 gene locus_tag LOCUS_12760 14579 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 14895 14464 gene locus_tag LOCUS_12770 14895 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12770 15516 16079 gene locus_tag LOCUS_12780 15516 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence0066 370 804 gene locus_tag LOCUS_12790 370 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 813 2027 gene locus_tag LOCUS_12800 813 2027 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 protein_id gnl|my_center|LOCUS_12800 2053 2856 gene locus_tag LOCUS_12810 2053 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2971 4548 gene locus_tag LOCUS_12820 gene dacB 2971 4548 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279147.1 protein_id gnl|my_center|LOCUS_12820 5309 4545 gene locus_tag LOCUS_12830 5309 4545 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113889933.1 protein_id gnl|my_center|LOCUS_12830 7144 5306 gene locus_tag LOCUS_12840 7144 5306 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_12840 9347 7290 gene locus_tag LOCUS_12850 9347 7290 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_12850 9485 10057 gene locus_tag LOCUS_12860 gene efp 9485 10057 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_12860 12108 10123 gene locus_tag LOCUS_12870 gene glgB 12108 10123 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257047.1 protein_id gnl|my_center|LOCUS_12870 14251 12338 gene locus_tag LOCUS_12880 14251 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence0067 <1 573 gene locus_tag LOCUS_12890 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329551.1:response regulator 671 2380 gene locus_tag LOCUS_12900 671 2380 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_12900 2926 2393 gene locus_tag LOCUS_12910 2926 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3578 3108 gene locus_tag LOCUS_12920 3578 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4144 3662 gene locus_tag LOCUS_12930 4144 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 4581 6452 gene locus_tag LOCUS_12940 gene aspS 4581 6452 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404698.1 protein_id gnl|my_center|LOCUS_12940 6607 7071 gene locus_tag LOCUS_12950 6607 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 8879 7113 gene locus_tag LOCUS_12960 8879 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 10467 8980 gene locus_tag LOCUS_12970 10467 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 13301 10524 gene locus_tag LOCUS_12980 13301 10524 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_12980 14015 13374 gene locus_tag LOCUS_12990 14015 13374 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_12990 15734 14052 gene locus_tag LOCUS_13000 gene ilvD 15734 14052 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence0068 487 251 gene locus_tag LOCUS_13010 487 251 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_13010 658 1350 gene locus_tag LOCUS_13020 658 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1616 3124 gene locus_tag LOCUS_13030 1616 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 3240 4088 gene locus_tag LOCUS_13040 3240 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4208 4597 gene locus_tag LOCUS_13050 4208 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 6359 4719 gene locus_tag LOCUS_13060 gene groL 6359 4719 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 protein_id gnl|my_center|LOCUS_13060 6656 6411 gene locus_tag LOCUS_13070 6656 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 7036 6743 gene locus_tag LOCUS_13080 gene groES 7036 6743 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441664.1 protein_id gnl|my_center|LOCUS_13080 7297 7992 gene locus_tag LOCUS_13090 7297 7992 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_13090 8646 7999 gene locus_tag LOCUS_13100 8646 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 8972 8643 gene locus_tag LOCUS_13110 8972 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 10158 8974 gene locus_tag LOCUS_13120 10158 8974 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887715.1 protein_id gnl|my_center|LOCUS_13120 11192 10242 gene locus_tag LOCUS_13130 11192 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 11304 12182 gene locus_tag LOCUS_13140 11304 12182 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921623.1 protein_id gnl|my_center|LOCUS_13140 12182 13081 gene locus_tag LOCUS_13150 gene yedA 12182 13081 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_13150 14078 13104 gene locus_tag LOCUS_13160 14078 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 14933 14148 gene locus_tag LOCUS_13170 14933 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 15084 16079 gene locus_tag LOCUS_13180 15084 16079 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119258.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence0069 334 975 gene locus_tag LOCUS_13190 334 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1317 994 gene locus_tag LOCUS_13200 1317 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4400 1587 gene locus_tag LOCUS_13210 4400 1587 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922826.1 protein_id gnl|my_center|LOCUS_13210 4514 5524 gene locus_tag LOCUS_13220 4514 5524 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_13220 5521 6030 gene locus_tag LOCUS_13230 5521 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6083 6523 gene locus_tag LOCUS_13240 6083 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6726 8255 gene locus_tag LOCUS_13250 6726 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 8365 11703 gene locus_tag LOCUS_13260 8365 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 11743 12858 gene locus_tag LOCUS_13270 11743 12858 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808265.1 protein_id gnl|my_center|LOCUS_13270 12959 13156 gene locus_tag LOCUS_13280 12959 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 13191 13493 gene locus_tag LOCUS_13290 13191 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 13593 14912 gene locus_tag LOCUS_13300 13593 14912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 15527 14925 gene locus_tag LOCUS_13310 15527 14925 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922815.1 protein_id gnl|my_center|LOCUS_13310 15657 16004 gene locus_tag LOCUS_13320 15657 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence0070 120 506 gene locus_tag LOCUS_13330 120 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 519 875 gene locus_tag LOCUS_13340 519 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 872 1441 gene locus_tag LOCUS_13350 872 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1632 2624 gene locus_tag LOCUS_13360 1632 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 2670 3338 gene locus_tag LOCUS_13370 2670 3338 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097039.1 protein_id gnl|my_center|LOCUS_13370 3342 4442 gene locus_tag LOCUS_13380 3342 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4501 5439 gene locus_tag LOCUS_13390 4501 5439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_13390 5436 6284 gene locus_tag LOCUS_13400 5436 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 6281 7033 gene locus_tag LOCUS_13410 6281 7033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209786.1 protein_id gnl|my_center|LOCUS_13410 7205 8509 gene locus_tag LOCUS_13420 7205 8509 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_13420 8612 10165 gene locus_tag LOCUS_13430 gene gltX 8612 10165 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922083.1 protein_id gnl|my_center|LOCUS_13430 10162 10377 gene locus_tag LOCUS_13440 10162 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 10364 10672 gene locus_tag LOCUS_13450 10364 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 10730 12433 gene locus_tag LOCUS_13460 10730 12433 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_13460 12536 13927 gene locus_tag LOCUS_13470 gene asnS 12536 13927 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337912.1 protein_id gnl|my_center|LOCUS_13470 14271 15416 gene locus_tag LOCUS_13480 14271 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 15546 16067 gene locus_tag LOCUS_13490 15546 16067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence0071 <1 826 gene locus_tag LOCUS_13500 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389119.1:substrate-binding domain-containing protein 830 1855 gene locus_tag LOCUS_13510 830 1855 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533060.1 protein_id gnl|my_center|LOCUS_13510 1889 2824 gene locus_tag LOCUS_13520 1889 2824 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898985.1 protein_id gnl|my_center|LOCUS_13520 2926 3846 gene locus_tag LOCUS_13530 2926 3846 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_13530 3868 4407 gene locus_tag LOCUS_13540 3868 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6343 4379 gene locus_tag LOCUS_13550 6343 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6444 7619 gene locus_tag LOCUS_13560 gene larC 6444 7619 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_13560 7962 7735 gene locus_tag LOCUS_13570 7962 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 8361 8047 gene locus_tag LOCUS_13580 8361 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 8243 10858 gene locus_tag LOCUS_13590 gene alaS 8243 10858 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_13590 11859 10981 gene locus_tag LOCUS_13600 11859 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 12090 12875 gene locus_tag LOCUS_13610 12090 12875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706701.1 protein_id gnl|my_center|LOCUS_13610 12920 13684 gene locus_tag LOCUS_13620 12920 13684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013466.1 protein_id gnl|my_center|LOCUS_13620 13687 14613 gene locus_tag LOCUS_13630 13687 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 14604 15827 gene locus_tag LOCUS_13640 14604 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence0072 423 947 gene locus_tag LOCUS_13650 423 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 944 1162 gene locus_tag LOCUS_13660 944 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1149 1343 gene locus_tag LOCUS_13670 1149 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2448 1630 gene locus_tag LOCUS_13680 gene xerD 2448 1630 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644441.1 protein_id gnl|my_center|LOCUS_13680 2882 2808 gene locus_tag LOCUS_t00150 2882 2808 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3146 3811 gene locus_tag LOCUS_13690 3146 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4007 6007 gene locus_tag LOCUS_13700 4007 6007 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_13700 6085 7200 gene locus_tag LOCUS_13710 6085 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7609 7298 gene locus_tag LOCUS_13720 7609 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8040 7606 gene locus_tag LOCUS_13730 8040 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9165 8050 gene locus_tag LOCUS_13740 9165 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 9432 14498 gene locus_tag LOCUS_13750 9432 14498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 14645 15817 gene locus_tag LOCUS_13760 14645 15817 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence0073 54 1193 gene locus_tag LOCUS_13770 54 1193 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 protein_id gnl|my_center|LOCUS_13770 2152 1436 gene locus_tag LOCUS_13780 2152 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3100 2411 gene locus_tag LOCUS_13790 3100 2411 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_13790 5280 3187 gene locus_tag LOCUS_13800 5280 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 5736 5296 gene locus_tag LOCUS_13810 5736 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6659 5736 gene locus_tag LOCUS_13820 6659 5736 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_13820 8066 6846 gene locus_tag LOCUS_13830 8066 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8224 8535 gene locus_tag LOCUS_13840 8224 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 8532 8912 gene locus_tag LOCUS_13850 8532 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 9951 8923 gene locus_tag LOCUS_13860 9951 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 10937 9948 gene locus_tag LOCUS_13870 10937 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13870 11636 10962 gene locus_tag LOCUS_13880 11636 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 11835 11656 gene locus_tag LOCUS_13890 11835 11656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 12775 11849 gene locus_tag LOCUS_13900 12775 11849 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_13900 13081 13254 gene locus_tag LOCUS_13910 13081 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 14521 13634 gene locus_tag LOCUS_13920 gene prmC 14521 13634 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_13920 15100 14666 gene locus_tag LOCUS_13930 15100 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0074 1086 1760 gene locus_tag LOCUS_13940 1086 1760 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_13940 1856 2548 gene locus_tag LOCUS_13950 1856 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2589 3050 gene locus_tag LOCUS_13960 2589 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3208 4245 gene locus_tag LOCUS_13970 3208 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4250 5137 gene locus_tag LOCUS_13980 4250 5137 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_13980 5680 5141 gene locus_tag LOCUS_13990 5680 5141 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169876.1 protein_id gnl|my_center|LOCUS_13990 6516 5995 gene locus_tag LOCUS_14000 6516 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7112 8371 gene locus_tag LOCUS_14010 7112 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 8664 10508 gene locus_tag LOCUS_14020 8664 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 10704 12206 gene locus_tag LOCUS_14030 10704 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 12522 12971 gene locus_tag LOCUS_14040 12522 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 13093 13476 gene locus_tag LOCUS_14050 13093 13476 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526549.1 protein_id gnl|my_center|LOCUS_14050 13884 13567 gene locus_tag LOCUS_14060 13884 13567 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_14060 14448 14179 gene locus_tag LOCUS_14070 14448 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 14777 14496 gene locus_tag LOCUS_14080 14777 14496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence0075 366 974 gene locus_tag LOCUS_14090 366 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 971 1375 gene locus_tag LOCUS_14100 971 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2166 1447 gene locus_tag LOCUS_14110 2166 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2495 2163 gene locus_tag LOCUS_14120 2495 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 2907 2518 gene locus_tag LOCUS_14130 2907 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3013 3324 gene locus_tag LOCUS_14140 3013 3324 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336823.1 protein_id gnl|my_center|LOCUS_14140 3369 3782 gene locus_tag LOCUS_14150 3369 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5053 3896 gene locus_tag LOCUS_14160 5053 3896 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_14160 5090 7102 gene locus_tag LOCUS_14170 gene yagF 5090 7102 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_14170 7115 7414 gene locus_tag LOCUS_14180 7115 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 7411 7623 gene locus_tag LOCUS_14190 7411 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 7633 8547 gene locus_tag LOCUS_14200 7633 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 8578 9189 gene locus_tag LOCUS_14210 8578 9189 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_14210 9245 10234 gene locus_tag LOCUS_14220 gene rsmH 9245 10234 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_14220 10255 10830 gene locus_tag LOCUS_14230 10255 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 11658 10951 gene locus_tag LOCUS_14240 gene sodA 11658 10951 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974746.1 protein_id gnl|my_center|LOCUS_14240 12097 11642 gene locus_tag LOCUS_14250 12097 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 12911 12213 gene locus_tag LOCUS_14260 12911 12213 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_14260 14500 13034 gene locus_tag LOCUS_14270 14500 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence0076 3377 2496 gene locus_tag LOCUS_14280 3377 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4812 3466 gene locus_tag LOCUS_14290 4812 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 5033 6535 gene locus_tag LOCUS_14300 5033 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 6744 7214 gene locus_tag LOCUS_14310 6744 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 7954 7220 gene locus_tag LOCUS_14320 7954 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8695 8003 gene locus_tag LOCUS_14330 8695 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 8804 10216 gene locus_tag LOCUS_14340 8804 10216 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_14340 10219 10854 gene locus_tag LOCUS_14350 10219 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 11264 10860 gene locus_tag LOCUS_14360 11264 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 11512 11279 gene locus_tag LOCUS_14370 11512 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 11397 13106 gene locus_tag LOCUS_14380 11397 13106 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_14380 14569 13202 gene locus_tag LOCUS_14390 14569 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence0077 3 1688 gene locus_tag LOCUS_14400 3 1688 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085096.1 protein_id gnl|my_center|LOCUS_14400 3385 1781 gene locus_tag LOCUS_14410 gene metG 3385 1781 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14410 4161 3478 gene locus_tag LOCUS_14420 4161 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 5610 4177 gene locus_tag LOCUS_14430 5610 4177 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932285.1 protein_id gnl|my_center|LOCUS_14430 7192 6281 gene locus_tag LOCUS_14440 7192 6281 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_14440 7352 8191 gene locus_tag LOCUS_14450 gene fabG 7352 8191 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_14450 8210 8494 gene locus_tag LOCUS_14460 8210 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 8620 8934 gene locus_tag LOCUS_14470 8620 8934 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327966.1 protein_id gnl|my_center|LOCUS_14470 9094 9807 gene locus_tag LOCUS_14480 9094 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10346 9885 gene locus_tag LOCUS_14490 10346 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 11336 10572 gene locus_tag LOCUS_14500 11336 10572 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_14500 12390 11446 gene locus_tag LOCUS_14510 12390 11446 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942716.1 protein_id gnl|my_center|LOCUS_14510 12582 13304 gene locus_tag LOCUS_14520 gene queE 12582 13304 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_14520 13332 14111 gene locus_tag LOCUS_14530 13332 14111 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence0078 521 1252 gene locus_tag LOCUS_14540 521 1252 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_14540 3140 1440 gene locus_tag LOCUS_14550 3140 1440 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020878.1 protein_id gnl|my_center|LOCUS_14550 5835 3292 gene locus_tag LOCUS_14560 5835 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 8091 5959 gene locus_tag LOCUS_14570 8091 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 9947 8130 gene locus_tag LOCUS_14580 9947 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 11092 10112 gene locus_tag LOCUS_14590 11092 10112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_14590 11735 11430 gene locus_tag LOCUS_14600 11735 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 12368 11811 gene locus_tag LOCUS_14610 12368 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 12560 14254 gene locus_tag LOCUS_14620 12560 14254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 14365 14883 gene locus_tag LOCUS_14630 14365 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence0079 102 467 gene locus_tag LOCUS_14640 102 467 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_14640 1177 512 gene locus_tag LOCUS_14650 1177 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1314 1679 gene locus_tag LOCUS_14660 1314 1679 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172694.1 protein_id gnl|my_center|LOCUS_14660 3159 1888 gene locus_tag LOCUS_14670 3159 1888 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113728.1 protein_id gnl|my_center|LOCUS_14670 4338 3286 gene locus_tag LOCUS_14680 4338 3286 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315045.1 protein_id gnl|my_center|LOCUS_14680 5576 4458 gene locus_tag LOCUS_14690 gene bfmBAA 5576 4458 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852555.1 protein_id gnl|my_center|LOCUS_14690 8217 5842 gene locus_tag LOCUS_14700 8217 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 8941 8291 gene locus_tag LOCUS_14710 8941 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 9483 8938 gene locus_tag LOCUS_14720 9483 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 10206 9592 gene locus_tag LOCUS_14730 gene kynB 10206 9592 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858074.1 protein_id gnl|my_center|LOCUS_14730 11458 10214 gene locus_tag LOCUS_14740 gene kynU 11458 10214 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 protein_id gnl|my_center|LOCUS_14740 11591 13732 gene locus_tag LOCUS_14750 11591 13732 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_14750 <14867 13813 gene locus_tag LOCUS_14760 <14867 13813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011214278.1:AI-2E family transporter >Feature sequence0080 <1 890 gene locus_tag LOCUS_14770 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117790.1:porin 1173 1802 gene locus_tag LOCUS_14780 1173 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2427 1822 gene locus_tag LOCUS_14790 2427 1822 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_14790 5924 2430 gene locus_tag LOCUS_14800 gene ileS 5924 2430 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_14800 6173 8779 gene locus_tag LOCUS_14810 6173 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8910 10505 gene locus_tag LOCUS_14820 gene glpK 8910 10505 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084227.1 protein_id gnl|my_center|LOCUS_14820 10961 10509 gene locus_tag LOCUS_14830 10961 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 12079 11018 gene locus_tag LOCUS_14840 12079 11018 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324315.1 protein_id gnl|my_center|LOCUS_14840 12107 12592 gene locus_tag LOCUS_14850 12107 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 13294 12593 gene locus_tag LOCUS_14860 13294 12593 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_14860 13367 14257 gene locus_tag LOCUS_14870 13367 14257 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence0081 104 370 gene locus_tag LOCUS_14880 104 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 860 564 gene locus_tag LOCUS_14890 860 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 950 1204 gene locus_tag LOCUS_14900 950 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1201 1383 gene locus_tag LOCUS_14910 1201 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1586 1407 gene locus_tag LOCUS_14920 1586 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 8178 1849 gene locus_tag LOCUS_14930 8178 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8453 8154 gene locus_tag LOCUS_14940 8453 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 9176 9649 gene locus_tag LOCUS_14950 9176 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 10044 9754 gene locus_tag LOCUS_14960 10044 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 10098 10643 gene locus_tag LOCUS_14970 10098 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 10820 12865 gene locus_tag LOCUS_14980 10820 12865 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_14980 14532 12973 gene locus_tag LOCUS_14990 14532 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence0082 1085 2350 gene locus_tag LOCUS_15000 1085 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3138 2386 gene locus_tag LOCUS_15010 3138 2386 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258317.1 protein_id gnl|my_center|LOCUS_15010 4287 3199 gene locus_tag LOCUS_15020 4287 3199 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_15020 5151 4366 gene locus_tag LOCUS_15030 5151 4366 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_15030 6822 5239 gene locus_tag LOCUS_15040 6822 5239 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_15040 7095 7307 gene locus_tag LOCUS_15050 7095 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 7405 8310 gene locus_tag LOCUS_15060 gene xerC 7405 8310 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_15060 8346 9512 gene locus_tag LOCUS_15070 8346 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 9560 10294 gene locus_tag LOCUS_15080 9560 10294 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 protein_id gnl|my_center|LOCUS_15080 10328 11485 gene locus_tag LOCUS_15090 gene glf 10328 11485 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872005.1 protein_id gnl|my_center|LOCUS_15090 11608 12873 gene locus_tag LOCUS_15100 11608 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 13753 12857 gene locus_tag LOCUS_15110 13753 12857 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence0083 1301 81 gene locus_tag LOCUS_15120 1301 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2127 1258 gene locus_tag LOCUS_15130 2127 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2685 2260 gene locus_tag LOCUS_15140 2685 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2956 2774 gene locus_tag LOCUS_15150 2956 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4077 3061 gene locus_tag LOCUS_15160 4077 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4204 5028 gene locus_tag LOCUS_15170 4204 5028 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140274.1 protein_id gnl|my_center|LOCUS_15170 5637 5035 gene locus_tag LOCUS_15180 5637 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 7833 5701 gene locus_tag LOCUS_15190 7833 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8400 9782 gene locus_tag LOCUS_15200 8400 9782 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_15200 9911 10684 gene locus_tag LOCUS_15210 gene hpnC 9911 10684 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_15210 12670 10730 gene locus_tag LOCUS_15220 12670 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 12731 13045 gene locus_tag LOCUS_15230 12731 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 13073 13348 gene locus_tag LOCUS_15240 13073 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 13399 13650 gene locus_tag LOCUS_15250 13399 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 14525 13656 gene locus_tag LOCUS_15260 14525 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence0084 610 3981 gene locus_tag LOCUS_15270 610 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6596 3987 gene locus_tag LOCUS_15280 6596 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 8132 7149 gene locus_tag LOCUS_15290 8132 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 9175 8285 gene locus_tag LOCUS_15300 9175 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 9174 10460 gene locus_tag LOCUS_15310 gene pfp 9174 10460 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083005.1 protein_id gnl|my_center|LOCUS_15310 10685 11101 gene locus_tag LOCUS_15320 10685 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 11148 12419 gene locus_tag LOCUS_15330 11148 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 12466 12747 gene locus_tag LOCUS_15340 12466 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 12769 13251 gene locus_tag LOCUS_15350 12769 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 13901 13206 gene locus_tag LOCUS_15360 13901 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 <14756 13947 gene locus_tag LOCUS_15370 <14756 13947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393782.1:type I glutamate--ammonia ligase >Feature sequence0085 1486 125 gene locus_tag LOCUS_15380 1486 125 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118398.1 protein_id gnl|my_center|LOCUS_15380 1787 1542 gene locus_tag LOCUS_15390 1787 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2947 1967 gene locus_tag LOCUS_15400 2947 1967 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665638.1 protein_id gnl|my_center|LOCUS_15400 2828 3262 gene locus_tag LOCUS_15410 2828 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3368 4078 gene locus_tag LOCUS_15420 3368 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4934 4080 gene locus_tag LOCUS_15430 4934 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_15430 5132 5761 gene locus_tag LOCUS_15440 5132 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 7315 5807 gene locus_tag LOCUS_15450 7315 5807 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970696.1 protein_id gnl|my_center|LOCUS_15450 7962 7471 gene locus_tag LOCUS_15460 7962 7471 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_15460 8886 8206 gene locus_tag LOCUS_15470 8886 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929093.1 protein_id gnl|my_center|LOCUS_15470 9158 8979 gene locus_tag LOCUS_15480 9158 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 9627 9220 gene locus_tag LOCUS_15490 9627 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 9927 14045 gene locus_tag LOCUS_15500 9927 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence0086 <1 2041 gene locus_tag LOCUS_15510 <1 2041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 2555 2049 gene locus_tag LOCUS_15520 2555 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2932 2555 gene locus_tag LOCUS_15530 2932 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 4290 3037 gene locus_tag LOCUS_15540 gene dinB 4290 3037 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_15540 4528 5610 gene locus_tag LOCUS_15550 gene mnmA 4528 5610 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_15550 5673 5867 gene locus_tag LOCUS_15560 5673 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 6351 5899 gene locus_tag LOCUS_15570 6351 5899 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387847.1 protein_id gnl|my_center|LOCUS_15570 7190 6372 gene locus_tag LOCUS_15580 7190 6372 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_15580 7878 7294 gene locus_tag LOCUS_15590 7878 7294 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_15590 8441 7875 gene locus_tag LOCUS_15600 8441 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8689 8357 gene locus_tag LOCUS_15610 8689 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 10308 8773 gene locus_tag LOCUS_15620 10308 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 10426 11703 gene locus_tag LOCUS_15630 10426 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 11700 12071 gene locus_tag LOCUS_15640 11700 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 12408 12112 gene locus_tag LOCUS_15650 12408 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 12463 13353 gene locus_tag LOCUS_15660 gene dapF 12463 13353 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_15660 13378 14085 gene locus_tag LOCUS_15670 13378 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence0087 1105 251 gene locus_tag LOCUS_15680 1105 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1214 1480 gene locus_tag LOCUS_15690 1214 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2115 1663 gene locus_tag LOCUS_15700 2115 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2175 3173 gene locus_tag LOCUS_15710 2175 3173 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_15710 3179 3886 gene locus_tag LOCUS_15720 gene pxpA 3179 3886 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197223.1 protein_id gnl|my_center|LOCUS_15720 3975 4976 gene locus_tag LOCUS_15730 3975 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5031 5363 gene locus_tag LOCUS_15740 5031 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 5416 5961 gene locus_tag LOCUS_15750 5416 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 6040 7110 gene locus_tag LOCUS_15760 gene queA 6040 7110 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120320.1 protein_id gnl|my_center|LOCUS_15760 7626 7183 gene locus_tag LOCUS_15770 7626 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8589 7711 gene locus_tag LOCUS_15780 8589 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 9562 8750 gene locus_tag LOCUS_15790 9562 8750 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_15790 10747 9695 gene locus_tag LOCUS_15800 10747 9695 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285058.1 protein_id gnl|my_center|LOCUS_15800 10985 13402 gene locus_tag LOCUS_15810 10985 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 13622 14377 gene locus_tag LOCUS_15820 13622 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 14634 14416 gene locus_tag LOCUS_15830 14634 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence0088 410 75 gene locus_tag LOCUS_15840 410 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1429 524 gene locus_tag LOCUS_15850 1429 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3533 1698 gene locus_tag LOCUS_15860 3533 1698 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_15860 4166 3681 gene locus_tag LOCUS_15870 4166 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15870 4892 6238 gene locus_tag LOCUS_15880 4892 6238 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643405.1 protein_id gnl|my_center|LOCUS_15880 6231 6890 gene locus_tag LOCUS_15890 6231 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 6895 8505 gene locus_tag LOCUS_15900 6895 8505 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_15900 8617 9354 gene locus_tag LOCUS_15910 8617 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15910 9261 9947 gene locus_tag LOCUS_15920 9261 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15920 10389 10075 gene locus_tag LOCUS_15930 10389 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 11966 10311 gene locus_tag LOCUS_15940 11966 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15940 12439 12170 gene locus_tag LOCUS_15950 12439 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 12636 12490 gene locus_tag LOCUS_15960 12636 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 12999 12667 gene locus_tag LOCUS_15970 12999 12667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 13569 13000 gene locus_tag LOCUS_15980 13569 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 13568 13882 gene locus_tag LOCUS_15990 13568 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 13989 14321 gene locus_tag LOCUS_16000 13989 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence0089 2032 200 gene locus_tag LOCUS_16010 2032 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2284 2120 gene locus_tag LOCUS_16020 2284 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2883 2434 gene locus_tag LOCUS_16030 2883 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2780 3064 gene locus_tag LOCUS_16040 2780 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5637 2974 gene locus_tag LOCUS_16050 gene ppdK 5637 2974 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_16050 5777 6250 gene locus_tag LOCUS_16060 5777 6250 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388638.1 protein_id gnl|my_center|LOCUS_16060 6247 6639 gene locus_tag LOCUS_16070 6247 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 6675 8066 gene locus_tag LOCUS_16080 6675 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 8247 9131 gene locus_tag LOCUS_16090 8247 9131 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616091.1 protein_id gnl|my_center|LOCUS_16090 9189 9839 gene locus_tag LOCUS_16100 9189 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 9936 11036 gene locus_tag LOCUS_16110 9936 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 11106 12653 gene locus_tag LOCUS_16120 11106 12653 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528380.1 protein_id gnl|my_center|LOCUS_16120 12650 13627 gene locus_tag LOCUS_16130 12650 13627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311044.1 protein_id gnl|my_center|LOCUS_16130 13634 14299 gene locus_tag LOCUS_16140 13634 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence0090 425 1048 gene locus_tag LOCUS_16150 425 1048 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 protein_id gnl|my_center|LOCUS_16150 1180 2751 gene locus_tag LOCUS_16160 1180 2751 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_16160 2976 2755 gene locus_tag LOCUS_16170 2976 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3457 2963 gene locus_tag LOCUS_16180 3457 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4436 3489 gene locus_tag LOCUS_16190 4436 3489 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_16190 4996 4433 gene locus_tag LOCUS_16200 4996 4433 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_16200 6570 5086 gene locus_tag LOCUS_16210 gene pabB 6570 5086 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_16210 7801 6662 gene locus_tag LOCUS_16220 7801 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 9266 7887 gene locus_tag LOCUS_16230 9266 7887 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_16230 10252 9389 gene locus_tag LOCUS_16240 10252 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 11879 10260 gene locus_tag LOCUS_16250 11879 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 13984 11951 gene locus_tag LOCUS_16260 13984 11951 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence0091 3094 2759 gene locus_tag LOCUS_16270 3094 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4254 3145 gene locus_tag LOCUS_16280 gene tgt 4254 3145 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778950.1 protein_id gnl|my_center|LOCUS_16280 5711 4374 gene locus_tag LOCUS_16290 5711 4374 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_16290 6737 5838 gene locus_tag LOCUS_16300 6737 5838 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_16300 7235 6783 gene locus_tag LOCUS_16310 7235 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 8393 7281 gene locus_tag LOCUS_16320 8393 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 9172 8390 gene locus_tag LOCUS_16330 9172 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 9386 10669 gene locus_tag LOCUS_16340 9386 10669 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_16340 11191 10679 gene locus_tag LOCUS_16350 11191 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 11524 11204 gene locus_tag LOCUS_16360 11524 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 11594 12700 gene locus_tag LOCUS_16370 11594 12700 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_16370 12817 13704 gene locus_tag LOCUS_16380 12817 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 13722 14264 gene locus_tag LOCUS_16390 13722 14264 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062684.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence0092 1449 571 gene locus_tag LOCUS_16400 1449 571 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_16400 1594 2901 gene locus_tag LOCUS_16410 1594 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2915 3643 gene locus_tag LOCUS_16420 2915 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3700 4929 gene locus_tag LOCUS_16430 gene pepT 3700 4929 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121359.1 protein_id gnl|my_center|LOCUS_16430 5125 6045 gene locus_tag LOCUS_16440 5125 6045 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328804.1 protein_id gnl|my_center|LOCUS_16440 6173 8365 gene locus_tag LOCUS_16450 6173 8365 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_16450 8381 9832 gene locus_tag LOCUS_16460 8381 9832 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_16460 11029 9839 gene locus_tag LOCUS_16470 11029 9839 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_16470 11979 11167 gene locus_tag LOCUS_16480 11979 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 12443 12015 gene locus_tag LOCUS_16490 12443 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 13975 12548 gene locus_tag LOCUS_16500 13975 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence0093 1325 69 gene locus_tag LOCUS_16510 1325 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2517 1435 gene locus_tag LOCUS_16520 2517 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 4581 2632 gene locus_tag LOCUS_16530 4581 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8187 4795 gene locus_tag LOCUS_16540 8187 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 <14395 8286 gene locus_tag LOCUS_16550 <14395 8286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921453.1:BatA domain-containing protein >Feature sequence0094 594 148 gene locus_tag LOCUS_16560 594 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1329 643 gene locus_tag LOCUS_16570 1329 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2690 1326 gene locus_tag LOCUS_16580 2690 1326 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_16580 5387 2766 gene locus_tag LOCUS_16590 5387 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 6168 5443 gene locus_tag LOCUS_16600 6168 5443 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_16600 6314 6820 gene locus_tag LOCUS_16610 6314 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223324.1 protein_id gnl|my_center|LOCUS_16610 7286 8578 gene locus_tag LOCUS_16620 7286 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 9353 8544 gene locus_tag LOCUS_16630 9353 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 9453 10277 gene locus_tag LOCUS_16640 9453 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 10361 11182 gene locus_tag LOCUS_16650 10361 11182 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258173.1 protein_id gnl|my_center|LOCUS_16650 11644 11195 gene locus_tag LOCUS_16660 11644 11195 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_16660 11927 11667 gene locus_tag LOCUS_16670 11927 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 <14307 11958 gene locus_tag LOCUS_16680 <14307 11958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528058.1:heavy metal translocating P-type ATPase >Feature sequence0095 291 1286 gene locus_tag LOCUS_16690 291 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1415 2053 gene locus_tag LOCUS_16700 1415 2053 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615797.1 protein_id gnl|my_center|LOCUS_16700 2620 2075 gene locus_tag LOCUS_16710 2620 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2717 3718 gene locus_tag LOCUS_16720 gene coxB 2717 3718 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171472.1 protein_id gnl|my_center|LOCUS_16720 3847 5508 gene locus_tag LOCUS_16730 gene ctaD 3847 5508 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533221.1 protein_id gnl|my_center|LOCUS_16730 5688 6332 gene locus_tag LOCUS_16740 5688 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 6336 7178 gene locus_tag LOCUS_16750 6336 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 7175 7882 gene locus_tag LOCUS_16760 7175 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 7986 8579 gene locus_tag LOCUS_16770 7986 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 8686 10143 gene locus_tag LOCUS_16780 8686 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 10140 12413 gene locus_tag LOCUS_16790 10140 12413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 12475 13494 gene locus_tag LOCUS_16800 gene gnd 12475 13494 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence0096 <1 2035 gene locus_tag LOCUS_16810 <1 2035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118002.1:serine/threonine-protein kinase 2032 2523 gene locus_tag LOCUS_16820 2032 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2614 3477 gene locus_tag LOCUS_16830 2614 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 4735 3797 gene locus_tag LOCUS_16840 4735 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6066 4648 gene locus_tag LOCUS_16850 6066 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7229 6189 gene locus_tag LOCUS_16860 7229 6189 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072090.1 protein_id gnl|my_center|LOCUS_16860 7357 7429 gene locus_tag LOCUS_t00160 7357 7429 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8633 7476 gene locus_tag LOCUS_16870 8633 7476 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_16870 8721 8987 gene locus_tag LOCUS_16880 8721 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 9111 9950 gene locus_tag LOCUS_16890 9111 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 10109 11329 gene locus_tag LOCUS_16900 10109 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 11326 11664 gene locus_tag LOCUS_16910 11326 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 12126 12581 gene locus_tag LOCUS_16920 12126 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 12578 12874 gene locus_tag LOCUS_16930 12578 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 12959 13399 gene locus_tag LOCUS_16940 12959 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 13421 13567 gene locus_tag LOCUS_16950 13421 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 13567 13719 gene locus_tag LOCUS_16960 13567 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 13716 13958 gene locus_tag LOCUS_16970 13716 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence0097 688 2139 gene locus_tag LOCUS_16980 688 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2226 3071 gene locus_tag LOCUS_16990 2226 3071 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325558.1 protein_id gnl|my_center|LOCUS_16990 2909 2987 gene locus_tag LOCUS_t00170 2909 2987 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3191 4426 gene locus_tag LOCUS_17000 3191 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4663 6822 gene locus_tag LOCUS_17010 4663 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6960 7784 gene locus_tag LOCUS_17020 6960 7784 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929069.1 protein_id gnl|my_center|LOCUS_17020 8220 7753 gene locus_tag LOCUS_17030 8220 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 8540 8220 gene locus_tag LOCUS_17040 8540 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 9838 8537 gene locus_tag LOCUS_17050 gene hemL 9838 8537 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331929.1 protein_id gnl|my_center|LOCUS_17050 11920 9917 gene locus_tag LOCUS_17060 11920 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 12264 12527 gene locus_tag LOCUS_17070 12264 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence0098 <1 1872 gene locus_tag LOCUS_17080 <1 1872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141077.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase 1869 2852 gene locus_tag LOCUS_17090 1869 2852 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328804.1 protein_id gnl|my_center|LOCUS_17090 2892 3341 gene locus_tag LOCUS_17100 2892 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3607 3371 gene locus_tag LOCUS_17110 3607 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3784 3644 gene locus_tag LOCUS_17120 3784 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 3921 4397 gene locus_tag LOCUS_17130 3921 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 4639 5535 gene locus_tag LOCUS_17140 4639 5535 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_17140 5728 6912 gene locus_tag LOCUS_17150 5728 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 6926 7678 gene locus_tag LOCUS_17160 6926 7678 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120080.1 protein_id gnl|my_center|LOCUS_17160 7671 8843 gene locus_tag LOCUS_17170 7671 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 8863 10257 gene locus_tag LOCUS_17180 8863 10257 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_17180 10479 10246 gene locus_tag LOCUS_17190 10479 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 10724 10512 gene locus_tag LOCUS_17200 10724 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 11022 10834 gene locus_tag LOCUS_17210 11022 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 11467 11090 gene locus_tag LOCUS_17220 11467 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 11699 11505 gene locus_tag LOCUS_17230 11699 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 12175 13263 gene locus_tag LOCUS_17240 gene hcp 12175 13263 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391685.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17240 13188 13484 gene locus_tag LOCUS_17250 13188 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17250 13509 13853 gene locus_tag LOCUS_17260 13509 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence0099 4576 1376 gene locus_tag LOCUS_17270 4576 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5317 4739 gene locus_tag LOCUS_17280 5317 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6840 5767 gene locus_tag LOCUS_17290 6840 5767 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965351.1 protein_id gnl|my_center|LOCUS_17290 7718 7044 gene locus_tag LOCUS_17300 7718 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 8005 9237 gene locus_tag LOCUS_17310 8005 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 9514 10290 gene locus_tag LOCUS_17320 9514 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 10392 11291 gene locus_tag LOCUS_17330 10392 11291 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_17330 12659 11337 gene locus_tag LOCUS_17340 12659 11337 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence0100 1 726 gene locus_tag LOCUS_17350 1 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 900 4454 gene locus_tag LOCUS_17360 900 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4909 4523 gene locus_tag LOCUS_17370 4909 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4981 7461 gene locus_tag LOCUS_17380 4981 7461 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_17380 7516 8832 gene locus_tag LOCUS_17390 7516 8832 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_17390 9197 9442 gene locus_tag LOCUS_17400 9197 9442 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090751.1 protein_id gnl|my_center|LOCUS_17400 10056 9331 gene locus_tag LOCUS_17410 10056 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 10058 11053 gene locus_tag LOCUS_17420 10058 11053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 11527 11213 gene locus_tag LOCUS_17430 11527 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 12127 11669 gene locus_tag LOCUS_17440 12127 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 12328 12537 gene locus_tag LOCUS_17450 12328 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 12542 13456 gene locus_tag LOCUS_17460 12542 13456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 13387 13752 gene locus_tag LOCUS_17470 13387 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 13902 13830 gene locus_tag LOCUS_t00180 13902 13830 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0101 73 1080 gene locus_tag LOCUS_17480 73 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1077 1493 gene locus_tag LOCUS_17490 1077 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1490 2344 gene locus_tag LOCUS_17500 1490 2344 CDS product cyclopropane mycolic acid synthase family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727278.1 protein_id gnl|my_center|LOCUS_17500 2609 3427 gene locus_tag LOCUS_17510 2609 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3625 4761 gene locus_tag LOCUS_17520 3625 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4908 6149 gene locus_tag LOCUS_17530 4908 6149 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_17530 6227 6619 gene locus_tag LOCUS_17540 6227 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6623 7084 gene locus_tag LOCUS_17550 6623 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 7164 7871 gene locus_tag LOCUS_17560 7164 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 7868 8029 gene locus_tag LOCUS_17570 7868 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 8210 8470 gene locus_tag LOCUS_17580 8210 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 8476 8733 gene locus_tag LOCUS_17590 8476 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 8743 8997 gene locus_tag LOCUS_17600 8743 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10356 9007 gene locus_tag LOCUS_17610 10356 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 10414 11073 gene locus_tag LOCUS_17620 10414 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 11111 12040 gene locus_tag LOCUS_17630 11111 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 12037 13311 gene locus_tag LOCUS_17640 gene hemA 12037 13311 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence0102 466 1716 gene locus_tag LOCUS_17650 466 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2066 1857 gene locus_tag LOCUS_17660 2066 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2820 2206 gene locus_tag LOCUS_17670 2820 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4164 3439 gene locus_tag LOCUS_17680 4164 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 4651 4169 gene locus_tag LOCUS_17690 4651 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 6943 4781 gene locus_tag LOCUS_17700 6943 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 7546 6962 gene locus_tag LOCUS_17710 7546 6962 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_17710 7545 7820 gene locus_tag LOCUS_17720 7545 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 7928 8200 gene locus_tag LOCUS_17730 7928 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 9268 9041 gene locus_tag LOCUS_17740 9268 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 9861 9786 gene locus_tag LOCUS_t00190 9861 9786 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10408 9887 gene locus_tag LOCUS_17750 10408 9887 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_17750 10855 10448 gene locus_tag LOCUS_17760 10855 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 11135 10845 gene locus_tag LOCUS_17770 11135 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 11569 11186 gene locus_tag LOCUS_17780 11569 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 11544 11786 gene locus_tag LOCUS_17790 11544 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 11770 12075 gene locus_tag LOCUS_17800 11770 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 <13900 12079 gene locus_tag LOCUS_17810 <13900 12079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123669.1:serine/threonine-protein kinase >Feature sequence0103 910 1482 gene locus_tag LOCUS_17820 910 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1551 3476 gene locus_tag LOCUS_17830 1551 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3518 3820 gene locus_tag LOCUS_17840 3518 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3949 4242 gene locus_tag LOCUS_17850 3949 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4458 4724 gene locus_tag LOCUS_17860 4458 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 4846 5199 gene locus_tag LOCUS_17870 4846 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5249 7246 gene locus_tag LOCUS_17880 5249 7246 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_17880 7549 8040 gene locus_tag LOCUS_17890 7549 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 8555 10573 gene locus_tag LOCUS_17900 8555 10573 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328238.1 protein_id gnl|my_center|LOCUS_17900 11314 10637 gene locus_tag LOCUS_17910 11314 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 12050 11343 gene locus_tag LOCUS_17920 12050 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 <13841 12157 gene locus_tag LOCUS_17930 <13841 12157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140627.1:prolyl oligopeptidase family serine peptidase >Feature sequence0104 714 106 gene locus_tag LOCUS_17940 714 106 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_17940 932 1750 gene locus_tag LOCUS_17950 932 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1876 2697 gene locus_tag LOCUS_17960 1876 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4173 2707 gene locus_tag LOCUS_17970 4173 2707 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_17970 4605 4231 gene locus_tag LOCUS_17980 4605 4231 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_17980 7749 4693 gene locus_tag LOCUS_17990 7749 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 9176 7830 gene locus_tag LOCUS_18000 9176 7830 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_18000 9204 9968 gene locus_tag LOCUS_18010 9204 9968 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921554.1 protein_id gnl|my_center|LOCUS_18010 12131 10008 gene locus_tag LOCUS_18020 gene fusA 12131 10008 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_18020 13557 12142 gene locus_tag LOCUS_18030 13557 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence0105 <1 1343 gene locus_tag LOCUS_18040 <1 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943120.1:sensor histidine kinase KdpD 1348 2037 gene locus_tag LOCUS_18050 gene kdpE 1348 2037 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186103.1 protein_id gnl|my_center|LOCUS_18050 2724 2125 gene locus_tag LOCUS_18060 2724 2125 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_18060 2839 3171 gene locus_tag LOCUS_18070 2839 3171 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879421.1 protein_id gnl|my_center|LOCUS_18070 3225 3407 gene locus_tag LOCUS_18080 3225 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3483 4811 gene locus_tag LOCUS_18090 3483 4811 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 transl_except (pos:3828..3830,aa:Sec) note codon on position 116 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_18090 4913 6574 gene locus_tag LOCUS_18100 4913 6574 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_18100 6682 7488 gene locus_tag LOCUS_18110 6682 7488 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877167.1 protein_id gnl|my_center|LOCUS_18110 7608 8663 gene locus_tag LOCUS_18120 gene selD 7608 8663 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011344950.1 protein_id gnl|my_center|LOCUS_18120 9867 8947 gene locus_tag LOCUS_18130 9867 8947 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_18130 10300 9881 gene locus_tag LOCUS_18140 10300 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 11483 10323 gene locus_tag LOCUS_18150 11483 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 12548 11499 gene locus_tag LOCUS_18160 12548 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence0106 1999 761 gene locus_tag LOCUS_18170 1999 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2170 2583 gene locus_tag LOCUS_18180 2170 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3621 2692 gene locus_tag LOCUS_18190 3621 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_18190 4050 3724 gene locus_tag LOCUS_18200 4050 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5417 4143 gene locus_tag LOCUS_18210 5417 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5641 7740 gene locus_tag LOCUS_18220 5641 7740 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090696.1 protein_id gnl|my_center|LOCUS_18220 8310 7723 gene locus_tag LOCUS_18230 8310 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 8771 8505 gene locus_tag LOCUS_18240 8771 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 9480 9905 gene locus_tag LOCUS_18250 9480 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 10306 10782 gene locus_tag LOCUS_18260 10306 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 10968 11441 gene locus_tag LOCUS_18270 10968 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 11828 11517 gene locus_tag LOCUS_18280 11828 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 12248 12742 gene locus_tag LOCUS_18290 12248 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence0107 63 359 gene locus_tag LOCUS_18300 63 359 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_18300 1616 423 gene locus_tag LOCUS_18310 1616 423 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_18310 3544 1613 gene locus_tag LOCUS_18320 3544 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 5798 3678 gene locus_tag LOCUS_18330 5798 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 6010 6285 gene locus_tag LOCUS_18340 6010 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 6570 8753 gene locus_tag LOCUS_18350 6570 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 8947 10953 gene locus_tag LOCUS_18360 8947 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 10969 11391 gene locus_tag LOCUS_18370 10969 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 11489 12214 gene locus_tag LOCUS_18380 gene flgF 11489 12214 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392318.1 protein_id gnl|my_center|LOCUS_18380 12261 13052 gene locus_tag LOCUS_18390 gene flgG 12261 13052 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082164.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence0108 757 1545 gene locus_tag LOCUS_18400 gene trpC 757 1545 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_18400 1937 1587 gene locus_tag LOCUS_18410 1937 1587 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 protein_id gnl|my_center|LOCUS_18410 2093 2009 gene locus_tag LOCUS_t00200 2093 2009 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2993 2106 gene locus_tag LOCUS_18420 2993 2106 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257492.1 protein_id gnl|my_center|LOCUS_18420 4219 2993 gene locus_tag LOCUS_18430 gene amrB 4219 2993 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_18430 5384 4260 gene locus_tag LOCUS_18440 5384 4260 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257273.1 protein_id gnl|my_center|LOCUS_18440 6886 5417 gene locus_tag LOCUS_18450 6886 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 7880 7059 gene locus_tag LOCUS_18460 7880 7059 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_18460 7957 9231 gene locus_tag LOCUS_18470 7957 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 9251 10243 gene locus_tag LOCUS_18480 9251 10243 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_18480 10240 11163 gene locus_tag LOCUS_18490 10240 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 11174 12007 gene locus_tag LOCUS_18500 gene ricT 11174 12007 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615890.1 protein_id gnl|my_center|LOCUS_18500 12093 12503 gene locus_tag LOCUS_18510 12093 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_18510 12533 13000 gene locus_tag LOCUS_18520 12533 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 13102 13174 gene locus_tag LOCUS_t00210 13102 13174 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13245 13328 gene locus_tag LOCUS_t00220 13245 13328 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0109 2762 345 gene locus_tag LOCUS_18530 2762 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3256 2894 gene locus_tag LOCUS_18540 3256 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3514 3263 gene locus_tag LOCUS_18550 3514 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4038 3613 gene locus_tag LOCUS_18560 4038 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 4301 4035 gene locus_tag LOCUS_18570 4301 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4657 4394 gene locus_tag LOCUS_18580 4657 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 5442 4765 gene locus_tag LOCUS_18590 5442 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 6375 5530 gene locus_tag LOCUS_18600 6375 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 7892 6576 gene locus_tag LOCUS_18610 gene fliI 7892 6576 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_18610 8553 7879 gene locus_tag LOCUS_18620 8553 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 9740 8814 gene locus_tag LOCUS_18630 9740 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 11373 9835 gene locus_tag LOCUS_18640 gene fliF 11373 9835 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_18640 11802 11497 gene locus_tag LOCUS_18650 11802 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 12243 11809 gene locus_tag LOCUS_18660 gene flgC 12243 11809 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081561.1 protein_id gnl|my_center|LOCUS_18660 12709 12329 gene locus_tag LOCUS_18670 gene flgB 12709 12329 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence0110 1812 436 gene locus_tag LOCUS_18680 1812 436 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_18680 2311 1973 gene locus_tag LOCUS_18690 2311 1973 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143541.1 protein_id gnl|my_center|LOCUS_18690 2510 9367 gene locus_tag LOCUS_18700 2510 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 9442 11067 gene locus_tag LOCUS_18710 9442 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 11625 12437 gene locus_tag LOCUS_18720 11625 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 12447 12614 gene locus_tag LOCUS_18730 12447 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 <13446 12709 gene locus_tag LOCUS_18740 <13446 12709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144147.1:ATP-binding protein >Feature sequence0111 1211 657 gene locus_tag LOCUS_18750 1211 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2002 1364 gene locus_tag LOCUS_18760 gene pth 2002 1364 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_18760 2739 2095 gene locus_tag LOCUS_18770 2739 2095 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_18770 5243 2961 gene locus_tag LOCUS_18780 5243 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 6471 5251 gene locus_tag LOCUS_18790 6471 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 7292 6468 gene locus_tag LOCUS_18800 7292 6468 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_18800 8065 7289 gene locus_tag LOCUS_18810 8065 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 8916 8143 gene locus_tag LOCUS_18820 8916 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 9911 8913 gene locus_tag LOCUS_18830 9911 8913 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533625.1 protein_id gnl|my_center|LOCUS_18830 11044 9908 gene locus_tag LOCUS_18840 11044 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 11888 11058 gene locus_tag LOCUS_18850 gene lpxA 11888 11058 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036553.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence0112 5556 6599 gene locus_tag LOCUS_18860 5556 6599 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922674.1 protein_id gnl|my_center|LOCUS_18860 6734 8167 gene locus_tag LOCUS_18870 6734 8167 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122854.1 protein_id gnl|my_center|LOCUS_18870 8489 8815 gene locus_tag LOCUS_18880 8489 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 9211 8750 gene locus_tag LOCUS_18890 9211 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 9313 9732 gene locus_tag LOCUS_18900 9313 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 10039 9701 gene locus_tag LOCUS_18910 10039 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 10317 12416 gene locus_tag LOCUS_18920 gene tkt 10317 12416 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_18920 13268 12507 gene locus_tag LOCUS_18930 13268 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence0113 297 806 gene locus_tag LOCUS_18940 297 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 989 1363 gene locus_tag LOCUS_18950 989 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1383 2225 gene locus_tag LOCUS_18960 1383 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2347 4461 gene locus_tag LOCUS_18970 2347 4461 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_18970 5961 4579 gene locus_tag LOCUS_18980 5961 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_18980 6676 5975 gene locus_tag LOCUS_18990 6676 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 7660 6824 gene locus_tag LOCUS_19000 7660 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 8989 7766 gene locus_tag LOCUS_19010 8989 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 9352 9038 gene locus_tag LOCUS_19020 9352 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 11191 9371 gene locus_tag LOCUS_19030 gene dnaK 11191 9371 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_19030 12103 11330 gene locus_tag LOCUS_19040 12103 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 12387 12100 gene locus_tag LOCUS_19050 12387 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence0114 3145 1226 gene locus_tag LOCUS_19060 3145 1226 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_19060 4324 3215 gene locus_tag LOCUS_19070 4324 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4606 5493 gene locus_tag LOCUS_19080 4606 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19080 5487 5882 gene locus_tag LOCUS_19090 5487 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19090 6276 5893 gene locus_tag LOCUS_19100 6276 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 6662 6273 gene locus_tag LOCUS_19110 6662 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 6661 6855 gene locus_tag LOCUS_19120 6661 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 8606 6822 gene locus_tag LOCUS_19130 8606 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 8769 12779 gene locus_tag LOCUS_19140 8769 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence0115 778 293 gene locus_tag LOCUS_19150 778 293 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388638.1 protein_id gnl|my_center|LOCUS_19150 964 1551 gene locus_tag LOCUS_19160 964 1551 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_19160 2992 1616 gene locus_tag LOCUS_19170 2992 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3966 2995 gene locus_tag LOCUS_19180 3966 2995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_19180 4204 4560 gene locus_tag LOCUS_19190 4204 4560 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338472.1 protein_id gnl|my_center|LOCUS_19190 4931 5398 gene locus_tag LOCUS_19200 4931 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5444 6295 gene locus_tag LOCUS_19210 5444 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 6180 6941 gene locus_tag LOCUS_19220 6180 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 7186 8520 gene locus_tag LOCUS_19230 7186 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 8944 9525 gene locus_tag LOCUS_19240 gene pncA 8944 9525 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338913.1 protein_id gnl|my_center|LOCUS_19240 9975 9517 gene locus_tag LOCUS_19250 9975 9517 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_19250 10193 10945 gene locus_tag LOCUS_19260 10193 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 11054 12256 gene locus_tag LOCUS_19270 11054 12256 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence0116 477 1070 gene locus_tag LOCUS_19280 477 1070 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_19280 1198 2493 gene locus_tag LOCUS_19290 1198 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2586 3632 gene locus_tag LOCUS_19300 2586 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19300 3626 5440 gene locus_tag LOCUS_19310 3626 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19310 11867 5946 gene locus_tag LOCUS_19320 11867 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 12241 11921 gene locus_tag LOCUS_19330 12241 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 13052 12243 gene locus_tag LOCUS_19340 13052 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence0117 1604 1266 gene locus_tag LOCUS_19350 gene sugE1 1604 1266 CDS product quaternary ammonium compound efflux SMR transporter SugE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736027.1 protein_id gnl|my_center|LOCUS_19350 2976 1693 gene locus_tag LOCUS_19360 gene bioF 2976 1693 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_19360 3497 3246 gene locus_tag LOCUS_19370 3497 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 3688 4374 gene locus_tag LOCUS_19380 3688 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4655 5476 gene locus_tag LOCUS_19390 4655 5476 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128919446.1 protein_id gnl|my_center|LOCUS_19390 5489 5779 gene locus_tag LOCUS_19400 5489 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 7130 6135 gene locus_tag LOCUS_19410 7130 6135 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_19410 7633 8508 gene locus_tag LOCUS_19420 7633 8508 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_19420 8992 8558 gene locus_tag LOCUS_19430 8992 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 11545 9209 gene locus_tag LOCUS_19440 11545 9209 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435048.1 protein_id gnl|my_center|LOCUS_19440 12729 11542 gene locus_tag LOCUS_19450 12729 11542 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence0118 238 525 gene locus_tag LOCUS_19460 238 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 723 4610 gene locus_tag LOCUS_19470 723 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19470 4651 5037 gene locus_tag LOCUS_19480 4651 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 5053 5244 gene locus_tag LOCUS_19490 5053 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5556 5984 gene locus_tag LOCUS_19500 5556 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 6104 7006 gene locus_tag LOCUS_19510 6104 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 7090 8556 gene locus_tag LOCUS_19520 7090 8556 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_19520 8582 8884 gene locus_tag LOCUS_19530 8582 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 8881 9105 gene locus_tag LOCUS_19540 8881 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 9114 10046 gene locus_tag LOCUS_19550 9114 10046 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_19550 10216 10632 gene locus_tag LOCUS_19560 10216 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 <13117 10697 gene locus_tag LOCUS_19570 <13117 10697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926964.1:sodium-translocating pyrophosphatase >Feature sequence0119 198 677 gene locus_tag LOCUS_19580 198 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 680 1513 gene locus_tag LOCUS_19590 680 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2022 1516 gene locus_tag LOCUS_19600 2022 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2463 2897 gene locus_tag LOCUS_19610 2463 2897 CDS product S-adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119244.1 protein_id gnl|my_center|LOCUS_19610 2994 5006 gene locus_tag LOCUS_19620 2994 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 5077 5256 gene locus_tag LOCUS_19630 5077 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5256 5480 gene locus_tag LOCUS_19640 5256 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 5548 7062 gene locus_tag LOCUS_19650 5548 7062 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118670.1 protein_id gnl|my_center|LOCUS_19650 7189 7935 gene locus_tag LOCUS_19660 7189 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 8014 8442 gene locus_tag LOCUS_19670 8014 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 8439 8657 gene locus_tag LOCUS_19680 8439 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 8755 8940 gene locus_tag LOCUS_19690 8755 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 8980 10584 gene locus_tag LOCUS_19700 8980 10584 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921438.1 protein_id gnl|my_center|LOCUS_19700 10636 11784 gene locus_tag LOCUS_19710 10636 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_19710 11932 12621 gene locus_tag LOCUS_19720 11932 12621 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence0120 2235 1738 gene locus_tag LOCUS_19730 2235 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2495 2232 gene locus_tag LOCUS_19740 2495 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3859 2561 gene locus_tag LOCUS_19750 3859 2561 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_19750 6362 3945 gene locus_tag LOCUS_19760 6362 3945 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_19760 6980 6426 gene locus_tag LOCUS_19770 6980 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 7266 7021 gene locus_tag LOCUS_19780 7266 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 9781 7304 gene locus_tag LOCUS_19790 9781 7304 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 protein_id gnl|my_center|LOCUS_19790 11267 9927 gene locus_tag LOCUS_19800 11267 9927 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence0121 479 1084 gene locus_tag LOCUS_19810 479 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1091 2203 gene locus_tag LOCUS_19820 1091 2203 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922070.1 protein_id gnl|my_center|LOCUS_19820 2292 2852 gene locus_tag LOCUS_19830 2292 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2941 3816 gene locus_tag LOCUS_19840 2941 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 3813 4682 gene locus_tag LOCUS_19850 3813 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4751 5446 gene locus_tag LOCUS_19860 4751 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 5541 8021 gene locus_tag LOCUS_19870 5541 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 8116 8634 gene locus_tag LOCUS_19880 8116 8634 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727730.1 protein_id gnl|my_center|LOCUS_19880 8644 9309 gene locus_tag LOCUS_19890 8644 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 10733 9288 gene locus_tag LOCUS_19900 10733 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 10717 10956 gene locus_tag LOCUS_19910 10717 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 10977 11705 gene locus_tag LOCUS_19920 10977 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence0122 1405 707 gene locus_tag LOCUS_19930 1405 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2108 1392 gene locus_tag LOCUS_19940 2108 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3117 2053 gene locus_tag LOCUS_19950 3117 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3415 3191 gene locus_tag LOCUS_19960 3415 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4192 3587 gene locus_tag LOCUS_19970 4192 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 6784 4355 gene locus_tag LOCUS_19980 6784 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 7048 8262 gene locus_tag LOCUS_19990 7048 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 9323 8280 gene locus_tag LOCUS_20000 gene xerC 9323 8280 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266244.1 protein_id gnl|my_center|LOCUS_20000 10198 9632 gene locus_tag LOCUS_20010 10198 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 10782 10387 gene locus_tag LOCUS_20020 10782 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 11711 10818 gene locus_tag LOCUS_20030 11711 10818 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_20030 11968 11708 gene locus_tag LOCUS_20040 11968 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 12318 12004 gene locus_tag LOCUS_20050 12318 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 12885 12418 gene locus_tag LOCUS_20060 12885 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence0123 905 1654 gene locus_tag LOCUS_20070 905 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1732 2157 gene locus_tag LOCUS_20080 1732 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2267 2662 gene locus_tag LOCUS_20090 2267 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 4029 2773 gene locus_tag LOCUS_20100 gene lhgO 4029 2773 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_20100 4699 4082 gene locus_tag LOCUS_20110 gene gmhB 4699 4082 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_20110 4998 5999 gene locus_tag LOCUS_20120 4998 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 6248 6036 gene locus_tag LOCUS_20130 6248 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 6499 6248 gene locus_tag LOCUS_20140 6499 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 6671 6513 gene locus_tag LOCUS_20150 6671 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 6883 6683 gene locus_tag LOCUS_20160 6883 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 7118 6891 gene locus_tag LOCUS_20170 7118 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 7713 7243 gene locus_tag LOCUS_20180 7713 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 8108 7770 gene locus_tag LOCUS_20190 8108 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 8490 8149 gene locus_tag LOCUS_20200 8490 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 8774 8541 gene locus_tag LOCUS_20210 8774 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 9080 8778 gene locus_tag LOCUS_20220 9080 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 9747 9112 gene locus_tag LOCUS_20230 9747 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 11174 9747 gene locus_tag LOCUS_20240 11174 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 12048 11248 gene locus_tag LOCUS_20250 12048 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 12275 12045 gene locus_tag LOCUS_20260 12275 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence0124 2296 2679 gene locus_tag LOCUS_20270 2296 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 4293 2938 gene locus_tag LOCUS_20280 4293 2938 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_20280 4782 4354 gene locus_tag LOCUS_20290 4782 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 5003 4779 gene locus_tag LOCUS_20300 5003 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 8230 5198 gene locus_tag LOCUS_20310 8230 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 8400 9584 gene locus_tag LOCUS_20320 8400 9584 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_20320 10527 9574 gene locus_tag LOCUS_20330 gene rarD 10527 9574 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_20330 11650 10520 gene locus_tag LOCUS_20340 11650 10520 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929288.1 protein_id gnl|my_center|LOCUS_20340 12539 11727 gene locus_tag LOCUS_20350 12539 11727 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence0125 213 73 gene locus_tag LOCUS_20360 213 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5197 224 gene locus_tag LOCUS_20370 5197 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 5422 6081 gene locus_tag LOCUS_20380 5422 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 6896 6078 gene locus_tag LOCUS_20390 6896 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20390 7237 6944 gene locus_tag LOCUS_20400 7237 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 7910 7515 gene locus_tag LOCUS_20410 7910 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 12254 7923 gene locus_tag LOCUS_20420 12254 7923 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257092.1 protein_id gnl|my_center|LOCUS_20420 12640 12305 gene locus_tag LOCUS_20430 12640 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence0126 2237 1869 gene locus_tag LOCUS_20440 2237 1869 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 protein_id gnl|my_center|LOCUS_20440 2546 2397 gene locus_tag LOCUS_20450 2546 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2674 3666 gene locus_tag LOCUS_20460 2674 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 4999 3743 gene locus_tag LOCUS_20470 4999 3743 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_20470 6085 5033 gene locus_tag LOCUS_20480 gene rfaE1 6085 5033 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627445.1 protein_id gnl|my_center|LOCUS_20480 6059 6325 gene locus_tag LOCUS_20490 6059 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 7230 6253 gene locus_tag LOCUS_20500 7230 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_20500 7609 7232 gene locus_tag LOCUS_20510 7609 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 7812 7606 gene locus_tag LOCUS_20520 7812 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 8636 7809 gene locus_tag LOCUS_20530 8636 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 8783 10555 gene locus_tag LOCUS_20540 8783 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 10598 11578 gene locus_tag LOCUS_20550 gene miaA 10598 11578 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_20550 11712 12386 gene locus_tag LOCUS_20560 11712 12386 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327679.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence0127 23 691 gene locus_tag LOCUS_20570 23 691 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776485.1 protein_id gnl|my_center|LOCUS_20570 976 707 gene locus_tag LOCUS_20580 976 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1371 973 gene locus_tag LOCUS_20590 1371 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2818 1433 gene locus_tag LOCUS_20600 2818 1433 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_20600 3107 2850 gene locus_tag LOCUS_20610 3107 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3522 3100 gene locus_tag LOCUS_20620 3522 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 4791 3547 gene locus_tag LOCUS_20630 4791 3547 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_20630 6879 4942 gene locus_tag LOCUS_20640 6879 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 7314 6931 gene locus_tag LOCUS_20650 7314 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 8721 7393 gene locus_tag LOCUS_20660 8721 7393 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_20660 10398 8884 gene locus_tag LOCUS_20670 10398 8884 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_20670 11258 10545 gene locus_tag LOCUS_20680 11258 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 11759 11424 gene locus_tag LOCUS_20690 11759 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence0128 382 1503 gene locus_tag LOCUS_20700 382 1503 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_20700 1645 2112 gene locus_tag LOCUS_20710 1645 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2293 2547 gene locus_tag LOCUS_20720 2293 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2544 2945 gene locus_tag LOCUS_20730 2544 2945 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_20730 3694 2996 gene locus_tag LOCUS_20740 3694 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4666 3794 gene locus_tag LOCUS_20750 4666 3794 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_20750 4857 5264 gene locus_tag LOCUS_tm00010 4857 5264 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5773 5414 gene locus_tag LOCUS_20760 5773 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20760 6183 5656 gene locus_tag LOCUS_20770 6183 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 6804 6208 gene locus_tag LOCUS_20780 6804 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 8394 6976 gene locus_tag LOCUS_20790 8394 6976 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_20790 10704 8458 gene locus_tag LOCUS_20800 10704 8458 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666047.1 protein_id gnl|my_center|LOCUS_20800 11661 10768 gene locus_tag LOCUS_20810 11661 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 <12523 11676 gene locus_tag LOCUS_20820 <12523 11676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615995.1:c-type cytochrome >Feature sequence0129 1862 915 gene locus_tag LOCUS_20830 1862 915 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458881.1 protein_id gnl|my_center|LOCUS_20830 1999 2355 gene locus_tag LOCUS_20840 1999 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2468 3769 gene locus_tag LOCUS_20850 gene purD 2468 3769 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_20850 4373 3759 gene locus_tag LOCUS_20860 4373 3759 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_20860 5102 4428 gene locus_tag LOCUS_20870 gene purN 5102 4428 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_20870 5225 9160 gene locus_tag LOCUS_20880 5225 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334944.1 protein_id gnl|my_center|LOCUS_20880 9675 9211 gene locus_tag LOCUS_20890 9675 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 10716 9781 gene locus_tag LOCUS_20900 10716 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 11405 10713 gene locus_tag LOCUS_20910 gene aat 11405 10713 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241673.1 protein_id gnl|my_center|LOCUS_20910 11941 11402 gene locus_tag LOCUS_20920 11941 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence0130 1526 450 gene locus_tag LOCUS_20930 1526 450 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404751.1 protein_id gnl|my_center|LOCUS_20930 2940 1888 gene locus_tag LOCUS_20940 2940 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3860 3120 gene locus_tag LOCUS_20950 3860 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 6948 4003 gene locus_tag LOCUS_20960 6948 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 8335 7046 gene locus_tag LOCUS_20970 gene lysA 8335 7046 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_20970 8776 8339 gene locus_tag LOCUS_20980 8776 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 9087 8782 gene locus_tag LOCUS_20990 9087 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 10500 9115 gene locus_tag LOCUS_21000 gene argH 10500 9115 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 protein_id gnl|my_center|LOCUS_21000 10624 12231 gene locus_tag LOCUS_21010 10624 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence0131 114 797 gene locus_tag LOCUS_21020 114 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1905 829 gene locus_tag LOCUS_21030 1905 829 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_21030 2649 2023 gene locus_tag LOCUS_21040 2649 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2746 3519 gene locus_tag LOCUS_21050 gene ubiE 2746 3519 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_21050 3519 4526 gene locus_tag LOCUS_21060 gene hemE 3519 4526 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056588.1 protein_id gnl|my_center|LOCUS_21060 4651 6150 gene locus_tag LOCUS_21070 4651 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 6215 7030 gene locus_tag LOCUS_21080 6215 7030 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_21080 7172 8560 gene locus_tag LOCUS_21090 7172 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 9801 8581 gene locus_tag LOCUS_21100 gene truD 9801 8581 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393246.1 protein_id gnl|my_center|LOCUS_21100 10638 9838 gene locus_tag LOCUS_21110 10638 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 11225 10875 gene locus_tag LOCUS_21120 11225 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 11569 11180 gene locus_tag LOCUS_21130 11569 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence0132 1702 3489 gene locus_tag LOCUS_21140 1702 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3519 3944 gene locus_tag LOCUS_21150 3519 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 3937 4176 gene locus_tag LOCUS_21160 3937 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 4229 4456 gene locus_tag LOCUS_21170 4229 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 4524 5372 gene locus_tag LOCUS_21180 4524 5372 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_21180 5480 5743 gene locus_tag LOCUS_21190 5480 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 6839 5730 gene locus_tag LOCUS_21200 6839 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 12214 7238 gene locus_tag LOCUS_21210 12214 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence0133 687 91 gene locus_tag LOCUS_21220 687 91 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921290.1 protein_id gnl|my_center|LOCUS_21220 846 1106 gene locus_tag LOCUS_21230 846 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1106 1501 gene locus_tag LOCUS_21240 1106 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 4681 1532 gene locus_tag LOCUS_21250 4681 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 7221 4753 gene locus_tag LOCUS_21260 7221 4753 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_21260 8079 7240 gene locus_tag LOCUS_21270 8079 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 9465 8095 gene locus_tag LOCUS_21280 9465 8095 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_21280 9707 12277 gene locus_tag LOCUS_21290 9707 12277 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence0134 1280 678 gene locus_tag LOCUS_21300 1280 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1914 1483 gene locus_tag LOCUS_21310 1914 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 3212 5278 gene locus_tag LOCUS_21320 3212 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5393 5247 gene locus_tag LOCUS_21330 5393 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 6124 5390 gene locus_tag LOCUS_21340 6124 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 7585 6248 gene locus_tag LOCUS_21350 7585 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 7791 10007 gene locus_tag LOCUS_21360 7791 10007 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_21360 10016 10552 gene locus_tag LOCUS_21370 10016 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 10960 10556 gene locus_tag LOCUS_21380 10960 10556 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_21380 11220 10957 gene locus_tag LOCUS_21390 11220 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 11403 11741 gene locus_tag LOCUS_21400 11403 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence0135 120 665 gene locus_tag LOCUS_21410 120 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1021 662 gene locus_tag LOCUS_21420 1021 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1109 1636 gene locus_tag LOCUS_21430 gene ndhC 1109 1636 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_21430 1633 1890 gene locus_tag LOCUS_21440 1633 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1887 2288 gene locus_tag LOCUS_21450 1887 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2306 2923 gene locus_tag LOCUS_21460 2306 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2920 3453 gene locus_tag LOCUS_21470 2920 3453 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_21470 4101 3460 gene locus_tag LOCUS_21480 4101 3460 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_21480 4243 4446 gene locus_tag LOCUS_21490 4243 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 4554 4766 gene locus_tag LOCUS_21500 4554 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 4967 6430 gene locus_tag LOCUS_21510 4967 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 6316 6636 gene locus_tag LOCUS_21520 6316 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 6679 7977 gene locus_tag LOCUS_21530 gene nuoD 6679 7977 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_21530 8077 8667 gene locus_tag LOCUS_21540 8077 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 9037 8702 gene locus_tag LOCUS_21550 9037 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 9444 9025 gene locus_tag LOCUS_21560 9444 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 11739 9577 gene locus_tag LOCUS_21570 gene fusA 11739 9577 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933845.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence0136 1709 540 gene locus_tag LOCUS_21580 1709 540 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228342.1 protein_id gnl|my_center|LOCUS_21580 2341 1880 gene locus_tag LOCUS_21590 2341 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3764 2436 gene locus_tag LOCUS_21600 3764 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_21600 5216 3783 gene locus_tag LOCUS_21610 5216 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 6733 5210 gene locus_tag LOCUS_21620 gene gcvPB 6733 5210 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121465.1 protein_id gnl|my_center|LOCUS_21620 7507 6737 gene locus_tag LOCUS_21630 7507 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 8304 7504 gene locus_tag LOCUS_21640 8304 7504 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_21640 9696 8332 gene locus_tag LOCUS_21650 gene gcvPA 9696 8332 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331407.1 protein_id gnl|my_center|LOCUS_21650 10459 9719 gene locus_tag LOCUS_21660 10459 9719 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_21660 10876 10472 gene locus_tag LOCUS_21670 gene gcvH 10876 10472 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 protein_id gnl|my_center|LOCUS_21670 11995 10901 gene locus_tag LOCUS_21680 gene gcvT 11995 10901 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121468.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence0137 528 103 gene locus_tag LOCUS_21690 528 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1460 525 gene locus_tag LOCUS_21700 1460 525 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_21700 1628 1981 gene locus_tag LOCUS_21710 1628 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2077 3300 gene locus_tag LOCUS_21720 2077 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3600 3397 gene locus_tag LOCUS_21730 3600 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4554 3625 gene locus_tag LOCUS_21740 4554 3625 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_21740 5324 4812 gene locus_tag LOCUS_21750 5324 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 6486 5446 gene locus_tag LOCUS_21760 6486 5446 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_21760 6925 6503 gene locus_tag LOCUS_21770 6925 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 8963 6930 gene locus_tag LOCUS_21780 8963 6930 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_21780 9127 9552 gene locus_tag LOCUS_21790 9127 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 9564 10010 gene locus_tag LOCUS_21800 9564 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence0138 1453 71 gene locus_tag LOCUS_21810 1453 71 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 protein_id gnl|my_center|LOCUS_21810 1691 2446 gene locus_tag LOCUS_21820 1691 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2708 2466 gene locus_tag LOCUS_21830 2708 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 3636 2794 gene locus_tag LOCUS_21840 3636 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4122 4544 gene locus_tag LOCUS_21850 4122 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 5851 4652 gene locus_tag LOCUS_21860 5851 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 6082 6561 gene locus_tag LOCUS_21870 6082 6561 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_21870 7611 6637 gene locus_tag LOCUS_21880 7611 6637 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_21880 8490 7615 gene locus_tag LOCUS_21890 8490 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 9274 8504 gene locus_tag LOCUS_21900 gene uppS 9274 8504 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328291.1 protein_id gnl|my_center|LOCUS_21900 10690 9392 gene locus_tag LOCUS_21910 10690 9392 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333174.1 protein_id gnl|my_center|LOCUS_21910 11157 10804 gene locus_tag LOCUS_21920 11157 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 11387 11154 gene locus_tag LOCUS_21930 11387 11154 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_21930 11716 11411 gene locus_tag LOCUS_21940 11716 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 12086 11790 gene locus_tag LOCUS_21950 12086 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence0139 1778 2851 gene locus_tag LOCUS_21960 1778 2851 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_21960 2979 4475 gene locus_tag LOCUS_21970 2979 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 4482 5591 gene locus_tag LOCUS_21980 4482 5591 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_21980 5626 6573 gene locus_tag LOCUS_21990 5626 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 6570 7304 gene locus_tag LOCUS_22000 gene nagB 6570 7304 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399383.1 protein_id gnl|my_center|LOCUS_22000 7308 8210 gene locus_tag LOCUS_22010 7308 8210 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_22010 8684 9022 gene locus_tag LOCUS_22020 8684 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 9092 9343 gene locus_tag LOCUS_22030 9092 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 9539 10138 gene locus_tag LOCUS_22040 9539 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 10184 10678 gene locus_tag LOCUS_22050 10184 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 10815 11324 gene locus_tag LOCUS_22060 10815 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence0140 35 1732 gene locus_tag LOCUS_22070 35 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3507 1798 gene locus_tag LOCUS_22080 3507 1798 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922444.1 protein_id gnl|my_center|LOCUS_22080 4590 3568 gene locus_tag LOCUS_22090 gene mutM 4590 3568 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_22090 4573 5772 gene locus_tag LOCUS_22100 gene trpB 4573 5772 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_22100 5782 6240 gene locus_tag LOCUS_22110 5782 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 6237 6806 gene locus_tag LOCUS_22120 6237 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 6853 7545 gene locus_tag LOCUS_22130 6853 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 7986 7552 gene locus_tag LOCUS_22140 7986 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 8455 7970 gene locus_tag LOCUS_22150 8455 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 8546 9001 gene locus_tag LOCUS_22160 8546 9001 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836250.1 protein_id gnl|my_center|LOCUS_22160 10545 9187 gene locus_tag LOCUS_22170 10545 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 11903 10542 gene locus_tag LOCUS_22180 11903 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence0141 16 1161 gene locus_tag LOCUS_22190 gene mqnE 16 1161 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_22190 1237 1914 gene locus_tag LOCUS_22200 1237 1914 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_22200 2704 1925 gene locus_tag LOCUS_22210 2704 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 4024 2906 gene locus_tag LOCUS_22220 4024 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 5094 4081 gene locus_tag LOCUS_22230 5094 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 5562 5308 gene locus_tag LOCUS_22240 5562 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 6377 5562 gene locus_tag LOCUS_22250 6377 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 6655 6443 gene locus_tag LOCUS_22260 6655 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 10720 6953 gene locus_tag LOCUS_22270 10720 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 10174 10261 gene locus_tag LOCUS_t00230 10174 10261 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11848 10991 gene locus_tag LOCUS_22280 gene ada 11848 10991 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence0142 1618 2454 gene locus_tag LOCUS_22290 1618 2454 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_22290 3695 2493 gene locus_tag LOCUS_22300 3695 2493 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_22300 4906 3692 gene locus_tag LOCUS_22310 4906 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 5861 5160 gene locus_tag LOCUS_22320 5861 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 6536 5913 gene locus_tag LOCUS_22330 6536 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 7508 6672 gene locus_tag LOCUS_22340 7508 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 8426 8022 gene locus_tag LOCUS_22350 8426 8022 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_22350 8632 9198 gene locus_tag LOCUS_22360 gene dcd 8632 9198 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256878.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence0143 748 2409 gene locus_tag LOCUS_22370 748 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 5382 2449 gene locus_tag LOCUS_22380 5382 2449 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_22380 6686 5379 gene locus_tag LOCUS_22390 6686 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_22390 6808 8163 gene locus_tag LOCUS_22400 6808 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 8463 8170 gene locus_tag LOCUS_22410 8463 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 9611 8460 gene locus_tag LOCUS_22420 9611 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 <11956 9734 gene locus_tag LOCUS_22430 <11956 9734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144334.1:NB-ARC domain-containing protein >Feature sequence0144 1328 630 gene locus_tag LOCUS_22440 1328 630 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_22440 1430 3004 gene locus_tag LOCUS_22450 1430 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3092 5308 gene locus_tag LOCUS_22460 gene ppk1 3092 5308 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_22460 5740 5312 gene locus_tag LOCUS_22470 5740 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 6683 5778 gene locus_tag LOCUS_22480 6683 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 6948 6718 gene locus_tag LOCUS_22490 6948 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 7519 7295 gene locus_tag LOCUS_22500 7519 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 7855 8541 gene locus_tag LOCUS_22510 7855 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 8670 8963 gene locus_tag LOCUS_22520 8670 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 9036 9272 gene locus_tag LOCUS_22530 9036 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 9756 11018 gene locus_tag LOCUS_22540 gene thrC 9756 11018 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_22540 11081 11353 gene locus_tag LOCUS_22550 11081 11353 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_22550 11357 11737 gene locus_tag LOCUS_22560 11357 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence0145 1034 288 gene locus_tag LOCUS_22570 1034 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1573 2328 gene locus_tag LOCUS_22580 gene aqpZ 1573 2328 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535818.1 protein_id gnl|my_center|LOCUS_22580 2854 2342 gene locus_tag LOCUS_22590 2854 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3880 2981 gene locus_tag LOCUS_22600 3880 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4049 4276 gene locus_tag LOCUS_22610 4049 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 6487 4403 gene locus_tag LOCUS_22620 gene ligA 6487 4403 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122894.1 protein_id gnl|my_center|LOCUS_22620 6905 6636 gene locus_tag LOCUS_22630 6905 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 7261 6932 gene locus_tag LOCUS_22640 7261 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 7827 7381 gene locus_tag LOCUS_22650 gene ndk 7827 7381 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_22650 8026 9621 gene locus_tag LOCUS_22660 8026 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 9630 10070 gene locus_tag LOCUS_22670 9630 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 10315 10109 gene locus_tag LOCUS_22680 10315 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 10220 11356 gene locus_tag LOCUS_22690 10220 11356 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965859.1 protein_id gnl|my_center|LOCUS_22690 11500 11841 gene locus_tag LOCUS_22700 11500 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence0146 <1 1246 gene locus_tag LOCUS_22710 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922339.1:transglutaminaseTgpA domain-containing protein 1243 1830 gene locus_tag LOCUS_22720 1243 1830 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_22720 2072 3256 gene locus_tag LOCUS_22730 2072 3256 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 protein_id gnl|my_center|LOCUS_22730 3265 3855 gene locus_tag LOCUS_22740 3265 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3921 4760 gene locus_tag LOCUS_22750 3921 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 4816 5832 gene locus_tag LOCUS_22760 gene hemB 4816 5832 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_22760 5999 7054 gene locus_tag LOCUS_22770 gene rtcA 5999 7054 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112809.1 protein_id gnl|my_center|LOCUS_22770 7062 7715 gene locus_tag LOCUS_22780 7062 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7712 8863 gene locus_tag LOCUS_22790 7712 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 8903 9475 gene locus_tag LOCUS_22800 8903 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 9582 11804 gene locus_tag LOCUS_22810 9582 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence0147 498 2522 gene locus_tag LOCUS_22820 498 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2765 3097 gene locus_tag LOCUS_22830 2765 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 3294 4163 gene locus_tag LOCUS_22840 3294 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4276 4926 gene locus_tag LOCUS_22850 4276 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 8502 5383 gene locus_tag LOCUS_22860 8502 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22860 10097 9063 gene locus_tag LOCUS_22870 10097 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 10462 11058 gene locus_tag LOCUS_22880 10462 11058 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence0148 476 1504 gene locus_tag LOCUS_22890 476 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2663 1755 gene locus_tag LOCUS_22900 2663 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2847 3686 gene locus_tag LOCUS_22910 2847 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 5312 3801 gene locus_tag LOCUS_22920 5312 3801 CDS product cytochrome C Snr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103259.1 protein_id gnl|my_center|LOCUS_22920 5555 6583 gene locus_tag LOCUS_22930 5555 6583 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082283.1 protein_id gnl|my_center|LOCUS_22930 7737 6661 gene locus_tag LOCUS_22940 7737 6661 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531646.1 protein_id gnl|my_center|LOCUS_22940 7853 9001 gene locus_tag LOCUS_22950 gene pstS 7853 9001 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582618.1 protein_id gnl|my_center|LOCUS_22950 9085 11154 gene locus_tag LOCUS_22960 9085 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence0149 365 1804 gene locus_tag LOCUS_22970 365 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2103 4595 gene locus_tag LOCUS_22980 2103 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6602 4683 gene locus_tag LOCUS_22990 6602 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 6927 6607 gene locus_tag LOCUS_23000 6927 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 7472 7056 gene locus_tag LOCUS_23010 7472 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 7725 7462 gene locus_tag LOCUS_23020 7725 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 10578 7777 gene locus_tag LOCUS_23030 10578 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 11422 10835 gene locus_tag LOCUS_23040 11422 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence0150 35 370 gene locus_tag LOCUS_23050 35 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 770 414 gene locus_tag LOCUS_23060 770 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 881 3055 gene locus_tag LOCUS_23070 881 3055 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_23070 3663 3085 gene locus_tag LOCUS_23080 3663 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4109 3729 gene locus_tag LOCUS_23090 4109 3729 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707451.1 protein_id gnl|my_center|LOCUS_23090 6417 4111 gene locus_tag LOCUS_23100 6417 4111 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992271.1 protein_id gnl|my_center|LOCUS_23100 6630 6427 gene locus_tag LOCUS_23110 6630 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 6944 6654 gene locus_tag LOCUS_23120 6944 6654 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 protein_id gnl|my_center|LOCUS_23120 7090 8346 gene locus_tag LOCUS_23130 7090 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 8501 8836 gene locus_tag LOCUS_23140 8501 8836 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_23140 9244 11127 gene locus_tag LOCUS_23150 9244 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 11586 11161 gene locus_tag LOCUS_23160 11586 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence0151 3028 2099 gene locus_tag LOCUS_23170 3028 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 3843 3025 gene locus_tag LOCUS_23180 3843 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5388 3883 gene locus_tag LOCUS_23190 5388 3883 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_23190 5588 5385 gene locus_tag LOCUS_23200 5588 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 6039 5665 gene locus_tag LOCUS_23210 6039 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 7449 6184 gene locus_tag LOCUS_23220 7449 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_23220 8315 7446 gene locus_tag LOCUS_23230 8315 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 10418 8319 gene locus_tag LOCUS_23240 10418 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 <11713 10567 gene locus_tag LOCUS_23250 <11713 10567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922552.1:TAT-variant-translocated molybdopterin oxidoreductase >Feature sequence0152 3558 49 gene locus_tag LOCUS_23260 gene dnaE 3558 49 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119187.1 protein_id gnl|my_center|LOCUS_23260 4152 3670 gene locus_tag LOCUS_23270 4152 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4294 5127 gene locus_tag LOCUS_23280 4294 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 7770 5134 gene locus_tag LOCUS_23290 7770 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 8379 7804 gene locus_tag LOCUS_23300 8379 7804 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_23300 8598 9158 gene locus_tag LOCUS_23310 8598 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 protein_id gnl|my_center|LOCUS_23310 9462 10205 gene locus_tag LOCUS_23320 9462 10205 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121194.1 protein_id gnl|my_center|LOCUS_23320 10334 10756 gene locus_tag LOCUS_23330 10334 10756 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_23330 10960 11316 gene locus_tag LOCUS_23340 10960 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence0153 726 1715 gene locus_tag LOCUS_23350 726 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121407.1 protein_id gnl|my_center|LOCUS_23350 2032 1796 gene locus_tag LOCUS_23360 2032 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3410 2103 gene locus_tag LOCUS_23370 3410 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 3480 4430 gene locus_tag LOCUS_23380 3480 4430 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921398.1 protein_id gnl|my_center|LOCUS_23380 4476 4958 gene locus_tag LOCUS_23390 4476 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 5083 5649 gene locus_tag LOCUS_23400 5083 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 7334 5772 gene locus_tag LOCUS_23410 7334 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 8677 7484 gene locus_tag LOCUS_23420 8677 7484 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_23420 8902 9774 gene locus_tag LOCUS_23430 8902 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 9789 10517 gene locus_tag LOCUS_23440 9789 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence0154 1320 193 gene locus_tag LOCUS_23450 1320 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2618 1353 gene locus_tag LOCUS_23460 2618 1353 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_23460 3275 2661 gene locus_tag LOCUS_23470 3275 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 4688 3357 gene locus_tag LOCUS_23480 4688 3357 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_23480 5911 4838 gene locus_tag LOCUS_23490 gene wecB 5911 4838 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_23490 7128 5908 gene locus_tag LOCUS_23500 7128 5908 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787334.1 protein_id gnl|my_center|LOCUS_23500 8428 7133 gene locus_tag LOCUS_23510 8428 7133 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748684.1 protein_id gnl|my_center|LOCUS_23510 9990 8515 gene locus_tag LOCUS_23520 9990 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 11330 10014 gene locus_tag LOCUS_23530 11330 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence0155 267 1076 gene locus_tag LOCUS_23540 267 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1216 1704 gene locus_tag LOCUS_23550 gene moaC 1216 1704 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_23550 1761 2759 gene locus_tag LOCUS_23560 1761 2759 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_23560 2872 3588 gene locus_tag LOCUS_23570 2872 3588 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_23570 3687 5795 gene locus_tag LOCUS_23580 3687 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 5838 7295 gene locus_tag LOCUS_23590 5838 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 7766 8827 gene locus_tag LOCUS_23600 7766 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 8837 9061 gene locus_tag LOCUS_23610 8837 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 9121 9741 gene locus_tag LOCUS_23620 9121 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 9734 10153 gene locus_tag LOCUS_23630 9734 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 10775 10131 gene locus_tag LOCUS_23640 10775 10131 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_23640 10999 10926 gene locus_tag LOCUS_t00240 10999 10926 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11450 11079 gene locus_tag LOCUS_23650 11450 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence0156 2252 384 gene locus_tag LOCUS_23660 2252 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2417 2884 gene locus_tag LOCUS_23670 2417 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 4017 2968 gene locus_tag LOCUS_23680 gene ruvB 4017 2968 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331968.1 protein_id gnl|my_center|LOCUS_23680 4515 4129 gene locus_tag LOCUS_23690 4515 4129 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_23690 4709 4512 gene locus_tag LOCUS_23700 4709 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 5485 4715 gene locus_tag LOCUS_23710 5485 4715 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_23710 6286 5612 gene locus_tag LOCUS_23720 6286 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 6699 6355 gene locus_tag LOCUS_23730 6699 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 7080 6703 gene locus_tag LOCUS_23740 7080 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 8616 7084 gene locus_tag LOCUS_23750 gene cysS 8616 7084 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921769.1 protein_id gnl|my_center|LOCUS_23750 9200 8679 gene locus_tag LOCUS_23760 gene ispF 9200 8679 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_23760 9558 10595 gene locus_tag LOCUS_23770 9558 10595 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061140.1 protein_id gnl|my_center|LOCUS_23770 10706 11449 gene locus_tag LOCUS_23780 10706 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence0157 1423 3498 gene locus_tag LOCUS_23790 1423 3498 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_23790 4697 3609 gene locus_tag LOCUS_23800 4697 3609 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948100.1 protein_id gnl|my_center|LOCUS_23800 5502 4780 gene locus_tag LOCUS_23810 5502 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 6690 5527 gene locus_tag LOCUS_23820 6690 5527 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_23820 7430 6708 gene locus_tag LOCUS_23830 7430 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 8309 7494 gene locus_tag LOCUS_23840 8309 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 9145 8375 gene locus_tag LOCUS_23850 9145 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 9916 9179 gene locus_tag LOCUS_23860 9916 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 11379 10030 gene locus_tag LOCUS_23870 11379 10030 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence0158 1028 756 gene locus_tag LOCUS_23880 1028 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 952 2028 gene locus_tag LOCUS_23890 952 2028 CDS product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967100.1 protein_id gnl|my_center|LOCUS_23890 2969 2040 gene locus_tag LOCUS_23900 2969 2040 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_23900 4125 2974 gene locus_tag LOCUS_23910 4125 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 5261 4176 gene locus_tag LOCUS_23920 5261 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 5692 5342 gene locus_tag LOCUS_23930 5692 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 6788 5811 gene locus_tag LOCUS_23940 6788 5811 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_23940 8382 6877 gene locus_tag LOCUS_23950 8382 6877 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_23950 <11484 8812 gene locus_tag LOCUS_23960 <11484 8812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325625.1:pitrilysin family protein >Feature sequence0159 1049 132 gene locus_tag LOCUS_23970 1049 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 3614 1086 gene locus_tag LOCUS_23980 3614 1086 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965877.1 protein_id gnl|my_center|LOCUS_23980 5094 3679 gene locus_tag LOCUS_23990 5094 3679 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112138.1 protein_id gnl|my_center|LOCUS_23990 5397 6656 gene locus_tag LOCUS_24000 5397 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 6845 8194 gene locus_tag LOCUS_24010 6845 8194 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119323.1 protein_id gnl|my_center|LOCUS_24010 11098 8279 gene locus_tag LOCUS_24020 11098 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence0160 <1 2564 gene locus_tag LOCUS_24030 <1 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084771.1:S9 family peptidase 3384 2962 gene locus_tag LOCUS_24040 3384 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3583 3762 gene locus_tag LOCUS_24050 3583 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 4736 3873 gene locus_tag LOCUS_24060 4736 3873 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386997.1 protein_id gnl|my_center|LOCUS_24060 5207 5566 gene locus_tag LOCUS_24070 5207 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5838 7661 gene locus_tag LOCUS_24080 5838 7661 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_24080 8835 7828 gene locus_tag LOCUS_24090 8835 7828 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_24090 8952 9902 gene locus_tag LOCUS_24100 8952 9902 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_24100 <11453 10169 gene locus_tag LOCUS_24110 <11453 10169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921825.1:DUF1552 domain-containing protein >Feature sequence0161 6092 4956 gene locus_tag LOCUS_24120 6092 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 7221 6217 gene locus_tag LOCUS_24130 7221 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 8439 7315 gene locus_tag LOCUS_24140 8439 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 9308 8442 gene locus_tag LOCUS_24150 9308 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 10162 9305 gene locus_tag LOCUS_24160 10162 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 <11379 10309 gene locus_tag LOCUS_24170 <11379 10309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329380.1:type II secretion system F family protein >Feature sequence0162 1797 457 gene locus_tag LOCUS_24180 1797 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2987 1917 gene locus_tag LOCUS_24190 2987 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119567.1 protein_id gnl|my_center|LOCUS_24190 3707 4786 gene locus_tag LOCUS_24200 3707 4786 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24200 5969 5124 gene locus_tag LOCUS_24210 5969 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 6544 8028 gene locus_tag LOCUS_24220 6544 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 8476 8697 gene locus_tag LOCUS_24230 8476 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 8834 8715 gene locus_tag LOCUS_24240 8834 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 8833 9273 gene locus_tag LOCUS_24250 8833 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 9788 10258 gene locus_tag LOCUS_24260 9788 10258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 10768 10598 gene locus_tag LOCUS_24270 10768 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence0163 2722 1565 gene locus_tag LOCUS_24280 2722 1565 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_24280 3879 2839 gene locus_tag LOCUS_24290 3879 2839 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_24290 4095 5486 gene locus_tag LOCUS_24300 4095 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 5862 5539 gene locus_tag LOCUS_24310 5862 5539 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687228.1 protein_id gnl|my_center|LOCUS_24310 6430 5987 gene locus_tag LOCUS_24320 6430 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 6620 6790 gene locus_tag LOCUS_24330 6620 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 6895 7728 gene locus_tag LOCUS_24340 6895 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 7797 8117 gene locus_tag LOCUS_24350 7797 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 8122 8565 gene locus_tag LOCUS_24360 8122 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 9442 8576 gene locus_tag LOCUS_24370 9442 8576 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921895.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence0164 1854 55 gene locus_tag LOCUS_24380 1854 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2594 1977 gene locus_tag LOCUS_24390 2594 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2779 2621 gene locus_tag LOCUS_24400 2779 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3032 4135 gene locus_tag LOCUS_24410 3032 4135 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 protein_id gnl|my_center|LOCUS_24410 5211 4321 gene locus_tag LOCUS_24420 5211 4321 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227725.1 protein_id gnl|my_center|LOCUS_24420 5645 5992 gene locus_tag LOCUS_24430 5645 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 6061 6837 gene locus_tag LOCUS_24440 6061 6837 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_24440 6977 10288 gene locus_tag LOCUS_24450 6977 10288 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404834.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence0165 863 222 gene locus_tag LOCUS_24460 863 222 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_24460 2081 879 gene locus_tag LOCUS_24470 gene sucC 2081 879 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327386.1 protein_id gnl|my_center|LOCUS_24470 2330 5194 gene locus_tag LOCUS_24480 2330 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 5216 5425 gene locus_tag LOCUS_24490 5216 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 5422 5832 gene locus_tag LOCUS_24500 5422 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 5907 6644 gene locus_tag LOCUS_24510 5907 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 6657 7154 gene locus_tag LOCUS_24520 6657 7154 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_24520 7223 8377 gene locus_tag LOCUS_24530 7223 8377 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_24530 8521 8691 gene locus_tag LOCUS_24540 8521 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence0166 135 1862 gene locus_tag LOCUS_24550 135 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1859 2260 gene locus_tag LOCUS_24560 1859 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2277 2450 gene locus_tag LOCUS_24570 2277 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 3739 2447 gene locus_tag LOCUS_24580 3739 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3928 4971 gene locus_tag LOCUS_24590 3928 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 5052 5186 gene locus_tag LOCUS_24600 5052 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5173 5364 gene locus_tag LOCUS_24610 5173 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 5422 5691 gene locus_tag LOCUS_24620 5422 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 5688 6017 gene locus_tag LOCUS_24630 5688 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 6080 7018 gene locus_tag LOCUS_24640 6080 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 7130 7984 gene locus_tag LOCUS_24650 7130 7984 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_24650 8066 8269 gene locus_tag LOCUS_24660 8066 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 9095 8328 gene locus_tag LOCUS_24670 9095 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 10049 10321 gene locus_tag LOCUS_24680 10049 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 10395 10631 gene locus_tag LOCUS_24690 10395 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence0167 <1 963 gene locus_tag LOCUS_24700 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107525.1:proline--tRNA ligase 1199 2011 gene locus_tag LOCUS_24710 1199 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2430 2870 gene locus_tag LOCUS_24720 2430 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2886 3779 gene locus_tag LOCUS_24730 2886 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 4807 3836 gene locus_tag LOCUS_24740 4807 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 5129 6976 gene locus_tag LOCUS_24750 5129 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 7294 7734 gene locus_tag LOCUS_24760 7294 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 7793 9034 gene locus_tag LOCUS_24770 7793 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 8941 9237 gene locus_tag LOCUS_24780 8941 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 9477 10709 gene locus_tag LOCUS_24790 9477 10709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence0168 3 554 gene locus_tag LOCUS_24800 3 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 997 2121 gene locus_tag LOCUS_24810 gene dnaN 997 2121 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_24810 2236 2550 gene locus_tag LOCUS_24820 2236 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2574 2915 gene locus_tag LOCUS_24830 2574 2915 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_24830 2908 3264 gene locus_tag LOCUS_24840 2908 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 3274 5751 gene locus_tag LOCUS_24850 3274 5751 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 protein_id gnl|my_center|LOCUS_24850 6465 5803 gene locus_tag LOCUS_24860 6465 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615698.1 protein_id gnl|my_center|LOCUS_24860 7468 6491 gene locus_tag LOCUS_24870 gene nadA 7468 6491 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_24870 7890 7573 gene locus_tag LOCUS_24880 7890 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 9940 7892 gene locus_tag LOCUS_24890 9940 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 10063 10968 gene locus_tag LOCUS_24900 gene rsmH 10063 10968 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence0169 961 233 gene locus_tag LOCUS_24910 961 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3249 955 gene locus_tag LOCUS_24920 3249 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 4174 3314 gene locus_tag LOCUS_24930 gene xrt 4174 3314 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_24930 4143 4409 gene locus_tag LOCUS_24940 4143 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 5797 4508 gene locus_tag LOCUS_24950 gene fabF 5797 4508 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_24950 6286 8472 gene locus_tag LOCUS_24960 6286 8472 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921569.1 protein_id gnl|my_center|LOCUS_24960 8579 9142 gene locus_tag LOCUS_24970 8579 9142 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_24970 9378 10454 gene locus_tag LOCUS_24980 gene floA 9378 10454 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence0170 1122 1976 gene locus_tag LOCUS_24990 1122 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 1979 2830 gene locus_tag LOCUS_25000 1979 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2991 3314 gene locus_tag LOCUS_25010 2991 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 3318 3602 gene locus_tag LOCUS_25020 3318 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 4061 3714 gene locus_tag LOCUS_25030 4061 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 6851 4323 gene locus_tag LOCUS_25040 6851 4323 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815631.1 protein_id gnl|my_center|LOCUS_25040 10004 7020 gene locus_tag LOCUS_25050 gene purL 10004 7020 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_25050 10830 9988 gene locus_tag LOCUS_25060 10830 9988 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence0171 <1 928 gene locus_tag LOCUS_25070 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144210.1:type I polyketide synthase 1074 853 gene locus_tag LOCUS_25080 1074 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1055 7906 gene locus_tag LOCUS_25090 1055 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 7966 9165 gene locus_tag LOCUS_25100 7966 9165 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_25100 9193 10167 gene locus_tag LOCUS_25110 9193 10167 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence0172 154 1137 gene locus_tag LOCUS_25120 154 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 1121 1582 gene locus_tag LOCUS_25130 1121 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1804 2490 gene locus_tag LOCUS_25140 1804 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25140 4614 2497 gene locus_tag LOCUS_25150 4614 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence0173 <1 734 gene locus_tag LOCUS_25160 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259340.1:response regulator 1540 812 gene locus_tag LOCUS_25170 1540 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1870 1568 gene locus_tag LOCUS_25180 1870 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2036 3250 gene locus_tag LOCUS_25190 2036 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3937 3266 gene locus_tag LOCUS_25200 gene rpe 3937 3266 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_25200 5146 4067 gene locus_tag LOCUS_25210 5146 4067 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187814.1 protein_id gnl|my_center|LOCUS_25210 6006 5284 gene locus_tag LOCUS_25220 6006 5284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525001.1 protein_id gnl|my_center|LOCUS_25220 7255 6104 gene locus_tag LOCUS_25230 7255 6104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_25230 7905 7252 gene locus_tag LOCUS_25240 7905 7252 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_25240 8035 8346 gene locus_tag LOCUS_25250 8035 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence0174 <1 1226 gene locus_tag LOCUS_25260 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907467.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1258 1725 gene locus_tag LOCUS_25270 1258 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1614 2081 gene locus_tag LOCUS_25280 1614 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2402 2124 gene locus_tag LOCUS_25290 2402 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2534 2890 gene locus_tag LOCUS_25300 2534 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 2897 3628 gene locus_tag LOCUS_25310 2897 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25310 3556 3903 gene locus_tag LOCUS_25320 3556 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3900 4772 gene locus_tag LOCUS_25330 3900 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 5028 4804 gene locus_tag LOCUS_25340 5028 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 6321 5044 gene locus_tag LOCUS_25350 6321 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 7565 6318 gene locus_tag LOCUS_25360 7565 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 8929 7562 gene locus_tag LOCUS_25370 8929 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence0175 2938 380 gene locus_tag LOCUS_25380 2938 380 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_25380 4951 3071 gene locus_tag LOCUS_25390 4951 3071 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121419.1 protein_id gnl|my_center|LOCUS_25390 5939 5058 gene locus_tag LOCUS_25400 5939 5058 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121418.1 protein_id gnl|my_center|LOCUS_25400 6437 6000 gene locus_tag LOCUS_25410 6437 6000 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_25410 7460 6450 gene locus_tag LOCUS_25420 7460 6450 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922072.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence0176 1394 636 gene locus_tag LOCUS_25430 1394 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2781 1408 gene locus_tag LOCUS_25440 gene nuoF 2781 1408 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_25440 3272 2793 gene locus_tag LOCUS_25450 gene nuoE 3272 2793 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967798.1 protein_id gnl|my_center|LOCUS_25450 4621 3395 gene locus_tag LOCUS_25460 gene nuoD 4621 3395 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969257.1 protein_id gnl|my_center|LOCUS_25460 5237 4731 gene locus_tag LOCUS_25470 5237 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 5943 5344 gene locus_tag LOCUS_25480 5943 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 6377 5934 gene locus_tag LOCUS_25490 6377 5934 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_25490 7357 6524 gene locus_tag LOCUS_25500 7357 6524 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_25500 8083 7388 gene locus_tag LOCUS_25510 8083 7388 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_25510 9162 8125 gene locus_tag LOCUS_25520 9162 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 10148 9228 gene locus_tag LOCUS_25530 10148 9228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence0177 80 1432 gene locus_tag LOCUS_25540 80 1432 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_25540 2186 1476 gene locus_tag LOCUS_25550 2186 1476 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_25550 3670 2183 gene locus_tag LOCUS_25560 3670 2183 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296108.1 protein_id gnl|my_center|LOCUS_25560 4655 3801 gene locus_tag LOCUS_25570 gene purU 4655 3801 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933485.1 protein_id gnl|my_center|LOCUS_25570 4827 7805 gene locus_tag LOCUS_25580 4827 7805 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_25580 8027 9265 gene locus_tag LOCUS_25590 8027 9265 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_25590 9520 10518 gene locus_tag LOCUS_25600 gene mch 9520 10518 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145084390.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence0178 1494 85 gene locus_tag LOCUS_25610 1494 85 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_25610 4607 1626 gene locus_tag LOCUS_25620 4607 1626 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_25620 6553 4670 gene locus_tag LOCUS_25630 6553 4670 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_25630 7586 6624 gene locus_tag LOCUS_25640 7586 6624 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_25640 7641 9020 gene locus_tag LOCUS_25650 7641 9020 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_25650 9067 9510 gene locus_tag LOCUS_25660 9067 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 10528 9641 gene locus_tag LOCUS_25670 10528 9641 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence0179 5483 678 gene locus_tag LOCUS_25680 5483 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 5893 7359 gene locus_tag LOCUS_25690 5893 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 7752 9584 gene locus_tag LOCUS_25700 7752 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 10529 10143 gene locus_tag LOCUS_25710 10529 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence0180 244 768 gene locus_tag LOCUS_25720 244 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25720 1627 2079 gene locus_tag LOCUS_25730 1627 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2241 2480 gene locus_tag LOCUS_25740 2241 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2677 3777 gene locus_tag LOCUS_25750 2677 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3767 5254 gene locus_tag LOCUS_25760 3767 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 5279 5989 gene locus_tag LOCUS_25770 5279 5989 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_25770 5986 6342 gene locus_tag LOCUS_25780 5986 6342 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405530.1 protein_id gnl|my_center|LOCUS_25780 6393 7778 gene locus_tag LOCUS_25790 6393 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 7802 8032 gene locus_tag LOCUS_25800 7802 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 8350 9204 gene locus_tag LOCUS_25810 8350 9204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 9225 9707 gene locus_tag LOCUS_25820 9225 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence0181 585 1454 gene locus_tag LOCUS_25830 585 1454 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582623.1 protein_id gnl|my_center|LOCUS_25830 1682 2197 gene locus_tag LOCUS_25840 1682 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2212 2709 gene locus_tag LOCUS_25850 2212 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2759 2833 gene locus_tag LOCUS_t00250 2759 2833 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3497 2883 gene locus_tag LOCUS_25860 3497 2883 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_25860 3576 4637 gene locus_tag LOCUS_25870 3576 4637 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_25870 4634 6289 gene locus_tag LOCUS_25880 4634 6289 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_25880 6388 6867 gene locus_tag LOCUS_25890 6388 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 7639 6872 gene locus_tag LOCUS_25900 7639 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975431.1 protein_id gnl|my_center|LOCUS_25900 8443 7664 gene locus_tag LOCUS_25910 8443 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 8550 9449 gene locus_tag LOCUS_25920 8550 9449 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_25920 9743 10567 gene locus_tag LOCUS_25930 9743 10567 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909160.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence0182 122 982 gene locus_tag LOCUS_25940 122 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1020 1469 gene locus_tag LOCUS_25950 1020 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1474 1956 gene locus_tag LOCUS_25960 1474 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1972 2838 gene locus_tag LOCUS_25970 1972 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2844 3932 gene locus_tag LOCUS_25980 2844 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 4680 4066 gene locus_tag LOCUS_25990 4680 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 5489 4893 gene locus_tag LOCUS_26000 5489 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 6157 5576 gene locus_tag LOCUS_26010 6157 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 7545 6235 gene locus_tag LOCUS_26020 7545 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 7697 8926 gene locus_tag LOCUS_26030 7697 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 9108 9614 gene locus_tag LOCUS_26040 gene ilvN 9108 9614 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_26040 9683 9991 gene locus_tag LOCUS_26050 9683 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 10472 10026 gene locus_tag LOCUS_26060 10472 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence0183 1508 684 gene locus_tag LOCUS_26070 1508 684 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_26070 3074 1614 gene locus_tag LOCUS_26080 3074 1614 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_26080 4679 3264 gene locus_tag LOCUS_26090 gene lpdA 4679 3264 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271667.1 protein_id gnl|my_center|LOCUS_26090 6049 4787 gene locus_tag LOCUS_26100 gene odhB 6049 4787 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943087.1 protein_id gnl|my_center|LOCUS_26100 9147 6226 gene locus_tag LOCUS_26110 9147 6226 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_26110 10487 9276 gene locus_tag LOCUS_26120 10487 9276 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence0184 3 884 gene locus_tag LOCUS_26130 3 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1605 958 gene locus_tag LOCUS_26140 1605 958 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922815.1 protein_id gnl|my_center|LOCUS_26140 1719 2066 gene locus_tag LOCUS_26150 1719 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 5455 2114 gene locus_tag LOCUS_26160 gene carB 5455 2114 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123580.1 protein_id gnl|my_center|LOCUS_26160 5610 6161 gene locus_tag LOCUS_26170 5610 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 7302 6088 gene locus_tag LOCUS_26180 7302 6088 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_26180 7371 7766 gene locus_tag LOCUS_26190 7371 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 7830 8663 gene locus_tag LOCUS_26200 7830 8663 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_26200 9407 8694 gene locus_tag LOCUS_26210 9407 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence0185 1193 222 gene locus_tag LOCUS_26220 1193 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 1395 2849 gene locus_tag LOCUS_26230 1395 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2849 4198 gene locus_tag LOCUS_26240 2849 4198 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_26240 4253 5038 gene locus_tag LOCUS_26250 4253 5038 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_26250 5695 5162 gene locus_tag LOCUS_26260 5695 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 6171 5692 gene locus_tag LOCUS_26270 6171 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 7663 6212 gene locus_tag LOCUS_26280 7663 6212 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_26280 7820 10228 gene locus_tag LOCUS_26290 7820 10228 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121337.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence0186 758 1870 gene locus_tag LOCUS_26300 758 1870 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392163.1 protein_id gnl|my_center|LOCUS_26300 2017 2229 gene locus_tag LOCUS_26310 2017 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2353 4617 gene locus_tag LOCUS_26320 2353 4617 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921460.1 protein_id gnl|my_center|LOCUS_26320 4621 5394 gene locus_tag LOCUS_26330 4621 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 5426 6265 gene locus_tag LOCUS_26340 5426 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 6304 7701 gene locus_tag LOCUS_26350 6304 7701 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123058.1 protein_id gnl|my_center|LOCUS_26350 7810 9852 gene locus_tag LOCUS_26360 7810 9852 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444445.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence0187 <1 690 gene locus_tag LOCUS_26370 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869672.1:YebC/PmpR family DNA-binding transcriptional regulator 1475 765 gene locus_tag LOCUS_26380 1475 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1808 3232 gene locus_tag LOCUS_26390 1808 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3402 3731 gene locus_tag LOCUS_26400 3402 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 5162 3846 gene locus_tag LOCUS_26410 5162 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 5682 5326 gene locus_tag LOCUS_26420 5682 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 5930 6640 gene locus_tag LOCUS_26430 5930 6640 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_26430 7510 6653 gene locus_tag LOCUS_26440 7510 6653 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_26440 8647 7547 gene locus_tag LOCUS_26450 gene mnmE 8647 7547 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938378.1 protein_id gnl|my_center|LOCUS_26450 9390 8644 gene locus_tag LOCUS_26460 9390 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 10441 9380 gene locus_tag LOCUS_26470 gene obgE 10441 9380 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324342.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence0188 5288 4950 gene locus_tag LOCUS_26480 5288 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 5695 5276 gene locus_tag LOCUS_26490 5695 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 5809 7473 gene locus_tag LOCUS_26500 5809 7473 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_26500 7810 7475 gene locus_tag LOCUS_26510 7810 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 8217 7798 gene locus_tag LOCUS_26520 8217 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 9240 8287 gene locus_tag LOCUS_26530 9240 8287 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence0189 1087 2187 gene locus_tag LOCUS_26540 gene purM 1087 2187 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_26540 2202 2537 gene locus_tag LOCUS_26550 2202 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 3321 2548 gene locus_tag LOCUS_26560 gene flgG 3321 2548 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880505.1 protein_id gnl|my_center|LOCUS_26560 4271 3429 gene locus_tag LOCUS_26570 4271 3429 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_26570 5034 4306 gene locus_tag LOCUS_26580 5034 4306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_26580 5825 5064 gene locus_tag LOCUS_26590 5825 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 6015 8243 gene locus_tag LOCUS_26600 6015 8243 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224556.1 protein_id gnl|my_center|LOCUS_26600 8495 8944 gene locus_tag LOCUS_26610 gene tnpA 8495 8944 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_26610 9227 10321 gene locus_tag LOCUS_26620 9227 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence0190 1481 105 gene locus_tag LOCUS_26630 1481 105 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_26630 1767 3077 gene locus_tag LOCUS_26640 1767 3077 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_26640 4301 3243 gene locus_tag LOCUS_26650 4301 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 5050 4310 gene locus_tag LOCUS_26660 5050 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 5152 5556 gene locus_tag LOCUS_26670 5152 5556 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_26670 5609 6298 gene locus_tag LOCUS_26680 5609 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 7227 6295 gene locus_tag LOCUS_26690 7227 6295 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_26690 8549 7587 gene locus_tag LOCUS_26700 8549 7587 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119630.1 protein_id gnl|my_center|LOCUS_26700 8618 9412 gene locus_tag LOCUS_26710 8618 9412 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_26710 10349 9474 gene locus_tag LOCUS_26720 10349 9474 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence0191 1493 1119 gene locus_tag LOCUS_26730 1493 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1862 1500 gene locus_tag LOCUS_26740 1862 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 1957 2997 gene locus_tag LOCUS_26750 1957 2997 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_26750 3019 3615 gene locus_tag LOCUS_26760 3019 3615 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_26760 4514 3708 gene locus_tag LOCUS_26770 gene speB 4514 3708 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_26770 4983 4531 gene locus_tag LOCUS_26780 4983 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 5083 5391 gene locus_tag LOCUS_26790 5083 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 6439 5441 gene locus_tag LOCUS_26800 6439 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 6670 9495 gene locus_tag LOCUS_26810 6670 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 10166 9540 gene locus_tag LOCUS_26820 10166 9540 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence0192 <1 4098 gene locus_tag LOCUS_26830 <1 4098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404926.1:T9SS type A sorting domain-containing protein 4165 5871 gene locus_tag LOCUS_26840 4165 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 6449 5904 gene locus_tag LOCUS_26850 6449 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 7279 6446 gene locus_tag LOCUS_26860 7279 6446 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_26860 8262 7378 gene locus_tag LOCUS_26870 8262 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 8745 8314 gene locus_tag LOCUS_26880 8745 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence0193 <1 2505 gene locus_tag LOCUS_26890 <1 2505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259099.1:glutamate synthase large subunit 3409 3014 gene locus_tag LOCUS_26900 3409 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 4003 3701 gene locus_tag LOCUS_26910 4003 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 4041 4424 gene locus_tag LOCUS_26920 4041 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 4597 5004 gene locus_tag LOCUS_26930 4597 5004 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967708.1 protein_id gnl|my_center|LOCUS_26930 6324 5101 gene locus_tag LOCUS_26940 6324 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 6463 7578 gene locus_tag LOCUS_26950 6463 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 7683 9782 gene locus_tag LOCUS_26960 7683 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 10387 9875 gene locus_tag LOCUS_26970 10387 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence0194 415 1137 gene locus_tag LOCUS_26980 415 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2448 1186 gene locus_tag LOCUS_26990 gene metK 2448 1186 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225644.1 protein_id gnl|my_center|LOCUS_26990 3665 2778 gene locus_tag LOCUS_27000 3665 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 5065 3890 gene locus_tag LOCUS_27010 5065 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 5141 5350 gene locus_tag LOCUS_27020 5141 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 6291 5440 gene locus_tag LOCUS_27030 6291 5440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258883.1 protein_id gnl|my_center|LOCUS_27030 10003 6416 gene locus_tag LOCUS_27040 gene metH 10003 6416 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140480.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence0195 695 2773 gene locus_tag LOCUS_27050 695 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2961 4430 gene locus_tag LOCUS_27060 2961 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 4367 5605 gene locus_tag LOCUS_27070 4367 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 5742 7724 gene locus_tag LOCUS_27080 5742 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence0196 96 569 gene locus_tag LOCUS_27090 96 569 CDS product DUF1569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338801.1 protein_id gnl|my_center|LOCUS_27090 612 2084 gene locus_tag LOCUS_27100 gene atpD 612 2084 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_27100 2221 2724 gene locus_tag LOCUS_27110 2221 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2804 3127 gene locus_tag LOCUS_27120 2804 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3415 3071 gene locus_tag LOCUS_27130 3415 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 3633 3412 gene locus_tag LOCUS_27140 3633 3412 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_27140 4483 3788 gene locus_tag LOCUS_27150 4483 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 6471 4600 gene locus_tag LOCUS_27160 6471 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 8911 6563 gene locus_tag LOCUS_27170 8911 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 9205 8915 gene locus_tag LOCUS_27180 9205 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 9524 9210 gene locus_tag LOCUS_27190 gene nuoK 9524 9210 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_27190 10042 9521 gene locus_tag LOCUS_27200 10042 9521 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence0197 2635 1796 gene locus_tag LOCUS_27210 gene kdsA 2635 1796 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_27210 3097 2753 gene locus_tag LOCUS_27220 3097 2753 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119951.1 protein_id gnl|my_center|LOCUS_27220 3335 4954 gene locus_tag LOCUS_27230 3335 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 5090 6628 gene locus_tag LOCUS_27240 5090 6628 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228658.1 protein_id gnl|my_center|LOCUS_27240 6835 7263 gene locus_tag LOCUS_27250 6835 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 7313 8173 gene locus_tag LOCUS_27260 7313 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 8273 9580 gene locus_tag LOCUS_27270 8273 9580 CDS product Trx7/PDZ domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922213.1 protein_id gnl|my_center|LOCUS_27270 >Feature sequence0198 2030 546 gene locus_tag LOCUS_27280 2030 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 2287 2027 gene locus_tag LOCUS_27290 2287 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2743 2297 gene locus_tag LOCUS_27300 2743 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3470 3279 gene locus_tag LOCUS_27310 3470 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 4873 3521 gene locus_tag LOCUS_27320 4873 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_27320 5551 4889 gene locus_tag LOCUS_27330 5551 4889 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_27330 6556 5612 gene locus_tag LOCUS_27340 6556 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 7029 7424 gene locus_tag LOCUS_27350 7029 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 8017 7550 gene locus_tag LOCUS_27360 8017 7550 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_27360 9354 8203 gene locus_tag LOCUS_27370 9354 8203 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726684.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence0199 1296 7151 gene locus_tag LOCUS_27380 1296 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 7507 8790 gene locus_tag LOCUS_27390 7507 8790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 8896 9162 gene locus_tag LOCUS_27400 gene rpmA 8896 9162 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence0200 2325 943 gene locus_tag LOCUS_27410 2325 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 3912 2356 gene locus_tag LOCUS_27420 gene miaB 3912 2356 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_27420 4548 3955 gene locus_tag LOCUS_27430 4548 3955 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_27430 6122 4611 gene locus_tag LOCUS_27440 6122 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7161 6172 gene locus_tag LOCUS_27450 gene fmt 7161 6172 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_27450 7804 7253 gene locus_tag LOCUS_27460 gene def 7804 7253 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324462.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence0201 1506 904 gene locus_tag LOCUS_27470 1506 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 1804 3624 gene locus_tag LOCUS_27480 1804 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 5799 4180 gene locus_tag LOCUS_27490 5799 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 5955 6704 gene locus_tag LOCUS_27500 5955 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 6679 7581 gene locus_tag LOCUS_27510 gene lipA 6679 7581 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_27510 7574 7819 gene locus_tag LOCUS_27520 7574 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 7939 8586 gene locus_tag LOCUS_27530 7939 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 8590 9609 gene locus_tag LOCUS_27540 8590 9609 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence0202 521 72 gene locus_tag LOCUS_27550 521 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1363 542 gene locus_tag LOCUS_27560 1363 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2187 1432 gene locus_tag LOCUS_27570 2187 1432 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928498.1 protein_id gnl|my_center|LOCUS_27570 3721 2273 gene locus_tag LOCUS_27580 3721 2273 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230428.1 protein_id gnl|my_center|LOCUS_27580 4440 3760 gene locus_tag LOCUS_27590 4440 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 4727 5773 gene locus_tag LOCUS_27600 4727 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 5958 6686 gene locus_tag LOCUS_27610 5958 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 7701 6928 gene locus_tag LOCUS_27620 7701 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 <10191 7747 gene locus_tag LOCUS_27630 <10191 7747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928885.1:tetratricopeptide repeat protein >Feature sequence0203 512 733 gene locus_tag LOCUS_27640 512 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672712.1 protein_id gnl|my_center|LOCUS_27640 4532 840 gene locus_tag LOCUS_27650 4532 840 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813379.1 protein_id gnl|my_center|LOCUS_27650 4785 4858 gene locus_tag LOCUS_t00260 4785 4858 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4983 5813 gene locus_tag LOCUS_27660 4983 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27660 6092 6439 gene locus_tag LOCUS_27670 6092 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 6625 6900 gene locus_tag LOCUS_27680 6625 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 7623 7898 gene locus_tag LOCUS_27690 7623 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 8138 7917 gene locus_tag LOCUS_27700 8138 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence0204 1659 1339 gene locus_tag LOCUS_27710 gene groES 1659 1339 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_27710 3524 1815 gene locus_tag LOCUS_27720 gene groL 3524 1815 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_27720 3935 5815 gene locus_tag LOCUS_27730 3935 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 6736 5825 gene locus_tag LOCUS_27740 6736 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 7494 6862 gene locus_tag LOCUS_27750 7494 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 7838 7491 gene locus_tag LOCUS_27760 7838 7491 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 protein_id gnl|my_center|LOCUS_27760 8173 7841 gene locus_tag LOCUS_27770 8173 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 9691 8204 gene locus_tag LOCUS_27780 9691 8204 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence0205 1489 38 gene locus_tag LOCUS_27790 1489 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2691 1672 gene locus_tag LOCUS_27800 2691 1672 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463394.1 protein_id gnl|my_center|LOCUS_27800 2865 4643 gene locus_tag LOCUS_27810 2865 4643 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494117.1 protein_id gnl|my_center|LOCUS_27810 4782 5135 gene locus_tag LOCUS_27820 4782 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 5181 6239 gene locus_tag LOCUS_27830 5181 6239 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975400.1 protein_id gnl|my_center|LOCUS_27830 6367 7653 gene locus_tag LOCUS_27840 6367 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 7661 8071 gene locus_tag LOCUS_27850 7661 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 <10059 8456 gene locus_tag LOCUS_27860 <10059 8456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081461260.1:PAS domain S-box protein >Feature sequence0206 1420 167 gene locus_tag LOCUS_27870 1420 167 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_27870 1687 1553 gene locus_tag LOCUS_27880 1687 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 1861 1691 gene locus_tag LOCUS_27890 1861 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 3165 1885 gene locus_tag LOCUS_27900 3165 1885 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228554.1 protein_id gnl|my_center|LOCUS_27900 3816 3184 gene locus_tag LOCUS_27910 3816 3184 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008654974.1 protein_id gnl|my_center|LOCUS_27910 5143 3860 gene locus_tag LOCUS_27920 5143 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 5931 5176 gene locus_tag LOCUS_27930 5931 5176 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_27930 7314 6073 gene locus_tag LOCUS_27940 7314 6073 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_27940 7849 7391 gene locus_tag LOCUS_27950 7849 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 8628 7849 gene locus_tag LOCUS_27960 8628 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence0207 3367 44 gene locus_tag LOCUS_27970 3367 44 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928965.1 protein_id gnl|my_center|LOCUS_27970 5141 3381 gene locus_tag LOCUS_27980 5141 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 5759 6034 gene locus_tag LOCUS_27990 5759 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 6251 6039 gene locus_tag LOCUS_28000 6251 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 6679 6416 gene locus_tag LOCUS_28010 6679 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28010 7041 6763 gene locus_tag LOCUS_28020 7041 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 7183 8937 gene locus_tag LOCUS_28030 7183 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 9056 9712 gene locus_tag LOCUS_28040 9056 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28040 >Feature sequence0208 1525 563 gene locus_tag LOCUS_28050 1525 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 4735 1616 gene locus_tag LOCUS_28060 4735 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 5154 5936 gene locus_tag LOCUS_28070 5154 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28070 5939 6307 gene locus_tag LOCUS_28080 5939 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence0209 1455 979 gene locus_tag LOCUS_28090 1455 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1701 2525 gene locus_tag LOCUS_28100 1701 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 3071 2718 gene locus_tag LOCUS_28110 3071 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3871 3125 gene locus_tag LOCUS_28120 3871 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 4389 4015 gene locus_tag LOCUS_28130 4389 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 5382 4633 gene locus_tag LOCUS_28140 5382 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 6807 6091 gene locus_tag LOCUS_28150 6807 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 7073 6858 gene locus_tag LOCUS_28160 7073 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 7322 7113 gene locus_tag LOCUS_28170 7322 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 7765 7478 gene locus_tag LOCUS_28180 7765 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 8646 7810 gene locus_tag LOCUS_28190 8646 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 9134 8643 gene locus_tag LOCUS_28200 9134 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28200 9412 9131 gene locus_tag LOCUS_28210 9412 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 9815 9483 gene locus_tag LOCUS_28220 9815 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence0210 1067 537 gene locus_tag LOCUS_28230 1067 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1423 1064 gene locus_tag LOCUS_28240 1423 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 2130 1444 gene locus_tag LOCUS_28250 2130 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3475 2168 gene locus_tag LOCUS_28260 3475 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 5706 3571 gene locus_tag LOCUS_28270 5706 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 6341 5757 gene locus_tag LOCUS_28280 6341 5757 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922102.1 protein_id gnl|my_center|LOCUS_28280 6970 6392 gene locus_tag LOCUS_28290 6970 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 7593 6967 gene locus_tag LOCUS_28300 7593 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 8119 7607 gene locus_tag LOCUS_28310 8119 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 8444 8151 gene locus_tag LOCUS_28320 8444 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_28320 9052 8441 gene locus_tag LOCUS_28330 9052 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 9486 9121 gene locus_tag LOCUS_28340 9486 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence0211 94 1377 gene locus_tag LOCUS_28350 94 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_28350 1527 3161 gene locus_tag LOCUS_28360 1527 3161 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_28360 4401 3145 gene locus_tag LOCUS_28370 gene nrfD 4401 3145 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_28370 5348 4413 gene locus_tag LOCUS_28380 5348 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 5898 5341 gene locus_tag LOCUS_28390 5898 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 6095 6352 gene locus_tag LOCUS_28400 6095 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 6339 8762 gene locus_tag LOCUS_28410 gene napA 6339 8762 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_28410 8777 9544 gene locus_tag LOCUS_28420 8777 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 9541 9849 gene locus_tag LOCUS_28430 9541 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence0212 169 735 gene locus_tag LOCUS_28440 169 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 3228 850 gene locus_tag LOCUS_28450 3228 850 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_28450 3917 5641 gene locus_tag LOCUS_28460 gene kdpA 3917 5641 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814045.1 protein_id gnl|my_center|LOCUS_28460 5724 7784 gene locus_tag LOCUS_28470 gene kdpB 5724 7784 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_28470 7942 8529 gene locus_tag LOCUS_28480 gene kdpC 7942 8529 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_28480 >Feature sequence0213 396 76 gene locus_tag LOCUS_28490 396 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1400 498 gene locus_tag LOCUS_28500 1400 498 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_28500 1759 1397 gene locus_tag LOCUS_28510 1759 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 4271 1773 gene locus_tag LOCUS_28520 4271 1773 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_28520 5503 4313 gene locus_tag LOCUS_28530 5503 4313 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_28530 8087 5613 gene locus_tag LOCUS_28540 8087 5613 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_28540 9076 8129 gene locus_tag LOCUS_28550 9076 8129 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228449.1 protein_id gnl|my_center|LOCUS_28550 <9812 9073 gene locus_tag LOCUS_28560 <9812 9073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480279.1:phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) >Feature sequence0214 1118 126 gene locus_tag LOCUS_28570 gene rfbB 1118 126 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_28570 2155 1115 gene locus_tag LOCUS_28580 2155 1115 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967057.1 protein_id gnl|my_center|LOCUS_28580 2772 2143 gene locus_tag LOCUS_28590 2772 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088172.1 protein_id gnl|my_center|LOCUS_28590 3935 2871 gene locus_tag LOCUS_28600 3935 2871 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090704.1 protein_id gnl|my_center|LOCUS_28600 5051 4020 gene locus_tag LOCUS_28610 5051 4020 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_28610 6166 5168 gene locus_tag LOCUS_28620 6166 5168 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_28620 6314 8404 gene locus_tag LOCUS_28630 6314 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 9288 8440 gene locus_tag LOCUS_28640 9288 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence0215 <1 813 gene locus_tag LOCUS_28650 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932021.1:undecaprenyl-diphosphate phosphatase 1166 756 gene locus_tag LOCUS_28660 1166 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 1169 1930 gene locus_tag LOCUS_28670 1169 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 5559 2398 gene locus_tag LOCUS_28680 5559 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 7038 5758 gene locus_tag LOCUS_28690 7038 5758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_28690 8554 7127 gene locus_tag LOCUS_28700 8554 7127 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence0216 453 28 gene locus_tag LOCUS_28710 453 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 615 2693 gene locus_tag LOCUS_28720 615 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28720 2690 3379 gene locus_tag LOCUS_28730 2690 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3376 5586 gene locus_tag LOCUS_28740 3376 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 5583 6959 gene locus_tag LOCUS_28750 5583 6959 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_28750 7015 8547 gene locus_tag LOCUS_28760 7015 8547 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence0217 98 595 gene locus_tag LOCUS_28770 98 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 592 1179 gene locus_tag LOCUS_28780 592 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 1176 1997 gene locus_tag LOCUS_28790 1176 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 2067 2154 gene locus_tag LOCUS_t00270 2067 2154 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3311 2193 gene locus_tag LOCUS_28800 3311 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3347 3940 gene locus_tag LOCUS_28810 3347 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 4039 5874 gene locus_tag LOCUS_28820 4039 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 5952 7490 gene locus_tag LOCUS_28830 5952 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 8915 8136 gene locus_tag LOCUS_28840 8915 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 9613 9032 gene locus_tag LOCUS_28850 9613 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence0218 1239 97 gene locus_tag LOCUS_28860 1239 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 3213 1381 gene locus_tag LOCUS_28870 3213 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615466.1 protein_id gnl|my_center|LOCUS_28870 3295 4641 gene locus_tag LOCUS_28880 3295 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 6325 4589 gene locus_tag LOCUS_28890 6325 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 7858 6851 gene locus_tag LOCUS_28900 7858 6851 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence0219 2513 1215 gene locus_tag LOCUS_28910 2513 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3158 2616 gene locus_tag LOCUS_28920 3158 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3331 4725 gene locus_tag LOCUS_28930 3331 4725 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_28930 5309 5824 gene locus_tag LOCUS_28940 5309 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 5982 7067 gene locus_tag LOCUS_28950 5982 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 7103 8179 gene locus_tag LOCUS_28960 7103 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 8176 9075 gene locus_tag LOCUS_28970 8176 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 9365 9003 gene locus_tag LOCUS_28980 9365 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence0220 1232 2227 gene locus_tag LOCUS_28990 1232 2227 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_28990 2260 2958 gene locus_tag LOCUS_29000 2260 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3175 4323 gene locus_tag LOCUS_29010 3175 4323 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_29010 4333 4632 gene locus_tag LOCUS_29020 4333 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 4645 4923 gene locus_tag LOCUS_29030 4645 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 4942 5442 gene locus_tag LOCUS_29040 4942 5442 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337215.1 protein_id gnl|my_center|LOCUS_29040 5601 6899 gene locus_tag LOCUS_29050 gene serS 5601 6899 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_29050 7174 9522 gene locus_tag LOCUS_29060 7174 9522 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence0221 769 107 gene locus_tag LOCUS_29070 769 107 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_29070 2349 955 gene locus_tag LOCUS_29080 gene secY 2349 955 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_29080 3041 2520 gene locus_tag LOCUS_29090 gene rplO 3041 2520 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_29090 3717 3187 gene locus_tag LOCUS_29100 gene rpsE 3717 3187 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326813.1 protein_id gnl|my_center|LOCUS_29100 4348 3845 gene locus_tag LOCUS_29110 4348 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 5038 4490 gene locus_tag LOCUS_29120 gene rplF 5038 4490 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_29120 5580 5125 gene locus_tag LOCUS_29130 gene rpsH 5580 5125 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 protein_id gnl|my_center|LOCUS_29130 5872 5612 gene locus_tag LOCUS_29140 5872 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 6625 6035 gene locus_tag LOCUS_29150 gene rplE 6625 6035 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393925.1 protein_id gnl|my_center|LOCUS_29150 7043 6693 gene locus_tag LOCUS_29160 gene rplX 7043 6693 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326807.1 protein_id gnl|my_center|LOCUS_29160 7525 7160 gene locus_tag LOCUS_29170 gene rplN 7525 7160 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_29170 7943 7572 gene locus_tag LOCUS_29180 7943 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 8360 7947 gene locus_tag LOCUS_29190 8360 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 8861 8466 gene locus_tag LOCUS_29200 gene rplP 8861 8466 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_29200 <9587 8863 gene locus_tag LOCUS_29210 <9587 8863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326802.1:30S ribosomal protein S3 >Feature sequence0222 1145 78 gene locus_tag LOCUS_29220 1145 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 2150 1452 gene locus_tag LOCUS_29230 2150 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2578 5781 gene locus_tag LOCUS_29240 2578 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 6148 6423 gene locus_tag LOCUS_29250 6148 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 6420 7886 gene locus_tag LOCUS_29260 6420 7886 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_29260 8096 9376 gene locus_tag LOCUS_29270 8096 9376 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence0223 1152 181 gene locus_tag LOCUS_29280 1152 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 3169 1304 gene locus_tag LOCUS_29290 3169 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3259 3501 gene locus_tag LOCUS_29300 3259 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 5401 3554 gene locus_tag LOCUS_29310 5401 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 6621 5497 gene locus_tag LOCUS_29320 6621 5497 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122080.1 protein_id gnl|my_center|LOCUS_29320 6718 7218 gene locus_tag LOCUS_29330 6718 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 7322 9292 gene locus_tag LOCUS_29340 7322 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence0224 101 1006 gene locus_tag LOCUS_29350 101 1006 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_29350 1003 2118 gene locus_tag LOCUS_29360 gene coxB 1003 2118 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_29360 2122 3885 gene locus_tag LOCUS_29370 gene ctaD 2122 3885 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_29370 3875 4666 gene locus_tag LOCUS_29380 3875 4666 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_29380 4763 5086 gene locus_tag LOCUS_29390 4763 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 5110 6318 gene locus_tag LOCUS_29400 5110 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 6345 7556 gene locus_tag LOCUS_29410 6345 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 7553 8521 gene locus_tag LOCUS_29420 gene cyoE 7553 8521 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_29420 8655 9287 gene locus_tag LOCUS_29430 8655 9287 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833353.1 protein_id gnl|my_center|LOCUS_29430 9344 9484 gene locus_tag LOCUS_29440 9344 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence0225 1714 2190 gene locus_tag LOCUS_29450 1714 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 2212 3990 gene locus_tag LOCUS_29460 2212 3990 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251940.1 protein_id gnl|my_center|LOCUS_29460 4113 5186 gene locus_tag LOCUS_29470 4113 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 5177 6307 gene locus_tag LOCUS_29480 5177 6307 CDS product UV damage repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256156.1 protein_id gnl|my_center|LOCUS_29480 6362 6535 gene locus_tag LOCUS_29490 6362 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 6842 6600 gene locus_tag LOCUS_29500 6842 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 6919 7080 gene locus_tag LOCUS_29510 6919 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 8052 7180 gene locus_tag LOCUS_29520 8052 7180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967099.1 protein_id gnl|my_center|LOCUS_29520 8713 8090 gene locus_tag LOCUS_29530 8713 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 8833 9225 gene locus_tag LOCUS_29540 8833 9225 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142058.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence0226 754 59 gene locus_tag LOCUS_29550 754 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 938 1013 gene locus_tag LOCUS_t00280 938 1013 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1261 1512 gene locus_tag LOCUS_29560 1261 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 1499 2590 gene locus_tag LOCUS_29570 1499 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2859 2587 gene locus_tag LOCUS_29580 2859 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3859 3251 gene locus_tag LOCUS_29590 3859 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 4438 4004 gene locus_tag LOCUS_29600 4438 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 5293 4523 gene locus_tag LOCUS_29610 5293 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 6124 6357 gene locus_tag LOCUS_29620 6124 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 7602 6886 gene locus_tag LOCUS_29630 7602 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 7887 8420 gene locus_tag LOCUS_29640 7887 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 8417 9397 gene locus_tag LOCUS_29650 8417 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0227 2204 963 gene locus_tag LOCUS_29660 2204 963 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_29660 2301 3803 gene locus_tag LOCUS_29670 2301 3803 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921298.1 protein_id gnl|my_center|LOCUS_29670 4092 3787 gene locus_tag LOCUS_29680 4092 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 4664 4107 gene locus_tag LOCUS_29690 4664 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 5009 6394 gene locus_tag LOCUS_29700 5009 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 6440 6943 gene locus_tag LOCUS_29710 6440 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 9148 7100 gene locus_tag LOCUS_29720 9148 7100 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence0228 <1 3008 gene locus_tag LOCUS_29730 <1 3008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524111.1:serine/threonine-protein kinase 3055 3414 gene locus_tag LOCUS_29740 3055 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 5089 3953 gene locus_tag LOCUS_29750 5089 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 5198 6517 gene locus_tag LOCUS_29760 5198 6517 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_29760 6560 6949 gene locus_tag LOCUS_29770 6560 6949 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_29770 6958 7467 gene locus_tag LOCUS_29780 6958 7467 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922010.1 protein_id gnl|my_center|LOCUS_29780 7522 8547 gene locus_tag LOCUS_29790 7522 8547 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121488.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence0229 75 4415 gene locus_tag LOCUS_29800 75 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 4602 5711 gene locus_tag LOCUS_29810 4602 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 5780 6271 gene locus_tag LOCUS_29820 5780 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 7170 8651 gene locus_tag LOCUS_29830 7170 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 <9479 8739 gene locus_tag LOCUS_29840 <9479 8739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392424.1:DUF3662 and FHA domain-containing protein >Feature sequence0230 295 23 gene locus_tag LOCUS_29850 295 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 937 320 gene locus_tag LOCUS_29860 937 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 1570 965 gene locus_tag LOCUS_29870 1570 965 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921301.1 protein_id gnl|my_center|LOCUS_29870 1643 2215 gene locus_tag LOCUS_29880 1643 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 2694 2353 gene locus_tag LOCUS_29890 2694 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29890 3142 2597 gene locus_tag LOCUS_29900 3142 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29900 3704 3189 gene locus_tag LOCUS_29910 3704 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 4885 3710 gene locus_tag LOCUS_29920 4885 3710 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_29920 5269 5051 gene locus_tag LOCUS_29930 5269 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 5979 5266 gene locus_tag LOCUS_29940 5979 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 7157 6051 gene locus_tag LOCUS_29950 gene hppD 7157 6051 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_29950 8175 7279 gene locus_tag LOCUS_29960 8175 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 8315 9316 gene locus_tag LOCUS_29970 8315 9316 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326204.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence0231 214 1728 gene locus_tag LOCUS_29980 214 1728 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_29980 3613 1808 gene locus_tag LOCUS_29990 3613 1808 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_29990 3530 3757 gene locus_tag LOCUS_30000 3530 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 4406 6172 gene locus_tag LOCUS_30010 4406 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 6395 7996 gene locus_tag LOCUS_30020 6395 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 8869 8108 gene locus_tag LOCUS_30030 8869 8108 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922179.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence0232 1384 320 gene locus_tag LOCUS_30040 1384 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 1836 1384 gene locus_tag LOCUS_30050 1836 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 3081 1912 gene locus_tag LOCUS_30060 3081 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 3860 3144 gene locus_tag LOCUS_30070 3860 3144 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_30070 4110 4409 gene locus_tag LOCUS_30080 4110 4409 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_30080 4430 6844 gene locus_tag LOCUS_30090 4430 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 6922 7860 gene locus_tag LOCUS_30100 6922 7860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_30100 8034 8915 gene locus_tag LOCUS_30110 8034 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 9032 9190 gene locus_tag LOCUS_30120 9032 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence0233 <1 1073 gene locus_tag LOCUS_30130 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392273.1:LegC family aminotransferase 1196 2404 gene locus_tag LOCUS_30140 1196 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2591 3859 gene locus_tag LOCUS_30150 2591 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 4373 3882 gene locus_tag LOCUS_30160 4373 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 7655 4500 gene locus_tag LOCUS_30170 7655 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 9044 7668 gene locus_tag LOCUS_30180 9044 7668 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921758.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence0234 1676 849 gene locus_tag LOCUS_30190 1676 849 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088174.1 protein_id gnl|my_center|LOCUS_30190 2565 1771 gene locus_tag LOCUS_30200 2565 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3660 2569 gene locus_tag LOCUS_30210 3660 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 4665 3667 gene locus_tag LOCUS_30220 4665 3667 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088171.1 protein_id gnl|my_center|LOCUS_30220 6376 4808 gene locus_tag LOCUS_30230 6376 4808 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_30230 7101 6610 gene locus_tag LOCUS_30240 7101 6610 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_30240 7997 7098 gene locus_tag LOCUS_30250 7997 7098 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827560.1 protein_id gnl|my_center|LOCUS_30250 8851 7994 gene locus_tag LOCUS_30260 8851 7994 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922006.1 protein_id gnl|my_center|LOCUS_30260 <9391 8848 gene locus_tag LOCUS_30270 <9391 8848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922237.1:Uma2 family endonuclease >Feature sequence0235 1007 1765 gene locus_tag LOCUS_30280 1007 1765 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_30280 1786 2136 gene locus_tag LOCUS_30290 1786 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 2232 4211 gene locus_tag LOCUS_30300 2232 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 6864 4267 gene locus_tag LOCUS_30310 6864 4267 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_30310 7565 7071 gene locus_tag LOCUS_30320 gene ruvX 7565 7071 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331673.1 protein_id gnl|my_center|LOCUS_30320 <9367 7615 gene locus_tag LOCUS_30330 <9367 7615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235190714.1:FxSxx-COOH system tetratricopeptide repeat protein >Feature sequence0236 249 890 gene locus_tag LOCUS_30340 249 890 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_30340 2121 1006 gene locus_tag LOCUS_30350 2121 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 2408 2214 gene locus_tag LOCUS_30360 2408 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3001 2408 gene locus_tag LOCUS_30370 3001 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_30370 4069 3026 gene locus_tag LOCUS_30380 gene ychF 4069 3026 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_30380 5005 4259 gene locus_tag LOCUS_30390 5005 4259 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_30390 5391 5176 gene locus_tag LOCUS_30400 5391 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 5284 7005 gene locus_tag LOCUS_30410 5284 7005 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121786.1 protein_id gnl|my_center|LOCUS_30410 7949 7032 gene locus_tag LOCUS_30420 7949 7032 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_30420 8332 7946 gene locus_tag LOCUS_30430 8332 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 8537 8764 gene locus_tag LOCUS_30440 8537 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 8807 9022 gene locus_tag LOCUS_30450 8807 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 >Feature sequence0237 748 623 gene locus_tag LOCUS_30460 748 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 1263 1808 gene locus_tag LOCUS_30470 1263 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 1798 2523 gene locus_tag LOCUS_30480 1798 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 4245 2536 gene locus_tag LOCUS_30490 gene recN 4245 2536 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_30490 4376 5116 gene locus_tag LOCUS_30500 4376 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 5113 6150 gene locus_tag LOCUS_30510 gene yhaM 5113 6150 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245698.1 protein_id gnl|my_center|LOCUS_30510 6940 6164 gene locus_tag LOCUS_30520 6940 6164 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887334.1 protein_id gnl|my_center|LOCUS_30520 7074 7148 gene locus_tag LOCUS_t00290 7074 7148 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7604 7311 gene locus_tag LOCUS_30530 7604 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 9182 8160 gene locus_tag LOCUS_30540 9182 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence0238 8501 8229 gene locus_tag LOCUS_30550 8501 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 9167 8553 gene locus_tag LOCUS_30560 9167 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence0239 1351 86 gene locus_tag LOCUS_30570 1351 86 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_30570 1585 2007 gene locus_tag LOCUS_30580 1585 2007 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266691.1 protein_id gnl|my_center|LOCUS_30580 2004 2465 gene locus_tag LOCUS_30590 2004 2465 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402968.1 protein_id gnl|my_center|LOCUS_30590 2568 3014 gene locus_tag LOCUS_30600 2568 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 3011 3490 gene locus_tag LOCUS_30610 3011 3490 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 protein_id gnl|my_center|LOCUS_30610 3556 5484 gene locus_tag LOCUS_30620 3556 5484 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_30620 5975 5541 gene locus_tag LOCUS_30630 5975 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 6252 7571 gene locus_tag LOCUS_30640 6252 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 7587 8330 gene locus_tag LOCUS_30650 7587 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 8430 9173 gene locus_tag LOCUS_30660 gene pyrH 8430 9173 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_30660 >Feature sequence0240 137 322 gene locus_tag LOCUS_30670 137 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 434 1057 gene locus_tag LOCUS_30680 434 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30680 1104 2165 gene locus_tag LOCUS_30690 1104 2165 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_30690 2208 3158 gene locus_tag LOCUS_30700 2208 3158 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_30700 3957 3502 gene locus_tag LOCUS_30710 3957 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 4298 3954 gene locus_tag LOCUS_30720 4298 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 5289 4357 gene locus_tag LOCUS_30730 5289 4357 CDS product XamI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040059.1 protein_id gnl|my_center|LOCUS_30730 6949 5291 gene locus_tag LOCUS_30740 6949 5291 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034475911.1 protein_id gnl|my_center|LOCUS_30740 7569 7189 gene locus_tag LOCUS_30750 7569 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 8117 7566 gene locus_tag LOCUS_30760 8117 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 8576 8130 gene locus_tag LOCUS_30770 8576 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence0241 179 739 gene locus_tag LOCUS_30780 179 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 2265 1054 gene locus_tag LOCUS_30790 2265 1054 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327172.1 protein_id gnl|my_center|LOCUS_30790 2966 3166 gene locus_tag LOCUS_30800 2966 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3163 3567 gene locus_tag LOCUS_30810 3163 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3640 4491 gene locus_tag LOCUS_30820 3640 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 4557 4844 gene locus_tag LOCUS_30830 4557 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 4940 5560 gene locus_tag LOCUS_30840 4940 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 5680 6384 gene locus_tag LOCUS_30850 5680 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 6344 8062 gene locus_tag LOCUS_30860 gene atpA 6344 8062 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403677.1 protein_id gnl|my_center|LOCUS_30860 8238 9155 gene locus_tag LOCUS_30870 gene atpG 8238 9155 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence0242 1991 2078 gene locus_tag LOCUS_t00300 1991 2078 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3376 2234 gene locus_tag LOCUS_30880 3376 2234 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230505.1 protein_id gnl|my_center|LOCUS_30880 3627 3376 gene locus_tag LOCUS_30890 3627 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 4797 3742 gene locus_tag LOCUS_30900 4797 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 6643 5345 gene locus_tag LOCUS_30910 6643 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 8973 6640 gene locus_tag LOCUS_30920 8973 6640 CDS product Piwi domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031225.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence0243 264 67 gene locus_tag LOCUS_30930 264 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 964 383 gene locus_tag LOCUS_30940 964 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1565 1350 gene locus_tag LOCUS_30950 1565 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30950 2860 1457 gene locus_tag LOCUS_30960 2860 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30960 3359 2874 gene locus_tag LOCUS_30970 3359 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3953 3429 gene locus_tag LOCUS_30980 3953 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 4443 4030 gene locus_tag LOCUS_30990 4443 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 4659 4480 gene locus_tag LOCUS_31000 4659 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 4760 5386 gene locus_tag LOCUS_31010 4760 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 5390 8587 gene locus_tag LOCUS_31020 5390 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 8622 8750 gene locus_tag LOCUS_31030 8622 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence0244 <1 855 gene locus_tag LOCUS_31040 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008671603.1:DUF1501 domain-containing protein 1821 907 gene locus_tag LOCUS_31050 gene blaCAU 1821 907 CDS product CAU/MBL1b family subclass B3 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920000.1 protein_id gnl|my_center|LOCUS_31050 1906 2535 gene locus_tag LOCUS_31060 1906 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 2985 2539 gene locus_tag LOCUS_31070 2985 2539 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142427.1 protein_id gnl|my_center|LOCUS_31070 3321 2986 gene locus_tag LOCUS_31080 3321 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 4749 3367 gene locus_tag LOCUS_31090 4749 3367 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_31090 5285 4809 gene locus_tag LOCUS_31100 5285 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 7885 5363 gene locus_tag LOCUS_31110 7885 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 <9178 8266 gene locus_tag LOCUS_31120 <9178 8266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121618.1:DNA mismatch repair endonuclease MutL >Feature sequence0245 1275 25 gene locus_tag LOCUS_31130 1275 25 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_31130 1897 1346 gene locus_tag LOCUS_31140 1897 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2331 3689 gene locus_tag LOCUS_31150 2331 3689 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_31150 3794 4414 gene locus_tag LOCUS_31160 3794 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 4878 4432 gene locus_tag LOCUS_31170 4878 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 5048 6304 gene locus_tag LOCUS_31180 5048 6304 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_31180 6407 7363 gene locus_tag LOCUS_31190 6407 7363 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence0246 1939 260 gene locus_tag LOCUS_31200 1939 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 2744 2067 gene locus_tag LOCUS_31210 2744 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3909 2806 gene locus_tag LOCUS_31220 3909 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 6201 3976 gene locus_tag LOCUS_31230 6201 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 6762 6689 gene locus_tag LOCUS_t00310 6762 6689 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7397 6816 gene locus_tag LOCUS_31240 gene thpR 7397 6816 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267029.1 protein_id gnl|my_center|LOCUS_31240 8393 7404 gene locus_tag LOCUS_31250 8393 7404 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_31250 <9122 8535 gene locus_tag LOCUS_31260 <9122 8535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229257.1:MaoC/PaaZ C-terminal domain-containing protein >Feature sequence0247 553 1602 gene locus_tag LOCUS_31270 gene hflC 553 1602 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209155.1 protein_id gnl|my_center|LOCUS_31270 1614 2555 gene locus_tag LOCUS_31280 1614 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 2589 3557 gene locus_tag LOCUS_31290 2589 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 3733 6939 gene locus_tag LOCUS_31300 3733 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence0248 405 2873 gene locus_tag LOCUS_31310 405 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3355 2885 gene locus_tag LOCUS_31320 3355 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 3840 3379 gene locus_tag LOCUS_31330 3840 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 4027 4962 gene locus_tag LOCUS_31340 4027 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 5067 5393 gene locus_tag LOCUS_31350 5067 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 5390 5743 gene locus_tag LOCUS_31360 5390 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 5799 7046 gene locus_tag LOCUS_31370 5799 7046 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121115.1 protein_id gnl|my_center|LOCUS_31370 7151 8473 gene locus_tag LOCUS_31380 7151 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence0249 2798 1428 gene locus_tag LOCUS_31390 2798 1428 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_31390 5384 2937 gene locus_tag LOCUS_31400 5384 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 8996 5403 gene locus_tag LOCUS_31410 8996 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence0250 1544 1089 gene locus_tag LOCUS_31420 1544 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 1768 1592 gene locus_tag LOCUS_31430 1768 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 2899 1838 gene locus_tag LOCUS_31440 2899 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3176 4084 gene locus_tag LOCUS_31450 3176 4084 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389768.1 protein_id gnl|my_center|LOCUS_31450 4170 4544 gene locus_tag LOCUS_31460 4170 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 4541 4789 gene locus_tag LOCUS_31470 4541 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 5766 4873 gene locus_tag LOCUS_31480 5766 4873 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_31480 6635 5901 gene locus_tag LOCUS_31490 6635 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 6726 8900 gene locus_tag LOCUS_31500 6726 8900 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615483.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence0251 472 1230 gene locus_tag LOCUS_31510 472 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 1722 3644 gene locus_tag LOCUS_31520 1722 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 4067 5656 gene locus_tag LOCUS_31530 4067 5656 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 protein_id gnl|my_center|LOCUS_31530 5684 6406 gene locus_tag LOCUS_31540 5684 6406 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_31540 6427 7692 gene locus_tag LOCUS_31550 6427 7692 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_31550 8878 8186 gene locus_tag LOCUS_31560 8878 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence0252 1598 1029 gene locus_tag LOCUS_31570 1598 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 1854 2987 gene locus_tag LOCUS_31580 1854 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3487 2984 gene locus_tag LOCUS_31590 3487 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 4240 3491 gene locus_tag LOCUS_31600 4240 3491 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_31600 6216 4360 gene locus_tag LOCUS_31610 6216 4360 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_31610 7137 6352 gene locus_tag LOCUS_31620 7137 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence0253 2278 233 gene locus_tag LOCUS_31630 2278 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2547 2275 gene locus_tag LOCUS_31640 2547 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3802 2474 gene locus_tag LOCUS_31650 3802 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 4594 3806 gene locus_tag LOCUS_31660 4594 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 4858 6156 gene locus_tag LOCUS_31670 4858 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 6791 6189 gene locus_tag LOCUS_31680 6791 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 8485 7247 gene locus_tag LOCUS_31690 8485 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence0254 7894 827 gene locus_tag LOCUS_31700 gene uvrA 7894 827 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121648.1 protein_id gnl|my_center|LOCUS_31700 8052 8627 gene locus_tag LOCUS_31710 gene rpoE 8052 8627 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 protein_id gnl|my_center|LOCUS_31710 >Feature sequence0255 94 339 gene locus_tag LOCUS_31720 94 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 311 1495 gene locus_tag LOCUS_31730 311 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1488 2093 gene locus_tag LOCUS_31740 1488 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 2041 3087 gene locus_tag LOCUS_31750 2041 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 4136 3105 gene locus_tag LOCUS_31760 4136 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31760 5479 4154 gene locus_tag LOCUS_31770 5479 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31770 5749 5489 gene locus_tag LOCUS_31780 5749 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 6008 8017 gene locus_tag LOCUS_31790 6008 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 8014 8673 gene locus_tag LOCUS_31800 8014 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence0256 2285 2713 gene locus_tag LOCUS_31810 2285 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3072 4013 gene locus_tag LOCUS_31820 3072 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 4029 4658 gene locus_tag LOCUS_31830 4029 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 4670 5218 gene locus_tag LOCUS_31840 4670 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 6168 5230 gene locus_tag LOCUS_31850 6168 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 6301 6465 gene locus_tag LOCUS_31860 6301 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 6521 7108 gene locus_tag LOCUS_31870 6521 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 8347 7118 gene locus_tag LOCUS_31880 8347 7118 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence0257 509 63 gene locus_tag LOCUS_31890 509 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 3775 521 gene locus_tag LOCUS_31900 3775 521 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_31900 5503 3857 gene locus_tag LOCUS_31910 5503 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 6885 5536 gene locus_tag LOCUS_31920 6885 5536 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_31920 7537 7058 gene locus_tag LOCUS_31930 7537 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 7797 8720 gene locus_tag LOCUS_31940 7797 8720 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence0258 <1 730 gene locus_tag LOCUS_31950 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081315.1:magnesium/cobalt transporter CorA 808 1230 gene locus_tag LOCUS_31960 808 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 2194 1313 gene locus_tag LOCUS_31970 2194 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 2677 2360 gene locus_tag LOCUS_31980 gene nirD 2677 2360 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_31980 2744 3286 gene locus_tag LOCUS_31990 gene cyaB 2744 3286 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023937.1 protein_id gnl|my_center|LOCUS_31990 3398 4249 gene locus_tag LOCUS_32000 gene panC 3398 4249 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_32000 4323 5759 gene locus_tag LOCUS_32010 gene mgtE 4323 5759 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118267.1 protein_id gnl|my_center|LOCUS_32010 5980 6837 gene locus_tag LOCUS_32020 5980 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 7044 7874 gene locus_tag LOCUS_32030 7044 7874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_32030 7994 8773 gene locus_tag LOCUS_32040 7994 8773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_32040 >Feature sequence0259 122 3277 gene locus_tag LOCUS_32050 122 3277 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_32050 3327 4418 gene locus_tag LOCUS_32060 3327 4418 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_32060 4458 5603 gene locus_tag LOCUS_32070 4458 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 5488 6069 gene locus_tag LOCUS_32080 5488 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32080 6181 7176 gene locus_tag LOCUS_32090 6181 7176 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330332.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence0260 1689 457 gene locus_tag LOCUS_32100 1689 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 1819 2805 gene locus_tag LOCUS_32110 1819 2805 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_32110 2894 4138 gene locus_tag LOCUS_32120 2894 4138 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527913.1 protein_id gnl|my_center|LOCUS_32120 4287 4212 gene locus_tag LOCUS_t00320 4287 4212 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4329 4787 gene locus_tag LOCUS_32130 4329 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 5046 7406 gene locus_tag LOCUS_32140 5046 7406 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_32140 7403 7753 gene locus_tag LOCUS_32150 7403 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 7750 8103 gene locus_tag LOCUS_32160 7750 8103 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142949.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence0261 3076 1139 gene locus_tag LOCUS_32170 3076 1139 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325003.1 protein_id gnl|my_center|LOCUS_32170 3316 3882 gene locus_tag LOCUS_32180 3316 3882 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_32180 3947 4447 gene locus_tag LOCUS_32190 3947 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 4469 5089 gene locus_tag LOCUS_32200 4469 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 5534 5172 gene locus_tag LOCUS_32210 5534 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 6905 5604 gene locus_tag LOCUS_32220 6905 5604 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_32220 >Feature sequence0262 345 1718 gene locus_tag LOCUS_32230 345 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 1715 2182 gene locus_tag LOCUS_32240 1715 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 2956 2189 gene locus_tag LOCUS_32250 2956 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 3703 3116 gene locus_tag LOCUS_32260 3703 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 4657 4187 gene locus_tag LOCUS_32270 4657 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 5408 5085 gene locus_tag LOCUS_32280 5408 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 5772 5392 gene locus_tag LOCUS_32290 5772 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 6591 5839 gene locus_tag LOCUS_32300 6591 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 7018 6698 gene locus_tag LOCUS_32310 7018 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 7190 6966 gene locus_tag LOCUS_32320 7190 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence0263 664 1893 gene locus_tag LOCUS_32330 664 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 3491 1941 gene locus_tag LOCUS_32340 3491 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 4314 3499 gene locus_tag LOCUS_32350 4314 3499 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_32350 4561 4767 gene locus_tag LOCUS_32360 4561 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 8230 4814 gene locus_tag LOCUS_32370 8230 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence0264 668 1702 gene locus_tag LOCUS_32380 668 1702 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_32380 1824 2351 gene locus_tag LOCUS_32390 1824 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 2270 2563 gene locus_tag LOCUS_32400 2270 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2641 3399 gene locus_tag LOCUS_32410 2641 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 3443 5389 gene locus_tag LOCUS_32420 3443 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 6675 5419 gene locus_tag LOCUS_32430 6675 5419 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_32430 6906 7094 gene locus_tag LOCUS_32440 6906 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 7963 7274 gene locus_tag LOCUS_32450 7963 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 <8734 7970 gene locus_tag LOCUS_32460 <8734 7970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044997.1:ATP-binding protein >Feature sequence0265 2917 638 gene locus_tag LOCUS_32470 2917 638 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121841.1 protein_id gnl|my_center|LOCUS_32470 3991 2987 gene locus_tag LOCUS_32480 3991 2987 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_32480 4247 5026 gene locus_tag LOCUS_32490 gene panB 4247 5026 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_32490 5036 5533 gene locus_tag LOCUS_32500 5036 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 5551 5958 gene locus_tag LOCUS_32510 5551 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 5972 6595 gene locus_tag LOCUS_32520 5972 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 6727 7647 gene locus_tag LOCUS_32530 6727 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 7732 8244 gene locus_tag LOCUS_32540 gene dps 7732 8244 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_32540 8402 8629 gene locus_tag LOCUS_32550 8402 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence0266 1090 1449 gene locus_tag LOCUS_32560 1090 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 2062 1421 gene locus_tag LOCUS_32570 2062 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 2875 2072 gene locus_tag LOCUS_32580 2875 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 3888 2872 gene locus_tag LOCUS_32590 gene argC 3888 2872 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_32590 3925 5334 gene locus_tag LOCUS_32600 3925 5334 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_32600 5342 6070 gene locus_tag LOCUS_32610 5342 6070 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_32610 6369 7307 gene locus_tag LOCUS_32620 6369 7307 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925420.1 protein_id gnl|my_center|LOCUS_32620 7310 8101 gene locus_tag LOCUS_32630 7310 8101 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027775.1 protein_id gnl|my_center|LOCUS_32630 >Feature sequence0267 322 137 gene locus_tag LOCUS_32640 322 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 728 907 gene locus_tag LOCUS_32650 728 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 1033 1977 gene locus_tag LOCUS_32660 1033 1977 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_32660 1981 3117 gene locus_tag LOCUS_32670 1981 3117 CDS product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 protein_id gnl|my_center|LOCUS_32670 3114 3920 gene locus_tag LOCUS_32680 3114 3920 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_32680 3957 5291 gene locus_tag LOCUS_32690 3957 5291 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_32690 5282 6256 gene locus_tag LOCUS_32700 5282 6256 CDS product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681897.1 protein_id gnl|my_center|LOCUS_32700 7302 6232 gene locus_tag LOCUS_32710 7302 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 7618 7322 gene locus_tag LOCUS_32720 7618 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 8321 7788 gene locus_tag LOCUS_32730 8321 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence0268 2931 2266 gene locus_tag LOCUS_32740 2931 2266 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_32740 4377 3169 gene locus_tag LOCUS_32750 4377 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 4438 4989 gene locus_tag LOCUS_32760 4438 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 6398 4986 gene locus_tag LOCUS_32770 6398 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939880.1 protein_id gnl|my_center|LOCUS_32770 6843 6301 gene locus_tag LOCUS_32780 6843 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 7183 7962 gene locus_tag LOCUS_32790 7183 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 8606 7971 gene locus_tag LOCUS_32800 8606 7971 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088912.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence0269 2098 77 gene locus_tag LOCUS_32810 gene asnB 2098 77 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525357.1 protein_id gnl|my_center|LOCUS_32810 2345 2148 gene locus_tag LOCUS_32820 2345 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 2596 2381 gene locus_tag LOCUS_32830 2596 2381 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_32830 2891 2583 gene locus_tag LOCUS_32840 2891 2583 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546699.1 protein_id gnl|my_center|LOCUS_32840 3740 2901 gene locus_tag LOCUS_32850 3740 2901 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_32850 3949 4533 gene locus_tag LOCUS_32860 3949 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 4739 6091 gene locus_tag LOCUS_32870 4739 6091 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_32870 6113 6388 gene locus_tag LOCUS_32880 6113 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 6385 6798 gene locus_tag LOCUS_32890 6385 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 6837 7109 gene locus_tag LOCUS_32900 6837 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 7084 7497 gene locus_tag LOCUS_32910 7084 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 7593 8093 gene locus_tag LOCUS_32920 gene fae 7593 8093 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326305.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence0270 485 1420 gene locus_tag LOCUS_32930 485 1420 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121793.1 protein_id gnl|my_center|LOCUS_32930 1417 1650 gene locus_tag LOCUS_32940 1417 1650 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888660.1 protein_id gnl|my_center|LOCUS_32940 1647 2525 gene locus_tag LOCUS_32950 1647 2525 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_32950 4184 2547 gene locus_tag LOCUS_32960 4184 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 5336 4350 gene locus_tag LOCUS_32970 5336 4350 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_32970 5706 6368 gene locus_tag LOCUS_32980 5706 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 6506 7735 gene locus_tag LOCUS_32990 6506 7735 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615854.1 protein_id gnl|my_center|LOCUS_32990 7786 8157 gene locus_tag LOCUS_33000 7786 8157 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence0271 189 6767 gene locus_tag LOCUS_33010 189 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 6821 8011 gene locus_tag LOCUS_33020 6821 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence0272 1497 82 gene locus_tag LOCUS_33030 1497 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 4169 1557 gene locus_tag LOCUS_33040 4169 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 4530 6752 gene locus_tag LOCUS_33050 4530 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_33050 6820 7536 gene locus_tag LOCUS_33060 6820 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence0273 199 552 gene locus_tag LOCUS_33070 199 552 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_33070 614 847 gene locus_tag LOCUS_33080 614 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 1191 1979 gene locus_tag LOCUS_33090 1191 1979 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_33090 2346 1987 gene locus_tag LOCUS_33100 2346 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3035 2343 gene locus_tag LOCUS_33110 gene msrA 3035 2343 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_33110 4583 3048 gene locus_tag LOCUS_33120 4583 3048 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_33120 6341 4680 gene locus_tag LOCUS_33130 6341 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 6488 7366 gene locus_tag LOCUS_33140 gene hemF 6488 7366 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172630.1 protein_id gnl|my_center|LOCUS_33140 8369 7374 gene locus_tag LOCUS_33150 8369 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence0274 1822 470 gene locus_tag LOCUS_33160 1822 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 1933 2811 gene locus_tag LOCUS_33170 gene murB 1933 2811 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_33170 2950 3615 gene locus_tag LOCUS_33180 2950 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 4700 3618 gene locus_tag LOCUS_33190 gene trpS 4700 3618 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_33190 4782 5510 gene locus_tag LOCUS_33200 4782 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 6277 5555 gene locus_tag LOCUS_33210 gene rph 6277 5555 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811149.1 protein_id gnl|my_center|LOCUS_33210 7307 6726 gene locus_tag LOCUS_33220 7307 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 8237 7326 gene locus_tag LOCUS_33230 gene argF 8237 7326 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_33230 >Feature sequence0275 2099 54 gene locus_tag LOCUS_33240 2099 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 3227 2220 gene locus_tag LOCUS_33250 3227 2220 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798653.1 protein_id gnl|my_center|LOCUS_33250 4821 3277 gene locus_tag LOCUS_33260 4821 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 6350 4818 gene locus_tag LOCUS_33270 6350 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 7825 6551 gene locus_tag LOCUS_33280 7825 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence0276 2114 153 gene locus_tag LOCUS_33290 2114 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 2455 2207 gene locus_tag LOCUS_33300 2455 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 3360 2509 gene locus_tag LOCUS_33310 3360 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 3687 4325 gene locus_tag LOCUS_33320 3687 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 4335 7523 gene locus_tag LOCUS_33330 4335 7523 CDS product [glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008674544.1 protein_id gnl|my_center|LOCUS_33330 <8482 7529 gene locus_tag LOCUS_33340 <8482 7529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839231.1:PD-(D/E)XK nuclease family protein >Feature sequence0277 575 135 gene locus_tag LOCUS_33350 575 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 743 937 gene locus_tag LOCUS_33360 743 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 3054 949 gene locus_tag LOCUS_33370 3054 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 3560 3240 gene locus_tag LOCUS_33380 3560 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 4277 4768 gene locus_tag LOCUS_33390 4277 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 4752 4976 gene locus_tag LOCUS_33400 4752 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 5076 8189 gene locus_tag LOCUS_33410 5076 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence0278 2069 582 gene locus_tag LOCUS_33420 2069 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 2317 3231 gene locus_tag LOCUS_33430 gene rplC 2317 3231 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121602.1 protein_id gnl|my_center|LOCUS_33430 3676 4464 gene locus_tag LOCUS_33440 3676 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 4681 5589 gene locus_tag LOCUS_33450 4681 5589 CDS product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928850.1 protein_id gnl|my_center|LOCUS_33450 6607 5675 gene locus_tag LOCUS_33460 gene flgL 6607 5675 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_33460 8308 6623 gene locus_tag LOCUS_33470 gene flgK 8308 6623 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616092.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence0279 300 64 gene locus_tag LOCUS_33480 300 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 627 334 gene locus_tag LOCUS_33490 627 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33490 971 621 gene locus_tag LOCUS_33500 971 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33500 1267 983 gene locus_tag LOCUS_33510 gene cas2 1267 983 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387937.1 protein_id gnl|my_center|LOCUS_33510 2220 1267 gene locus_tag LOCUS_33520 2220 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 2973 2716 gene locus_tag LOCUS_33530 2973 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3022 3258 gene locus_tag LOCUS_33540 3022 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 3255 3632 gene locus_tag LOCUS_33550 3255 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 5479 3629 gene locus_tag LOCUS_33560 5479 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 6014 5781 gene locus_tag LOCUS_33570 6014 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 7376 6126 gene locus_tag LOCUS_33580 7376 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 8229 7429 gene locus_tag LOCUS_33590 8229 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence0280 2165 132 gene locus_tag LOCUS_33600 2165 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 2280 3515 gene locus_tag LOCUS_33610 2280 3515 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_33610 3612 3905 gene locus_tag LOCUS_33620 3612 3905 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329069.1 protein_id gnl|my_center|LOCUS_33620 3933 5435 gene locus_tag LOCUS_33630 3933 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 5638 6525 gene locus_tag LOCUS_33640 5638 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 7127 6576 gene locus_tag LOCUS_33650 7127 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 7057 7275 gene locus_tag LOCUS_33660 7057 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 7927 7430 gene locus_tag LOCUS_33670 gene sixA 7927 7430 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence0281 2169 2468 gene locus_tag LOCUS_33680 2169 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 2900 2544 gene locus_tag LOCUS_33690 2900 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 3196 5457 gene locus_tag LOCUS_33700 3196 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 5498 6301 gene locus_tag LOCUS_33710 5498 6301 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142137.1 protein_id gnl|my_center|LOCUS_33710 6696 6289 gene locus_tag LOCUS_33720 6696 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 7119 6700 gene locus_tag LOCUS_33730 7119 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 7261 8061 gene locus_tag LOCUS_33740 7261 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence0282 <1 754 gene locus_tag LOCUS_33750 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921767.1:protein translocase subunit SecD 872 1195 gene locus_tag LOCUS_33760 872 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 1176 1622 gene locus_tag LOCUS_33770 1176 1622 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258781.1 protein_id gnl|my_center|LOCUS_33770 1643 3214 gene locus_tag LOCUS_33780 1643 3214 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_33780 3289 3666 gene locus_tag LOCUS_33790 gene rplU 3289 3666 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_33790 3791 4999 gene locus_tag LOCUS_33800 3791 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 5071 6090 gene locus_tag LOCUS_33810 5071 6090 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921954.1 protein_id gnl|my_center|LOCUS_33810 6145 6411 gene locus_tag LOCUS_33820 6145 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 6408 6686 gene locus_tag LOCUS_33830 6408 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 6714 7682 gene locus_tag LOCUS_33840 6714 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence0283 1372 2703 gene locus_tag LOCUS_33850 1372 2703 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_33850 2781 3197 gene locus_tag LOCUS_33860 2781 3197 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_33860 3245 4186 gene locus_tag LOCUS_33870 3245 4186 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_33870 4269 4889 gene locus_tag LOCUS_33880 4269 4889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_33880 >Feature sequence0284 705 115 gene locus_tag LOCUS_33890 705 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 659 1024 gene locus_tag LOCUS_33900 659 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 1074 1421 gene locus_tag LOCUS_33910 1074 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 1418 1825 gene locus_tag LOCUS_33920 1418 1825 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_33920 2538 1900 gene locus_tag LOCUS_33930 2538 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 4307 2547 gene locus_tag LOCUS_33940 4307 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 5528 4473 gene locus_tag LOCUS_33950 5528 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 <8359 5620 gene locus_tag LOCUS_33960 <8359 5620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015445472.1:AAA family ATPase >Feature sequence0285 1309 869 gene locus_tag LOCUS_33970 1309 869 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266947.1 protein_id gnl|my_center|LOCUS_33970 3083 1422 gene locus_tag LOCUS_33980 3083 1422 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552066.1 protein_id gnl|my_center|LOCUS_33980 4389 3223 gene locus_tag LOCUS_33990 4389 3223 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_33990 4456 5334 gene locus_tag LOCUS_34000 4456 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_34000 5368 7011 gene locus_tag LOCUS_34010 5368 7011 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937938.1 protein_id gnl|my_center|LOCUS_34010 7066 7278 gene locus_tag LOCUS_34020 7066 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 <8329 7275 gene locus_tag LOCUS_34030 <8329 7275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257129.1:glycosyltransferase family 4 protein >Feature sequence0286 296 39 gene locus_tag LOCUS_34040 296 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 546 2324 gene locus_tag LOCUS_34050 gene recJ 546 2324 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_34050 2846 2400 gene locus_tag LOCUS_34060 2846 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 3787 3080 gene locus_tag LOCUS_34070 3787 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 4402 3974 gene locus_tag LOCUS_34080 4402 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 4605 4399 gene locus_tag LOCUS_34090 4605 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 5140 4745 gene locus_tag LOCUS_34100 5140 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 7204 5549 gene locus_tag LOCUS_34110 7204 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 8184 7273 gene locus_tag LOCUS_34120 8184 7273 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031014.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence0287 697 215 gene locus_tag LOCUS_34130 697 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 2593 743 gene locus_tag LOCUS_34140 2593 743 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530759.1 protein_id gnl|my_center|LOCUS_34140 4404 3232 gene locus_tag LOCUS_34150 4404 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 4849 4379 gene locus_tag LOCUS_34160 4849 4379 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_34160 <8247 4856 gene locus_tag LOCUS_34170 <8247 4856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389628.1:PAS domain-containing sensor histidine kinase >Feature sequence0288 1680 538 gene locus_tag LOCUS_34180 1680 538 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_34180 2560 1664 gene locus_tag LOCUS_34190 2560 1664 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256104.1 protein_id gnl|my_center|LOCUS_34190 3482 2550 gene locus_tag LOCUS_34200 3482 2550 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259301.1 protein_id gnl|my_center|LOCUS_34200 4729 3479 gene locus_tag LOCUS_34210 4729 3479 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087123.1 protein_id gnl|my_center|LOCUS_34210 4835 6463 gene locus_tag LOCUS_34220 gene pgi 4835 6463 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_34220 8149 7142 gene locus_tag LOCUS_34230 8149 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence0289 3726 3166 gene locus_tag LOCUS_34240 3726 3166 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_34240 4602 3847 gene locus_tag LOCUS_34250 4602 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 5697 4756 gene locus_tag LOCUS_34260 5697 4756 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_34260 6227 5799 gene locus_tag LOCUS_34270 6227 5799 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339262.1 protein_id gnl|my_center|LOCUS_34270 7061 6240 gene locus_tag LOCUS_34280 7061 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 8017 7310 gene locus_tag LOCUS_34290 8017 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 >Feature sequence0290 <1 821 gene locus_tag LOCUS_34300 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324457.1:50S ribosomal protein L1 916 1488 gene locus_tag LOCUS_34310 916 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 1668 2066 gene locus_tag LOCUS_34320 gene rplL 1668 2066 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707747.1 protein_id gnl|my_center|LOCUS_34320 2189 2398 gene locus_tag LOCUS_34330 2189 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 2488 6231 gene locus_tag LOCUS_34340 gene rpoB 2488 6231 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_34340 6235 6585 gene locus_tag LOCUS_34350 6235 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 6582 6950 gene locus_tag LOCUS_34360 6582 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence0291 1771 74 gene locus_tag LOCUS_34370 gene lnt 1771 74 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_34370 3100 1916 gene locus_tag LOCUS_34380 3100 1916 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_34380 4125 3169 gene locus_tag LOCUS_34390 4125 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 6039 4321 gene locus_tag LOCUS_34400 6039 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 6894 6136 gene locus_tag LOCUS_34410 6894 6136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_34410 8000 7086 gene locus_tag LOCUS_34420 8000 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence0292 <1 1221 gene locus_tag LOCUS_34430 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922057.1:DEAD/DEAH box helicase 1373 1978 gene locus_tag LOCUS_34440 1373 1978 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_34440 3442 1982 gene locus_tag LOCUS_34450 gene purB 3442 1982 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_34450 3663 3959 gene locus_tag LOCUS_34460 3663 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 4462 4025 gene locus_tag LOCUS_34470 4462 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 4967 4614 gene locus_tag LOCUS_34480 4967 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 5152 7953 gene locus_tag LOCUS_34490 5152 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 >Feature sequence0293 367 1356 gene locus_tag LOCUS_34500 367 1356 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_34500 1385 2503 gene locus_tag LOCUS_34510 1385 2503 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_34510 2689 3807 gene locus_tag LOCUS_34520 2689 3807 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_34520 3921 4331 gene locus_tag LOCUS_34530 3921 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 4328 4864 gene locus_tag LOCUS_34540 4328 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 4939 5307 gene locus_tag LOCUS_34550 4939 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 5728 5351 gene locus_tag LOCUS_34560 5728 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 5727 6485 gene locus_tag LOCUS_34570 5727 6485 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731602.1 protein_id gnl|my_center|LOCUS_34570 6661 7905 gene locus_tag LOCUS_34580 6661 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 7962 7880 gene locus_tag LOCUS_t00330 7962 7880 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0294 <1 1453 gene locus_tag LOCUS_34590 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012502785.1:tetratricopeptide repeat protein 1499 2230 gene locus_tag LOCUS_34600 1499 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 2299 2910 gene locus_tag LOCUS_34610 2299 2910 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_34610 3722 2895 gene locus_tag LOCUS_34620 3722 2895 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_34620 4024 5313 gene locus_tag LOCUS_34630 4024 5313 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_34630 5449 6513 gene locus_tag LOCUS_34640 gene waaC 5449 6513 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_34640 6580 7176 gene locus_tag LOCUS_34650 6580 7176 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921444.1 protein_id gnl|my_center|LOCUS_34650 7495 7109 gene locus_tag LOCUS_34660 7495 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 7739 7587 gene locus_tag LOCUS_34670 7739 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 7820 8062 gene locus_tag LOCUS_34680 7820 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence0295 3497 1992 gene locus_tag LOCUS_34690 3497 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 5167 3494 gene locus_tag LOCUS_34700 5167 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 <8167 5177 gene locus_tag LOCUS_34710 <8167 5177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002383762.1:glycosyltransferase >Feature sequence0296 <1 1545 gene locus_tag LOCUS_34720 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121080.1:ATP-dependent Clp protease ATP-binding subunit 1564 2511 gene locus_tag LOCUS_34730 1564 2511 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258373.1 protein_id gnl|my_center|LOCUS_34730 5298 2626 gene locus_tag LOCUS_34740 5298 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 6507 5383 gene locus_tag LOCUS_34750 gene citZ 6507 5383 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_34750 7310 6504 gene locus_tag LOCUS_34760 gene prpB 7310 6504 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_34760 7692 7766 gene locus_tag LOCUS_t00340 7692 7766 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 7788 7861 gene locus_tag LOCUS_t00350 7788 7861 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0297 1953 52 gene locus_tag LOCUS_34770 1953 52 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_34770 2263 2613 gene locus_tag LOCUS_34780 2263 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 2910 2653 gene locus_tag LOCUS_34790 2910 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 4046 3066 gene locus_tag LOCUS_34800 4046 3066 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_34800 4520 4086 gene locus_tag LOCUS_34810 4520 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 5929 4862 gene locus_tag LOCUS_34820 5929 4862 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 protein_id gnl|my_center|LOCUS_34820 6328 6032 gene locus_tag LOCUS_34830 6328 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 6997 6362 gene locus_tag LOCUS_34840 6997 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34840 7509 7093 gene locus_tag LOCUS_34850 7509 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence0298 <1 1020 gene locus_tag LOCUS_34860 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335517.1:DUF1501 domain-containing protein 1295 1384 gene locus_tag LOCUS_t00360 1295 1384 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1576 2424 gene locus_tag LOCUS_34870 1576 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2440 2778 gene locus_tag LOCUS_34880 2440 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34880 2993 2805 gene locus_tag LOCUS_34890 2993 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 3205 2990 gene locus_tag LOCUS_34900 3205 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 4099 3218 gene locus_tag LOCUS_34910 4099 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 4533 4237 gene locus_tag LOCUS_34920 4533 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 5150 4530 gene locus_tag LOCUS_34930 5150 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 5472 5197 gene locus_tag LOCUS_34940 5472 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 7128 5476 gene locus_tag LOCUS_34950 7128 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 7359 7228 gene locus_tag LOCUS_34960 7359 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence0299 684 82 gene locus_tag LOCUS_34970 684 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 1447 698 gene locus_tag LOCUS_34980 1447 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 1373 1564 gene locus_tag LOCUS_34990 1373 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 2134 1544 gene locus_tag LOCUS_35000 2134 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 3471 2131 gene locus_tag LOCUS_35010 gene hisS 3471 2131 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_35010 4764 3553 gene locus_tag LOCUS_35020 4764 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 4697 4906 gene locus_tag LOCUS_35030 4697 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 4943 5455 gene locus_tag LOCUS_35040 4943 5455 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040134.1 protein_id gnl|my_center|LOCUS_35040 6033 5557 gene locus_tag LOCUS_35050 6033 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 7311 6049 gene locus_tag LOCUS_35060 gene glgC 7311 6049 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_35060 <8090 7383 gene locus_tag LOCUS_35070 <8090 7383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226125.1:glycosyltransferase family 1 protein >Feature sequence0300 418 83 gene locus_tag LOCUS_35080 418 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 360 1946 gene locus_tag LOCUS_35090 360 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 2387 2704 gene locus_tag LOCUS_35100 2387 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 3195 2770 gene locus_tag LOCUS_35110 3195 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3492 3259 gene locus_tag LOCUS_35120 3492 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 3791 3489 gene locus_tag LOCUS_35130 3791 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 4493 3870 gene locus_tag LOCUS_35140 4493 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 5110 4646 gene locus_tag LOCUS_35150 5110 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 5000 5332 gene locus_tag LOCUS_35160 5000 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 6069 5800 gene locus_tag LOCUS_35170 6069 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 6370 6561 gene locus_tag LOCUS_35180 6370 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 >Feature sequence0301 138 503 gene locus_tag LOCUS_35190 138 503 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703181.1 protein_id gnl|my_center|LOCUS_35190 506 907 gene locus_tag LOCUS_35200 506 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 2213 1071 gene locus_tag LOCUS_35210 2213 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 2611 2225 gene locus_tag LOCUS_35220 2611 2225 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_35220 2850 2608 gene locus_tag LOCUS_35230 2850 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 4134 2896 gene locus_tag LOCUS_35240 4134 2896 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 protein_id gnl|my_center|LOCUS_35240 5483 4305 gene locus_tag LOCUS_35250 5483 4305 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242620.1 protein_id gnl|my_center|LOCUS_35250 6106 5618 gene locus_tag LOCUS_35260 6106 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35260 6703 6404 gene locus_tag LOCUS_35270 6703 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 >Feature sequence0302 <1 1159 gene locus_tag LOCUS_35280 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962256.1:di-heme oxidoredictase family protein 2068 1172 gene locus_tag LOCUS_35290 2068 1172 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887745.1 protein_id gnl|my_center|LOCUS_35290 2495 2085 gene locus_tag LOCUS_35300 2495 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3063 2617 gene locus_tag LOCUS_35310 3063 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 3579 3130 gene locus_tag LOCUS_35320 3579 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 7179 3616 gene locus_tag LOCUS_35330 7179 3616 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_35330 >Feature sequence0303 655 293 gene locus_tag LOCUS_35340 655 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 997 674 gene locus_tag LOCUS_35350 997 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 1257 982 gene locus_tag LOCUS_35360 1257 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 1764 1330 gene locus_tag LOCUS_35370 1764 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 2069 1713 gene locus_tag LOCUS_35380 2069 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 2900 2193 gene locus_tag LOCUS_35390 2900 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 3171 3641 gene locus_tag LOCUS_35400 gene ribE 3171 3641 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258065.1 protein_id gnl|my_center|LOCUS_35400 3756 4415 gene locus_tag LOCUS_35410 3756 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 4996 4499 gene locus_tag LOCUS_35420 4996 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 <7936 5057 gene locus_tag LOCUS_35430 <7936 5057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839328.1:SMC family ATPase >Feature sequence0304 295 969 gene locus_tag LOCUS_35440 295 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 1357 1091 gene locus_tag LOCUS_35450 1357 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 1241 3208 gene locus_tag LOCUS_35460 1241 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 3345 3770 gene locus_tag LOCUS_35470 3345 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 3852 4262 gene locus_tag LOCUS_35480 3852 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 4368 4631 gene locus_tag LOCUS_35490 4368 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 5133 4717 gene locus_tag LOCUS_35500 5133 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 5429 5130 gene locus_tag LOCUS_35510 5429 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 5702 6730 gene locus_tag LOCUS_35520 5702 6730 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 protein_id gnl|my_center|LOCUS_35520 7629 6892 gene locus_tag LOCUS_35530 7629 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 >Feature sequence0305 365 75 gene locus_tag LOCUS_35540 365 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 1399 461 gene locus_tag LOCUS_35550 gene moaA 1399 461 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_35550 2160 1573 gene locus_tag LOCUS_35560 2160 1573 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_35560 2672 2157 gene locus_tag LOCUS_35570 2672 2157 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_35570 3194 2826 gene locus_tag LOCUS_35580 3194 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 3477 3232 gene locus_tag LOCUS_35590 gene moaD 3477 3232 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_35590 6578 3618 gene locus_tag LOCUS_35600 6578 3618 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_35600 7336 6701 gene locus_tag LOCUS_35610 gene folE 7336 6701 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336701.1 protein_id gnl|my_center|LOCUS_35610 7644 7333 gene locus_tag LOCUS_35620 7644 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence0306 <1 595 gene locus_tag LOCUS_35630 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083922.1:chemotaxis response regulator protein-glutamate methylesterase 5379 784 gene locus_tag LOCUS_35640 5379 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 6496 5495 gene locus_tag LOCUS_35650 6496 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 7420 7193 gene locus_tag LOCUS_35660 7420 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence0307 152 1864 gene locus_tag LOCUS_35670 152 1864 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122444.1 protein_id gnl|my_center|LOCUS_35670 2238 1894 gene locus_tag LOCUS_35680 2238 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 2358 3209 gene locus_tag LOCUS_35690 2358 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 3281 3589 gene locus_tag LOCUS_35700 3281 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 3586 3906 gene locus_tag LOCUS_35710 3586 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 4436 3903 gene locus_tag LOCUS_35720 4436 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 protein_id gnl|my_center|LOCUS_35720 6005 4587 gene locus_tag LOCUS_35730 6005 4587 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_35730 6158 7171 gene locus_tag LOCUS_35740 6158 7171 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_35740 >Feature sequence0308 181 864 gene locus_tag LOCUS_35750 181 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 1142 1068 gene locus_tag LOCUS_t00370 1142 1068 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1223 2554 gene locus_tag LOCUS_35760 1223 2554 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_35760 3131 5848 gene locus_tag LOCUS_35770 3131 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35770 5845 6288 gene locus_tag LOCUS_35780 5845 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 6613 6876 gene locus_tag LOCUS_35790 6613 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 6882 7238 gene locus_tag LOCUS_35800 6882 7238 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence0309 304 1263 gene locus_tag LOCUS_35810 304 1263 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339199.1 protein_id gnl|my_center|LOCUS_35810 2628 1723 gene locus_tag LOCUS_35820 2628 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 3665 2655 gene locus_tag LOCUS_35830 3665 2655 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732405.1 protein_id gnl|my_center|LOCUS_35830 4709 3762 gene locus_tag LOCUS_35840 4709 3762 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406943.1 protein_id gnl|my_center|LOCUS_35840 6315 4900 gene locus_tag LOCUS_35850 6315 4900 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776179.1 protein_id gnl|my_center|LOCUS_35850 7623 6331 gene locus_tag LOCUS_35860 7623 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence0310 435 1103 gene locus_tag LOCUS_35870 435 1103 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_35870 1100 3859 gene locus_tag LOCUS_35880 1100 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 3974 4999 gene locus_tag LOCUS_35890 3974 4999 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190908.1 protein_id gnl|my_center|LOCUS_35890 5454 4996 gene locus_tag LOCUS_35900 5454 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 5711 5451 gene locus_tag LOCUS_35910 5711 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 6248 5742 gene locus_tag LOCUS_35920 6248 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 6449 7426 gene locus_tag LOCUS_35930 6449 7426 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_35930 >Feature sequence0311 161 1912 gene locus_tag LOCUS_35940 161 1912 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003660.1 protein_id gnl|my_center|LOCUS_35940 2106 3350 gene locus_tag LOCUS_35950 2106 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 3432 3593 gene locus_tag LOCUS_35960 3432 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 3650 3895 gene locus_tag LOCUS_35970 3650 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 3992 4507 gene locus_tag LOCUS_35980 3992 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 4504 6681 gene locus_tag LOCUS_35990 4504 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 >Feature sequence0312 104 511 gene locus_tag LOCUS_36000 104 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 1471 566 gene locus_tag LOCUS_36010 1471 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 2114 1581 gene locus_tag LOCUS_36020 gene mog 2114 1581 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_36020 2245 3450 gene locus_tag LOCUS_36030 2245 3450 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970145.1 protein_id gnl|my_center|LOCUS_36030 3589 4764 gene locus_tag LOCUS_36040 3589 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 4761 6407 gene locus_tag LOCUS_36050 4761 6407 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_36050 6443 6910 gene locus_tag LOCUS_36060 6443 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 7711 6950 gene locus_tag LOCUS_36070 7711 6950 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_36070 >Feature sequence0313 1015 197 gene locus_tag LOCUS_36080 1015 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 1236 2492 gene locus_tag LOCUS_36090 1236 2492 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176146113.1 protein_id gnl|my_center|LOCUS_36090 3234 2686 gene locus_tag LOCUS_36100 3234 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 3313 4008 gene locus_tag LOCUS_36110 3313 4008 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141378.1 protein_id gnl|my_center|LOCUS_36110 4481 4080 gene locus_tag LOCUS_36120 4481 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 4878 6014 gene locus_tag LOCUS_36130 4878 6014 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_36130 6070 6669 gene locus_tag LOCUS_36140 6070 6669 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence0314 174 1121 gene locus_tag LOCUS_36150 174 1121 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36150 1200 3077 gene locus_tag LOCUS_36160 1200 3077 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_36160 3133 3669 gene locus_tag LOCUS_36170 3133 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 4477 4923 gene locus_tag LOCUS_36180 4477 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 4920 5663 gene locus_tag LOCUS_36190 4920 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 5688 5882 gene locus_tag LOCUS_36200 5688 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 7392 5953 gene locus_tag LOCUS_36210 7392 5953 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence0315 1166 639 gene locus_tag LOCUS_36220 1166 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 3113 1188 gene locus_tag LOCUS_36230 3113 1188 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_36230 3912 3247 gene locus_tag LOCUS_36240 3912 3247 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022379.1 protein_id gnl|my_center|LOCUS_36240 4046 6022 gene locus_tag LOCUS_36250 4046 6022 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_36250 7725 6442 gene locus_tag LOCUS_36260 7725 6442 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943127.1 protein_id gnl|my_center|LOCUS_36260 >Feature sequence0316 1373 321 gene locus_tag LOCUS_36270 1373 321 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_36270 2567 1515 gene locus_tag LOCUS_36280 2567 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 3134 4825 gene locus_tag LOCUS_36290 3134 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 5650 4886 gene locus_tag LOCUS_36300 5650 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 6511 5756 gene locus_tag LOCUS_36310 6511 5756 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268503.1 protein_id gnl|my_center|LOCUS_36310 >Feature sequence0317 1728 43 gene locus_tag LOCUS_36320 1728 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 1953 2378 gene locus_tag LOCUS_36330 gene arfB 1953 2378 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721956.1 protein_id gnl|my_center|LOCUS_36330 3956 2448 gene locus_tag LOCUS_36340 3956 2448 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324689.1 protein_id gnl|my_center|LOCUS_36340 4206 4823 gene locus_tag LOCUS_36350 4206 4823 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_36350 6340 4934 gene locus_tag LOCUS_36360 6340 4934 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_36360 6922 6344 gene locus_tag LOCUS_36370 6922 6344 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_36370 7687 6941 gene locus_tag LOCUS_36380 7687 6941 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_36380 >Feature sequence0318 2868 124 gene locus_tag LOCUS_36390 2868 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 3707 2928 gene locus_tag LOCUS_36400 3707 2928 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922136.1 protein_id gnl|my_center|LOCUS_36400 5224 3761 gene locus_tag LOCUS_36410 5224 3761 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_36410 <7762 5236 gene locus_tag LOCUS_36420 <7762 5236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117969.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0319 3403 1676 gene locus_tag LOCUS_36430 3403 1676 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_36430 3653 6970 gene locus_tag LOCUS_36440 3653 6970 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_36440 7197 7622 gene locus_tag LOCUS_36450 7197 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence0320 101 2635 gene locus_tag LOCUS_36460 101 2635 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_36460 4662 2686 gene locus_tag LOCUS_36470 4662 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 5708 4815 gene locus_tag LOCUS_36480 5708 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 6566 5781 gene locus_tag LOCUS_36490 6566 5781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_36490 >Feature sequence0321 <1 814 gene locus_tag LOCUS_36500 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187151961.1:ABC transporter ATP-binding protein 1539 2735 gene locus_tag LOCUS_36510 1539 2735 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681203.1 protein_id gnl|my_center|LOCUS_36510 2884 4458 gene locus_tag LOCUS_36520 2884 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 4655 5284 gene locus_tag LOCUS_36530 4655 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 5281 5514 gene locus_tag LOCUS_36540 5281 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 5678 6178 gene locus_tag LOCUS_36550 5678 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 6920 6441 gene locus_tag LOCUS_36560 6920 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence0322 55 1092 gene locus_tag LOCUS_36570 55 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 1146 2216 gene locus_tag LOCUS_36580 1146 2216 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003378.1 protein_id gnl|my_center|LOCUS_36580 2234 2890 gene locus_tag LOCUS_36590 2234 2890 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115023.1 protein_id gnl|my_center|LOCUS_36590 2887 4203 gene locus_tag LOCUS_36600 2887 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 4480 5115 gene locus_tag LOCUS_36610 4480 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 5293 6606 gene locus_tag LOCUS_36620 5293 6606 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275473.1 protein_id gnl|my_center|LOCUS_36620 >Feature sequence0323 2620 917 gene locus_tag LOCUS_36630 2620 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 6163 2873 gene locus_tag LOCUS_36640 6163 2873 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940506.1 protein_id gnl|my_center|LOCUS_36640 5595 5498 gene locus_tag LOCUS_t00380 5595 5498 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <7676 6275 gene locus_tag LOCUS_36650 <7676 6275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367128.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0324 368 57 gene locus_tag LOCUS_36660 368 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 1348 428 gene locus_tag LOCUS_36670 1348 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 1412 2275 gene locus_tag LOCUS_36680 1412 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 2295 3299 gene locus_tag LOCUS_36690 2295 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 4267 3434 gene locus_tag LOCUS_36700 4267 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 5156 4275 gene locus_tag LOCUS_36710 5156 4275 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_36710 6391 5153 gene locus_tag LOCUS_36720 6391 5153 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_36720 6931 7317 gene locus_tag LOCUS_36730 6931 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence0325 380 1126 gene locus_tag LOCUS_36740 gene ispD 380 1126 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_36740 2158 1256 gene locus_tag LOCUS_36750 2158 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 3939 2380 gene locus_tag LOCUS_36760 3939 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 4610 4122 gene locus_tag LOCUS_36770 4610 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 4701 6101 gene locus_tag LOCUS_36780 4701 6101 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389742.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence0326 1175 144 gene locus_tag LOCUS_36790 1175 144 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814616.1 protein_id gnl|my_center|LOCUS_36790 1393 1554 gene locus_tag LOCUS_36800 1393 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 1582 1944 gene locus_tag LOCUS_36810 1582 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 3910 2078 gene locus_tag LOCUS_36820 gene glmS 3910 2078 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_36820 5448 3991 gene locus_tag LOCUS_36830 5448 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 5870 6199 gene locus_tag LOCUS_36840 5870 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 6958 6131 gene locus_tag LOCUS_36850 6958 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence0327 130 933 gene locus_tag LOCUS_36860 130 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 1020 1691 gene locus_tag LOCUS_36870 1020 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 2808 1654 gene locus_tag LOCUS_36880 2808 1654 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_36880 4526 2949 gene locus_tag LOCUS_36890 4526 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 6015 4519 gene locus_tag LOCUS_36900 6015 4519 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084967.1 protein_id gnl|my_center|LOCUS_36900 <7589 6133 gene locus_tag LOCUS_36910 <7589 6133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970582.1:arylsulfatase >Feature sequence0328 954 397 gene locus_tag LOCUS_36920 954 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 1481 951 gene locus_tag LOCUS_36930 1481 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 1955 1506 gene locus_tag LOCUS_36940 1955 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 3460 2249 gene locus_tag LOCUS_36950 3460 2249 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_36950 5312 3552 gene locus_tag LOCUS_36960 5312 3552 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_36960 5497 6174 gene locus_tag LOCUS_36970 5497 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 7253 6153 gene locus_tag LOCUS_36980 gene queG 7253 6153 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_36980 >Feature sequence0329 1685 921 gene locus_tag LOCUS_36990 1685 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 2432 1848 gene locus_tag LOCUS_37000 2432 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 2547 3011 gene locus_tag LOCUS_37010 2547 3011 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349893.1 protein_id gnl|my_center|LOCUS_37010 3435 3037 gene locus_tag LOCUS_37020 3435 3037 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_37020 3664 3419 gene locus_tag LOCUS_37030 3664 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 4278 3736 gene locus_tag LOCUS_37040 4278 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 4556 4275 gene locus_tag LOCUS_37050 4556 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 4437 5267 gene locus_tag LOCUS_37060 4437 5267 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169980830.1 protein_id gnl|my_center|LOCUS_37060 5385 6080 gene locus_tag LOCUS_37070 5385 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence0330 1211 117 gene locus_tag LOCUS_37080 1211 117 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_37080 1799 1299 gene locus_tag LOCUS_37090 1799 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 4730 1884 gene locus_tag LOCUS_37100 4730 1884 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085893.1 protein_id gnl|my_center|LOCUS_37100 4901 5503 gene locus_tag LOCUS_37110 4901 5503 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_37110 >Feature sequence0331 63 560 gene locus_tag LOCUS_37120 63 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 661 1344 gene locus_tag LOCUS_37130 661 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 2903 1506 gene locus_tag LOCUS_37140 2903 1506 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_37140 5429 3015 gene locus_tag LOCUS_37150 5429 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 5557 7398 gene locus_tag LOCUS_37160 5557 7398 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_37160 >Feature sequence0332 465 337 gene locus_tag LOCUS_37170 465 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 749 468 gene locus_tag LOCUS_37180 749 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 890 1717 gene locus_tag LOCUS_37190 890 1717 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_37190 1852 3021 gene locus_tag LOCUS_37200 1852 3021 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_37200 3098 3490 gene locus_tag LOCUS_37210 3098 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 3493 4011 gene locus_tag LOCUS_37220 3493 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 4994 4104 gene locus_tag LOCUS_37230 4994 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 6890 5061 gene locus_tag LOCUS_37240 6890 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 >Feature sequence0333 827 468 gene locus_tag LOCUS_37250 827 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 2652 1216 gene locus_tag LOCUS_37260 2652 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 2746 3765 gene locus_tag LOCUS_37270 2746 3765 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259009.1 protein_id gnl|my_center|LOCUS_37270 4199 3750 gene locus_tag LOCUS_37280 4199 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 4598 4470 gene locus_tag LOCUS_37290 4598 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 4774 6186 gene locus_tag LOCUS_37300 4774 6186 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009972112.1 protein_id gnl|my_center|LOCUS_37300 7190 6183 gene locus_tag LOCUS_37310 7190 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence0334 3919 488 gene locus_tag LOCUS_37320 3919 488 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_37320 5048 4128 gene locus_tag LOCUS_37330 5048 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 5263 5886 gene locus_tag LOCUS_37340 5263 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 6034 7152 gene locus_tag LOCUS_37350 6034 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 >Feature sequence0335 4223 1380 gene locus_tag LOCUS_37360 gene fdhF 4223 1380 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_37360 5830 4220 gene locus_tag LOCUS_37370 5830 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 6396 5899 gene locus_tag LOCUS_37380 6396 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 6672 6400 gene locus_tag LOCUS_37390 6672 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 <7383 6730 gene locus_tag LOCUS_37400 <7383 6730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140584.1:S9 family peptidase >Feature sequence0336 227 1015 gene locus_tag LOCUS_37410 227 1015 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_37410 1159 4512 gene locus_tag LOCUS_37420 1159 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 4990 4553 gene locus_tag LOCUS_37430 4990 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 6370 5003 gene locus_tag LOCUS_37440 gene dnaB 6370 5003 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118493.1 protein_id gnl|my_center|LOCUS_37440 7172 6546 gene locus_tag LOCUS_37450 gene rplI 7172 6546 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 protein_id gnl|my_center|LOCUS_37450 >Feature sequence0337 93 467 gene locus_tag LOCUS_37460 93 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 525 1019 gene locus_tag LOCUS_37470 525 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 2560 1025 gene locus_tag LOCUS_37480 gene pckA 2560 1025 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_37480 2810 3973 gene locus_tag LOCUS_37490 2810 3973 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123048.1 protein_id gnl|my_center|LOCUS_37490 4048 4431 gene locus_tag LOCUS_37500 4048 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 4597 5775 gene locus_tag LOCUS_37510 gene argJ 4597 5775 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_37510 5879 6811 gene locus_tag LOCUS_37520 5879 6811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_37520 >Feature sequence0338 159 1619 gene locus_tag LOCUS_37530 159 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 2888 1626 gene locus_tag LOCUS_37540 2888 1626 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_37540 3575 3042 gene locus_tag LOCUS_37550 3575 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 4349 3699 gene locus_tag LOCUS_37560 4349 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 5155 4409 gene locus_tag LOCUS_37570 5155 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 5819 5547 gene locus_tag LOCUS_37580 5819 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 6166 5942 gene locus_tag LOCUS_37590 gene infA 6166 5942 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328023.1 protein_id gnl|my_center|LOCUS_37590 7082 6402 gene locus_tag LOCUS_37600 gene yghX 7082 6402 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267754.1 protein_id gnl|my_center|LOCUS_37600 >Feature sequence0339 1096 3720 gene locus_tag LOCUS_37610 gene clpB 1096 3720 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939160.1 protein_id gnl|my_center|LOCUS_37610 3799 4023 gene locus_tag LOCUS_37620 3799 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 4020 4439 gene locus_tag LOCUS_37630 4020 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 4457 4702 gene locus_tag LOCUS_37640 4457 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 4820 4990 gene locus_tag LOCUS_37650 4820 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 5722 5000 gene locus_tag LOCUS_37660 5722 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 5865 7085 gene locus_tag LOCUS_37670 5865 7085 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_37670 >Feature sequence0340 4403 2379 gene locus_tag LOCUS_37680 4403 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 5438 4527 gene locus_tag LOCUS_37690 5438 4527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_37690 6367 5657 gene locus_tag LOCUS_37700 6367 5657 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767401.1 protein_id gnl|my_center|LOCUS_37700 7323 6481 gene locus_tag LOCUS_37710 7323 6481 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_37710 >Feature sequence0341 2206 1499 gene locus_tag LOCUS_37720 2206 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 2819 2304 gene locus_tag LOCUS_37730 2819 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 2913 3893 gene locus_tag LOCUS_37740 2913 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 3992 5578 gene locus_tag LOCUS_37750 gene purH 3992 5578 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_37750 5706 6776 gene locus_tag LOCUS_37760 5706 6776 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922921.1 protein_id gnl|my_center|LOCUS_37760 >Feature sequence0342 771 166 gene locus_tag LOCUS_37770 771 166 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_37770 1482 853 gene locus_tag LOCUS_37780 1482 853 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_37780 2204 1578 gene locus_tag LOCUS_37790 2204 1578 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_37790 5536 2279 gene locus_tag LOCUS_37800 5536 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 7016 6003 gene locus_tag LOCUS_37810 7016 6003 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_37810 >Feature sequence0343 206 961 gene locus_tag LOCUS_37820 206 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946778.1 protein_id gnl|my_center|LOCUS_37820 958 1749 gene locus_tag LOCUS_37830 958 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444655.1 protein_id gnl|my_center|LOCUS_37830 1763 3385 gene locus_tag LOCUS_37840 gene zwf 1763 3385 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888234.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37840 3435 3824 gene locus_tag LOCUS_37850 3435 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 3863 4672 gene locus_tag LOCUS_37860 3863 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 4749 6059 gene locus_tag LOCUS_37870 4749 6059 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552083.1 protein_id gnl|my_center|LOCUS_37870 >Feature sequence0344 1488 853 gene locus_tag LOCUS_37880 1488 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 <7292 1708 gene locus_tag LOCUS_37890 <7292 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243811.1:calcium-binding protein >Feature sequence0345 389 598 gene locus_tag LOCUS_37900 389 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 1728 643 gene locus_tag LOCUS_37910 1728 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 1942 1867 gene locus_tag LOCUS_t00390 1942 1867 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2265 3650 gene locus_tag LOCUS_37920 2265 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 3700 5940 gene locus_tag LOCUS_37930 3700 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 6020 6104 gene locus_tag LOCUS_t00400 6020 6104 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <7281 6269 gene locus_tag LOCUS_37940 <7281 6269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070418.1:POT family MFS transporter >Feature sequence0346 833 456 gene locus_tag LOCUS_37950 833 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 1244 975 gene locus_tag LOCUS_37960 1244 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 2665 1574 gene locus_tag LOCUS_37970 2665 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 3168 6206 gene locus_tag LOCUS_37980 3168 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 6315 7085 gene locus_tag LOCUS_37990 6315 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 >Feature sequence0347 >Feature sequence0348 456 148 gene locus_tag LOCUS_38000 456 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 719 453 gene locus_tag LOCUS_38010 719 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 2314 743 gene locus_tag LOCUS_38020 2314 743 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_38020 2622 2807 gene locus_tag LOCUS_38030 2622 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 4399 2852 gene locus_tag LOCUS_38040 gene cobA 4399 2852 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_38040 5687 4524 gene locus_tag LOCUS_38050 gene tatC 5687 4524 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338730.1 protein_id gnl|my_center|LOCUS_38050 5894 6133 gene locus_tag LOCUS_38060 5894 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 >Feature sequence0349 192 818 gene locus_tag LOCUS_38070 192 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 2824 890 gene locus_tag LOCUS_38080 gene selB 2824 890 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_38080 2905 3180 gene locus_tag LOCUS_38090 2905 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 3177 3578 gene locus_tag LOCUS_38100 3177 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 3612 4202 gene locus_tag LOCUS_38110 3612 4202 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_38110 4280 4963 gene locus_tag LOCUS_38120 4280 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 5734 5069 gene locus_tag LOCUS_38130 5734 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 7049 5820 gene locus_tag LOCUS_38140 7049 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 >Feature sequence0350 1086 2000 gene locus_tag LOCUS_38150 gene ftsY 1086 2000 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331084.1 protein_id gnl|my_center|LOCUS_38150 3277 2147 gene locus_tag LOCUS_38160 3277 2147 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_38160 3712 3281 gene locus_tag LOCUS_38170 3712 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 5054 3813 gene locus_tag LOCUS_38180 5054 3813 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_38180 5582 5091 gene locus_tag LOCUS_38190 5582 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 6203 5589 gene locus_tag LOCUS_38200 6203 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 <7243 6352 gene locus_tag LOCUS_38210 <7243 6352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920780.1:alpha/beta fold hydrolase >Feature sequence0351 800 612 gene locus_tag LOCUS_38220 800 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 1891 827 gene locus_tag LOCUS_38230 1891 827 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_38230 2376 2209 gene locus_tag LOCUS_38240 2376 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 3542 2466 gene locus_tag LOCUS_38250 3542 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 5224 3812 gene locus_tag LOCUS_38260 gene rimO 5224 3812 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 protein_id gnl|my_center|LOCUS_38260 5765 6595 gene locus_tag LOCUS_38270 5765 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 6599 7093 gene locus_tag LOCUS_38280 6599 7093 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241839.1 protein_id gnl|my_center|LOCUS_38280 >Feature sequence0352 1515 733 gene locus_tag LOCUS_38290 1515 733 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816315.1 protein_id gnl|my_center|LOCUS_38290 3751 1649 gene locus_tag LOCUS_38300 3751 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 3956 4936 gene locus_tag LOCUS_38310 3956 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 5481 5050 gene locus_tag LOCUS_38320 5481 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence0353 1552 3363 gene locus_tag LOCUS_38330 1552 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 4656 3664 gene locus_tag LOCUS_38340 4656 3664 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_38340 5641 4796 gene locus_tag LOCUS_38350 5641 4796 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_38350 5774 6517 gene locus_tag LOCUS_38360 5774 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 6637 6984 gene locus_tag LOCUS_38370 6637 6984 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222125.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence0354 1069 1761 gene locus_tag LOCUS_38380 1069 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 2179 1772 gene locus_tag LOCUS_38390 2179 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 2448 2176 gene locus_tag LOCUS_38400 2448 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 2979 2515 gene locus_tag LOCUS_38410 2979 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 3245 2979 gene locus_tag LOCUS_38420 3245 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 3967 4266 gene locus_tag LOCUS_38430 3967 4266 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551648.1 protein_id gnl|my_center|LOCUS_38430 4317 4598 gene locus_tag LOCUS_38440 4317 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 4608 4814 gene locus_tag LOCUS_38450 4608 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 4859 5335 gene locus_tag LOCUS_38460 4859 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 5521 5994 gene locus_tag LOCUS_38470 5521 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 6375 6067 gene locus_tag LOCUS_38480 6375 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 6626 6994 gene locus_tag LOCUS_38490 6626 6994 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_38490 >Feature sequence0355 1 1095 gene locus_tag LOCUS_38500 1 1095 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_38500 1232 2371 gene locus_tag LOCUS_38510 1232 2371 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_38510 2727 2434 gene locus_tag LOCUS_38520 2727 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 5031 2839 gene locus_tag LOCUS_38530 5031 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 5632 4994 gene locus_tag LOCUS_38540 5632 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 5962 5720 gene locus_tag LOCUS_38550 5962 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 6133 6894 gene locus_tag LOCUS_38560 6133 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 6984 7121 gene locus_tag LOCUS_38570 6984 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 >Feature sequence0356 1740 664 gene locus_tag LOCUS_38580 1740 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3868 2000 gene locus_tag LOCUS_38590 3868 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 4063 4136 gene locus_tag LOCUS_t00410 4063 4136 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5037 4426 gene locus_tag LOCUS_38600 5037 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 <7149 5271 gene locus_tag LOCUS_38610 <7149 5271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084126.1:tetratricopeptide repeat protein >Feature sequence0357 1049 453 gene locus_tag LOCUS_38620 1049 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 2709 1156 gene locus_tag LOCUS_38630 2709 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 4145 2982 gene locus_tag LOCUS_38640 4145 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 6070 4211 gene locus_tag LOCUS_38650 6070 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 6269 6859 gene locus_tag LOCUS_38660 6269 6859 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_38660 >Feature sequence0358 2258 459 gene locus_tag LOCUS_38670 2258 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 4690 2306 gene locus_tag LOCUS_38680 4690 2306 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615857.1 protein_id gnl|my_center|LOCUS_38680 6155 4836 gene locus_tag LOCUS_38690 6155 4836 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_38690 6377 6967 gene locus_tag LOCUS_38700 6377 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 >Feature sequence0359 504 79 gene locus_tag LOCUS_38710 504 79 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088388.1 protein_id gnl|my_center|LOCUS_38710 1397 501 gene locus_tag LOCUS_38720 1397 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 1621 1394 gene locus_tag LOCUS_38730 1621 1394 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_38730 3032 1743 gene locus_tag LOCUS_38740 3032 1743 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_38740 3975 3307 gene locus_tag LOCUS_38750 3975 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 4248 5270 gene locus_tag LOCUS_38760 4248 5270 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_38760 5403 5807 gene locus_tag LOCUS_38770 5403 5807 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_38770 5910 6368 gene locus_tag LOCUS_38780 5910 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 6850 6374 gene locus_tag LOCUS_38790 6850 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 >Feature sequence0360 130 576 gene locus_tag LOCUS_38800 130 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 983 1822 gene locus_tag LOCUS_38810 983 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 3262 1952 gene locus_tag LOCUS_38820 gene argA 3262 1952 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702691.1 protein_id gnl|my_center|LOCUS_38820 3445 4515 gene locus_tag LOCUS_38830 3445 4515 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_38830 4535 5149 gene locus_tag LOCUS_38840 4535 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 5458 6222 gene locus_tag LOCUS_38850 5458 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 7036 6308 gene locus_tag LOCUS_38860 7036 6308 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_38860 >Feature sequence0361 2589 1660 gene locus_tag LOCUS_38870 gene nhaR 2589 1660 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_38870 2700 3044 gene locus_tag LOCUS_38880 2700 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 3077 3301 gene locus_tag LOCUS_38890 3077 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 3380 3754 gene locus_tag LOCUS_38900 3380 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 3818 4156 gene locus_tag LOCUS_38910 3818 4156 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_38910 4214 6994 gene locus_tag LOCUS_38920 4214 6994 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_38920 >Feature sequence0362 1402 20 gene locus_tag LOCUS_38930 1402 20 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_38930 1655 3100 gene locus_tag LOCUS_38940 gene ffh 1655 3100 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_38940 3291 4625 gene locus_tag LOCUS_38950 3291 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 4725 5762 gene locus_tag LOCUS_38960 4725 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence0363 2764 1526 gene locus_tag LOCUS_38970 2764 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 3934 2771 gene locus_tag LOCUS_38980 3934 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 5477 4251 gene locus_tag LOCUS_38990 5477 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 5887 6183 gene locus_tag LOCUS_39000 5887 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 6800 6988 gene locus_tag LOCUS_39010 6800 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence0364 366 76 gene locus_tag LOCUS_39020 366 76 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776476.1 protein_id gnl|my_center|LOCUS_39020 493 1017 gene locus_tag LOCUS_39030 493 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 2867 1152 gene locus_tag LOCUS_39040 2867 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 2939 3769 gene locus_tag LOCUS_39050 gene trpA 2939 3769 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 protein_id gnl|my_center|LOCUS_39050 4010 4558 gene locus_tag LOCUS_39060 4010 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 >Feature sequence0365 852 643 gene locus_tag LOCUS_39070 852 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 1236 946 gene locus_tag LOCUS_39080 1236 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 2128 1631 gene locus_tag LOCUS_39090 2128 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 2806 2204 gene locus_tag LOCUS_39100 2806 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 3775 2957 gene locus_tag LOCUS_39110 3775 2957 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498063.1 protein_id gnl|my_center|LOCUS_39110 3759 3962 gene locus_tag LOCUS_39120 3759 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4226 4459 gene locus_tag LOCUS_39130 4226 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 4754 4473 gene locus_tag LOCUS_39140 4754 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 4865 5113 gene locus_tag LOCUS_39150 4865 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 5222 6634 gene locus_tag LOCUS_39160 5222 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 >Feature sequence0366 2106 3164 gene locus_tag LOCUS_39170 2106 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 3613 3686 gene locus_tag LOCUS_t00420 3613 3686 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3766 4080 gene locus_tag LOCUS_39180 3766 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 4432 4097 gene locus_tag LOCUS_39190 4432 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4766 4365 gene locus_tag LOCUS_39200 4766 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 4905 5198 gene locus_tag LOCUS_39210 4905 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 5195 5560 gene locus_tag LOCUS_39220 5195 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 5627 6832 gene locus_tag LOCUS_39230 5627 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 >Feature sequence0367 2695 437 gene locus_tag LOCUS_39240 2695 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 2589 2888 gene locus_tag LOCUS_39250 2589 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 2927 4369 gene locus_tag LOCUS_39260 2927 4369 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_39260 4392 4727 gene locus_tag LOCUS_39270 4392 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 4885 5454 gene locus_tag LOCUS_39280 4885 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 5559 6929 gene locus_tag LOCUS_39290 5559 6929 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_39290 >Feature sequence0368 209 541 gene locus_tag LOCUS_39300 209 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 855 1829 gene locus_tag LOCUS_39310 855 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 2819 1884 gene locus_tag LOCUS_39320 gene rsmA 2819 1884 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 protein_id gnl|my_center|LOCUS_39320 3508 2915 gene locus_tag LOCUS_39330 3508 2915 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_39330 3626 4639 gene locus_tag LOCUS_39340 3626 4639 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865320.1 protein_id gnl|my_center|LOCUS_39340 4823 4653 gene locus_tag LOCUS_39350 4823 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 5575 4967 gene locus_tag LOCUS_39360 5575 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 <7003 5723 gene locus_tag LOCUS_39370 <7003 5723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058222.1:adenosylhomocysteinase >Feature sequence0369 2274 877 gene locus_tag LOCUS_39380 2274 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 3719 2313 gene locus_tag LOCUS_39390 3719 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 5164 4601 gene locus_tag LOCUS_39400 5164 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 5737 5189 gene locus_tag LOCUS_39410 5737 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence0370 475 1092 gene locus_tag LOCUS_39420 475 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 1175 1600 gene locus_tag LOCUS_39430 1175 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 2304 1642 gene locus_tag LOCUS_39440 2304 1642 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 protein_id gnl|my_center|LOCUS_39440 3739 2675 gene locus_tag LOCUS_39450 3739 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 4226 3861 gene locus_tag LOCUS_39460 4226 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 4335 4550 gene locus_tag LOCUS_39470 4335 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 5029 4649 gene locus_tag LOCUS_39480 5029 4649 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_39480 5122 5865 gene locus_tag LOCUS_39490 gene queC 5122 5865 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_39490 5922 6836 gene locus_tag LOCUS_39500 5922 6836 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 protein_id gnl|my_center|LOCUS_39500 >Feature sequence0371 105 1451 gene locus_tag LOCUS_39510 105 1451 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_39510 1472 2287 gene locus_tag LOCUS_39520 1472 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 3300 2284 gene locus_tag LOCUS_39530 3300 2284 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121700.1 protein_id gnl|my_center|LOCUS_39530 3698 3348 gene locus_tag LOCUS_39540 3698 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39540 4741 3593 gene locus_tag LOCUS_39550 4741 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39550 >Feature sequence0372 1 1782 gene locus_tag LOCUS_39560 1 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 1825 2238 gene locus_tag LOCUS_39570 1825 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 2342 2611 gene locus_tag LOCUS_39580 2342 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 2608 3108 gene locus_tag LOCUS_39590 2608 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 3377 3117 gene locus_tag LOCUS_39600 3377 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 5468 3426 gene locus_tag LOCUS_39610 5468 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 6584 5685 gene locus_tag LOCUS_39620 6584 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_39620 >Feature sequence0373 297 1514 gene locus_tag LOCUS_39630 297 1514 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_39630 6532 >6888 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq caacgccatcttcggcgggaccgg >Feature sequence0374 138 1349 gene locus_tag LOCUS_39640 138 1349 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420380.1 protein_id gnl|my_center|LOCUS_39640 1419 2192 gene locus_tag LOCUS_39650 1419 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 3276 2287 gene locus_tag LOCUS_39660 3276 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39660 4222 3443 gene locus_tag LOCUS_39670 4222 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 4380 5567 gene locus_tag LOCUS_39680 4380 5567 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669535.1 protein_id gnl|my_center|LOCUS_39680 6482 5625 gene locus_tag LOCUS_39690 6482 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 >Feature sequence0375 756 220 gene locus_tag LOCUS_39700 756 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 1474 2154 gene locus_tag LOCUS_39710 1474 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 3335 2355 gene locus_tag LOCUS_39720 3335 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4433 3474 gene locus_tag LOCUS_39730 4433 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 >Feature sequence0376 <1 3707 gene locus_tag LOCUS_39740 <1 3707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941986.1:CusA/CzcA family heavy metal efflux RND transporter 3847 5940 gene locus_tag LOCUS_39750 3847 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 6000 6677 gene locus_tag LOCUS_39760 6000 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 >Feature sequence0377 928 242 gene locus_tag LOCUS_39770 928 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 1058 1717 gene locus_tag LOCUS_39780 1058 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 1787 2425 gene locus_tag LOCUS_39790 1787 2425 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818481.1 protein_id gnl|my_center|LOCUS_39790 3592 2441 gene locus_tag LOCUS_39800 3592 2441 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337844.1 protein_id gnl|my_center|LOCUS_39800 4477 3602 gene locus_tag LOCUS_39810 4477 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 4702 5655 gene locus_tag LOCUS_39820 4702 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 >Feature sequence0378 358 1131 gene locus_tag LOCUS_39830 358 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 3905 1137 gene locus_tag LOCUS_39840 3905 1137 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_39840 4389 4153 gene locus_tag LOCUS_39850 4389 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 4609 4406 gene locus_tag LOCUS_39860 4609 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 5413 4694 gene locus_tag LOCUS_39870 5413 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 6448 5426 gene locus_tag LOCUS_39880 6448 5426 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665997.1 protein_id gnl|my_center|LOCUS_39880 >Feature sequence0379 1041 850 gene locus_tag LOCUS_39890 1041 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 953 2095 gene locus_tag LOCUS_39900 953 2095 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_39900 2172 3668 gene locus_tag LOCUS_39910 2172 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 3678 4847 gene locus_tag LOCUS_39920 3678 4847 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_39920 4987 5742 gene locus_tag LOCUS_39930 4987 5742 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812496.1 protein_id gnl|my_center|LOCUS_39930 5932 5753 gene locus_tag LOCUS_39940 5932 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 6494 6081 gene locus_tag LOCUS_39950 6494 6081 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327289.1 protein_id gnl|my_center|LOCUS_39950 >Feature sequence0380 1300 71 gene locus_tag LOCUS_39960 1300 71 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_39960 1931 1488 gene locus_tag LOCUS_39970 gene dtd 1931 1488 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_39970 2058 2663 gene locus_tag LOCUS_39980 2058 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 3416 2793 gene locus_tag LOCUS_39990 gene upp 3416 2793 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_39990 3988 3584 gene locus_tag LOCUS_40000 3988 3584 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086285.1 protein_id gnl|my_center|LOCUS_40000 5379 4078 gene locus_tag LOCUS_40010 5379 4078 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_40010 >Feature sequence0381 <1 729 gene locus_tag LOCUS_40020 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703894.1:galactonate dehydratase 788 2104 gene locus_tag LOCUS_40030 788 2104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 protein_id gnl|my_center|LOCUS_40030 2180 4588 gene locus_tag LOCUS_40040 2180 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 4708 6045 gene locus_tag LOCUS_40050 4708 6045 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_40050 6392 6535 gene locus_tag LOCUS_40060 6392 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence0382 33 1160 gene locus_tag LOCUS_40070 33 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_40070 1266 1484 gene locus_tag LOCUS_40080 1266 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 1534 2232 gene locus_tag LOCUS_40090 1534 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 2303 3235 gene locus_tag LOCUS_40100 2303 3235 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226358.1 protein_id gnl|my_center|LOCUS_40100 3818 3258 gene locus_tag LOCUS_40110 gene msrA 3818 3258 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_40110 5228 3888 gene locus_tag LOCUS_40120 5228 3888 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_40120 >Feature sequence0383 294 1001 gene locus_tag LOCUS_40130 294 1001 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870611.1 protein_id gnl|my_center|LOCUS_40130 1121 1540 gene locus_tag LOCUS_40140 1121 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 1844 3592 gene locus_tag LOCUS_40150 1844 3592 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_40150 4939 3710 gene locus_tag LOCUS_40160 4939 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 6180 4936 gene locus_tag LOCUS_40170 6180 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 >Feature sequence0384 123 449 gene locus_tag LOCUS_40180 123 449 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478180.1 protein_id gnl|my_center|LOCUS_40180 477 1772 gene locus_tag LOCUS_40190 477 1772 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364999.1 protein_id gnl|my_center|LOCUS_40190 1829 3892 gene locus_tag LOCUS_40200 gene glgX 1829 3892 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_40200 5463 3928 gene locus_tag LOCUS_40210 5463 3928 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_40210 5784 5611 gene locus_tag LOCUS_40220 5784 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 5993 5784 gene locus_tag LOCUS_40230 5993 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 >Feature sequence0385 346 1335 gene locus_tag LOCUS_40240 346 1335 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_40240 1395 1763 gene locus_tag LOCUS_40250 1395 1763 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_40250 1832 2764 gene locus_tag LOCUS_40260 1832 2764 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_40260 2805 3950 gene locus_tag LOCUS_40270 2805 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 4017 4604 gene locus_tag LOCUS_40280 4017 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 4694 5287 gene locus_tag LOCUS_40290 4694 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 5341 6210 gene locus_tag LOCUS_40300 gene pyrF 5341 6210 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_40300 6665 6324 gene locus_tag LOCUS_40310 6665 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence0386 874 95 gene locus_tag LOCUS_40320 874 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 1328 903 gene locus_tag LOCUS_40330 1328 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 2869 1325 gene locus_tag LOCUS_40340 2869 1325 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_40340 3173 4123 gene locus_tag LOCUS_40350 3173 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 4984 4184 gene locus_tag LOCUS_40360 4984 4184 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928847.1 protein_id gnl|my_center|LOCUS_40360 5255 4995 gene locus_tag LOCUS_40370 5255 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 5506 5252 gene locus_tag LOCUS_40380 5506 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 <6662 5577 gene locus_tag LOCUS_40390 <6662 5577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805157.1:sugar phosphate isomerase/epimerase >Feature sequence0387 <1 1536 gene locus_tag LOCUS_40400 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142622.1:S46 family peptidase 1571 2200 gene locus_tag LOCUS_40410 1571 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230911.1 protein_id gnl|my_center|LOCUS_40410 2269 2946 gene locus_tag LOCUS_40420 2269 2946 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_40420 3579 2947 gene locus_tag LOCUS_40430 gene lexA 3579 2947 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080401.1 protein_id gnl|my_center|LOCUS_40430 3927 4970 gene locus_tag LOCUS_40440 gene trpD 3927 4970 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460914.1 protein_id gnl|my_center|LOCUS_40440 4999 5535 gene locus_tag LOCUS_40450 4999 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 5585 6511 gene locus_tag LOCUS_40460 5585 6511 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324951.1 protein_id gnl|my_center|LOCUS_40460 >Feature sequence0388 29 1849 gene locus_tag LOCUS_40470 29 1849 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_40470 1898 2347 gene locus_tag LOCUS_40480 1898 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 2513 3169 gene locus_tag LOCUS_40490 2513 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 3234 3902 gene locus_tag LOCUS_40500 3234 3902 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141208.1 protein_id gnl|my_center|LOCUS_40500 3948 6437 gene locus_tag LOCUS_40510 3948 6437 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_40510 >Feature sequence0389 388 756 gene locus_tag LOCUS_40520 388 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 1162 758 gene locus_tag LOCUS_40530 1162 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 2330 1305 gene locus_tag LOCUS_40540 2330 1305 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_40540 3890 2949 gene locus_tag LOCUS_40550 3890 2949 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921669.1 protein_id gnl|my_center|LOCUS_40550 4601 4002 gene locus_tag LOCUS_40560 4601 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 5809 4820 gene locus_tag LOCUS_40570 5809 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 >Feature sequence0390 728 459 gene locus_tag LOCUS_40580 728 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 969 1409 gene locus_tag LOCUS_40590 969 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 1455 2444 gene locus_tag LOCUS_40600 1455 2444 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406329.1 protein_id gnl|my_center|LOCUS_40600 2493 3404 gene locus_tag LOCUS_40610 2493 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 3391 3741 gene locus_tag LOCUS_40620 3391 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 4760 3738 gene locus_tag LOCUS_40630 4760 3738 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_40630 4917 5291 gene locus_tag LOCUS_40640 4917 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 5322 5690 gene locus_tag LOCUS_40650 5322 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 5725 6150 gene locus_tag LOCUS_40660 5725 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 >Feature sequence0391 <1 1275 gene locus_tag LOCUS_40670 <1 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122127.1:BBP7 family outer membrane beta-barrel protein 1508 2908 gene locus_tag LOCUS_40680 1508 2908 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_40680 3326 2916 gene locus_tag LOCUS_40690 3326 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 3649 3335 gene locus_tag LOCUS_40700 3649 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence0392 <1 1034 gene locus_tag LOCUS_40710 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:DUF1549 domain-containing protein 1031 1432 gene locus_tag LOCUS_40720 1031 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 1453 2808 gene locus_tag LOCUS_40730 1453 2808 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_40730 3241 2876 gene locus_tag LOCUS_40740 3241 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 4276 3350 gene locus_tag LOCUS_40750 4276 3350 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942605.1 protein_id gnl|my_center|LOCUS_40750 5705 4359 gene locus_tag LOCUS_40760 5705 4359 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_40760 >Feature sequence0393 2722 1160 gene locus_tag LOCUS_40770 2722 1160 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_40770 4534 2747 gene locus_tag LOCUS_40780 4534 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 6559 4580 gene locus_tag LOCUS_40790 gene nuoL 6559 4580 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_40790 >Feature sequence0394 174 368 gene locus_tag LOCUS_40800 174 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 1099 287 gene locus_tag LOCUS_40810 1099 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 1486 1166 gene locus_tag LOCUS_40820 1486 1166 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_40820 2027 1584 gene locus_tag LOCUS_40830 2027 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 2363 4894 gene locus_tag LOCUS_40840 2363 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 4898 5716 gene locus_tag LOCUS_40850 4898 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 5713 6510 gene locus_tag LOCUS_40860 5713 6510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249669.1 protein_id gnl|my_center|LOCUS_40860 >Feature sequence0395 2820 2551 gene locus_tag LOCUS_40870 2820 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 3059 2817 gene locus_tag LOCUS_40880 3059 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 3182 4954 gene locus_tag LOCUS_40890 3182 4954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921383.1 protein_id gnl|my_center|LOCUS_40890 4988 6478 gene locus_tag LOCUS_40900 4988 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 >Feature sequence0396 468 151 gene locus_tag LOCUS_40910 468 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 1494 559 gene locus_tag LOCUS_40920 gene dapA 1494 559 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_40920 2392 1631 gene locus_tag LOCUS_40930 2392 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 3654 2515 gene locus_tag LOCUS_40940 3654 2515 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_40940 4925 3699 gene locus_tag LOCUS_40950 4925 3699 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_40950 5548 5048 gene locus_tag LOCUS_40960 5548 5048 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_40960 5643 5834 gene locus_tag LOCUS_40970 gene rpmF 5643 5834 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_40970 5856 6203 gene locus_tag LOCUS_40980 5856 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 >Feature sequence0397 777 460 gene locus_tag LOCUS_40990 777 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 974 774 gene locus_tag LOCUS_41000 974 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 1891 1145 gene locus_tag LOCUS_41010 1891 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 1772 2017 gene locus_tag LOCUS_41020 1772 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 2941 2507 gene locus_tag LOCUS_41030 2941 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 3358 2945 gene locus_tag LOCUS_41040 3358 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 3789 3571 gene locus_tag LOCUS_41050 3789 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 4054 3767 gene locus_tag LOCUS_41060 4054 3767 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_41060 6284 4419 gene locus_tag LOCUS_41070 6284 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 >Feature sequence0398 2539 191 gene locus_tag LOCUS_41080 2539 191 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671701.1 protein_id gnl|my_center|LOCUS_41080 3424 2687 gene locus_tag LOCUS_41090 3424 2687 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088485.1 protein_id gnl|my_center|LOCUS_41090 <6496 3698 gene locus_tag LOCUS_41100 <6496 3698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615762.1:amidohydrolase family protein >Feature sequence0399 1908 64 gene locus_tag LOCUS_41110 gene argS 1908 64 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_41110 2464 2051 gene locus_tag LOCUS_41120 2464 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 2918 3916 gene locus_tag LOCUS_41130 2918 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 4001 4924 gene locus_tag LOCUS_41140 4001 4924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260609.1 protein_id gnl|my_center|LOCUS_41140 5135 5629 gene locus_tag LOCUS_41150 5135 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 >Feature sequence0400 803 219 gene locus_tag LOCUS_41160 803 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 1424 840 gene locus_tag LOCUS_41170 1424 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 2157 1609 gene locus_tag LOCUS_41180 2157 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 6035 2166 gene locus_tag LOCUS_41190 6035 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 >Feature sequence0401 1007 75 gene locus_tag LOCUS_41200 gene accD 1007 75 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_41200 2206 1004 gene locus_tag LOCUS_41210 2206 1004 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_41210 3401 2352 gene locus_tag LOCUS_41220 gene gap 3401 2352 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_41220 3614 4600 gene locus_tag LOCUS_41230 3614 4600 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958098.1 protein_id gnl|my_center|LOCUS_41230 4754 5218 gene locus_tag LOCUS_41240 4754 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 5266 5712 gene locus_tag LOCUS_41250 5266 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 >Feature sequence0402 1742 1993 gene locus_tag LOCUS_41260 1742 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 3414 2131 gene locus_tag LOCUS_41270 3414 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 3534 4043 gene locus_tag LOCUS_41280 3534 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 5172 4027 gene locus_tag LOCUS_41290 5172 4027 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_41290 5804 5169 gene locus_tag LOCUS_41300 5804 5169 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928883.1 protein_id gnl|my_center|LOCUS_41300 6412 5840 gene locus_tag LOCUS_41310 6412 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 >Feature sequence0403 1060 179 gene locus_tag LOCUS_41320 gene ubiA 1060 179 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_41320 1316 1873 gene locus_tag LOCUS_41330 1316 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 3145 1973 gene locus_tag LOCUS_41340 3145 1973 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243654.1 protein_id gnl|my_center|LOCUS_41340 3310 4257 gene locus_tag LOCUS_41350 3310 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530069.1 protein_id gnl|my_center|LOCUS_41350 >Feature sequence0404 1122 2678 gene locus_tag LOCUS_41360 1122 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 3295 2795 gene locus_tag LOCUS_41370 3295 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 4006 3398 gene locus_tag LOCUS_41380 4006 3398 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929236.1 protein_id gnl|my_center|LOCUS_41380 4723 4037 gene locus_tag LOCUS_41390 4723 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 <6357 5021 gene locus_tag LOCUS_41400 <6357 5021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943729.1:transcription termination factor Rho >Feature sequence0405 350 862 gene locus_tag LOCUS_41410 350 862 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_41410 1434 1529 gene locus_tag LOCUS_t00430 1434 1529 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3131 1587 gene locus_tag LOCUS_41420 3131 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 3722 3303 gene locus_tag LOCUS_41430 3722 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 4693 3869 gene locus_tag LOCUS_41440 4693 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 4864 6093 gene locus_tag LOCUS_41450 4864 6093 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_41450 >Feature sequence0406 1544 630 gene locus_tag LOCUS_41460 1544 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 1806 3251 gene locus_tag LOCUS_41470 1806 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 3831 3259 gene locus_tag LOCUS_41480 3831 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 6312 4063 gene locus_tag LOCUS_41490 gene glgX 6312 4063 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_41490 >Feature sequence0407 <1 985 gene locus_tag LOCUS_41500 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403786.1:site-2 protease family protein 1142 1597 gene locus_tag LOCUS_41510 1142 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 1710 2741 gene locus_tag LOCUS_41520 1710 2741 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240521.1 protein_id gnl|my_center|LOCUS_41520 3328 2750 gene locus_tag LOCUS_41530 3328 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 3928 3362 gene locus_tag LOCUS_41540 3928 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41540 4621 3965 gene locus_tag LOCUS_41550 4621 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41550 5197 4715 gene locus_tag LOCUS_41560 5197 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41560 6200 5244 gene locus_tag LOCUS_41570 6200 5244 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_41570 >Feature sequence0408 230 2584 gene locus_tag LOCUS_41580 230 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 2727 4184 gene locus_tag LOCUS_41590 2727 4184 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_41590 4327 5643 gene locus_tag LOCUS_41600 4327 5643 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_41600 6279 5782 gene locus_tag LOCUS_41610 6279 5782 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456061.1 protein_id gnl|my_center|LOCUS_41610 >Feature sequence0409 1651 1220 gene locus_tag LOCUS_41620 1651 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 1872 1648 gene locus_tag LOCUS_41630 1872 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 2643 2101 gene locus_tag LOCUS_41640 2643 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 3201 2794 gene locus_tag LOCUS_41650 3201 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 3533 3198 gene locus_tag LOCUS_41660 3533 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 3784 3605 gene locus_tag LOCUS_41670 3784 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 4558 3821 gene locus_tag LOCUS_41680 4558 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 5737 4691 gene locus_tag LOCUS_41690 5737 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 >Feature sequence0410 522 884 gene locus_tag LOCUS_41700 522 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 1002 2273 gene locus_tag LOCUS_41710 gene flgE 1002 2273 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_41710 2709 2386 gene locus_tag LOCUS_41720 2709 2386 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_41720 2951 2700 gene locus_tag LOCUS_41730 2951 2700 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_41730 3521 2982 gene locus_tag LOCUS_41740 3521 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 3902 3606 gene locus_tag LOCUS_41750 3902 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 4481 4221 gene locus_tag LOCUS_41760 4481 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 5207 4809 gene locus_tag LOCUS_41770 5207 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 5557 5204 gene locus_tag LOCUS_41780 5557 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41780 >Feature sequence0411 1763 1125 gene locus_tag LOCUS_41790 gene rdgB 1763 1125 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_41790 2071 1787 gene locus_tag LOCUS_41800 2071 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 2350 2661 gene locus_tag LOCUS_41810 2350 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 2749 3420 gene locus_tag LOCUS_41820 2749 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 3701 3426 gene locus_tag LOCUS_41830 3701 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 3982 3698 gene locus_tag LOCUS_41840 3982 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 5069 4035 gene locus_tag LOCUS_41850 gene pheS 5069 4035 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_41850 5636 5220 gene locus_tag LOCUS_41860 gene rplT 5636 5220 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 protein_id gnl|my_center|LOCUS_41860 5928 5722 gene locus_tag LOCUS_41870 gene rpmI 5928 5722 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_41870 >Feature sequence0412 309 1622 gene locus_tag LOCUS_41880 309 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 1988 3547 gene locus_tag LOCUS_41890 1988 3547 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897308.1 protein_id gnl|my_center|LOCUS_41890 4579 3710 gene locus_tag LOCUS_41900 4579 3710 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_41900 5135 4755 gene locus_tag LOCUS_41910 5135 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 5417 5175 gene locus_tag LOCUS_41920 5417 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 6048 5449 gene locus_tag LOCUS_41930 6048 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 >Feature sequence0413 82 3249 gene locus_tag LOCUS_41940 82 3249 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_41940 3277 3663 gene locus_tag LOCUS_41950 3277 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 4643 4570 gene locus_tag LOCUS_t00440 4643 4570 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5855 4698 gene locus_tag LOCUS_41960 5855 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 >Feature sequence0414 226 41 gene locus_tag LOCUS_41970 226 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 761 237 gene locus_tag LOCUS_41980 761 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 1638 1231 gene locus_tag LOCUS_41990 1638 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 2825 1752 gene locus_tag LOCUS_42000 2825 1752 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_42000 3310 2822 gene locus_tag LOCUS_42010 3310 2822 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_42010 3541 3377 gene locus_tag LOCUS_42020 3541 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 3859 3545 gene locus_tag LOCUS_42030 3859 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 4050 3856 gene locus_tag LOCUS_42040 4050 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 4557 4078 gene locus_tag LOCUS_42050 4557 4078 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_42050 4694 5137 gene locus_tag LOCUS_42060 4694 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 >Feature sequence0415 3784 152 gene locus_tag LOCUS_42070 3784 152 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813379.1 protein_id gnl|my_center|LOCUS_42070 4306 3881 gene locus_tag LOCUS_42080 4306 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 4515 5990 gene locus_tag LOCUS_42090 4515 5990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897902.1 protein_id gnl|my_center|LOCUS_42090 6284 6015 gene locus_tag LOCUS_42100 6284 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 >Feature sequence0416 5924 4287 gene locus_tag LOCUS_42110 5924 4287 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142825.1 protein_id gnl|my_center|LOCUS_42110 >Feature sequence0417 1153 2055 gene locus_tag LOCUS_42120 1153 2055 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120072.1 protein_id gnl|my_center|LOCUS_42120 3578 2466 gene locus_tag LOCUS_42130 3578 2466 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_42130 3873 3580 gene locus_tag LOCUS_42140 3873 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 4107 3895 gene locus_tag LOCUS_42150 4107 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 4881 4129 gene locus_tag LOCUS_42160 4881 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 5179 4955 gene locus_tag LOCUS_42170 5179 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 5296 5628 gene locus_tag LOCUS_42180 5296 5628 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_42180 5819 6019 gene locus_tag LOCUS_42190 gene rpsU 5819 6019 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 protein_id gnl|my_center|LOCUS_42190 >Feature sequence0418 3396 1951 gene locus_tag LOCUS_42200 3396 1951 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_42200 3810 3448 gene locus_tag LOCUS_42210 3810 3448 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_42210 5253 3814 gene locus_tag LOCUS_42220 5253 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 >Feature sequence0419 1435 2592 gene locus_tag LOCUS_42230 1435 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 3426 4556 gene locus_tag LOCUS_42240 3426 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 4977 5702 gene locus_tag LOCUS_42250 4977 5702 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_42250 >Feature sequence0420 1762 1049 gene locus_tag LOCUS_42260 1762 1049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_42260 3981 1930 gene locus_tag LOCUS_42270 3981 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 >Feature sequence0421 1576 2301 gene locus_tag LOCUS_42280 1576 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 3062 2427 gene locus_tag LOCUS_42290 3062 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_42290 3473 3862 gene locus_tag LOCUS_42300 3473 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 4049 5815 gene locus_tag LOCUS_42310 4049 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 >Feature sequence0422 691 35 gene locus_tag LOCUS_42320 gene gmk 691 35 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618226.1 protein_id gnl|my_center|LOCUS_42320 1615 719 gene locus_tag LOCUS_42330 1615 719 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615387.1 protein_id gnl|my_center|LOCUS_42330 1920 1630 gene locus_tag LOCUS_42340 1920 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 2856 2098 gene locus_tag LOCUS_42350 gene tpiA 2856 2098 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927032.1 protein_id gnl|my_center|LOCUS_42350 3993 2974 gene locus_tag LOCUS_42360 gene aroF 3993 2974 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121242.1 protein_id gnl|my_center|LOCUS_42360 5254 4133 gene locus_tag LOCUS_42370 gene pheA 5254 4133 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_42370 >Feature sequence0423 1195 260 gene locus_tag LOCUS_42380 1195 260 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_42380 2587 1424 gene locus_tag LOCUS_42390 2587 1424 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459824.1 protein_id gnl|my_center|LOCUS_42390 2733 3164 gene locus_tag LOCUS_42400 2733 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 3322 4395 gene locus_tag LOCUS_42410 3322 4395 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_42410 4516 5049 gene locus_tag LOCUS_42420 4516 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 5144 6181 gene locus_tag LOCUS_42430 5144 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 >Feature sequence0424 2877 1546 gene locus_tag LOCUS_42440 2877 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 3748 3050 gene locus_tag LOCUS_42450 3748 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 6133 3878 gene locus_tag LOCUS_42460 6133 3878 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_42460 >Feature sequence0425 6073 3461 gene locus_tag LOCUS_42470 gene pheT 6073 3461 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_42470 >Feature sequence0426 190 858 gene locus_tag LOCUS_42480 190 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 759 995 gene locus_tag LOCUS_42490 759 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 1054 1671 gene locus_tag LOCUS_42500 1054 1671 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037712.1 protein_id gnl|my_center|LOCUS_42500 2071 1676 gene locus_tag LOCUS_42510 2071 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 2491 2132 gene locus_tag LOCUS_42520 2491 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 3910 2633 gene locus_tag LOCUS_42530 3910 2633 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_42530 5624 4017 gene locus_tag LOCUS_42540 5624 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 >Feature sequence0427 74 724 gene locus_tag LOCUS_42550 74 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 869 1342 gene locus_tag LOCUS_42560 869 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 2855 1353 gene locus_tag LOCUS_42570 gene glgA 2855 1353 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121026.1 protein_id gnl|my_center|LOCUS_42570 4338 3001 gene locus_tag LOCUS_42580 4338 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 >Feature sequence0428 <1 1490 gene locus_tag LOCUS_42590 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258810.1:serine/threonine-protein kinase note possible pseudo, internal stop codon, frameshifted 1889 1623 gene locus_tag LOCUS_42600 1889 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 2317 2607 gene locus_tag LOCUS_42610 2317 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 2604 2882 gene locus_tag LOCUS_42620 2604 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 4726 2969 gene locus_tag LOCUS_42630 4726 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42630 >Feature sequence0429 1027 410 gene locus_tag LOCUS_42640 1027 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 4545 1024 gene locus_tag LOCUS_42650 4545 1024 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_42650 4711 4947 gene locus_tag LOCUS_42660 4711 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 4947 5552 gene locus_tag LOCUS_42670 4947 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 >Feature sequence0430 828 124 gene locus_tag LOCUS_42680 828 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 1130 825 gene locus_tag LOCUS_42690 1130 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 2095 1442 gene locus_tag LOCUS_42700 2095 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 2366 3433 gene locus_tag LOCUS_42710 2366 3433 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331256.1 protein_id gnl|my_center|LOCUS_42710 3523 4077 gene locus_tag LOCUS_42720 3523 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 4182 4535 gene locus_tag LOCUS_42730 4182 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 4628 4834 gene locus_tag LOCUS_42740 4628 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 5547 4984 gene locus_tag LOCUS_42750 5547 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 >Feature sequence0431 3199 89 gene locus_tag LOCUS_42760 3199 89 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427762.1 protein_id gnl|my_center|LOCUS_42760 4773 3205 gene locus_tag LOCUS_42770 gene cimA 4773 3205 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_42770 5648 5085 gene locus_tag LOCUS_42780 5648 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 >Feature sequence0432 122 583 gene locus_tag LOCUS_42790 122 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 623 1468 gene locus_tag LOCUS_42800 623 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 1506 1955 gene locus_tag LOCUS_42810 1506 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 2481 1972 gene locus_tag LOCUS_42820 2481 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 2638 3411 gene locus_tag LOCUS_42830 2638 3411 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_42830 3498 4244 gene locus_tag LOCUS_42840 3498 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 6095 4353 gene locus_tag LOCUS_42850 6095 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence0433 1 1089 gene locus_tag LOCUS_42860 1 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 1840 1037 gene locus_tag LOCUS_42870 1840 1037 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528860.1 protein_id gnl|my_center|LOCUS_42870 3653 1956 gene locus_tag LOCUS_42880 3653 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 5491 3986 gene locus_tag LOCUS_42890 5491 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 >Feature sequence0434 2837 1494 gene locus_tag LOCUS_42900 2837 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 4078 3053 gene locus_tag LOCUS_42910 4078 3053 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_42910 4326 5282 gene locus_tag LOCUS_42920 4326 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 5279 6031 gene locus_tag LOCUS_42930 5279 6031 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113056.1 protein_id gnl|my_center|LOCUS_42930 >Feature sequence0435 <1 1650 gene locus_tag LOCUS_42940 <1 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108480.1:translational GTPase TypA 1672 2292 gene locus_tag LOCUS_42950 1672 2292 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616116.1 protein_id gnl|my_center|LOCUS_42950 3256 2393 gene locus_tag LOCUS_42960 3256 2393 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788072.1 protein_id gnl|my_center|LOCUS_42960 5220 3280 gene locus_tag LOCUS_42970 5220 3280 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_42970 5937 5263 gene locus_tag LOCUS_42980 5937 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 >Feature sequence0436 819 5108 gene locus_tag LOCUS_42990 819 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 5199 6095 gene locus_tag LOCUS_43000 5199 6095 CDS product enoyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871451.1 protein_id gnl|my_center|LOCUS_43000 >Feature sequence0437 361 3714 gene locus_tag LOCUS_43010 gene treS 361 3714 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_43010 3786 4919 gene locus_tag LOCUS_43020 3786 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 5013 5612 gene locus_tag LOCUS_43030 5013 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 5609 5833 gene locus_tag LOCUS_43040 5609 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 5836 5955 gene locus_tag LOCUS_43050 5836 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 >Feature sequence0438 915 2291 gene locus_tag LOCUS_43060 915 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 3483 2401 gene locus_tag LOCUS_43070 3483 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 3368 3592 gene locus_tag LOCUS_43080 3368 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 >Feature sequence0439 1291 83 gene locus_tag LOCUS_43090 1291 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 1937 1296 gene locus_tag LOCUS_43100 1937 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 3066 1942 gene locus_tag LOCUS_43110 3066 1942 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_43110 3403 3059 gene locus_tag LOCUS_43120 3403 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 4940 4020 gene locus_tag LOCUS_43130 4940 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 >Feature sequence0440 803 612 gene locus_tag LOCUS_43140 803 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 2005 872 gene locus_tag LOCUS_43150 2005 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 2107 2937 gene locus_tag LOCUS_43160 2107 2937 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 protein_id gnl|my_center|LOCUS_43160 2944 3153 gene locus_tag LOCUS_43170 2944 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 3150 4802 gene locus_tag LOCUS_43180 3150 4802 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_43180 5139 5597 gene locus_tag LOCUS_43190 5139 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 5610 5813 gene locus_tag LOCUS_43200 5610 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 >Feature sequence0441 299 550 gene locus_tag LOCUS_43210 299 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 578 2659 gene locus_tag LOCUS_43220 578 2659 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_43220 3665 2739 gene locus_tag LOCUS_43230 3665 2739 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_43230 3905 6007 gene locus_tag LOCUS_43240 3905 6007 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_43240 >Feature sequence0442 1682 231 gene locus_tag LOCUS_43250 1682 231 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_43250 3842 1692 gene locus_tag LOCUS_43260 3842 1692 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427755.1 protein_id gnl|my_center|LOCUS_43260 4841 3990 gene locus_tag LOCUS_43270 4841 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 5764 4838 gene locus_tag LOCUS_43280 5764 4838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_43280 >Feature sequence0443 4376 1215 gene locus_tag LOCUS_43290 4376 1215 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257050.1 protein_id gnl|my_center|LOCUS_43290 <6027 4447 gene locus_tag LOCUS_43300 <6027 4447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731328.1:glycogen debranching protein GlgX >Feature sequence0444 244 1110 gene locus_tag LOCUS_43310 244 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 1267 1818 gene locus_tag LOCUS_43320 1267 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 1776 2144 gene locus_tag LOCUS_43330 1776 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 2179 3675 gene locus_tag LOCUS_43340 gene stp 2179 3675 CDS product multidrug resistance protein Stp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906797.1 protein_id gnl|my_center|LOCUS_43340 3703 3900 gene locus_tag LOCUS_43350 3703 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 3897 4235 gene locus_tag LOCUS_43360 3897 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 4238 5284 gene locus_tag LOCUS_43370 4238 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 5310 5654 gene locus_tag LOCUS_43380 5310 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 >Feature sequence0445 1545 817 gene locus_tag LOCUS_43390 1545 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 3051 1831 gene locus_tag LOCUS_43400 3051 1831 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_43400 3537 3172 gene locus_tag LOCUS_43410 3537 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 3640 4404 gene locus_tag LOCUS_43420 3640 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 4995 4381 gene locus_tag LOCUS_43430 4995 4381 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_43430 <6013 4992 gene locus_tag LOCUS_43440 <6013 4992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393505.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence0446 <1 1665 gene locus_tag LOCUS_43450 <1 1665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120563.1:NAD(+) synthase 2695 1679 gene locus_tag LOCUS_43460 2695 1679 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_43460 >Feature sequence0447 1286 288 gene locus_tag LOCUS_43470 1286 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 1741 1436 gene locus_tag LOCUS_43480 1741 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 2652 1681 gene locus_tag LOCUS_43490 2652 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 2778 4778 gene locus_tag LOCUS_43500 2778 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 4864 5811 gene locus_tag LOCUS_43510 4864 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 >Feature sequence0448 2061 1093 gene locus_tag LOCUS_43520 2061 1093 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_43520 3073 2078 gene locus_tag LOCUS_43530 gene gmd 3073 2078 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_43530 4515 3289 gene locus_tag LOCUS_43540 4515 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 5943 4627 gene locus_tag LOCUS_43550 5943 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 >Feature sequence0449 755 2239 gene locus_tag LOCUS_43560 755 2239 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650522.1 protein_id gnl|my_center|LOCUS_43560 2255 2425 gene locus_tag LOCUS_43570 2255 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 3457 2441 gene locus_tag LOCUS_43580 3457 2441 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 protein_id gnl|my_center|LOCUS_43580 4103 3633 gene locus_tag LOCUS_43590 4103 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43590 4363 4040 gene locus_tag LOCUS_43600 4363 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43600 4749 4372 gene locus_tag LOCUS_43610 4749 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43610 5715 5924 gene locus_tag LOCUS_43620 5715 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 >Feature sequence0450 1971 790 gene locus_tag LOCUS_43630 1971 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 2208 1978 gene locus_tag LOCUS_43640 2208 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 2969 2235 gene locus_tag LOCUS_43650 2969 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 3404 5890 gene locus_tag LOCUS_43660 3404 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 >Feature sequence0451 441 668 gene locus_tag LOCUS_43670 441 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 672 1067 gene locus_tag LOCUS_43680 672 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 4814 1071 gene locus_tag LOCUS_43690 4814 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 5741 5136 gene locus_tag LOCUS_43700 5741 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 >Feature sequence0452 436 1620 gene locus_tag LOCUS_43710 436 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_43710 1661 2455 gene locus_tag LOCUS_43720 1661 2455 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259457.1 protein_id gnl|my_center|LOCUS_43720 2465 3904 gene locus_tag LOCUS_43730 2465 3904 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_43730 3891 5036 gene locus_tag LOCUS_43740 3891 5036 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_43740 5047 5406 gene locus_tag LOCUS_43750 5047 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 >Feature sequence0453 <1 1535 gene locus_tag LOCUS_43760 <1 1535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140908.1:WD40 repeat domain-containing protein 1976 1611 gene locus_tag LOCUS_43770 1976 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 2425 2051 gene locus_tag LOCUS_43780 2425 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 3562 2438 gene locus_tag LOCUS_43790 3562 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 3957 5591 gene locus_tag LOCUS_43800 3957 5591 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_43800 >Feature sequence0454 242 637 gene locus_tag LOCUS_43810 242 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 1449 634 gene locus_tag LOCUS_43820 1449 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43820 1793 1497 gene locus_tag LOCUS_43830 1793 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43830 1871 2656 gene locus_tag LOCUS_43840 1871 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 2770 3438 gene locus_tag LOCUS_43850 2770 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 3694 3476 gene locus_tag LOCUS_43860 3694 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 4472 3768 gene locus_tag LOCUS_43870 4472 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 5074 4469 gene locus_tag LOCUS_43880 5074 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 5376 5071 gene locus_tag LOCUS_43890 5376 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 5592 5386 gene locus_tag LOCUS_43900 5592 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 >Feature sequence0455 698 396 gene locus_tag LOCUS_43910 698 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 895 2235 gene locus_tag LOCUS_43920 895 2235 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922363.1 protein_id gnl|my_center|LOCUS_43920 2280 2723 gene locus_tag LOCUS_43930 2280 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 3071 2772 gene locus_tag LOCUS_43940 3071 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 3644 3105 gene locus_tag LOCUS_43950 3644 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 4089 4325 gene locus_tag LOCUS_43960 4089 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 5227 4472 gene locus_tag LOCUS_43970 5227 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 5300 5455 gene locus_tag LOCUS_43980 5300 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 >Feature sequence0456 714 642 gene locus_tag LOCUS_t00450 714 642 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 861 2723 gene locus_tag LOCUS_43990 gene treZ 861 2723 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_43990 3724 2816 gene locus_tag LOCUS_44000 3724 2816 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037155.1 protein_id gnl|my_center|LOCUS_44000 3953 4990 gene locus_tag LOCUS_44010 3953 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 5107 5880 gene locus_tag LOCUS_44020 5107 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 >Feature sequence0457 685 551 gene locus_tag LOCUS_44030 685 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 958 1932 gene locus_tag LOCUS_44040 958 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 3047 2004 gene locus_tag LOCUS_44050 3047 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 5791 4781 gene locus_tag LOCUS_44060 5791 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 >Feature sequence0458 1105 536 gene locus_tag LOCUS_44070 1105 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 1512 2420 gene locus_tag LOCUS_44080 1512 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 2541 3524 gene locus_tag LOCUS_44090 2541 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 3445 4269 gene locus_tag LOCUS_44100 3445 4269 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_44100 4276 4683 gene locus_tag LOCUS_44110 4276 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 4758 5096 gene locus_tag LOCUS_44120 4758 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 5171 5518 gene locus_tag LOCUS_44130 5171 5518 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635217.1 protein_id gnl|my_center|LOCUS_44130 >Feature sequence0459 515 1309 gene locus_tag LOCUS_44140 515 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 2362 1319 gene locus_tag LOCUS_44150 2362 1319 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_44150 2653 2949 gene locus_tag LOCUS_44160 2653 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44160 3033 4040 gene locus_tag LOCUS_44170 3033 4040 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176584.1 protein_id gnl|my_center|LOCUS_44170 4227 5174 gene locus_tag LOCUS_44180 4227 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 5199 5765 gene locus_tag LOCUS_44190 5199 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 >Feature sequence0460 <1 5326 gene locus_tag LOCUS_44200 <1 5326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052279112.1:PAS domain S-box protein >Feature sequence0461 <1 1079 gene locus_tag LOCUS_44210 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921976.1:polysaccharide biosynthesis/export family protein 2682 1201 gene locus_tag LOCUS_44220 2682 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 3404 2802 gene locus_tag LOCUS_44230 3404 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 4717 3494 gene locus_tag LOCUS_44240 4717 3494 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_44240 5210 4737 gene locus_tag LOCUS_44250 5210 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 5626 5207 gene locus_tag LOCUS_44260 5626 5207 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_44260 >Feature sequence0462 1839 862 gene locus_tag LOCUS_44270 1839 862 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_44270 2948 1836 gene locus_tag LOCUS_44280 2948 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 4049 2958 gene locus_tag LOCUS_44290 4049 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 4501 5130 gene locus_tag LOCUS_44300 4501 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 <5859 5211 gene locus_tag LOCUS_44310 <5859 5211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259547.1:N-methyl-L-tryptophan oxidase >Feature sequence0463 1133 894 gene locus_tag LOCUS_44320 1133 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 2330 1335 gene locus_tag LOCUS_44330 2330 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 3336 2596 gene locus_tag LOCUS_44340 3336 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 3483 4307 gene locus_tag LOCUS_44350 3483 4307 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_44350 4316 5005 gene locus_tag LOCUS_44360 4316 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 >Feature sequence0464 2611 1475 gene locus_tag LOCUS_44370 2611 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 3140 2754 gene locus_tag LOCUS_44380 3140 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 4588 3326 gene locus_tag LOCUS_44390 4588 3326 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_44390 >Feature sequence0465 794 1843 gene locus_tag LOCUS_44400 794 1843 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_44400 2680 1901 gene locus_tag LOCUS_44410 2680 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 2944 3654 gene locus_tag LOCUS_44420 2944 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 3661 4542 gene locus_tag LOCUS_44430 3661 4542 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_44430 <5836 4673 gene locus_tag LOCUS_44440 <5836 4673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121679.1:lactonase family protein >Feature sequence0466 1994 111 gene locus_tag LOCUS_44450 1994 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 <5820 2045 gene locus_tag LOCUS_44460 <5820 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000808718.1:FG-GAP and VCBS repeat-containing protein >Feature sequence0467 1736 798 gene locus_tag LOCUS_44470 1736 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_44470 1815 2165 gene locus_tag LOCUS_44480 1815 2165 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552785.1 protein_id gnl|my_center|LOCUS_44480 2168 2887 gene locus_tag LOCUS_44490 2168 2887 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_44490 2898 3200 gene locus_tag LOCUS_44500 2898 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 3311 3865 gene locus_tag LOCUS_44510 3311 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 3952 4881 gene locus_tag LOCUS_44520 3952 4881 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_44520 4895 5389 gene locus_tag LOCUS_44530 4895 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 >Feature sequence0468 1435 1668 gene locus_tag LOCUS_44540 1435 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 2079 1681 gene locus_tag LOCUS_44550 2079 1681 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_44550 2681 2097 gene locus_tag LOCUS_44560 2681 2097 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918863.1 protein_id gnl|my_center|LOCUS_44560 4139 2706 gene locus_tag LOCUS_44570 4139 2706 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265603.1 protein_id gnl|my_center|LOCUS_44570 <5781 4497 gene locus_tag LOCUS_44580 <5781 4497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068568.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence0469 <1 1264 gene locus_tag LOCUS_44590 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326169.1:CTP synthase 2199 1393 gene locus_tag LOCUS_44600 2199 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 3197 2421 gene locus_tag LOCUS_44610 gene hisN 3197 2421 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_44610 4206 3238 gene locus_tag LOCUS_44620 4206 3238 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_44620 4919 4248 gene locus_tag LOCUS_44630 4919 4248 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_44630 5546 4923 gene locus_tag LOCUS_44640 5546 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 >Feature sequence0470 <1 1065 gene locus_tag LOCUS_44650 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327691.1:tetratricopeptide repeat protein 1090 1557 gene locus_tag LOCUS_44660 1090 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 2637 1600 gene locus_tag LOCUS_44670 2637 1600 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_44670 2779 4173 gene locus_tag LOCUS_44680 2779 4173 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_44680 4207 4977 gene locus_tag LOCUS_44690 4207 4977 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929296.1 protein_id gnl|my_center|LOCUS_44690 >Feature sequence0471 234 845 gene locus_tag LOCUS_44700 234 845 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334179.1 protein_id gnl|my_center|LOCUS_44700 1375 1848 gene locus_tag LOCUS_44710 1375 1848 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390622.1 protein_id gnl|my_center|LOCUS_44710 2220 1870 gene locus_tag LOCUS_44720 2220 1870 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_44720 2478 2227 gene locus_tag LOCUS_44730 2478 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 3034 2591 gene locus_tag LOCUS_44740 3034 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 4104 3157 gene locus_tag LOCUS_44750 4104 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 >Feature sequence0472 807 1082 gene locus_tag LOCUS_44760 807 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44760 1819 1079 gene locus_tag LOCUS_44770 1819 1079 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 protein_id gnl|my_center|LOCUS_44770 1990 2889 gene locus_tag LOCUS_44780 1990 2889 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_44780 2947 3915 gene locus_tag LOCUS_44790 2947 3915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267282.1 protein_id gnl|my_center|LOCUS_44790 3936 4151 gene locus_tag LOCUS_44800 3936 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 4176 4841 gene locus_tag LOCUS_44810 4176 4841 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200392305.1 protein_id gnl|my_center|LOCUS_44810 <5729 4848 gene locus_tag LOCUS_44820 <5729 4848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921931.1:chromosome segregation protein SMC >Feature sequence0473 <1 1677 gene locus_tag LOCUS_44830 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120484.1:translation initiation factor IF-2 1757 2050 gene locus_tag LOCUS_44840 1757 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 2063 2314 gene locus_tag LOCUS_44850 2063 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 2331 3434 gene locus_tag LOCUS_44860 2331 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 3479 4219 gene locus_tag LOCUS_44870 3479 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 4234 4671 gene locus_tag LOCUS_44880 4234 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 4848 5624 gene locus_tag LOCUS_44890 4848 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 >Feature sequence0474 2040 991 gene locus_tag LOCUS_44900 2040 991 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225980.1 protein_id gnl|my_center|LOCUS_44900 4699 2141 gene locus_tag LOCUS_44910 4699 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 >Feature sequence0475 2200 986 gene locus_tag LOCUS_44920 2200 986 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107018.1 protein_id gnl|my_center|LOCUS_44920 4033 2270 gene locus_tag LOCUS_44930 4033 2270 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228000.1 protein_id gnl|my_center|LOCUS_44930 5121 4030 gene locus_tag LOCUS_44940 5121 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 <5680 5118 gene locus_tag LOCUS_44950 <5680 5118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053954397.1:ImmA/IrrE family metallo-endopeptidase >Feature sequence0476 1260 40 gene locus_tag LOCUS_44960 1260 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 1960 1250 gene locus_tag LOCUS_44970 1960 1250 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122200.1 protein_id gnl|my_center|LOCUS_44970 3049 2066 gene locus_tag LOCUS_44980 3049 2066 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_44980 3258 4466 gene locus_tag LOCUS_44990 3258 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 <5643 4536 gene locus_tag LOCUS_45000 <5643 4536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144334.1:NB-ARC domain-containing protein >Feature sequence0477 1682 783 gene locus_tag LOCUS_45010 1682 783 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_45010 2130 1702 gene locus_tag LOCUS_45020 2130 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 2524 2135 gene locus_tag LOCUS_45030 2524 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 3982 2543 gene locus_tag LOCUS_45040 3982 2543 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_45040 4073 4468 gene locus_tag LOCUS_45050 4073 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 4505 4966 gene locus_tag LOCUS_45060 4505 4966 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401913.1 protein_id gnl|my_center|LOCUS_45060 >Feature sequence0478 765 391 gene locus_tag LOCUS_45070 765 391 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965183.1 protein_id gnl|my_center|LOCUS_45070 1360 758 gene locus_tag LOCUS_45080 1360 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 1487 2572 gene locus_tag LOCUS_45090 1487 2572 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225970.1 protein_id gnl|my_center|LOCUS_45090 2739 3902 gene locus_tag LOCUS_45100 2739 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 >Feature sequence0479 <1 2416 gene locus_tag LOCUS_45110 <1 2416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009872660.1:outer membrane complex protein OmcB 2909 3118 gene locus_tag LOCUS_45120 2909 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 3149 3418 gene locus_tag LOCUS_45130 3149 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 3501 4430 gene locus_tag LOCUS_45140 3501 4430 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123049.1 protein_id gnl|my_center|LOCUS_45140 4548 5171 gene locus_tag LOCUS_45150 4548 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 <5628 5114 gene locus_tag LOCUS_45160 <5628 5114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008672586.1:c-type cytochrome >Feature sequence0480 64 666 gene locus_tag LOCUS_45170 64 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 663 1190 gene locus_tag LOCUS_45180 663 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 1310 1960 gene locus_tag LOCUS_45190 1310 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 1965 4538 gene locus_tag LOCUS_45200 1965 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 4619 5527 gene locus_tag LOCUS_45210 gene metF 4619 5527 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_45210 >Feature sequence0481 59 1153 gene locus_tag LOCUS_45220 59 1153 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_45220 1431 1225 gene locus_tag LOCUS_45230 1431 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 2466 1465 gene locus_tag LOCUS_45240 2466 1465 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_45240 2544 3659 gene locus_tag LOCUS_45250 2544 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 3790 5142 gene locus_tag LOCUS_45260 3790 5142 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_45260 >Feature sequence0482 2853 676 gene locus_tag LOCUS_45270 2853 676 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149111241.1 protein_id gnl|my_center|LOCUS_45270 3075 3419 gene locus_tag LOCUS_45280 3075 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 4954 3572 gene locus_tag LOCUS_45290 4954 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 5280 5555 gene locus_tag LOCUS_45300 5280 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 >Feature sequence0483 1899 208 gene locus_tag LOCUS_45310 1899 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 2958 1942 gene locus_tag LOCUS_45320 2958 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 2866 3054 gene locus_tag LOCUS_45330 2866 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 3578 3090 gene locus_tag LOCUS_45340 gene smpB 3578 3090 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_45340 3668 4822 gene locus_tag LOCUS_45350 3668 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 4831 5160 gene locus_tag LOCUS_45360 4831 5160 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_45360 >Feature sequence0484 1187 228 gene locus_tag LOCUS_45370 1187 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 2181 1348 gene locus_tag LOCUS_45380 2181 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 3369 2683 gene locus_tag LOCUS_45390 3369 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 4408 3791 gene locus_tag LOCUS_45400 4408 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 >Feature sequence0485 1604 810 gene locus_tag LOCUS_45410 1604 810 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_45410 1919 1608 gene locus_tag LOCUS_45420 1919 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 2260 1931 gene locus_tag LOCUS_45430 2260 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 3829 2435 gene locus_tag LOCUS_45440 3829 2435 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_45440 5216 3954 gene locus_tag LOCUS_45450 5216 3954 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 protein_id gnl|my_center|LOCUS_45450 >Feature sequence0486 214 1110 gene locus_tag LOCUS_45460 214 1110 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807565.1 protein_id gnl|my_center|LOCUS_45460 1216 2157 gene locus_tag LOCUS_45470 1216 2157 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_45470 2233 2634 gene locus_tag LOCUS_45480 2233 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 2641 3228 gene locus_tag LOCUS_45490 2641 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 <5553 3256 gene locus_tag LOCUS_45500 <5553 3256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein >Feature sequence0487 1419 661 gene locus_tag LOCUS_45510 gene kdsB 1419 661 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_45510 2079 1681 gene locus_tag LOCUS_45520 2079 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 3558 2323 gene locus_tag LOCUS_45530 3558 2323 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921947.1 protein_id gnl|my_center|LOCUS_45530 4392 3589 gene locus_tag LOCUS_45540 4392 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 >Feature sequence0488 1410 364 gene locus_tag LOCUS_45550 1410 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 2134 1562 gene locus_tag LOCUS_45560 2134 1562 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_45560 3383 2145 gene locus_tag LOCUS_45570 gene nuoH 3383 2145 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_45570 5235 3544 gene locus_tag LOCUS_45580 5235 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 >Feature sequence0489 505 415 gene locus_tag LOCUS_t00460 505 415 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1570 1040 gene locus_tag LOCUS_45590 1570 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 1828 2187 gene locus_tag LOCUS_45600 1828 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 2269 2970 gene locus_tag LOCUS_45610 2269 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 4128 2986 gene locus_tag LOCUS_45620 4128 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 4246 5436 gene locus_tag LOCUS_45630 4246 5436 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_45630 >Feature sequence0490 2250 106 gene locus_tag LOCUS_45640 2250 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 3030 2515 gene locus_tag LOCUS_45650 3030 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45650 3951 3337 gene locus_tag LOCUS_45660 3951 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 4424 5005 gene locus_tag LOCUS_45670 4424 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 >Feature sequence0491 1078 167 gene locus_tag LOCUS_45680 1078 167 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921963.1 protein_id gnl|my_center|LOCUS_45680 1413 1485 gene locus_tag LOCUS_t00470 1413 1485 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2205 3305 gene locus_tag LOCUS_45690 2205 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 3796 4263 gene locus_tag LOCUS_45700 3796 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 >Feature sequence0492 1415 708 gene locus_tag LOCUS_45710 1415 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 1939 2931 gene locus_tag LOCUS_45720 1939 2931 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 protein_id gnl|my_center|LOCUS_45720 4354 2972 gene locus_tag LOCUS_45730 4354 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 4692 4411 gene locus_tag LOCUS_45740 4692 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 <5517 4972 gene locus_tag LOCUS_45750 <5517 4972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679544.1:integron integrase >Feature sequence0493 632 30 gene locus_tag LOCUS_45760 632 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 2421 880 gene locus_tag LOCUS_45770 2421 880 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_45770 2584 5187 gene locus_tag LOCUS_45780 2584 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 >Feature sequence0494 398 913 gene locus_tag LOCUS_45790 398 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 2156 930 gene locus_tag LOCUS_45800 2156 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 3102 2185 gene locus_tag LOCUS_45810 3102 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 3428 3895 gene locus_tag LOCUS_45820 3428 3895 CDS product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047611.1 protein_id gnl|my_center|LOCUS_45820 3892 4287 gene locus_tag LOCUS_45830 3892 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 4367 4573 gene locus_tag LOCUS_45840 4367 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 4558 4743 gene locus_tag LOCUS_45850 4558 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 >Feature sequence0495 855 31 gene locus_tag LOCUS_45860 855 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 3202 1004 gene locus_tag LOCUS_45870 3202 1004 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211634420.1 protein_id gnl|my_center|LOCUS_45870 3480 3758 gene locus_tag LOCUS_45880 3480 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 3758 4210 gene locus_tag LOCUS_45890 3758 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 4227 4571 gene locus_tag LOCUS_45900 4227 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 4900 4673 gene locus_tag LOCUS_45910 4900 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 4781 4999 gene locus_tag LOCUS_45920 4781 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 4996 5292 gene locus_tag LOCUS_45930 4996 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 >Feature sequence0496 908 204 gene locus_tag LOCUS_45940 908 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 1972 1016 gene locus_tag LOCUS_45950 1972 1016 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_45950 3014 1989 gene locus_tag LOCUS_45960 3014 1989 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338658.1 protein_id gnl|my_center|LOCUS_45960 4050 3121 gene locus_tag LOCUS_45970 4050 3121 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_45970 5022 4156 gene locus_tag LOCUS_45980 5022 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 >Feature sequence0497 793 2340 gene locus_tag LOCUS_45990 793 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 >Feature sequence0498 647 1702 gene locus_tag LOCUS_46000 647 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 1751 3043 gene locus_tag LOCUS_46010 1751 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 3910 3542 gene locus_tag LOCUS_46020 3910 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 4179 3907 gene locus_tag LOCUS_46030 4179 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 >Feature sequence0499 <1 2337 gene locus_tag LOCUS_46040 <1 2337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007339602.1:BamA/TamA family outer membrane protein 4783 2456 gene locus_tag LOCUS_46050 4783 2456 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_46050 4694 5041 gene locus_tag LOCUS_46060 4694 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 >Feature sequence0500 832 1572 gene locus_tag LOCUS_46070 832 1572 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_46070 1572 3038 gene locus_tag LOCUS_46080 1572 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_46080 3880 3149 gene locus_tag LOCUS_46090 3880 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 >Feature sequence0501 134 502 gene locus_tag LOCUS_46100 134 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 1032 526 gene locus_tag LOCUS_46110 gene cas4 1032 526 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259413.1 protein_id gnl|my_center|LOCUS_46110 1313 1023 gene locus_tag LOCUS_46120 1313 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 4721 1446 gene locus_tag LOCUS_46130 4721 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 4811 5293 gene locus_tag LOCUS_46140 4811 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 >Feature sequence0502 <1 1549 gene locus_tag LOCUS_46150 <1 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249925.1:MATE family efflux transporter 1617 2852 gene locus_tag LOCUS_46160 1617 2852 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_46160 2925 3353 gene locus_tag LOCUS_46170 2925 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 3350 4096 gene locus_tag LOCUS_46180 3350 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 4219 4548 gene locus_tag LOCUS_46190 4219 4548 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 protein_id gnl|my_center|LOCUS_46190 >Feature sequence0503 >Feature sequence0504 1453 1235 gene locus_tag LOCUS_46200 1453 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 1597 2778 gene locus_tag LOCUS_46210 1597 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 2949 3698 gene locus_tag LOCUS_46220 2949 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 3853 4737 gene locus_tag LOCUS_46230 3853 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 4782 5051 gene locus_tag LOCUS_46240 4782 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 >Feature sequence0505 536 1510 gene locus_tag LOCUS_46250 gene cysK 536 1510 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_46250 1683 2849 gene locus_tag LOCUS_46260 1683 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 2926 3870 gene locus_tag LOCUS_46270 2926 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 4037 4363 gene locus_tag LOCUS_46280 4037 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 4938 4600 gene locus_tag LOCUS_46290 4938 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 >Feature sequence0506 1342 83 gene locus_tag LOCUS_46300 1342 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 2330 1482 gene locus_tag LOCUS_46310 2330 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 >Feature sequence0507 675 85 gene locus_tag LOCUS_46320 675 85 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327091.1 protein_id gnl|my_center|LOCUS_46320 3048 781 gene locus_tag LOCUS_46330 3048 781 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_46330 5185 3191 gene locus_tag LOCUS_46340 5185 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 >Feature sequence0508 <1 1010 gene locus_tag LOCUS_46350 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339253.1:ABC transporter permease 1192 1986 gene locus_tag LOCUS_46360 1192 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 2588 2109 gene locus_tag LOCUS_46370 2588 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 3829 2591 gene locus_tag LOCUS_46380 gene fabF 3829 2591 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_46380 4116 3865 gene locus_tag LOCUS_46390 4116 3865 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_46390 4135 4476 gene locus_tag LOCUS_46400 4135 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 5288 4392 gene locus_tag LOCUS_46410 gene fabD 5288 4392 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_46410 >Feature sequence0509 <1 1720 gene locus_tag LOCUS_46420 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 1657 2286 gene locus_tag LOCUS_46430 1657 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 2299 2544 gene locus_tag LOCUS_46440 2299 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 2833 4086 gene locus_tag LOCUS_46450 2833 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 4155 4901 gene locus_tag LOCUS_46460 4155 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 >Feature sequence0510 2261 1419 gene locus_tag LOCUS_46470 2261 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 3265 2261 gene locus_tag LOCUS_46480 gene fhcD 3265 2261 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 protein_id gnl|my_center|LOCUS_46480 3837 3265 gene locus_tag LOCUS_46490 3837 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 5159 3858 gene locus_tag LOCUS_46500 gene eno 5159 3858 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_46500 >Feature sequence0511 598 3915 gene locus_tag LOCUS_46510 598 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 >Feature sequence0512 1288 3003 gene locus_tag LOCUS_46520 1288 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 3711 2992 gene locus_tag LOCUS_46530 3711 2992 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088258909.1 protein_id gnl|my_center|LOCUS_46530 3952 3737 gene locus_tag LOCUS_46540 3952 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 4357 3956 gene locus_tag LOCUS_46550 4357 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 <5321 4392 gene locus_tag LOCUS_46560 <5321 4392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615779.1:glucose-1-phosphate adenylyltransferase >Feature sequence0513 874 143 gene locus_tag LOCUS_46570 874 143 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061894.1 protein_id gnl|my_center|LOCUS_46570 2376 871 gene locus_tag LOCUS_46580 2376 871 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_46580 2583 5129 gene locus_tag LOCUS_46590 gene hrpB 2583 5129 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_46590 >Feature sequence0514 78 341 gene locus_tag LOCUS_46600 78 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 460 3951 gene locus_tag LOCUS_46610 460 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 >Feature sequence0515 701 165 gene locus_tag LOCUS_46620 701 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 1837 806 gene locus_tag LOCUS_46630 1837 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 2121 3272 gene locus_tag LOCUS_46640 2121 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 3329 3691 gene locus_tag LOCUS_46650 3329 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 3706 4236 gene locus_tag LOCUS_46660 3706 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 4309 5223 gene locus_tag LOCUS_46670 4309 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 >Feature sequence0516 5058 946 gene locus_tag LOCUS_46680 5058 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence0517 449 1501 gene locus_tag LOCUS_46690 449 1501 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922187.1 protein_id gnl|my_center|LOCUS_46690 1498 2613 gene locus_tag LOCUS_46700 1498 2613 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 protein_id gnl|my_center|LOCUS_46700 4233 2626 gene locus_tag LOCUS_46710 4233 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 >Feature sequence0518 1087 488 gene locus_tag LOCUS_46720 1087 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 2152 1235 gene locus_tag LOCUS_46730 2152 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 2091 2300 gene locus_tag LOCUS_46740 2091 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 2815 2258 gene locus_tag LOCUS_46750 2815 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 <5222 3078 gene locus_tag LOCUS_46760 <5222 3078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088552.1:PAS domain-containing protein >Feature sequence0519 1379 1777 gene locus_tag LOCUS_46770 1379 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 1785 2237 gene locus_tag LOCUS_46780 1785 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46780 2147 3016 gene locus_tag LOCUS_46790 2147 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46790 3438 3040 gene locus_tag LOCUS_46800 3438 3040 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_46800 4097 3435 gene locus_tag LOCUS_46810 4097 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 4930 4094 gene locus_tag LOCUS_46820 4930 4094 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_46820 >Feature sequence0520 257 1171 gene locus_tag LOCUS_46830 gene cysD 257 1171 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_46830 1300 3216 gene locus_tag LOCUS_46840 gene cysN 1300 3216 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268855.1 protein_id gnl|my_center|LOCUS_46840 >Feature sequence0521 842 453 gene locus_tag LOCUS_46850 842 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 3659 1047 gene locus_tag LOCUS_46860 3659 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 5046 3928 gene locus_tag LOCUS_46870 5046 3928 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_46870 >Feature sequence0522 1120 311 gene locus_tag LOCUS_46880 1120 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 2744 1224 gene locus_tag LOCUS_46890 2744 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 2815 3228 gene locus_tag LOCUS_46900 2815 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 3228 3500 gene locus_tag LOCUS_46910 3228 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 3563 5074 gene locus_tag LOCUS_46920 3563 5074 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_46920 >Feature sequence0523 3005 30 gene locus_tag LOCUS_46930 3005 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 <5170 3141 gene locus_tag LOCUS_46940 <5170 3141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123986.1:cyclic nucleotide-binding domain-containing protein >Feature sequence0524 2810 780 gene locus_tag LOCUS_46950 2810 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 4532 2937 gene locus_tag LOCUS_46960 4532 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 4890 4633 gene locus_tag LOCUS_46970 4890 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 >Feature sequence0525 <1 651 gene locus_tag LOCUS_46980 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890070.1:PQQ-binding-like beta-propeller repeat protein 1100 2029 gene locus_tag LOCUS_46990 1100 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 3525 2194 gene locus_tag LOCUS_47000 3525 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 4554 3568 gene locus_tag LOCUS_47010 4554 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 4760 4551 gene locus_tag LOCUS_47020 4760 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 >Feature sequence0526 1661 834 gene locus_tag LOCUS_47030 1661 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 4016 1683 gene locus_tag LOCUS_47040 4016 1683 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_47040 4663 4013 gene locus_tag LOCUS_47050 4663 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 4765 5115 gene locus_tag LOCUS_47060 4765 5115 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640094.1 protein_id gnl|my_center|LOCUS_47060 >Feature sequence0527 1031 444 gene locus_tag LOCUS_47070 1031 444 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_47070 1990 1028 gene locus_tag LOCUS_47080 1990 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 3069 2038 gene locus_tag LOCUS_47090 3069 2038 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921527.1 protein_id gnl|my_center|LOCUS_47090 4582 3110 gene locus_tag LOCUS_47100 gene gnd 4582 3110 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 protein_id gnl|my_center|LOCUS_47100 >Feature sequence0528 110 670 gene locus_tag LOCUS_47110 110 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 730 1551 gene locus_tag LOCUS_47120 730 1551 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 protein_id gnl|my_center|LOCUS_47120 1811 3337 gene locus_tag LOCUS_47130 1811 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 3370 4143 gene locus_tag LOCUS_47140 3370 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 4161 4994 gene locus_tag LOCUS_47150 4161 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 >Feature sequence0529 288 70 gene locus_tag LOCUS_47160 288 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 910 5019 gene locus_tag LOCUS_47170 910 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 >Feature sequence0530 665 949 gene locus_tag LOCUS_47180 665 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 1958 1074 gene locus_tag LOCUS_47190 1958 1074 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002690262.1 protein_id gnl|my_center|LOCUS_47190 2661 2038 gene locus_tag LOCUS_47200 2661 2038 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_47200 3544 2717 gene locus_tag LOCUS_47210 3544 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 3713 5101 gene locus_tag LOCUS_47220 3713 5101 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_47220 >Feature sequence0531 3050 156 gene locus_tag LOCUS_47230 3050 156 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225782.1 protein_id gnl|my_center|LOCUS_47230 3305 3892 gene locus_tag LOCUS_47240 3305 3892 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_47240 >Feature sequence0532 1638 73 gene locus_tag LOCUS_47250 1638 73 CDS product lysine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886371.1 protein_id gnl|my_center|LOCUS_47250 1846 3918 gene locus_tag LOCUS_47260 1846 3918 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 protein_id gnl|my_center|LOCUS_47260 4090 4650 gene locus_tag LOCUS_47270 4090 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 >Feature sequence0533 665 2413 gene locus_tag LOCUS_47280 665 2413 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_47280 2420 3139 gene locus_tag LOCUS_47290 2420 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 3204 4112 gene locus_tag LOCUS_47300 3204 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 4637 4287 gene locus_tag LOCUS_47310 4637 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 >Feature sequence0534 1103 123 gene locus_tag LOCUS_47320 1103 123 CDS product YsnF/AvaK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929094.1 protein_id gnl|my_center|LOCUS_47320 2752 1310 gene locus_tag LOCUS_47330 2752 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 4323 2968 gene locus_tag LOCUS_47340 gene accC 4323 2968 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_47340 4761 4360 gene locus_tag LOCUS_47350 4761 4360 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_47350 >Feature sequence0535 >Feature sequence0536 495 1706 gene locus_tag LOCUS_47360 495 1706 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_47360 1785 3176 gene locus_tag LOCUS_47370 1785 3176 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324232.1 protein_id gnl|my_center|LOCUS_47370 3373 4335 gene locus_tag LOCUS_47380 3373 4335 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324233.1 protein_id gnl|my_center|LOCUS_47380 >Feature sequence0537 <1 1336 gene locus_tag LOCUS_47390 <1 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031164.1:hydroxysqualene dehydroxylase HpnE 1555 2841 gene locus_tag LOCUS_47400 1555 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 3559 2939 gene locus_tag LOCUS_47410 3559 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258774.1 protein_id gnl|my_center|LOCUS_47410 4943 3684 gene locus_tag LOCUS_47420 4943 3684 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_47420 >Feature sequence0538 3082 899 gene locus_tag LOCUS_47430 3082 899 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_47430 >Feature sequence0539 <1 1035 gene locus_tag LOCUS_47440 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921983.1:DUF1553 domain-containing protein 1094 1342 gene locus_tag LOCUS_47450 1094 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 1339 1821 gene locus_tag LOCUS_47460 1339 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 4611 1825 gene locus_tag LOCUS_47470 4611 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 >Feature sequence0540 1063 59 gene locus_tag LOCUS_47480 1063 59 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123049.1 protein_id gnl|my_center|LOCUS_47480 3148 1280 gene locus_tag LOCUS_47490 3148 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 4267 3779 gene locus_tag LOCUS_47500 4267 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 4774 4382 gene locus_tag LOCUS_47510 4774 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 >Feature sequence0541 2635 1781 gene locus_tag LOCUS_47520 2635 1781 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_47520 2965 3036 gene locus_tag LOCUS_t00480 2965 3036 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 <4999 3351 gene locus_tag LOCUS_47530 <4999 3351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108345.1:calcium-translocating P-type ATPase, PMCA-type >Feature sequence0542 1993 1151 gene locus_tag LOCUS_47540 1993 1151 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921488.1 protein_id gnl|my_center|LOCUS_47540 2282 4534 gene locus_tag LOCUS_47550 2282 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 >Feature sequence0543 <1 1461 gene locus_tag LOCUS_47560 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640105.1:histidine ammonia-lyase 1458 2300 gene locus_tag LOCUS_47570 gene hutG 1458 2300 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918842.1 protein_id gnl|my_center|LOCUS_47570 2297 3967 gene locus_tag LOCUS_47580 2297 3967 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088981.1 protein_id gnl|my_center|LOCUS_47580 >Feature sequence0544 612 85 gene locus_tag LOCUS_47590 612 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 2032 533 gene locus_tag LOCUS_47600 2032 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47600 3200 2361 gene locus_tag LOCUS_47610 3200 2361 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140081.1 protein_id gnl|my_center|LOCUS_47610 3514 3200 gene locus_tag LOCUS_47620 3514 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 3581 3955 gene locus_tag LOCUS_47630 3581 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 4050 4922 gene locus_tag LOCUS_47640 4050 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 >Feature sequence0545 <1 1817 gene locus_tag LOCUS_47650 <1 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921983.1:DUF1553 domain-containing protein 2125 2673 gene locus_tag LOCUS_47660 2125 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 2963 4420 gene locus_tag LOCUS_47670 2963 4420 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_47670 4466 4738 gene locus_tag LOCUS_47680 4466 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 >Feature sequence0546 3438 2557 gene locus_tag LOCUS_47690 3438 2557 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_47690 3687 4862 gene locus_tag LOCUS_47700 3687 4862 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_47700 >Feature sequence0547 996 1493 gene locus_tag LOCUS_47710 996 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 1569 2588 gene locus_tag LOCUS_47720 1569 2588 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_47720 3391 2627 gene locus_tag LOCUS_47730 3391 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 3532 4389 gene locus_tag LOCUS_47740 3532 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 >Feature sequence0548 22 984 gene locus_tag LOCUS_47750 22 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47750 962 2065 gene locus_tag LOCUS_47760 962 2065 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_47760 2065 3282 gene locus_tag LOCUS_47770 2065 3282 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_47770 3303 4889 gene locus_tag LOCUS_47780 3303 4889 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940278.1 protein_id gnl|my_center|LOCUS_47780 >Feature sequence0549 505 1680 gene locus_tag LOCUS_47790 505 1680 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_47790 1760 2260 gene locus_tag LOCUS_47800 gene coaD 1760 2260 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 protein_id gnl|my_center|LOCUS_47800 2270 2578 gene locus_tag LOCUS_47810 2270 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 3900 2617 gene locus_tag LOCUS_47820 3900 2617 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_47820 >Feature sequence0550 316 651 gene locus_tag LOCUS_47830 gene raiA 316 651 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328917.1 protein_id gnl|my_center|LOCUS_47830 706 1212 gene locus_tag LOCUS_47840 706 1212 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_47840 1284 1619 gene locus_tag LOCUS_47850 1284 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 1742 3517 gene locus_tag LOCUS_47860 gene ptsP 1742 3517 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_47860 3649 4434 gene locus_tag LOCUS_47870 3649 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 >Feature sequence0551 2357 2773 gene locus_tag LOCUS_47880 2357 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 2873 3778 gene locus_tag LOCUS_47890 2873 3778 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_47890 4078 3806 gene locus_tag LOCUS_47900 4078 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 4326 4075 gene locus_tag LOCUS_47910 4326 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 <4896 4384 gene locus_tag LOCUS_47920 <4896 4384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037228457.1:deoxyribose-phosphate aldolase >Feature sequence0552 147 587 gene locus_tag LOCUS_47930 147 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 605 1705 gene locus_tag LOCUS_47940 gene galT 605 1705 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_47940 1811 2425 gene locus_tag LOCUS_47950 gene nadD 1811 2425 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_47950 >Feature sequence0553 <1 681 gene locus_tag LOCUS_47960 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256848.1:GAF domain-containing sensor histidine kinase 674 2176 gene locus_tag LOCUS_47970 674 2176 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_47970 2645 2196 gene locus_tag LOCUS_47980 2645 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 <4877 2655 gene locus_tag LOCUS_47990 <4877 2655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162006391.1:heavy metal translocating P-type ATPase >Feature sequence0554 100 1122 gene locus_tag LOCUS_48000 gene ltaE 100 1122 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_48000 1542 1147 gene locus_tag LOCUS_48010 1542 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 1969 1589 gene locus_tag LOCUS_48020 1969 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 2413 2033 gene locus_tag LOCUS_48030 2413 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 3804 2500 gene locus_tag LOCUS_48040 3804 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 4159 4359 gene locus_tag LOCUS_48050 4159 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 >Feature sequence0555 397 221 gene locus_tag LOCUS_48060 397 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 754 2085 gene locus_tag LOCUS_48070 754 2085 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_48070 3426 2200 gene locus_tag LOCUS_48080 3426 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 3672 3932 gene locus_tag LOCUS_48090 3672 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 3944 4237 gene locus_tag LOCUS_48100 gene gatC 3944 4237 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404034.1 protein_id gnl|my_center|LOCUS_48100 >Feature sequence0556 <1 783 gene locus_tag LOCUS_48110 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390194.1:vitamin B12-dependent ribonucleotide reductase 1645 809 gene locus_tag LOCUS_48120 1645 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 1869 2657 gene locus_tag LOCUS_48130 1869 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146462316.1 protein_id gnl|my_center|LOCUS_48130 3890 3051 gene locus_tag LOCUS_48140 3890 3051 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012321.1 protein_id gnl|my_center|LOCUS_48140 4201 3968 gene locus_tag LOCUS_48150 4201 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 >Feature sequence0557 2253 598 gene locus_tag LOCUS_48160 2253 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 3583 2606 gene locus_tag LOCUS_48170 3583 2606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_48170 >Feature sequence0558 894 208 gene locus_tag LOCUS_48180 894 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 1404 898 gene locus_tag LOCUS_48190 1404 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 1828 1436 gene locus_tag LOCUS_48200 1828 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 3539 1962 gene locus_tag LOCUS_48210 gene aroE 3539 1962 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_48210 3825 3655 gene locus_tag LOCUS_48220 gene rpmG 3825 3655 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256375.1 protein_id gnl|my_center|LOCUS_48220 >Feature sequence0559 1199 63 gene locus_tag LOCUS_48230 gene proB 1199 63 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_48230 1400 3121 gene locus_tag LOCUS_48240 1400 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 3118 3990 gene locus_tag LOCUS_48250 gene nadC 3118 3990 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_48250 3987 4760 gene locus_tag LOCUS_48260 3987 4760 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389076.1 protein_id gnl|my_center|LOCUS_48260 >Feature sequence0560 <1 1226 gene locus_tag LOCUS_48270 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086840622.1:FxSxx-COOH system tetratricopeptide repeat protein 1294 2163 gene locus_tag LOCUS_48280 1294 2163 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088051.1 protein_id gnl|my_center|LOCUS_48280 2444 3610 gene locus_tag LOCUS_48290 2444 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 >Feature sequence0561 4584 1417 gene locus_tag LOCUS_48300 4584 1417 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_48300 >Feature sequence0562 601 921 gene locus_tag LOCUS_48310 601 921 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945958.1 protein_id gnl|my_center|LOCUS_48310 1247 2362 gene locus_tag LOCUS_48320 gene oxdD 1247 2362 CDS product oxalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231409.1 protein_id gnl|my_center|LOCUS_48320 2877 2455 gene locus_tag LOCUS_48330 2877 2455 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_48330 3224 2874 gene locus_tag LOCUS_48340 3224 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 3401 4213 gene locus_tag LOCUS_48350 3401 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 4219 4749 gene locus_tag LOCUS_48360 4219 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 >Feature sequence0563 141 1694 gene locus_tag LOCUS_48370 141 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 1912 3591 gene locus_tag LOCUS_48380 1912 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 >Feature sequence0564 <1 1245 gene locus_tag LOCUS_48390 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921843.1:DUF1501 domain-containing protein 1376 2770 gene locus_tag LOCUS_48400 1376 2770 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_48400 3356 2781 gene locus_tag LOCUS_48410 3356 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 3482 4240 gene locus_tag LOCUS_48420 3482 4240 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_48420 4567 4247 gene locus_tag LOCUS_48430 4567 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 >Feature sequence0565 402 1874 gene locus_tag LOCUS_48440 402 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 2409 1981 gene locus_tag LOCUS_48450 2409 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 3426 2782 gene locus_tag LOCUS_48460 3426 2782 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921755.1 protein_id gnl|my_center|LOCUS_48460 4398 3520 gene locus_tag LOCUS_48470 4398 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 >Feature sequence0566 505 263 gene locus_tag LOCUS_48480 505 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 1329 700 gene locus_tag LOCUS_48490 1329 700 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_48490 1457 3298 gene locus_tag LOCUS_48500 1457 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 3311 3478 gene locus_tag LOCUS_48510 3311 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 >Feature sequence0567 113 676 gene locus_tag LOCUS_48520 113 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 686 1759 gene locus_tag LOCUS_48530 686 1759 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122163.1 protein_id gnl|my_center|LOCUS_48530 1756 2259 gene locus_tag LOCUS_48540 1756 2259 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_48540 3766 2426 gene locus_tag LOCUS_48550 3766 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616020.1 protein_id gnl|my_center|LOCUS_48550 >Feature sequence0568 2140 134 gene locus_tag LOCUS_48560 2140 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 3346 2309 gene locus_tag LOCUS_48570 gene pstS 3346 2309 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407468.1 protein_id gnl|my_center|LOCUS_48570 3872 3531 gene locus_tag LOCUS_48580 3872 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 4221 4066 gene locus_tag LOCUS_48590 4221 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 >Feature sequence0569 1122 733 gene locus_tag LOCUS_48600 1122 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48600 1886 1062 gene locus_tag LOCUS_48610 1886 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48610 1973 2236 gene locus_tag LOCUS_48620 1973 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 3328 2312 gene locus_tag LOCUS_48630 gene tsaD 3328 2312 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338414.1 protein_id gnl|my_center|LOCUS_48630 3734 3363 gene locus_tag LOCUS_48640 3734 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 4516 3764 gene locus_tag LOCUS_48650 4516 3764 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_48650 >Feature sequence0570 1219 203 gene locus_tag LOCUS_48660 1219 203 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_48660 3534 1816 gene locus_tag LOCUS_48670 3534 1816 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_48670 4387 3815 gene locus_tag LOCUS_48680 4387 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 >Feature sequence0571 258 1001 gene locus_tag LOCUS_48690 258 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 1027 1584 gene locus_tag LOCUS_48700 1027 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 1621 2295 gene locus_tag LOCUS_48710 1621 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 2386 2655 gene locus_tag LOCUS_48720 2386 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 2652 3419 gene locus_tag LOCUS_48730 gene fliR 2652 3419 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_48730 >Feature sequence0572 492 88 gene locus_tag LOCUS_48740 492 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 2043 520 gene locus_tag LOCUS_48750 2043 520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_48750 2169 2354 gene locus_tag LOCUS_48760 2169 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 2351 3472 gene locus_tag LOCUS_48770 2351 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 >Feature sequence0573 <1 2328 gene locus_tag LOCUS_48780 <1 2328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022493.1:PQQ-binding-like beta-propeller repeat protein 2469 2660 gene locus_tag LOCUS_48790 2469 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 2802 3245 gene locus_tag LOCUS_48800 2802 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48800 >Feature sequence0574 2722 1226 gene locus_tag LOCUS_48810 2722 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117691.1 protein_id gnl|my_center|LOCUS_48810 3770 2910 gene locus_tag LOCUS_48820 gene lpxI 3770 2910 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_48820 <4556 3767 gene locus_tag LOCUS_48830 <4556 3767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922341.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence0575 1131 130 gene locus_tag LOCUS_48840 1131 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 1571 1128 gene locus_tag LOCUS_48850 1571 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 1863 1564 gene locus_tag LOCUS_48860 1863 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 2271 1900 gene locus_tag LOCUS_48870 2271 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48870 2570 2301 gene locus_tag LOCUS_48880 2570 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 3058 2660 gene locus_tag LOCUS_48890 3058 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 3612 3055 gene locus_tag LOCUS_48900 3612 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 >Feature sequence0576 816 571 gene locus_tag LOCUS_48910 816 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 989 2515 gene locus_tag LOCUS_48920 989 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 >Feature sequence0577 953 63 gene locus_tag LOCUS_48930 953 63 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_48930 1395 1003 gene locus_tag LOCUS_48940 1395 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 2570 1395 gene locus_tag LOCUS_48950 2570 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 3628 2585 gene locus_tag LOCUS_48960 3628 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 4140 3820 gene locus_tag LOCUS_48970 4140 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 >Feature sequence0578 <1 1538 gene locus_tag LOCUS_48980 <1 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein >Feature sequence0579 148 399 gene locus_tag LOCUS_48990 148 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 392 658 gene locus_tag LOCUS_49000 392 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 1497 685 gene locus_tag LOCUS_49010 1497 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 1610 2305 gene locus_tag LOCUS_49020 1610 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 3098 2523 gene locus_tag LOCUS_49030 3098 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 3556 3044 gene locus_tag LOCUS_49040 3556 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 3777 4151 gene locus_tag LOCUS_49050 3777 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 >Feature sequence0580 133 1776 gene locus_tag LOCUS_49060 133 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 1807 2910 gene locus_tag LOCUS_49070 1807 2910 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_49070 3399 2920 gene locus_tag LOCUS_49080 3399 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 4236 3520 gene locus_tag LOCUS_49090 4236 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 >Feature sequence0581 880 3081 gene locus_tag LOCUS_49100 880 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 3233 3946 gene locus_tag LOCUS_49110 3233 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 >Feature sequence0582 758 1399 gene locus_tag LOCUS_49120 gene pdxH 758 1399 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_49120 1487 2047 gene locus_tag LOCUS_49130 1487 2047 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_49130 2176 3048 gene locus_tag LOCUS_49140 gene folP 2176 3048 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120943.1 protein_id gnl|my_center|LOCUS_49140 3112 4389 gene locus_tag LOCUS_49150 3112 4389 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_49150 >Feature sequence0583 1043 30 gene locus_tag LOCUS_49160 1043 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 1386 2645 gene locus_tag LOCUS_49170 1386 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 2723 3664 gene locus_tag LOCUS_49180 2723 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 3553 4053 gene locus_tag LOCUS_49190 3553 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 >Feature sequence0584 634 86 gene locus_tag LOCUS_49200 634 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 2070 808 gene locus_tag LOCUS_49210 2070 808 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 protein_id gnl|my_center|LOCUS_49210 2713 2228 gene locus_tag LOCUS_49220 2713 2228 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141436.1 protein_id gnl|my_center|LOCUS_49220 3389 2910 gene locus_tag LOCUS_49230 3389 2910 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141436.1 protein_id gnl|my_center|LOCUS_49230 3742 3386 gene locus_tag LOCUS_49240 3742 3386 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_49240 3918 4388 gene locus_tag LOCUS_49250 3918 4388 CDS product cell division protein FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921625.1 protein_id gnl|my_center|LOCUS_49250 >Feature sequence0585 624 178 gene locus_tag LOCUS_49260 624 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 1629 730 gene locus_tag LOCUS_49270 1629 730 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_49270 2470 1844 gene locus_tag LOCUS_49280 2470 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 2851 3255 gene locus_tag LOCUS_49290 2851 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 >Feature sequence0586 936 106 gene locus_tag LOCUS_49300 936 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 2338 923 gene locus_tag LOCUS_49310 2338 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 3198 2335 gene locus_tag LOCUS_49320 3198 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49320 3782 3195 gene locus_tag LOCUS_49330 3782 3195 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_49330 <4444 3779 gene locus_tag LOCUS_49340 <4444 3779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000063680.1:polysulfide reductase NrfD >Feature sequence0587 134 550 gene locus_tag LOCUS_49350 134 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 752 1516 gene locus_tag LOCUS_49360 752 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 1841 3829 gene locus_tag LOCUS_49370 1841 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 >Feature sequence0588 1936 1250 gene locus_tag LOCUS_49380 1936 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 2041 3798 gene locus_tag LOCUS_49390 2041 3798 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_49390 >Feature sequence0589 <1 1991 gene locus_tag LOCUS_49400 <1 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:DUF1549 domain-containing protein 2047 2574 gene locus_tag LOCUS_49410 2047 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 3300 2590 gene locus_tag LOCUS_49420 3300 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 <4403 3561 gene locus_tag LOCUS_49430 <4403 3561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941762.1:phosphate regulon sensor histidine kinase PhoR >Feature sequence0590 979 305 gene locus_tag LOCUS_49440 gene rpiA 979 305 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_49440 1034 2659 gene locus_tag LOCUS_49450 1034 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 4206 2707 gene locus_tag LOCUS_49460 gene malQ 4206 2707 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_49460 >Feature sequence0591 366 755 gene locus_tag LOCUS_49470 366 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 794 1513 gene locus_tag LOCUS_49480 gene scpB 794 1513 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_49480 1616 2467 gene locus_tag LOCUS_49490 1616 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 2607 3590 gene locus_tag LOCUS_49500 2607 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 >Feature sequence0592 100 639 gene locus_tag LOCUS_49510 100 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 2081 1419 gene locus_tag LOCUS_49520 2081 1419 CDS product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 protein_id gnl|my_center|LOCUS_49520 2964 2293 gene locus_tag LOCUS_49530 2964 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 4156 3059 gene locus_tag LOCUS_49540 4156 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 >Feature sequence0593 1831 668 gene locus_tag LOCUS_49550 gene devC 1831 668 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_49550 3237 2002 gene locus_tag LOCUS_49560 gene devC 3237 2002 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_49560 >Feature sequence0594 296 658 gene locus_tag LOCUS_49570 296 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 847 2016 gene locus_tag LOCUS_49580 847 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 2099 2275 gene locus_tag LOCUS_49590 2099 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 3362 2244 gene locus_tag LOCUS_49600 3362 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 >Feature sequence0595 871 1206 gene locus_tag LOCUS_49610 871 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 1400 1954 gene locus_tag LOCUS_49620 1400 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 1997 2281 gene locus_tag LOCUS_49630 1997 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 2278 2952 gene locus_tag LOCUS_49640 2278 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 2949 3653 gene locus_tag LOCUS_49650 2949 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 3657 4136 gene locus_tag LOCUS_49660 3657 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 >Feature sequence0596 2927 117 gene locus_tag LOCUS_49670 2927 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 <4346 3071 gene locus_tag LOCUS_49680 <4346 3071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922003.1:DUF1583 domain-containing protein >Feature sequence0597 1832 1614 gene locus_tag LOCUS_49690 1832 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 1983 2207 gene locus_tag LOCUS_49700 1983 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 2310 2531 gene locus_tag LOCUS_49710 gene infA 2310 2531 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_49710 3328 2771 gene locus_tag LOCUS_49720 3328 2771 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778948.1 protein_id gnl|my_center|LOCUS_49720 3476 3982 gene locus_tag LOCUS_49730 gene hpt 3476 3982 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_49730 >Feature sequence0598 2522 1224 gene locus_tag LOCUS_49740 2522 1224 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_49740 4201 2660 gene locus_tag LOCUS_49750 4201 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 >Feature sequence0599 846 103 gene locus_tag LOCUS_49760 846 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 1303 866 gene locus_tag LOCUS_49770 1303 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 1710 1345 gene locus_tag LOCUS_49780 1710 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 2418 1825 gene locus_tag LOCUS_49790 2418 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 3684 2581 gene locus_tag LOCUS_49800 3684 2581 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_49800 >Feature sequence0600 797 165 gene locus_tag LOCUS_49810 gene coaE 797 165 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038217.1 protein_id gnl|my_center|LOCUS_49810 1435 794 gene locus_tag LOCUS_49820 1435 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 <4317 1432 gene locus_tag LOCUS_49830 <4317 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968406.1:DNA polymerase I >Feature sequence0601 490 642 gene locus_tag LOCUS_49840 490 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 639 941 gene locus_tag LOCUS_49850 639 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 938 1201 gene locus_tag LOCUS_49860 938 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_49860 2655 1243 gene locus_tag LOCUS_49870 2655 1243 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_49870 1415 1320 gene locus_tag LOCUS_t00490 1415 1320 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4228 2792 gene locus_tag LOCUS_49880 4228 2792 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_49880 >Feature sequence0602 1071 472 gene locus_tag LOCUS_49890 1071 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 2427 1090 gene locus_tag LOCUS_49900 2427 1090 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974182.1 protein_id gnl|my_center|LOCUS_49900 3821 2502 gene locus_tag LOCUS_49910 3821 2502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_49910 >Feature sequence0603 876 1346 gene locus_tag LOCUS_49920 876 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 1422 1799 gene locus_tag LOCUS_49930 1422 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 3037 1817 gene locus_tag LOCUS_49940 3037 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 3852 3034 gene locus_tag LOCUS_49950 3852 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 >Feature sequence0604 2718 1429 gene locus_tag LOCUS_49960 2718 1429 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_49960 <4304 2732 gene locus_tag LOCUS_49970 <4304 2732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921309.1:DUF1549 and DUF1553 domain-containing protein >Feature sequence0605 849 358 gene locus_tag LOCUS_49980 849 358 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_49980 1236 907 gene locus_tag LOCUS_49990 1236 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 1448 2308 gene locus_tag LOCUS_50000 1448 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 3036 2422 gene locus_tag LOCUS_50010 gene hisH 3036 2422 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_50010 <4289 3171 gene locus_tag LOCUS_50020 <4289 3171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942686.1:A24 family peptidase >Feature sequence0606 827 1594 gene locus_tag LOCUS_50030 827 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 1717 2802 gene locus_tag LOCUS_50040 1717 2802 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_50040 >Feature sequence0607 1715 1296 gene locus_tag LOCUS_50050 1715 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 2470 1967 gene locus_tag LOCUS_50060 2470 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 <4249 2549 gene locus_tag LOCUS_50070 <4249 2549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119405.1:FG-GAP-like repeat-containing protein >Feature sequence0608 159 401 gene locus_tag LOCUS_50080 159 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 505 1842 gene locus_tag LOCUS_50090 505 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 3261 1966 gene locus_tag LOCUS_50100 3261 1966 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_50100 >Feature sequence0609 1364 78 gene locus_tag LOCUS_50110 1364 78 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_50110 3276 1495 gene locus_tag LOCUS_50120 3276 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 4162 3383 gene locus_tag LOCUS_50130 4162 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 >Feature sequence0610 2265 1003 gene locus_tag LOCUS_50140 2265 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 >Feature sequence0611 1025 2815 gene locus_tag LOCUS_50150 1025 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 2812 3138 gene locus_tag LOCUS_50160 2812 3138 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_50160 3866 3231 gene locus_tag LOCUS_50170 3866 3231 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943932.1 protein_id gnl|my_center|LOCUS_50170 4160 3984 gene locus_tag LOCUS_50180 4160 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 >Feature sequence0612 <1 1812 gene locus_tag LOCUS_50190 <1 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921306.1:ATP-binding protein 1816 2250 gene locus_tag LOCUS_50200 1816 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 2301 2513 gene locus_tag LOCUS_50210 2301 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 4211 4137 gene locus_tag LOCUS_t00500 4211 4137 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0613 1844 342 gene locus_tag LOCUS_50220 gene der 1844 342 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_50220 2717 1938 gene locus_tag LOCUS_50230 2717 1938 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018207865.1 protein_id gnl|my_center|LOCUS_50230 2888 3415 gene locus_tag LOCUS_50240 2888 3415 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103756.1 protein_id gnl|my_center|LOCUS_50240 3541 3792 gene locus_tag LOCUS_50250 3541 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 3838 4200 gene locus_tag LOCUS_50260 3838 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 protein_id gnl|my_center|LOCUS_50260 >Feature sequence0614 1 201 gene locus_tag LOCUS_50270 1 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 365 207 gene locus_tag LOCUS_50280 365 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 588 397 gene locus_tag LOCUS_50290 588 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 719 3487 gene locus_tag LOCUS_50300 719 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 >Feature sequence0615 666 445 gene locus_tag LOCUS_50310 666 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 901 1140 gene locus_tag LOCUS_50320 901 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 1269 2114 gene locus_tag LOCUS_50330 gene fhcD 1269 2114 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_50330 2166 2651 gene locus_tag LOCUS_50340 2166 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 2676 2948 gene locus_tag LOCUS_50350 2676 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 3097 3318 gene locus_tag LOCUS_50360 3097 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 3840 3340 gene locus_tag LOCUS_50370 3840 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 >Feature sequence0616 1123 2457 gene locus_tag LOCUS_50380 1123 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 2355 3596 gene locus_tag LOCUS_50390 2355 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 >Feature sequence0617 433 2166 gene locus_tag LOCUS_50400 433 2166 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_50400 2808 2173 gene locus_tag LOCUS_50410 2808 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 3990 3064 gene locus_tag LOCUS_50420 3990 3064 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 protein_id gnl|my_center|LOCUS_50420 >Feature sequence0618 555 797 gene locus_tag LOCUS_50430 555 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 909 1403 gene locus_tag LOCUS_50440 909 1403 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334911.1 protein_id gnl|my_center|LOCUS_50440 1755 1396 gene locus_tag LOCUS_50450 1755 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 2116 3135 gene locus_tag LOCUS_50460 2116 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 3183 4154 gene locus_tag LOCUS_50470 3183 4154 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_50470 >Feature sequence0619 1902 2639 gene locus_tag LOCUS_50480 1902 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 2672 3892 gene locus_tag LOCUS_50490 2672 3892 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922165.1 protein_id gnl|my_center|LOCUS_50490 >Feature sequence0620 974 417 gene locus_tag LOCUS_50500 gene rplQ 974 417 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919152.1 protein_id gnl|my_center|LOCUS_50500 2114 1116 gene locus_tag LOCUS_50510 2114 1116 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_50510 2937 2299 gene locus_tag LOCUS_50520 gene rpsD 2937 2299 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869903.1 protein_id gnl|my_center|LOCUS_50520 3518 3138 gene locus_tag LOCUS_50530 gene rpsK 3518 3138 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_50530 4058 3675 gene locus_tag LOCUS_50540 gene rpsM 4058 3675 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_50540 >Feature sequence0621 2047 626 gene locus_tag LOCUS_50550 2047 626 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_50550 4009 2186 gene locus_tag LOCUS_50560 4009 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 >Feature sequence0622 1 453 gene locus_tag LOCUS_50570 1 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 1031 603 gene locus_tag LOCUS_50580 1031 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 1294 2601 gene locus_tag LOCUS_50590 1294 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 >Feature sequence0623 2585 1317 gene locus_tag LOCUS_50600 2585 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 4029 2761 gene locus_tag LOCUS_50610 4029 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 >Feature sequence0624 420 3104 gene locus_tag LOCUS_50620 420 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 <4142 3179 gene locus_tag LOCUS_50630 <4142 3179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122094.1:DUF1559 domain-containing protein >Feature sequence0625 1360 791 gene locus_tag LOCUS_50640 1360 791 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_50640 2234 1524 gene locus_tag LOCUS_50650 2234 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 >Feature sequence0626 341 532 gene locus_tag LOCUS_50660 341 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 888 592 gene locus_tag LOCUS_50670 888 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 2644 779 gene locus_tag LOCUS_50680 2644 779 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051509115.1 protein_id gnl|my_center|LOCUS_50680 3015 3266 gene locus_tag LOCUS_50690 3015 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 >Feature sequence0627 742 440 gene locus_tag LOCUS_50700 742 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 1240 1001 gene locus_tag LOCUS_50710 1240 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 1370 2149 gene locus_tag LOCUS_50720 1370 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 2231 2851 gene locus_tag LOCUS_50730 2231 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 3611 2829 gene locus_tag LOCUS_50740 3611 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 >Feature sequence0628 2916 586 gene locus_tag LOCUS_50750 2916 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 4036 3035 gene locus_tag LOCUS_50760 4036 3035 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926902.1 protein_id gnl|my_center|LOCUS_50760 >Feature sequence0629 1130 114 gene locus_tag LOCUS_50770 1130 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 2588 1251 gene locus_tag LOCUS_50780 2588 1251 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104227.1 protein_id gnl|my_center|LOCUS_50780 >Feature sequence0630 176 445 gene locus_tag LOCUS_50790 176 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 442 942 gene locus_tag LOCUS_50800 442 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 1062 1262 gene locus_tag LOCUS_50810 1062 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 1371 1778 gene locus_tag LOCUS_50820 1371 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 2579 3019 gene locus_tag LOCUS_50830 2579 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 3098 3421 gene locus_tag LOCUS_50840 3098 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 3846 4043 gene locus_tag LOCUS_50850 gene csrA 3846 4043 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_50850 >Feature sequence0631 787 218 gene locus_tag LOCUS_50860 787 218 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_50860 2121 949 gene locus_tag LOCUS_50870 2121 949 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_50870 3006 2224 gene locus_tag LOCUS_50880 3006 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 >Feature sequence0632 541 1539 gene locus_tag LOCUS_50890 541 1539 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_50890 1688 2854 gene locus_tag LOCUS_50900 1688 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 >Feature sequence0633 659 348 gene locus_tag LOCUS_50910 659 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 1313 1660 gene locus_tag LOCUS_50920 1313 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 2261 1797 gene locus_tag LOCUS_50930 2261 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 3524 2304 gene locus_tag LOCUS_50940 3524 2304 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_50940 >Feature sequence0634 3948 430 gene locus_tag LOCUS_50950 3948 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 >Feature sequence0635 4013 1323 gene locus_tag LOCUS_50960 4013 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 >Feature sequence0636 748 596 gene locus_tag LOCUS_50970 748 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 1206 2309 gene locus_tag LOCUS_50980 1206 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 2421 2717 gene locus_tag LOCUS_50990 2421 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 3114 2875 gene locus_tag LOCUS_51000 3114 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 3154 3555 gene locus_tag LOCUS_51010 3154 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51010 3795 3977 gene locus_tag LOCUS_51020 3795 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 >Feature sequence0637 >Feature sequence0638 716 1042 gene locus_tag LOCUS_51030 716 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 1079 1405 gene locus_tag LOCUS_51040 1079 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 1468 1776 gene locus_tag LOCUS_51050 1468 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 1833 3326 gene locus_tag LOCUS_51060 1833 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 3323 3751 gene locus_tag LOCUS_51070 3323 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 3744 4004 gene locus_tag LOCUS_51080 3744 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 >Feature sequence0639 >Feature sequence0640 3374 2865 gene locus_tag LOCUS_51090 3374 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 >Feature sequence0641 1239 2117 gene locus_tag LOCUS_51100 1239 2117 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333441.1 protein_id gnl|my_center|LOCUS_51100 3559 2195 gene locus_tag LOCUS_51110 3559 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 >Feature sequence0642 2982 2065 gene locus_tag LOCUS_51120 2982 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 >Feature sequence0643 1054 758 gene locus_tag LOCUS_51130 1054 758 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_51130 2339 1089 gene locus_tag LOCUS_51140 2339 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 2466 2867 gene locus_tag LOCUS_51150 2466 2867 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_51150 >Feature sequence0644 55 720 gene locus_tag LOCUS_51160 55 720 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_51160 768 1922 gene locus_tag LOCUS_51170 gene speY 768 1922 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_51170 1926 2975 gene locus_tag LOCUS_51180 1926 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 3250 3002 gene locus_tag LOCUS_51190 3250 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 3237 3428 gene locus_tag LOCUS_51200 3237 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 >Feature sequence0645 2226 352 gene locus_tag LOCUS_51210 2226 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 <3957 2315 gene locus_tag LOCUS_51220 <3957 2315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967507.1:ATP-binding protein >Feature sequence0646 2037 3227 gene locus_tag LOCUS_51230 2037 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 3221 3895 gene locus_tag LOCUS_51240 3221 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 >Feature sequence0647 166 405 gene locus_tag LOCUS_51250 166 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 1511 450 gene locus_tag LOCUS_51260 1511 450 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_51260 2090 2575 gene locus_tag LOCUS_51270 2090 2575 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_51270 3094 2762 gene locus_tag LOCUS_51280 3094 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 3470 3733 gene locus_tag LOCUS_51290 3470 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 >Feature sequence0648 338 159 gene locus_tag LOCUS_51300 338 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 2560 434 gene locus_tag LOCUS_51310 2560 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 3429 3755 gene locus_tag LOCUS_51320 3429 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 >Feature sequence0649 170 823 gene locus_tag LOCUS_51330 170 823 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_51330 882 1910 gene locus_tag LOCUS_51340 gene cysK 882 1910 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_51340 2615 1977 gene locus_tag LOCUS_51350 2615 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 2785 3243 gene locus_tag LOCUS_51360 2785 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 >Feature sequence0650 <1 1136 gene locus_tag LOCUS_51370 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615465.1:PSD1 and planctomycete cytochrome C domain-containing protein 1200 1766 gene locus_tag LOCUS_51380 1200 1766 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_51380 >Feature sequence0651 1308 295 gene locus_tag LOCUS_51390 1308 295 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065050.1 protein_id gnl|my_center|LOCUS_51390 <3926 1428 gene locus_tag LOCUS_51400 <3926 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922184.1:DNA gyrase subunit A >Feature sequence0652 619 149 gene locus_tag LOCUS_51410 619 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 1285 734 gene locus_tag LOCUS_51420 1285 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 3004 1523 gene locus_tag LOCUS_51430 3004 1523 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_51430 >Feature sequence0653 <1 1032 gene locus_tag LOCUS_51440 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389221.1:acetate/propionate family kinase 1029 1763 gene locus_tag LOCUS_51450 1029 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 >Feature sequence0654 <1 1116 gene locus_tag LOCUS_51460 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922371.1:RHS repeat-associated core domain-containing protein 2485 1514 gene locus_tag LOCUS_51470 2485 1514 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_51470 2831 2472 gene locus_tag LOCUS_51480 2831 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 3662 3024 gene locus_tag LOCUS_51490 3662 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 >Feature sequence0655 <1 1120 gene locus_tag LOCUS_51500 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035474.1:olefin beta-lactone synthetase OleC 1117 2112 gene locus_tag LOCUS_51510 1117 2112 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_51510 3102 2206 gene locus_tag LOCUS_51520 3102 2206 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_51520 >Feature sequence0656 <1 798 gene locus_tag LOCUS_51530 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120679.1:DUF1549 domain-containing protein 995 1192 gene locus_tag LOCUS_51540 995 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 1522 1217 gene locus_tag LOCUS_51550 1522 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 2043 1606 gene locus_tag LOCUS_51560 2043 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 3269 2157 gene locus_tag LOCUS_51570 3269 2157 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_51570 >Feature sequence0657 <1 2729 gene locus_tag LOCUS_51580 <1 2729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333812.1:DNA-directed RNA polymerase subunit beta' 2993 3367 gene locus_tag LOCUS_51590 gene rpsL 2993 3367 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_51590 >Feature sequence0658 <1 1093 gene locus_tag LOCUS_51600 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942647.1:UbiD family decarboxylase 1417 1100 gene locus_tag LOCUS_51610 1417 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 >Feature sequence0659 239 1978 gene locus_tag LOCUS_51620 239 1978 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922210.1 protein_id gnl|my_center|LOCUS_51620 2124 2693 gene locus_tag LOCUS_51630 2124 2693 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222864.1 protein_id gnl|my_center|LOCUS_51630 2906 3451 gene locus_tag LOCUS_51640 2906 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 >Feature sequence0660 1 489 gene locus_tag LOCUS_51650 1 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 1473 571 gene locus_tag LOCUS_51660 1473 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 1803 1603 gene locus_tag LOCUS_51670 1803 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 2810 2262 gene locus_tag LOCUS_51680 2810 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 3734 3486 gene locus_tag LOCUS_51690 3734 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 >Feature sequence0661 190 1248 gene locus_tag LOCUS_51700 190 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 1439 2296 gene locus_tag LOCUS_51710 1439 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 3096 2347 gene locus_tag LOCUS_51720 3096 2347 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122697.1 protein_id gnl|my_center|LOCUS_51720 >Feature sequence0662 3405 1894 gene locus_tag LOCUS_51730 3405 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51730 >Feature sequence0663 1158 2171 gene locus_tag LOCUS_51740 1158 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 2168 3067 gene locus_tag LOCUS_51750 2168 3067 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403827.1 protein_id gnl|my_center|LOCUS_51750 >Feature sequence0664 107 907 gene locus_tag LOCUS_51760 107 907 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_51760 1748 930 gene locus_tag LOCUS_51770 1748 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 3060 1933 gene locus_tag LOCUS_51780 3060 1933 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_51780 >Feature sequence0665 92 793 gene locus_tag LOCUS_51790 92 793 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583618.1 protein_id gnl|my_center|LOCUS_51790 921 1133 gene locus_tag LOCUS_51800 921 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 2687 1290 gene locus_tag LOCUS_51810 2687 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 >Feature sequence0666 2 1003 gene locus_tag LOCUS_51820 2 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 1110 1313 gene locus_tag LOCUS_51830 1110 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 1342 1590 gene locus_tag LOCUS_51840 1342 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 >Feature sequence0667 2131 233 gene locus_tag LOCUS_51850 gene dxs 2131 233 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325559.1 protein_id gnl|my_center|LOCUS_51850 3157 2237 gene locus_tag LOCUS_51860 3157 2237 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_51860 3562 3254 gene locus_tag LOCUS_51870 3562 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 >Feature sequence0668 <1 692 gene locus_tag LOCUS_51880 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090268.1:L-lactate permease 786 1418 gene locus_tag LOCUS_51890 786 1418 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_51890 1778 1443 gene locus_tag LOCUS_51900 1778 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 2437 1877 gene locus_tag LOCUS_51910 gene trmL 2437 1877 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_51910 >Feature sequence0669 1753 44 gene locus_tag LOCUS_51920 1753 44 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036780.1 protein_id gnl|my_center|LOCUS_51920 2247 1750 gene locus_tag LOCUS_51930 2247 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 3455 2244 gene locus_tag LOCUS_51940 3455 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204895.1 protein_id gnl|my_center|LOCUS_51940 >Feature sequence0670 96 1601 gene locus_tag LOCUS_51950 96 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 2546 1683 gene locus_tag LOCUS_51960 2546 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 <3771 2624 gene locus_tag LOCUS_51970 <3771 2624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545380.1:ATP-binding protein >Feature sequence0671 3012 1513 gene locus_tag LOCUS_51980 gene der 3012 1513 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_51980 <3771 3108 gene locus_tag LOCUS_51990 <3771 3108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970017.1:SDR family oxidoreductase >Feature sequence0672 >Feature sequence0673 1081 32 gene locus_tag LOCUS_52000 1081 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 3585 1342 gene locus_tag LOCUS_52010 3585 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 >Feature sequence0674 <1 963 gene locus_tag LOCUS_52020 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141892.1:aldo/keto reductase 1070 2236 gene locus_tag LOCUS_52030 1070 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 2262 2525 gene locus_tag LOCUS_52040 2262 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 3637 2522 gene locus_tag LOCUS_52050 3637 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 >Feature sequence0675 2007 688 gene locus_tag LOCUS_52060 2007 688 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397083.1 protein_id gnl|my_center|LOCUS_52060 3653 2070 gene locus_tag LOCUS_52070 3653 2070 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965750.1 protein_id gnl|my_center|LOCUS_52070 >Feature sequence0676 300 755 gene locus_tag LOCUS_52080 300 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 918 1109 gene locus_tag LOCUS_52090 918 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 1175 1609 gene locus_tag LOCUS_52100 1175 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 1611 2084 gene locus_tag LOCUS_52110 1611 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 2189 2533 gene locus_tag LOCUS_52120 2189 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 >Feature sequence0677 3594 1852 gene locus_tag LOCUS_52130 3594 1852 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_52130 >Feature sequence0678 >Feature sequence0679 3222 2596 gene locus_tag LOCUS_52140 3222 2596 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_52140 >Feature sequence0680 443 1258 gene locus_tag LOCUS_52150 gene thyX 443 1258 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228090.1 protein_id gnl|my_center|LOCUS_52150 1492 2274 gene locus_tag LOCUS_52160 1492 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 2347 3600 gene locus_tag LOCUS_52170 2347 3600 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120796.1 protein_id gnl|my_center|LOCUS_52170 >Feature sequence0681 <1 562 gene locus_tag LOCUS_52180 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969824.1:RNA polymerase sigma factor 559 798 gene locus_tag LOCUS_52190 559 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 2431 911 gene locus_tag LOCUS_52200 2431 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 2581 3267 gene locus_tag LOCUS_52210 2581 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 >Feature sequence0682 1511 1020 gene locus_tag LOCUS_52220 1511 1020 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_52220 2727 1645 gene locus_tag LOCUS_52230 2727 1645 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_52230 <3684 2797 gene locus_tag LOCUS_52240 <3684 2797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615542.1:UDP-3-O-acyl-N-acetylglucosamine deacetylase >Feature sequence0683 2215 356 gene locus_tag LOCUS_52250 2215 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 3394 2342 gene locus_tag LOCUS_52260 3394 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 >Feature sequence0684 <1 579 gene locus_tag LOCUS_52270 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335404.1:sigma-70 family RNA polymerase sigma factor 603 1400 gene locus_tag LOCUS_52280 603 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 1421 2383 gene locus_tag LOCUS_52290 1421 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 3343 2402 gene locus_tag LOCUS_52300 3343 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 >Feature sequence0685 <3662 1158 gene locus_tag LOCUS_52310 <3662 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein >Feature sequence0686 281 1402 gene locus_tag LOCUS_52320 gene rho 281 1402 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_52320 1447 1809 gene locus_tag LOCUS_52330 1447 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 1799 2239 gene locus_tag LOCUS_52340 1799 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 2236 2640 gene locus_tag LOCUS_52350 2236 2640 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 protein_id gnl|my_center|LOCUS_52350 3595 2627 gene locus_tag LOCUS_52360 3595 2627 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_52360 >Feature sequence0687 510 70 gene locus_tag LOCUS_52370 510 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 3091 737 gene locus_tag LOCUS_52380 3091 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 >Feature sequence0688 347 132 gene locus_tag LOCUS_52390 347 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 1405 356 gene locus_tag LOCUS_52400 1405 356 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_52400 1317 1709 gene locus_tag LOCUS_52410 1317 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 2359 1781 gene locus_tag LOCUS_52420 2359 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 <3642 2525 gene locus_tag LOCUS_52430 <3642 2525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368806.1:sigma-54-dependent response regulator transcription factor ZraR >Feature sequence0689 273 1928 gene locus_tag LOCUS_52440 273 1928 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_52440 1925 2272 gene locus_tag LOCUS_52450 1925 2272 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327264.1 protein_id gnl|my_center|LOCUS_52450 3545 2280 gene locus_tag LOCUS_52460 3545 2280 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_52460 >Feature sequence0690 <1 1831 gene locus_tag LOCUS_52470 <1 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888391.1:trypsin-like peptidase domain-containing protein 2980 1928 gene locus_tag LOCUS_52480 2980 1928 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533780.1 protein_id gnl|my_center|LOCUS_52480 >Feature sequence0691 1102 437 gene locus_tag LOCUS_52490 1102 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 2105 1536 gene locus_tag LOCUS_52500 2105 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 3069 2224 gene locus_tag LOCUS_52510 gene motA 3069 2224 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_52510 >Feature sequence0692 797 426 gene locus_tag LOCUS_52520 797 426 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923289.1 protein_id gnl|my_center|LOCUS_52520 2664 1057 gene locus_tag LOCUS_52530 2664 1057 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 protein_id gnl|my_center|LOCUS_52530 3381 2935 gene locus_tag LOCUS_52540 3381 2935 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_52540 3576 3385 gene locus_tag LOCUS_52550 3576 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 >Feature sequence0693 358 1131 gene locus_tag LOCUS_52560 358 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 1150 1356 gene locus_tag LOCUS_52570 1150 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 1914 1393 gene locus_tag LOCUS_52580 1914 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 2674 2021 gene locus_tag LOCUS_52590 2674 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 2835 2671 gene locus_tag LOCUS_52600 2835 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 <3634 2903 gene locus_tag LOCUS_52610 <3634 2903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931749.1:type I DNA topoisomerase >Feature sequence0694 266 748 gene locus_tag LOCUS_52620 266 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 1624 782 gene locus_tag LOCUS_52630 1624 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 2232 1888 gene locus_tag LOCUS_52640 2232 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 3492 2248 gene locus_tag LOCUS_52650 3492 2248 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_52650 >Feature sequence0695 971 3448 gene locus_tag LOCUS_52660 971 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 >Feature sequence0696 <1 751 gene locus_tag LOCUS_52670 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616161.1:HAMP domain-containing sensor histidine kinase 802 1548 gene locus_tag LOCUS_52680 802 1548 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_52680 >Feature sequence0697 231 956 gene locus_tag LOCUS_52690 231 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 1121 1609 gene locus_tag LOCUS_52700 gene greA 1121 1609 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_52700 1818 2333 gene locus_tag LOCUS_52710 1818 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 2593 3474 gene locus_tag LOCUS_52720 2593 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 >Feature sequence0698 427 1140 gene locus_tag LOCUS_52730 427 1140 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120970.1 protein_id gnl|my_center|LOCUS_52730 1813 1262 gene locus_tag LOCUS_52740 1813 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 2676 1810 gene locus_tag LOCUS_52750 2676 1810 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_52750 >Feature sequence0699 162 806 gene locus_tag LOCUS_52760 162 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 824 2086 gene locus_tag LOCUS_52770 824 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 2277 2885 gene locus_tag LOCUS_52780 2277 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 2975 3523 gene locus_tag LOCUS_52790 2975 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 >Feature sequence0700 <1 786 gene locus_tag LOCUS_52800 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525325.1:aldolase/citrate lyase family protein 909 2852 gene locus_tag LOCUS_52810 909 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827609.1 protein_id gnl|my_center|LOCUS_52810 >Feature sequence0701 >Feature sequence0702 734 1186 gene locus_tag LOCUS_52820 734 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 1389 2393 gene locus_tag LOCUS_52830 gene corA 1389 2393 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_52830 >Feature sequence0703 966 37 gene locus_tag LOCUS_52840 966 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 >Feature sequence0704 <3545 1752 gene locus_tag LOCUS_52850 <3545 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328387.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence0705 863 351 gene locus_tag LOCUS_52860 863 351 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022499.1 protein_id gnl|my_center|LOCUS_52860 1057 3507 gene locus_tag LOCUS_52870 1057 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 >Feature sequence0706 1294 77 gene locus_tag LOCUS_52880 gene hutI 1294 77 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918844.1 protein_id gnl|my_center|LOCUS_52880 1367 2728 gene locus_tag LOCUS_52890 1367 2728 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088984.1 protein_id gnl|my_center|LOCUS_52890 2847 3155 gene locus_tag LOCUS_52900 2847 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 >Feature sequence0707 2889 1108 gene locus_tag LOCUS_52910 2889 1108 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_52910 >Feature sequence0708 2361 2861 gene locus_tag LOCUS_52920 2361 2861 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_52920 >Feature sequence0709 1520 2581 gene locus_tag LOCUS_52930 1520 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 2651 3124 gene locus_tag LOCUS_52940 2651 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 >Feature sequence0710 150 2354 gene locus_tag LOCUS_52950 150 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 3071 2424 gene locus_tag LOCUS_52960 3071 2424 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787337.1 protein_id gnl|my_center|LOCUS_52960 >Feature sequence0711 53 1165 gene locus_tag LOCUS_52970 53 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118845.1 protein_id gnl|my_center|LOCUS_52970 1305 1859 gene locus_tag LOCUS_52980 1305 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 1891 2691 gene locus_tag LOCUS_52990 1891 2691 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_52990 2821 3447 gene locus_tag LOCUS_53000 2821 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088355.1 protein_id gnl|my_center|LOCUS_53000 >Feature sequence0712 1627 2676 gene locus_tag LOCUS_53010 1627 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 2826 3362 gene locus_tag LOCUS_53020 2826 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 >Feature sequence0713 866 12 gene locus_tag LOCUS_53030 866 12 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812797.1 protein_id gnl|my_center|LOCUS_53030 1058 1603 gene locus_tag LOCUS_53040 1058 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 2466 1678 gene locus_tag LOCUS_53050 2466 1678 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_53050 >Feature sequence0714 146 1003 gene locus_tag LOCUS_53060 146 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 1105 1177 gene locus_tag LOCUS_t00510 1105 1177 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1334 2893 gene locus_tag LOCUS_53070 gene tig 1334 2893 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_53070 >Feature sequence0715 393 4 gene locus_tag LOCUS_53080 393 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53080 3195 1264 gene locus_tag LOCUS_53090 3195 1264 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_53090 >Feature sequence0716 96 1769 gene locus_tag LOCUS_53100 96 1769 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667792.1 protein_id gnl|my_center|LOCUS_53100 3348 1876 gene locus_tag LOCUS_53110 3348 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 >Feature sequence0717 3170 456 gene locus_tag LOCUS_53120 3170 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 >Feature sequence0718 1127 810 gene locus_tag LOCUS_53130 1127 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 1546 1220 gene locus_tag LOCUS_53140 1546 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 1861 2592 gene locus_tag LOCUS_53150 1861 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 >Feature sequence0719 816 529 gene locus_tag LOCUS_53160 816 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 1391 1092 gene locus_tag LOCUS_53170 1391 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 1624 1388 gene locus_tag LOCUS_53180 1624 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 3252 1912 gene locus_tag LOCUS_53190 3252 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 >Feature sequence0720 332 183 gene locus_tag LOCUS_53200 332 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 2254 503 gene locus_tag LOCUS_53210 2254 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 3255 2371 gene locus_tag LOCUS_53220 3255 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 >Feature sequence0721 1428 1943 gene locus_tag LOCUS_53230 1428 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 1940 2491 gene locus_tag LOCUS_53240 1940 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 3379 2498 gene locus_tag LOCUS_53250 gene hisG 3379 2498 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_53250 >Feature sequence0722 293 1777 gene locus_tag LOCUS_53260 293 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 1874 3070 gene locus_tag LOCUS_53270 1874 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_53270 >Feature sequence0723 503 1078 gene locus_tag LOCUS_53280 503 1078 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479688.1 protein_id gnl|my_center|LOCUS_53280 2759 1119 gene locus_tag LOCUS_53290 gene pgm 2759 1119 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_53290 <3444 2913 gene locus_tag LOCUS_53300 <3444 2913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210864.1:patatin-like phospholipase family protein >Feature sequence0724 <1 969 gene locus_tag LOCUS_53310 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938112.1:molecular chaperone DnaK 1113 2099 gene locus_tag LOCUS_53320 1113 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 2808 2182 gene locus_tag LOCUS_53330 2808 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 >Feature sequence0725 865 125 gene locus_tag LOCUS_53340 gene hisA 865 125 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_53340 1767 943 gene locus_tag LOCUS_53350 1767 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 2196 2387 gene locus_tag LOCUS_53360 2196 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 <3439 2503 gene locus_tag LOCUS_53370 <3439 2503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986810.1:tetratricopeptide repeat protein >Feature sequence0726 3170 468 gene locus_tag LOCUS_53380 3170 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 >Feature sequence0727 670 1899 gene locus_tag LOCUS_53390 670 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 2367 3047 gene locus_tag LOCUS_53400 2367 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 >Feature sequence0728 2386 2165 gene locus_tag LOCUS_53410 2386 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 >Feature sequence0729 1231 56 gene locus_tag LOCUS_53420 gene rsgA 1231 56 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119119.1 protein_id gnl|my_center|LOCUS_53420 1397 2383 gene locus_tag LOCUS_53430 1397 2383 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_53430 2503 3399 gene locus_tag LOCUS_53440 2503 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 >Feature sequence0730 <1 903 gene locus_tag LOCUS_53450 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118969.1:xylose isomerase 982 2148 gene locus_tag LOCUS_53460 982 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_53460 2250 2633 gene locus_tag LOCUS_53470 2250 2633 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_53470 >Feature sequence0731 880 518 gene locus_tag LOCUS_53480 880 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 1538 1140 gene locus_tag LOCUS_53490 1538 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 2710 1670 gene locus_tag LOCUS_53500 gene exoA 2710 1670 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434899.1 protein_id gnl|my_center|LOCUS_53500 <3423 2759 gene locus_tag LOCUS_53510 <3423 2759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011787324.1:TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase >Feature sequence0732 206 832 gene locus_tag LOCUS_53520 206 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 922 1692 gene locus_tag LOCUS_53530 922 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 2514 1705 gene locus_tag LOCUS_53540 2514 1705 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644575.1 protein_id gnl|my_center|LOCUS_53540 <3412 2517 gene locus_tag LOCUS_53550 <3412 2517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037253001.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence0733 1823 267 gene locus_tag LOCUS_53560 1823 267 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_53560 <3400 1970 gene locus_tag LOCUS_53570 <3400 1970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012503946.1:fatty acid resistance MFS efflux transporter adaptor subunit FarA >Feature sequence0734 1728 97 gene locus_tag LOCUS_53580 1728 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 <3380 1910 gene locus_tag LOCUS_53590 <3380 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence0735 1384 2685 gene locus_tag LOCUS_53600 1384 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 3076 2672 gene locus_tag LOCUS_53610 3076 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 >Feature sequence0736 <1 2642 gene locus_tag LOCUS_53620 <1 2642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615526.1:organic solvent tolerance protein OstA 2846 3265 gene locus_tag LOCUS_53630 2846 3265 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037225450.1 protein_id gnl|my_center|LOCUS_53630 >Feature sequence0737 <3350 281 gene locus_tag LOCUS_53640 <3350 281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921428.1:general secretion pathway protein GspD >Feature sequence0738 1665 3089 gene locus_tag LOCUS_53650 1665 3089 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_53650 >Feature sequence0739 258 662 gene locus_tag LOCUS_53660 258 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53660 677 1054 gene locus_tag LOCUS_53670 677 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53670 1545 1078 gene locus_tag LOCUS_53680 1545 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53680 1930 1514 gene locus_tag LOCUS_53690 1930 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53690 2496 2092 gene locus_tag LOCUS_53700 2496 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53700 >Feature sequence0740 >Feature sequence0741 253 816 gene locus_tag LOCUS_53710 gene pyrE 253 816 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_53710 1499 822 gene locus_tag LOCUS_53720 1499 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 <3333 1536 gene locus_tag LOCUS_53730 <3333 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172992225.1:lamin tail domain-containing protein >Feature sequence0742 137 823 gene locus_tag LOCUS_53740 137 823 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889164.1 protein_id gnl|my_center|LOCUS_53740 1037 1189 gene locus_tag LOCUS_53750 1037 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 1239 2045 gene locus_tag LOCUS_53760 gene hisF 1239 2045 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 protein_id gnl|my_center|LOCUS_53760 >Feature sequence0743 2917 995 gene locus_tag LOCUS_53770 2917 995 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_53770 >Feature sequence0744 2217 1378 gene locus_tag LOCUS_53780 2217 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 <3318 2347 gene locus_tag LOCUS_53790 <3318 2347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124101.1:glycosyltransferase >Feature sequence0745 2445 2855 gene locus_tag LOCUS_53800 2445 2855 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088684.1 protein_id gnl|my_center|LOCUS_53800 >Feature sequence0746 99 998 gene locus_tag LOCUS_53810 gene dapA 99 998 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_53810 1213 1605 gene locus_tag LOCUS_53820 1213 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 <3311 1794 gene locus_tag LOCUS_53830 <3311 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921601.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0747 718 188 gene locus_tag LOCUS_53840 718 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 889 1236 gene locus_tag LOCUS_53850 889 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 1313 2044 gene locus_tag LOCUS_53860 1313 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 >Feature sequence0748 1061 90 gene locus_tag LOCUS_53870 1061 90 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_53870 2190 1162 gene locus_tag LOCUS_53880 2190 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 >Feature sequence0749 735 1145 gene locus_tag LOCUS_53890 735 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 3153 1525 gene locus_tag LOCUS_53900 3153 1525 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275546.1 protein_id gnl|my_center|LOCUS_53900 >Feature sequence0750 1711 188 gene locus_tag LOCUS_53910 gene malQ 1711 188 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_53910 3092 1914 gene locus_tag LOCUS_53920 3092 1914 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_53920 >Feature sequence0751 358 1293 gene locus_tag LOCUS_53930 358 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 1348 1836 gene locus_tag LOCUS_53940 1348 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 1870 2817 gene locus_tag LOCUS_53950 1870 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 3249 2824 gene locus_tag LOCUS_53960 3249 2824 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_53960 >Feature sequence0752 1404 394 gene locus_tag LOCUS_53970 1404 394 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088644.1 protein_id gnl|my_center|LOCUS_53970 1394 1642 gene locus_tag LOCUS_53980 1394 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 2908 1685 gene locus_tag LOCUS_53990 2908 1685 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_53990 >Feature sequence0753 2009 1101 gene locus_tag LOCUS_54000 gene argB 2009 1101 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_54000 2187 2549 gene locus_tag LOCUS_54010 2187 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 >Feature sequence0754 <3290 274 gene locus_tag LOCUS_54020 <3290 274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122437.1:c-type cytochrome >Feature sequence0755 417 1055 gene locus_tag LOCUS_54030 417 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 1045 1500 gene locus_tag LOCUS_54040 1045 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 1587 2402 gene locus_tag LOCUS_54050 1587 2402 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 protein_id gnl|my_center|LOCUS_54050 >Feature sequence0756 1571 852 gene locus_tag LOCUS_54060 1571 852 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_54060 2882 1668 gene locus_tag LOCUS_54070 gene ispG 2882 1668 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732336.1 protein_id gnl|my_center|LOCUS_54070 >Feature sequence0757 710 2395 gene locus_tag LOCUS_54080 710 2395 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_54080 2497 3072 gene locus_tag LOCUS_54090 2497 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 >Feature sequence0758 468 1664 gene locus_tag LOCUS_54100 468 1664 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_54100 1756 2718 gene locus_tag LOCUS_54110 1756 2718 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015424.1 protein_id gnl|my_center|LOCUS_54110 <3265 2712 gene locus_tag LOCUS_54120 <3265 2712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_114145417.1:gamma-glutamyltransferase >Feature sequence0759 284 697 gene locus_tag LOCUS_54130 284 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 814 1275 gene locus_tag LOCUS_54140 814 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 1432 2292 gene locus_tag LOCUS_54150 1432 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 2352 2792 gene locus_tag LOCUS_54160 2352 2792 CDS product nuclease A inhibitor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142296.1 protein_id gnl|my_center|LOCUS_54160 3211 2873 gene locus_tag LOCUS_54170 3211 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 >Feature sequence0760 738 2396 gene locus_tag LOCUS_54180 738 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 >Feature sequence0761 380 207 gene locus_tag LOCUS_54190 380 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 431 524 gene locus_tag LOCUS_t00520 431 524 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1101 577 gene locus_tag LOCUS_54200 1101 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 1261 2655 gene locus_tag LOCUS_54210 1261 2655 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_54210 3092 3165 gene locus_tag LOCUS_t00530 3092 3165 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0762 >Feature sequence0763 907 1593 gene locus_tag LOCUS_54220 gene cysC 907 1593 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332129.1 protein_id gnl|my_center|LOCUS_54220 1692 2183 gene locus_tag LOCUS_54230 1692 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 >Feature sequence0764 1146 145 gene locus_tag LOCUS_54240 1146 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 1443 1370 gene locus_tag LOCUS_t00540 1443 1370 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2878 1556 gene locus_tag LOCUS_54250 gene tuf 2878 1556 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_54250 3099 3026 gene locus_tag LOCUS_t00550 3099 3026 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0765 959 480 gene locus_tag LOCUS_54260 959 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 1284 943 gene locus_tag LOCUS_54270 1284 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 2721 1465 gene locus_tag LOCUS_54280 2721 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 2686 2877 gene locus_tag LOCUS_54290 2686 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 >Feature sequence0766 619 206 gene locus_tag LOCUS_54300 619 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 869 612 gene locus_tag LOCUS_54310 869 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 <3233 921 gene locus_tag LOCUS_54320 <3233 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928965.1:CHAT domain-containing protein >Feature sequence0767 2546 384 gene locus_tag LOCUS_54330 gene uvrB 2546 384 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_54330 >Feature sequence0768 <1 1272 gene locus_tag LOCUS_54340 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948622.1:class II fumarate hydratase 1535 2416 gene locus_tag LOCUS_54350 1535 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 2180 2263 gene locus_tag LOCUS_t00560 2180 2263 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3085 2486 gene locus_tag LOCUS_54360 3085 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 >Feature sequence0769 451 1197 gene locus_tag LOCUS_54370 gene fabG 451 1197 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_54370 1930 1376 gene locus_tag LOCUS_54380 1930 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 >Feature sequence0770 177 395 gene locus_tag LOCUS_54390 177 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 889 392 gene locus_tag LOCUS_54400 889 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 2168 1074 gene locus_tag LOCUS_54410 2168 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 <3218 2216 gene locus_tag LOCUS_54420 <3218 2216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272653.1:bifunctional 3'-5' exonuclease/DNA polymerase >Feature sequence0771 781 68 gene locus_tag LOCUS_54430 781 68 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_54430 3007 872 gene locus_tag LOCUS_54440 gene flhA 3007 872 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_54440 >Feature sequence0772 3 227 gene locus_tag LOCUS_54450 3 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 224 1369 gene locus_tag LOCUS_54460 224 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 1399 1851 gene locus_tag LOCUS_54470 1399 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 1919 2797 gene locus_tag LOCUS_54480 1919 2797 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_54480 >Feature sequence0773 141 380 gene locus_tag LOCUS_54490 141 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 377 631 gene locus_tag LOCUS_54500 377 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 694 1890 gene locus_tag LOCUS_54510 694 1890 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_54510 >Feature sequence0774 454 1200 gene locus_tag LOCUS_54520 454 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54520 1197 3032 gene locus_tag LOCUS_54530 1197 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54530 >Feature sequence0775 95 412 gene locus_tag LOCUS_54540 95 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 443 865 gene locus_tag LOCUS_54550 443 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 879 1889 gene locus_tag LOCUS_54560 879 1889 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_54560 2620 1910 gene locus_tag LOCUS_54570 2620 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 >Feature sequence0776 759 971 gene locus_tag LOCUS_54580 759 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 968 2872 gene locus_tag LOCUS_54590 968 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 >Feature sequence0777 2073 646 gene locus_tag LOCUS_54600 2073 646 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_54600 2570 2139 gene locus_tag LOCUS_54610 2570 2139 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228814.1 protein_id gnl|my_center|LOCUS_54610 2672 2863 gene locus_tag LOCUS_54620 2672 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 >Feature sequence0778 140 1243 gene locus_tag LOCUS_54630 140 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 1381 3126 gene locus_tag LOCUS_54640 gene polX 1381 3126 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_54640 >Feature sequence0779 133 534 gene locus_tag LOCUS_54650 133 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 670 1500 gene locus_tag LOCUS_54660 670 1500 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 protein_id gnl|my_center|LOCUS_54660 2553 1516 gene locus_tag LOCUS_54670 2553 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 2614 3144 gene locus_tag LOCUS_54680 2614 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 >Feature sequence0780 417 3107 gene locus_tag LOCUS_54690 417 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 >Feature sequence0781 <1 882 gene locus_tag LOCUS_54700 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122711.1:proton-conducting transporter membrane subunit 1008 1226 gene locus_tag LOCUS_54710 1008 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 3063 1537 gene locus_tag LOCUS_54720 3063 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 >Feature sequence0782 <1 1711 gene locus_tag LOCUS_54730 <1 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181409358.1:FtsH protease activity modulator HflK 904 983 gene locus_tag LOCUS_t00570 904 983 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0783 599 237 gene locus_tag LOCUS_54740 599 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 740 2263 gene locus_tag LOCUS_54750 740 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 2298 2780 gene locus_tag LOCUS_54760 2298 2780 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403066.1 protein_id gnl|my_center|LOCUS_54760 3167 2850 gene locus_tag LOCUS_54770 3167 2850 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153354109.1 protein_id gnl|my_center|LOCUS_54770 >Feature sequence0784 527 150 gene locus_tag LOCUS_54780 527 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 733 662 gene locus_tag LOCUS_t00580 733 662 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 898 826 gene locus_tag LOCUS_t00590 898 826 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 971 903 gene locus_tag LOCUS_t00600 971 903 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1149 1067 gene locus_tag LOCUS_t00610 1149 1067 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1600 1527 gene locus_tag LOCUS_t00620 1600 1527 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1694 1611 gene locus_tag LOCUS_t00630 1694 1611 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1776 1701 gene locus_tag LOCUS_t00640 1776 1701 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1859 1788 gene locus_tag LOCUS_t00650 1859 1788 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0785 828 247 gene locus_tag LOCUS_54790 828 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 1394 988 gene locus_tag LOCUS_tm00020 1394 988 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1545 2417 gene locus_tag LOCUS_54800 1545 2417 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_54800 2794 2477 gene locus_tag LOCUS_54810 2794 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 >Feature sequence0786 1548 277 gene locus_tag LOCUS_54820 1548 277 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_54820 2563 1823 gene locus_tag LOCUS_54830 2563 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 3126 2611 gene locus_tag LOCUS_54840 3126 2611 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091834394.1 protein_id gnl|my_center|LOCUS_54840 >Feature sequence0787 664 74 gene locus_tag LOCUS_54850 664 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 1621 677 gene locus_tag LOCUS_54860 gene ispE 1621 677 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923490.1 protein_id gnl|my_center|LOCUS_54860 <3150 1794 gene locus_tag LOCUS_54870 <3150 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121818.1:porin >Feature sequence0788 294 479 gene locus_tag LOCUS_54880 294 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 518 694 gene locus_tag LOCUS_54890 518 694 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920785.1 protein_id gnl|my_center|LOCUS_54890 856 1626 gene locus_tag LOCUS_54900 856 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 1860 3101 gene locus_tag LOCUS_54910 1860 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 >Feature sequence0789 136 855 gene locus_tag LOCUS_54920 136 855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_54920 1086 877 gene locus_tag LOCUS_54930 1086 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 1652 1083 gene locus_tag LOCUS_54940 1652 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 1724 3031 gene locus_tag LOCUS_54950 1724 3031 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_54950 >Feature sequence0790 896 132 gene locus_tag LOCUS_54960 896 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 1228 1521 gene locus_tag LOCUS_54970 1228 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 >Feature sequence0791 1804 1989 gene locus_tag LOCUS_54980 1804 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 >Feature sequence0792 756 1394 gene locus_tag LOCUS_54990 756 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 1459 1635 gene locus_tag LOCUS_55000 1459 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 1844 2668 gene locus_tag LOCUS_55010 1844 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 >Feature sequence0793 95 1123 gene locus_tag LOCUS_55020 95 1123 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122968.1 protein_id gnl|my_center|LOCUS_55020 1222 3015 gene locus_tag LOCUS_55030 1222 3015 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143991.1 protein_id gnl|my_center|LOCUS_55030 >Feature sequence0794 1437 73 gene locus_tag LOCUS_55040 1437 73 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_55040 2545 2342 gene locus_tag LOCUS_55050 2545 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 >Feature sequence0795 286 2295 gene locus_tag LOCUS_55060 286 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 >Feature sequence0796 558 1613 gene locus_tag LOCUS_55070 558 1613 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267065.1 protein_id gnl|my_center|LOCUS_55070 2205 2480 gene locus_tag LOCUS_55080 2205 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 >Feature sequence0797 <1 795 gene locus_tag LOCUS_55090 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919370.1:sugar kinase 1488 895 gene locus_tag LOCUS_55100 1488 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 1596 2402 gene locus_tag LOCUS_55110 1596 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 <3093 2488 gene locus_tag LOCUS_55120 <3093 2488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938513.1:MATE family efflux transporter >Feature sequence0798 <1 700 gene locus_tag LOCUS_55130 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073813.1:AAA family ATPase 764 1762 gene locus_tag LOCUS_55140 764 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 2334 2068 gene locus_tag LOCUS_55150 2334 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_55150 >Feature sequence0799 2006 954 gene locus_tag LOCUS_55160 2006 954 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970383.1 protein_id gnl|my_center|LOCUS_55160 >Feature sequence0800 828 169 gene locus_tag LOCUS_55170 828 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 2193 934 gene locus_tag LOCUS_55180 2193 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 >Feature sequence0801 823 1092 gene locus_tag LOCUS_55190 823 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 1117 1371 gene locus_tag LOCUS_55200 1117 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 1439 2353 gene locus_tag LOCUS_55210 gene sucD 1439 2353 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_55210 3029 2271 gene locus_tag LOCUS_55220 3029 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 >Feature sequence0802 <1 1509 gene locus_tag LOCUS_55230 <1 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392656.1:elongation factor G 1846 2598 gene locus_tag LOCUS_55240 1846 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 >Feature sequence0803 <1 867 gene locus_tag LOCUS_55250 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118978.1:serine/threonine-protein kinase 1706 873 gene locus_tag LOCUS_55260 1706 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 2620 1874 gene locus_tag LOCUS_55270 2620 1874 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189279.1 protein_id gnl|my_center|LOCUS_55270 >Feature sequence0804 235 1092 gene locus_tag LOCUS_55280 235 1092 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_55280 1107 1700 gene locus_tag LOCUS_55290 1107 1700 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_55290 1713 2261 gene locus_tag LOCUS_55300 1713 2261 CDS product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870944.1 protein_id gnl|my_center|LOCUS_55300 2293 2799 gene locus_tag LOCUS_55310 2293 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 >Feature sequence0805 2418 1636 gene locus_tag LOCUS_55320 2418 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 2723 2535 gene locus_tag LOCUS_55330 2723 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 >Feature sequence0806 <1 614 gene locus_tag LOCUS_55340 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258578.1:DUF4058 family protein 804 1394 gene locus_tag LOCUS_55350 804 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 2459 1449 gene locus_tag LOCUS_55360 2459 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 >Feature sequence0807 1177 674 gene locus_tag LOCUS_55370 1177 674 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730372.1 protein_id gnl|my_center|LOCUS_55370 1265 2092 gene locus_tag LOCUS_55380 1265 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 2373 2089 gene locus_tag LOCUS_55390 2373 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 2876 2373 gene locus_tag LOCUS_55400 2876 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 >Feature sequence0808 >Feature sequence0809 46 1941 gene locus_tag LOCUS_55410 46 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 2101 2490 gene locus_tag LOCUS_55420 2101 2490 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972193.1 protein_id gnl|my_center|LOCUS_55420 2663 2968 gene locus_tag LOCUS_55430 2663 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 >Feature sequence0810 1610 123 gene locus_tag LOCUS_55440 1610 123 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_55440 2829 2161 gene locus_tag LOCUS_55450 gene kdpE 2829 2161 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191774710.1 protein_id gnl|my_center|LOCUS_55450 >Feature sequence0811 336 1082 gene locus_tag LOCUS_55460 336 1082 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_55460 1709 1092 gene locus_tag LOCUS_55470 1709 1092 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_55470 1788 2363 gene locus_tag LOCUS_55480 1788 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 >Feature sequence0812 341 667 gene locus_tag LOCUS_55490 341 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 1163 1360 gene locus_tag LOCUS_55500 1163 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 1554 2510 gene locus_tag LOCUS_55510 1554 2510 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_55510 >Feature sequence0813 514 1848 gene locus_tag LOCUS_55520 514 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 2062 2922 gene locus_tag LOCUS_55530 2062 2922 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_55530 >Feature sequence0814 186 1706 gene locus_tag LOCUS_55540 186 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 >Feature sequence0815 1026 2903 gene locus_tag LOCUS_55550 1026 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 >Feature sequence0816 136 852 gene locus_tag LOCUS_55560 136 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 986 1882 gene locus_tag LOCUS_55570 986 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 >Feature sequence0817 >Feature sequence0818 597 2099 gene locus_tag LOCUS_55580 597 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120360.1 protein_id gnl|my_center|LOCUS_55580 2919 2128 gene locus_tag LOCUS_55590 2919 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 >Feature sequence0819 902 2872 gene locus_tag LOCUS_55600 902 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 >Feature sequence0820 55 348 gene locus_tag LOCUS_55610 55 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 348 803 gene locus_tag LOCUS_55620 348 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 919 2289 gene locus_tag LOCUS_55630 919 2289 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_55630 2402 2761 gene locus_tag LOCUS_55640 2402 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 >Feature sequence0821 470 967 gene locus_tag LOCUS_55650 470 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 1195 2490 gene locus_tag LOCUS_55660 1195 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 >Feature sequence0822 <1 1110 gene locus_tag LOCUS_55670 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198591.1:outer membrane protein assembly factor BamB 1208 1804 gene locus_tag LOCUS_55680 1208 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 >Feature sequence0823 1106 99 gene locus_tag LOCUS_55690 1106 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 1471 2691 gene locus_tag LOCUS_55700 1471 2691 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921329.1 protein_id gnl|my_center|LOCUS_55700 >Feature sequence0824 1402 95 gene locus_tag LOCUS_55710 1402 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 1723 1421 gene locus_tag LOCUS_55720 1723 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 2052 1738 gene locus_tag LOCUS_55730 2052 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 <2920 2065 gene locus_tag LOCUS_55740 <2920 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335201.1:glucose-6-phosphate dehydrogenase >Feature sequence0825 <2913 475 gene locus_tag LOCUS_55750 <2913 475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122500.1:serine/threonine-protein kinase >Feature sequence0826 373 717 gene locus_tag LOCUS_55760 373 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 732 1103 gene locus_tag LOCUS_55770 732 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 1136 1411 gene locus_tag LOCUS_55780 1136 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 1428 1655 gene locus_tag LOCUS_55790 1428 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 >Feature sequence0827 1252 800 gene locus_tag LOCUS_55800 1252 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 2112 1270 gene locus_tag LOCUS_55810 2112 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55810 >Feature sequence0828 451 1572 gene locus_tag LOCUS_55820 gene mutY 451 1572 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_55820 1585 2655 gene locus_tag LOCUS_55830 1585 2655 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144241.1 protein_id gnl|my_center|LOCUS_55830 >Feature sequence0829 1448 33 gene locus_tag LOCUS_55840 1448 33 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_55840 >Feature sequence0830 <1 1025 gene locus_tag LOCUS_55850 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726727.1:anhydro-N-acetylmuramic acid kinase 1242 1009 gene locus_tag LOCUS_55860 1242 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 1535 1239 gene locus_tag LOCUS_55870 1535 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 1940 1557 gene locus_tag LOCUS_55880 1940 1557 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932425.1 protein_id gnl|my_center|LOCUS_55880 2781 1942 gene locus_tag LOCUS_55890 2781 1942 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932424.1 protein_id gnl|my_center|LOCUS_55890 >Feature sequence0831 390 88 gene locus_tag LOCUS_55900 390 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 557 387 gene locus_tag LOCUS_55910 557 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 1384 710 gene locus_tag LOCUS_55920 1384 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 >Feature sequence0832 <1 938 gene locus_tag LOCUS_55930 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144334.1:NB-ARC domain-containing protein 991 1524 gene locus_tag LOCUS_55940 991 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 1602 2717 gene locus_tag LOCUS_55950 1602 2717 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061140.1 protein_id gnl|my_center|LOCUS_55950 >Feature sequence0833 <1 2451 gene locus_tag LOCUS_55960 <1 2451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615881.1:c-type cytochrome 2448 2744 gene locus_tag LOCUS_55970 2448 2744 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810208.1 protein_id gnl|my_center|LOCUS_55970 >Feature sequence0834 431 2773 gene locus_tag LOCUS_55980 431 2773 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_55980 >Feature sequence0835 979 2004 gene locus_tag LOCUS_55990 979 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 2746 2153 gene locus_tag LOCUS_56000 2746 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 >Feature sequence0836 36 485 gene locus_tag LOCUS_56010 36 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 582 1454 gene locus_tag LOCUS_56020 582 1454 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_56020 >Feature sequence0837 78 653 gene locus_tag LOCUS_56030 78 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 2393 654 gene locus_tag LOCUS_56040 2393 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 >Feature sequence0838 1888 1625 gene locus_tag LOCUS_56050 1888 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 2103 1933 gene locus_tag LOCUS_56060 2103 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 2780 2079 gene locus_tag LOCUS_56070 2780 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56070 >Feature sequence0839 672 1007 gene locus_tag LOCUS_56080 672 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 1065 2183 gene locus_tag LOCUS_56090 1065 2183 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_56090 2204 2695 gene locus_tag LOCUS_56100 2204 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 >Feature sequence0840 98 400 gene locus_tag LOCUS_56110 98 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 >Feature sequence0841 1778 411 gene locus_tag LOCUS_56120 1778 411 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_56120 2675 2097 gene locus_tag LOCUS_56130 2675 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56130 >Feature sequence0842 <1 1227 gene locus_tag LOCUS_56140 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123669.1:serine/threonine-protein kinase 2273 1353 gene locus_tag LOCUS_56150 2273 1353 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_56150 >Feature sequence0843 717 385 gene locus_tag LOCUS_56160 717 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 950 747 gene locus_tag LOCUS_56170 950 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 <2811 1222 gene locus_tag LOCUS_56180 <2811 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146390841.1:DUF1549 domain-containing protein >Feature sequence0844 >Feature sequence0845 540 2774 gene locus_tag LOCUS_56190 540 2774 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_56190 >Feature sequence0846 1042 1791 gene locus_tag LOCUS_56200 1042 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 >Feature sequence0847 1642 878 gene locus_tag LOCUS_56210 1642 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 >Feature sequence0848 320 982 gene locus_tag LOCUS_56220 320 982 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_56220 1004 1213 gene locus_tag LOCUS_56230 1004 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 1489 1704 gene locus_tag LOCUS_56240 1489 1704 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_56240 1779 2546 gene locus_tag LOCUS_56250 gene map 1779 2546 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_56250 >Feature sequence0849 113 322 gene locus_tag LOCUS_56260 113 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 319 1110 gene locus_tag LOCUS_56270 319 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 <2789 1152 gene locus_tag LOCUS_56280 <2789 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115028.1:SulP family inorganic anion transporter >Feature sequence0850 2627 129 gene locus_tag LOCUS_56290 2627 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 >Feature sequence0851 1608 2507 gene locus_tag LOCUS_56300 1608 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 >Feature sequence0852 1606 1166 gene locus_tag LOCUS_56310 1606 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328560.1 protein_id gnl|my_center|LOCUS_56310 2740 2183 gene locus_tag LOCUS_56320 2740 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 >Feature sequence0853 2601 556 gene locus_tag LOCUS_56330 2601 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141526.1 protein_id gnl|my_center|LOCUS_56330 >Feature sequence0854 935 60 gene locus_tag LOCUS_56340 935 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 1608 1069 gene locus_tag LOCUS_56350 gene hslV 1608 1069 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114726.1 protein_id gnl|my_center|LOCUS_56350 >Feature sequence0855 733 939 gene locus_tag LOCUS_56360 733 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 1049 2671 gene locus_tag LOCUS_56370 gene serA 1049 2671 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 protein_id gnl|my_center|LOCUS_56370 >Feature sequence0856 82 684 gene locus_tag LOCUS_56380 gene recR 82 684 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_56380 752 2299 gene locus_tag LOCUS_56390 gene rpoN 752 2299 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_56390 >Feature sequence0857 887 405 gene locus_tag LOCUS_56400 887 405 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115458779.1 protein_id gnl|my_center|LOCUS_56400 946 2319 gene locus_tag LOCUS_56410 946 2319 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_56410 >Feature sequence0858 464 2086 gene locus_tag LOCUS_56420 464 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 >Feature sequence0859 1358 822 gene locus_tag LOCUS_56430 1358 822 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521511.1 protein_id gnl|my_center|LOCUS_56430 1831 1358 gene locus_tag LOCUS_56440 1831 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 2562 1888 gene locus_tag LOCUS_56450 2562 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 >Feature sequence0860 87 248 gene locus_tag LOCUS_56460 87 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 1285 341 gene locus_tag LOCUS_56470 1285 341 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_56470 >Feature sequence0861 2735 1785 gene locus_tag LOCUS_56480 2735 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 >Feature sequence0862 >Feature sequence0863 534 869 gene locus_tag LOCUS_56490 534 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 <2720 938 gene locus_tag LOCUS_56500 <2720 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327402.1:NADPH-dependent assimilatory sulfite reductase hemoprotein subunit >Feature sequence0864 594 827 gene locus_tag LOCUS_56510 594 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 1814 1413 gene locus_tag LOCUS_56520 gene crcB 1814 1413 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_56520 >Feature sequence0865 >Feature sequence0866 1160 2359 gene locus_tag LOCUS_56530 1160 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 >Feature sequence0867 >Feature sequence0868 <1 2583 gene locus_tag LOCUS_56540 <1 2583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase >Feature sequence0869 2268 1375 gene locus_tag LOCUS_56550 2268 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 >Feature sequence0870 862 1050 gene locus_tag LOCUS_56560 862 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 >Feature sequence0871 657 1736 gene locus_tag LOCUS_56570 657 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 <2665 1754 gene locus_tag LOCUS_56580 <2665 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157368787.1:DEAD/DEAH box helicase >Feature sequence0872 >Feature sequence0873 876 1103 gene locus_tag LOCUS_56590 876 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 1143 2501 gene locus_tag LOCUS_56600 1143 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 >Feature sequence0874 >Feature sequence0875 2366 1506 gene locus_tag LOCUS_56610 2366 1506 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_56610 >Feature sequence0876 197 1774 gene locus_tag LOCUS_56620 197 1774 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_56620 >Feature sequence0877 133 693 gene locus_tag LOCUS_56630 133 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 753 1778 gene locus_tag LOCUS_56640 753 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 1977 2594 gene locus_tag LOCUS_56650 1977 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 >Feature sequence0878 864 106 gene locus_tag LOCUS_56660 864 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 1607 891 gene locus_tag LOCUS_56670 1607 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 2333 1641 gene locus_tag LOCUS_56680 2333 1641 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100235019.1 protein_id gnl|my_center|LOCUS_56680 >Feature sequence0879 <1 900 gene locus_tag LOCUS_56690 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047813294.1:recombinase RecA 1873 1421 gene locus_tag LOCUS_56700 1873 1421 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595914.1 protein_id gnl|my_center|LOCUS_56700 2570 1881 gene locus_tag LOCUS_56710 gene queC 2570 1881 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104586586.1 protein_id gnl|my_center|LOCUS_56710 >Feature sequence0880 1220 225 gene locus_tag LOCUS_56720 1220 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 2339 1581 gene locus_tag LOCUS_56730 2339 1581 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_56730 >Feature sequence0881 935 63 gene locus_tag LOCUS_56740 935 63 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_56740 1403 951 gene locus_tag LOCUS_56750 1403 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 2595 1450 gene locus_tag LOCUS_56760 2595 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 >Feature sequence0882 124 906 gene locus_tag LOCUS_56770 124 906 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_56770 1111 1539 gene locus_tag LOCUS_56780 1111 1539 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_56780 >Feature sequence0883 522 1979 gene locus_tag LOCUS_56790 gene hflX 522 1979 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_56790 2051 2467 gene locus_tag LOCUS_56800 2051 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 >Feature sequence0884 >Feature sequence0885 284 90 gene locus_tag LOCUS_56810 284 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 581 1936 gene locus_tag LOCUS_56820 581 1936 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_56820 >Feature sequence0886 >Feature sequence0887 137 1117 gene locus_tag LOCUS_56830 137 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 1343 1125 gene locus_tag LOCUS_56840 1343 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 <2561 1355 gene locus_tag LOCUS_56850 <2561 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891355.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence0888 806 402 gene locus_tag LOCUS_56860 806 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 <2561 931 gene locus_tag LOCUS_56870 <2561 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120234.1:bifunctional serine/threonine-protein kinase/formylglycine-generating enzyme family protein >Feature sequence0889 586 1443 gene locus_tag LOCUS_56880 586 1443 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_56880 >Feature sequence0890 >Feature sequence0891 119 1642 gene locus_tag LOCUS_56890 119 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 >Feature sequence0892 1401 160 gene locus_tag LOCUS_56900 1401 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 >Feature sequence0893 <1 1613 gene locus_tag LOCUS_56910 <1 1613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122094.1:DUF1559 domain-containing protein 1745 2458 gene locus_tag LOCUS_56920 1745 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 >Feature sequence0894 >Feature sequence0895 1098 304 gene locus_tag LOCUS_56930 1098 304 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_56930 2494 1304 gene locus_tag LOCUS_56940 2494 1304 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_56940 >Feature sequence0896 117 395 gene locus_tag LOCUS_56950 117 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 567 1616 gene locus_tag LOCUS_56960 567 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56960 1707 2195 gene locus_tag LOCUS_56970 1707 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56970 2185 2487 gene locus_tag LOCUS_56980 2185 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 >Feature sequence0897 696 1088 gene locus_tag LOCUS_56990 696 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 >Feature sequence0898 660 2210 gene locus_tag LOCUS_57000 660 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 >Feature sequence0899 <1 1072 gene locus_tag LOCUS_57010 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941827.1:tetratricopeptide repeat protein >Feature sequence0900 1126 32 gene locus_tag LOCUS_57020 1126 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 <2531 1797 gene locus_tag LOCUS_57030 <2531 1797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990818.1:formylglycine-generating enzyme family protein >Feature sequence0901 1 252 gene locus_tag LOCUS_57040 1 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 328 807 gene locus_tag LOCUS_57050 328 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 848 1810 gene locus_tag LOCUS_57060 gene hemC 848 1810 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 protein_id gnl|my_center|LOCUS_57060 >Feature sequence0902 59 394 gene locus_tag LOCUS_57070 59 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 2445 415 gene locus_tag LOCUS_57080 2445 415 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 protein_id gnl|my_center|LOCUS_57080 >Feature sequence0903 136 441 gene locus_tag LOCUS_57090 136 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 606 905 gene locus_tag LOCUS_57100 606 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 1012 1605 gene locus_tag LOCUS_57110 1012 1605 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172340.1 protein_id gnl|my_center|LOCUS_57110 >Feature sequence0904 <1 828 gene locus_tag LOCUS_57120 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121465.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB 931 2265 gene locus_tag LOCUS_57130 931 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_57130 >Feature sequence0905 <1 2136 gene locus_tag LOCUS_57140 <1 2136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119295.1:c-type cytochrome >Feature sequence0906 1661 849 gene locus_tag LOCUS_57150 1661 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 <2506 1679 gene locus_tag LOCUS_57160 <2506 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113139.1:patatin-like phospholipase PlpD >Feature sequence0907 809 222 gene locus_tag LOCUS_57170 gene rimI 809 222 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017535.1 protein_id gnl|my_center|LOCUS_57170 >Feature sequence0908 501 1259 gene locus_tag LOCUS_57180 501 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 >Feature sequence0909 <2489 1328 gene locus_tag LOCUS_57190 <2489 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119032.1:multiheme c-type cytochrome >Feature sequence0910 1645 2400 gene locus_tag LOCUS_57200 1645 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 >Feature sequence0911 248 1939 gene locus_tag LOCUS_57210 248 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 2014 2400 gene locus_tag LOCUS_57220 2014 2400 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121782.1 protein_id gnl|my_center|LOCUS_57220 >Feature sequence0912 280 1431 gene locus_tag LOCUS_57230 280 1431 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_57230 1446 1808 gene locus_tag LOCUS_57240 1446 1808 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_57240 1917 2387 gene locus_tag LOCUS_57250 1917 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 >Feature sequence0913 649 56 gene locus_tag LOCUS_57260 649 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 <2459 646 gene locus_tag LOCUS_57270 <2459 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930412.1:type I-U CRISPR-associated helicase/endonuclease Cas3 >Feature sequence0914 1833 220 gene locus_tag LOCUS_57280 1833 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 >Feature sequence0915 303 390 gene locus_tag LOCUS_t00660 303 390 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1414 812 gene locus_tag LOCUS_57290 1414 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 >Feature sequence0916 538 1452 gene locus_tag LOCUS_57300 538 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 1501 1992 gene locus_tag LOCUS_57310 1501 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 >Feature sequence0917 1756 134 gene locus_tag LOCUS_57320 1756 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 >Feature sequence0918 317 1216 gene locus_tag LOCUS_57330 317 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 1390 2430 gene locus_tag LOCUS_57340 1390 2430 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 protein_id gnl|my_center|LOCUS_57340 >Feature sequence0919 2438 2238 gene locus_tag LOCUS_57350 2438 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 >Feature sequence0920 1174 137 gene locus_tag LOCUS_57360 1174 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 1274 1684 gene locus_tag LOCUS_57370 1274 1684 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255995.1 protein_id gnl|my_center|LOCUS_57370 1677 2351 gene locus_tag LOCUS_57380 1677 2351 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_57380 >Feature sequence0921 <2418 576 gene locus_tag LOCUS_57390 <2418 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146975.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence0922 1307 87 gene locus_tag LOCUS_57400 gene tyrS 1307 87 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_57400 1766 1368 gene locus_tag LOCUS_57410 1766 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 >Feature sequence0923 <1 823 gene locus_tag LOCUS_57420 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002438175.1:MFS transporter 915 2123 gene locus_tag LOCUS_57430 915 2123 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228687.1 protein_id gnl|my_center|LOCUS_57430 >Feature sequence0924 2123 915 gene locus_tag LOCUS_57440 2123 915 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_57440 >Feature sequence0925 1049 747 gene locus_tag LOCUS_57450 1049 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 2092 1118 gene locus_tag LOCUS_57460 2092 1118 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_57460 >Feature sequence0926 994 1827 gene locus_tag LOCUS_57470 994 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 1575 1501 gene locus_tag LOCUS_t00670 1575 1501 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1947 2366 gene locus_tag LOCUS_57480 1947 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 >Feature sequence0927 1905 46 gene locus_tag LOCUS_57490 1905 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 >Feature sequence0928 >Feature sequence0929 483 692 gene locus_tag LOCUS_57500 483 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 785 1096 gene locus_tag LOCUS_57510 785 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 1317 1874 gene locus_tag LOCUS_57520 1317 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 2284 2045 gene locus_tag LOCUS_57530 2284 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 >Feature sequence0930 >Feature sequence0931 1086 208 gene locus_tag LOCUS_57540 1086 208 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_57540 1225 1566 gene locus_tag LOCUS_57550 1225 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 1566 1961 gene locus_tag LOCUS_57560 1566 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 >Feature sequence0932 531 2090 gene locus_tag LOCUS_57570 531 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 >Feature sequence0933 385 777 gene locus_tag LOCUS_57580 385 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 804 1259 gene locus_tag LOCUS_57590 804 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 1355 1660 gene locus_tag LOCUS_57600 1355 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 1678 1914 gene locus_tag LOCUS_57610 1678 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 >Feature sequence0934 <1 1209 gene locus_tag LOCUS_57620 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881407.1:thioredoxin domain-containing protein <2352 1216 gene locus_tag LOCUS_57630 <2352 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123104.1:PQQ-like beta-propeller repeat protein >Feature sequence0935 990 1853 gene locus_tag LOCUS_57640 990 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 >Feature sequence0936 198 105 gene locus_tag LOCUS_t00680 198 105 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 566 201 gene locus_tag LOCUS_57650 gene rplW 566 201 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326798.1 protein_id gnl|my_center|LOCUS_57650 1562 609 gene locus_tag LOCUS_57660 1562 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 2166 1837 gene locus_tag LOCUS_57670 gene rpsJ 2166 1837 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_57670 >Feature sequence0937 1601 351 gene locus_tag LOCUS_57680 1601 351 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_57680 2322 1651 gene locus_tag LOCUS_57690 2322 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 >Feature sequence0938 171 1832 gene locus_tag LOCUS_57700 171 1832 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_57700 >Feature sequence0939 947 228 gene locus_tag LOCUS_57710 947 228 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_57710 2186 1047 gene locus_tag LOCUS_57720 2186 1047 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_57720 >Feature sequence0940 >Feature sequence0941 >Feature sequence0942 >Feature sequence0943 572 189 gene locus_tag LOCUS_57730 572 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 878 963 gene locus_tag LOCUS_t00690 878 963 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1017 1460 gene locus_tag LOCUS_57740 1017 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 1668 2066 gene locus_tag LOCUS_57750 1668 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 >Feature sequence0944 880 521 gene locus_tag LOCUS_57760 880 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 >Feature sequence0945 406 816 gene locus_tag LOCUS_57770 406 816 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867748.1 protein_id gnl|my_center|LOCUS_57770 >Feature sequence0946 2096 114 gene locus_tag LOCUS_57780 2096 114 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615747.1 protein_id gnl|my_center|LOCUS_57780 >Feature sequence0947 775 59 gene locus_tag LOCUS_57790 775 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 732 947 gene locus_tag LOCUS_57800 732 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 1036 1323 gene locus_tag LOCUS_57810 1036 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 1379 2134 gene locus_tag LOCUS_57820 1379 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 >Feature sequence0948 <2270 268 gene locus_tag LOCUS_57830 <2270 268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616108.1:c-type cytochrome >Feature sequence0949 482 1972 gene locus_tag LOCUS_57840 482 1972 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328020.1 protein_id gnl|my_center|LOCUS_57840 >Feature sequence0950 460 1080 gene locus_tag LOCUS_57850 460 1080 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_57850 <2261 1128 gene locus_tag LOCUS_57860 <2261 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922459.1:trypsin-like peptidase domain-containing protein >Feature sequence0951 >Feature sequence0952 735 1538 gene locus_tag LOCUS_57870 735 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 >Feature sequence0953 >Feature sequence0954 >Feature sequence0955 205 1455 gene locus_tag LOCUS_57880 205 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 >Feature sequence0956 1086 1253 gene locus_tag LOCUS_57890 1086 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 >Feature sequence0957 >Feature sequence0958 <2211 836 gene locus_tag LOCUS_57900 <2211 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence0959 <1 1601 gene locus_tag LOCUS_57910 <1 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530050.1:S9 family peptidase >Feature sequence0960 <1 1131 gene locus_tag LOCUS_57920 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207280537.1:response regulator 1535 1137 gene locus_tag LOCUS_57930 1535 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 <2208 1663 gene locus_tag LOCUS_57940 <2208 1663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728405.1:primary-amine oxidase >Feature sequence0961 334 119 gene locus_tag LOCUS_57950 334 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 >Feature sequence0962 445 1980 gene locus_tag LOCUS_57960 gene csb2 445 1980 CDS product type I-U CRISPR-associated protein Csb2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940732.1 protein_id gnl|my_center|LOCUS_57960 >Feature sequence0963 510 1811 gene locus_tag LOCUS_57970 510 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 >Feature sequence0964 <1 590 gene locus_tag LOCUS_57980 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257749.1:succinate dehydrogenase/fumarate reductase iron-sulfur subunit 1130 2107 gene locus_tag LOCUS_57990 1130 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 >Feature sequence0965 >Feature sequence0966 1170 49 gene locus_tag LOCUS_58000 1170 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 1267 2100 gene locus_tag LOCUS_58010 1267 2100 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_58010 >Feature sequence0967 1184 1993 gene locus_tag LOCUS_58020 1184 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58020 >Feature sequence0968 522 1511 gene locus_tag LOCUS_58030 522 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 >Feature sequence0969 <2179 1001 gene locus_tag LOCUS_58040 <2179 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324371.1:30S ribosomal protein S1 >Feature sequence0970 <2179 646 gene locus_tag LOCUS_58050 <2179 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943729.1:transcription termination factor Rho >Feature sequence0971 635 1765 gene locus_tag LOCUS_58060 635 1765 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986870.1 protein_id gnl|my_center|LOCUS_58060 >Feature sequence0972 571 1419 gene locus_tag LOCUS_58070 571 1419 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_58070 1539 1913 gene locus_tag LOCUS_58080 1539 1913 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_58080 >Feature sequence0973 534 16 gene locus_tag LOCUS_58090 gene rpiB 534 16 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_58090 1628 531 gene locus_tag LOCUS_58100 1628 531 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_58100 >Feature sequence0974 1264 248 gene locus_tag LOCUS_58110 1264 248 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_58110 <2140 1430 gene locus_tag LOCUS_58120 <2140 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479718.1:KamA family radical SAM protein >Feature sequence0975 546 917 gene locus_tag LOCUS_58130 546 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 2021 1155 gene locus_tag LOCUS_58140 2021 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58140 >Feature sequence0976 >Feature sequence0977 <1 1205 gene locus_tag LOCUS_58150 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144367.1:IscS subfamily cysteine desulfurase 1251 1679 gene locus_tag LOCUS_58160 gene iscU 1251 1679 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_58160 >Feature sequence0978 >Feature sequence0979 >Feature sequence0980 538 1398 gene locus_tag LOCUS_58170 538 1398 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_58170 1898 1542 gene locus_tag LOCUS_58180 gene mazF9 1898 1542 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_58180 >Feature sequence0981 238 765 gene locus_tag LOCUS_58190 238 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 <2120 802 gene locus_tag LOCUS_58200 <2120 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123442.1:DNA translocase FtsK >Feature sequence0982 3 1763 gene locus_tag LOCUS_58210 3 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 >Feature sequence0983 1035 802 gene locus_tag LOCUS_58220 1035 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 1143 1757 gene locus_tag LOCUS_58230 1143 1757 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_58230 >Feature sequence0984 >Feature sequence0985 <1 887 gene locus_tag LOCUS_58240 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921769.1:cysteine--tRNA ligase 891 1268 gene locus_tag LOCUS_58250 891 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 1272 1616 gene locus_tag LOCUS_58260 1272 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 1613 1921 gene locus_tag LOCUS_58270 1613 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 >Feature sequence0986 <1 735 gene locus_tag LOCUS_58280 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119960.1:TolC family protein 795 1244 gene locus_tag LOCUS_58290 795 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 >Feature sequence0987 >Feature sequence0988 1054 1638 gene locus_tag LOCUS_58300 1054 1638 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_58300 >Feature sequence0989 <1 1227 gene locus_tag LOCUS_58310 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122381.1:DUF1501 domain-containing protein >Feature sequence0990 >Feature sequence0991 1109 93 gene locus_tag LOCUS_58320 1109 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 1589 1517 gene locus_tag LOCUS_t00700 1589 1517 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1729 2058 gene locus_tag LOCUS_58330 gene trxA 1729 2058 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460330.1 protein_id gnl|my_center|LOCUS_58330 >Feature sequence0992 1907 588 gene locus_tag LOCUS_58340 1907 588 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_58340 >Feature sequence0993 79 660 gene locus_tag LOCUS_58350 gene thpR 79 660 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082411.1 protein_id gnl|my_center|LOCUS_58350 713 786 gene locus_tag LOCUS_t00710 713 786 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1330 1064 gene locus_tag LOCUS_58360 1330 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 1569 1327 gene locus_tag LOCUS_58370 1569 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 >Feature sequence0994 <1 954 gene locus_tag LOCUS_58380 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146849598.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0995 668 30 gene locus_tag LOCUS_58390 668 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 1980 880 gene locus_tag LOCUS_58400 1980 880 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141502.1 protein_id gnl|my_center|LOCUS_58400 >Feature sequence0996 >Feature sequence0997 >Feature sequence0998 >Feature sequence0999 <2071 242 gene locus_tag LOCUS_58410 <2071 242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123042.1:CotH kinase family protein >Feature sequence1000 1136 429 gene locus_tag LOCUS_58420 1136 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 <2068 1025 gene locus_tag LOCUS_58430 <2068 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035372.1:winged helix-turn-helix domain-containing protein >Feature sequence1001 1576 1187 gene locus_tag LOCUS_58440 1576 1187 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143803.1 protein_id gnl|my_center|LOCUS_58440 >Feature sequence1002 2008 308 gene locus_tag LOCUS_58450 2008 308 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921874.1 protein_id gnl|my_center|LOCUS_58450 >Feature sequence1003 677 75 gene locus_tag LOCUS_58460 677 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 1241 711 gene locus_tag LOCUS_58470 1241 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 >Feature sequence1004 >Feature sequence1005 1841 126 gene locus_tag LOCUS_58480 1841 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 >Feature sequence1006 1101 466 gene locus_tag LOCUS_58490 1101 466 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530061.1 protein_id gnl|my_center|LOCUS_58490 1336 1857 gene locus_tag LOCUS_58500 1336 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 >Feature sequence1007 1673 162 gene locus_tag LOCUS_58510 1673 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_58510 >Feature sequence1008 >Feature sequence1009 <2028 836 gene locus_tag LOCUS_58520 <2028 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258751.1:NADH dehydrogenase (quinone) subunit D >Feature sequence1010 607 705 gene locus_tag LOCUS_t00720 607 705 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 853 1104 gene locus_tag LOCUS_58530 853 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 1146 1478 gene locus_tag LOCUS_58540 1146 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 1480 1815 gene locus_tag LOCUS_58550 1480 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 >Feature sequence1011 1934 54 gene locus_tag LOCUS_58560 1934 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58560 >Feature sequence1012 1120 1437 gene locus_tag LOCUS_58570 1120 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 1946 1536 gene locus_tag LOCUS_58580 1946 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 >Feature sequence1013 >Feature sequence1014 75 740 gene locus_tag LOCUS_58590 75 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 772 1044 gene locus_tag LOCUS_58600 772 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 1061 1627 gene locus_tag LOCUS_58610 1061 1627 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566199.1 protein_id gnl|my_center|LOCUS_58610 >Feature sequence1015 <2011 1212 gene locus_tag LOCUS_58620 <2011 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122454.1:ThuA domain-containing protein >Feature sequence1016 >Feature sequence1017 <1 648 gene locus_tag LOCUS_58630 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081401.1:ATP-dependent protease ATPase subunit HslU 1163 1585 gene locus_tag LOCUS_58640 1163 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 >Feature sequence1018 >Feature sequence1019 1884 1435 gene locus_tag LOCUS_58650 1884 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 >Feature sequence1020 >Feature sequence1021 157 1158 gene locus_tag LOCUS_58660 157 1158 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_58660 1278 1751 gene locus_tag LOCUS_58670 1278 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 >Feature sequence1022 1845 91 gene locus_tag LOCUS_58680 1845 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 >Feature sequence1023 148 375 gene locus_tag LOCUS_58690 148 375 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_58690 372 1307 gene locus_tag LOCUS_58700 372 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 1557 1835 gene locus_tag LOCUS_58710 1557 1835 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_58710 >Feature sequence1024 735 1706 gene locus_tag LOCUS_58720 735 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 >Feature sequence1025 1897 506 gene locus_tag LOCUS_58730 1897 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 >Feature sequence1026 1219 1857 gene locus_tag LOCUS_58740 1219 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 >Feature sequence1027 <1 1808 gene locus_tag LOCUS_58750 <1 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928965.1:CHAT domain-containing protein >Feature sequence1028 896 1567 gene locus_tag LOCUS_58760 896 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 >Feature sequence1029 <1 1197 gene locus_tag LOCUS_58770 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967507.1:ATP-binding protein 1194 1451 gene locus_tag LOCUS_58780 1194 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 1498 1881 gene locus_tag LOCUS_58790 1498 1881 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_58790 >Feature sequence1030 >Feature sequence1031 <1 916 gene locus_tag LOCUS_58800 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119613.1:serine/threonine-protein kinase 916 1308 gene locus_tag LOCUS_58810 916 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 1763 1404 gene locus_tag LOCUS_58820 1763 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 >Feature sequence1032 212 1048 gene locus_tag LOCUS_58830 212 1048 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118052.1 protein_id gnl|my_center|LOCUS_58830 >Feature sequence1033 1647 988 gene locus_tag LOCUS_58840 1647 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 >Feature sequence1034 >Feature sequence1035 1142 1780 gene locus_tag LOCUS_58850 1142 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 >Feature sequence1036 601 1080 gene locus_tag LOCUS_58860 601 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 1137 1682 gene locus_tag LOCUS_58870 1137 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 >Feature sequence1037 662 294 gene locus_tag LOCUS_58880 662 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 1910 804 gene locus_tag LOCUS_58890 1910 804 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_58890 >Feature sequence1038 896 815 gene locus_tag LOCUS_t00730 896 815 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1666 992 gene locus_tag LOCUS_58900 1666 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 >Feature sequence1039 >Feature sequence1040 <1 1246 gene locus_tag LOCUS_58910 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258027.1:ATP-binding protein 1243 1500 gene locus_tag LOCUS_58920 1243 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 >Feature sequence1041 1476 1249 gene locus_tag LOCUS_58930 1476 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 >Feature sequence1042 278 1504 gene locus_tag LOCUS_58940 278 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 >Feature sequence1043 >Feature sequence1044 >Feature sequence1045 >Feature sequence1046 1056 103 gene locus_tag LOCUS_58950 1056 103 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020474717.1 protein_id gnl|my_center|LOCUS_58950 1410 1087 gene locus_tag LOCUS_58960 1410 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 >Feature sequence1047 >Feature sequence1048 98 1453 gene locus_tag LOCUS_58970 98 1453 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_58970 >Feature sequence1049 157 1617 gene locus_tag LOCUS_58980 157 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 >Feature sequence1050 >Feature sequence1051 1779 292 gene locus_tag LOCUS_58990 1779 292 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328020.1 protein_id gnl|my_center|LOCUS_58990 >Feature sequence1052 >Feature sequence1053 77 6 gene locus_tag LOCUS_t00740 77 6 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 382 534 gene locus_tag LOCUS_59000 382 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 1489 1133 gene locus_tag LOCUS_59010 1489 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 >Feature sequence1054 181 825 gene locus_tag LOCUS_59020 181 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 843 1658 gene locus_tag LOCUS_59030 843 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 >Feature sequence1055 785 306 gene locus_tag LOCUS_59040 gene ispF 785 306 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_59040 1192 857 gene locus_tag LOCUS_59050 1192 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 <1884 1208 gene locus_tag LOCUS_59060 <1884 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230243.1:GTP 3',8-cyclase MoaA >Feature sequence1056 1060 98 gene locus_tag LOCUS_59070 gene araH 1060 98 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195084.1 protein_id gnl|my_center|LOCUS_59070 <1881 1057 gene locus_tag LOCUS_59080 <1881 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226378.1:sugar ABC transporter ATP-binding protein >Feature sequence1057 >Feature sequence1058 >Feature sequence1059 >Feature sequence1060 >Feature sequence1061 1416 448 gene locus_tag LOCUS_59090 1416 448 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_59090 >Feature sequence1062 112 804 gene locus_tag LOCUS_59100 112 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 1759 860 gene locus_tag LOCUS_59110 1759 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 >Feature sequence1063 >Feature sequence1064 1077 298 gene locus_tag LOCUS_59120 1077 298 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_59120 1217 1729 gene locus_tag LOCUS_59130 gene tadA 1217 1729 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_59130 >Feature sequence1065 17 802 gene locus_tag LOCUS_59140 17 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 >Feature sequence1066 512 1822 gene locus_tag LOCUS_59150 512 1822 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222955.1 protein_id gnl|my_center|LOCUS_59150 >Feature sequence1067 223 618 gene locus_tag LOCUS_59160 223 618 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384980.1 protein_id gnl|my_center|LOCUS_59160 1791 736 gene locus_tag LOCUS_59170 1791 736 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327669.1 protein_id gnl|my_center|LOCUS_59170 >Feature sequence1068 <1852 132 gene locus_tag LOCUS_59180 <1852 132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:CRTAC1 family protein >Feature sequence1069 >Feature sequence1070 >Feature sequence1071 1492 374 gene locus_tag LOCUS_59190 gene nagA 1492 374 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098892.1 protein_id gnl|my_center|LOCUS_59190 >Feature sequence1072 733 1653 gene locus_tag LOCUS_59200 733 1653 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334803.1 protein_id gnl|my_center|LOCUS_59200 >Feature sequence1073 <1 609 gene locus_tag LOCUS_59210 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324200.1:DUF58 domain-containing protein 1119 745 gene locus_tag LOCUS_59220 1119 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 >Feature sequence1074 <1833 979 gene locus_tag LOCUS_59230 <1833 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971956.1:DegQ family serine endoprotease >Feature sequence1075 <1829 975 gene locus_tag LOCUS_59240 <1829 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922068.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD >Feature sequence1076 <1 570 gene locus_tag LOCUS_59250 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038433.1:TetR/AcrR family transcriptional regulator >Feature sequence1077 998 1807 gene locus_tag LOCUS_59260 gene larB 998 1807 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_59260 >Feature sequence1078 <1813 126 gene locus_tag LOCUS_59270 <1813 126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118463.1:translation elongation factor 4 >Feature sequence1079 <1813 555 gene locus_tag LOCUS_59280 <1813 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200284324.1:NACHT domain-containing protein >Feature sequence1080 >Feature sequence1081 >Feature sequence1082 609 241 gene locus_tag LOCUS_59290 609 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 <1806 844 gene locus_tag LOCUS_59300 <1806 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968357.1:phosphoketolase family protein >Feature sequence1083 <1801 16 gene locus_tag LOCUS_59310 <1801 16 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:CRTAC1 family protein >Feature sequence1084 1535 75 gene locus_tag LOCUS_59320 1535 75 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479264.1 protein_id gnl|my_center|LOCUS_59320 >Feature sequence1085 106 726 gene locus_tag LOCUS_59330 106 726 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_59330 885 1106 gene locus_tag LOCUS_59340 885 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 1103 1771 gene locus_tag LOCUS_59350 1103 1771 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_59350 >Feature sequence1086 823 473 gene locus_tag LOCUS_59360 823 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 1787 927 gene locus_tag LOCUS_59370 1787 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 >Feature sequence1087 126 836 gene locus_tag LOCUS_59380 gene rnc 126 836 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120177.1 protein_id gnl|my_center|LOCUS_59380 938 1222 gene locus_tag LOCUS_59390 938 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 >Feature sequence1088 1482 79 gene locus_tag LOCUS_59400 1482 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59400 >Feature sequence1089 193 1740 gene locus_tag LOCUS_59410 193 1740 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_59410 >Feature sequence1090 473 1753 gene locus_tag LOCUS_59420 473 1753 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_59420 >Feature sequence1091 >Feature sequence1092 >Feature sequence1093 <1776 526 gene locus_tag LOCUS_59430 <1776 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704756.1:potassium-transporting ATPase subunit KdpB >Feature sequence1094 1542 217 gene locus_tag LOCUS_59440 1542 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 >Feature sequence1095 >Feature sequence1096 625 356 gene locus_tag LOCUS_59450 625 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 <1775 823 gene locus_tag LOCUS_59460 <1775 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928885.1:tetratricopeptide repeat protein 1264 1173 gene locus_tag LOCUS_t00750 1264 1173 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1097 <1 1079 gene locus_tag LOCUS_59470 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014526928.1:macrolide transporter subunit MacA >Feature sequence1098 <1 1105 gene locus_tag LOCUS_59480 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404730.1:DUF4139 domain-containing protein >Feature sequence1099 <1 1545 gene locus_tag LOCUS_59490 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480295.1:dihydrolipoyllysine-residue acetyltransferase >Feature sequence1100 >Feature sequence1101 <1761 1136 gene locus_tag LOCUS_59500 <1761 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974987.1:ABC transporter ATP-binding protein >Feature sequence1102 1713 799 gene locus_tag LOCUS_59510 1713 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 >Feature sequence1103 >Feature sequence1104 382 1620 gene locus_tag LOCUS_59520 382 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 >Feature sequence1105 <1 538 gene locus_tag LOCUS_59530 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:PAS domain S-box protein >Feature sequence1106 >Feature sequence1107 348 1685 gene locus_tag LOCUS_59540 348 1685 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_59540 >Feature sequence1108 135 542 gene locus_tag LOCUS_59550 135 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 539 880 gene locus_tag LOCUS_59560 539 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 1001 1327 gene locus_tag LOCUS_59570 gene rpsJ 1001 1327 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_59570 >Feature sequence1109 604 227 gene locus_tag LOCUS_59580 604 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 >Feature sequence1110 1670 951 gene locus_tag LOCUS_59590 1670 951 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787336.1 protein_id gnl|my_center|LOCUS_59590 >Feature sequence1111 <1737 532 gene locus_tag LOCUS_59600 <1737 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839988.1:zinc-dependent metalloprotease >Feature sequence1112 515 1675 gene locus_tag LOCUS_59610 515 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 >Feature sequence1113 <1 552 gene locus_tag LOCUS_59620 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838342.1:efflux RND transporter permease subunit >Feature sequence1114 >Feature sequence1115 569 198 gene locus_tag LOCUS_59630 569 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59630 1003 509 gene locus_tag LOCUS_59640 1003 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59640 1476 1021 gene locus_tag LOCUS_59650 1476 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 >Feature sequence1116 <1 711 gene locus_tag LOCUS_59660 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118978.1:serine/threonine-protein kinase 1701 721 gene locus_tag LOCUS_59670 1701 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 >Feature sequence1117 914 603 gene locus_tag LOCUS_59680 914 603 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_59680 1338 901 gene locus_tag LOCUS_59690 1338 901 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_59690 >Feature sequence1118 243 1415 gene locus_tag LOCUS_59700 243 1415 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 protein_id gnl|my_center|LOCUS_59700 >Feature sequence1119 <1719 12 gene locus_tag LOCUS_59710 <1719 12 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003901059.1:serine protease PepD >Feature sequence1120 418 1104 gene locus_tag LOCUS_59720 418 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 >Feature sequence1121 >Feature sequence1122 <1712 996 gene locus_tag LOCUS_59730 <1712 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259581.1:GHMP kinase >Feature sequence1123 324 1364 gene locus_tag LOCUS_59740 324 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 >Feature sequence1124 1688 18 gene locus_tag LOCUS_59750 1688 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 1428 1335 gene locus_tag LOCUS_t00760 1428 1335 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1125 >Feature sequence1126 <1 1036 gene locus_tag LOCUS_59760 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087584.1:FAD-binding oxidoreductase >Feature sequence1127 536 862 gene locus_tag LOCUS_59770 536 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 1300 1037 gene locus_tag LOCUS_59780 1300 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 >Feature sequence1128 >Feature sequence1129 241 420 gene locus_tag LOCUS_59790 241 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 553 990 gene locus_tag LOCUS_59800 553 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 >Feature sequence1130 >Feature sequence1131 >Feature sequence1132 >Feature sequence1133 <1685 486 gene locus_tag LOCUS_59810 <1685 486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218083104.1:CRTAC1 family protein >Feature sequence1134 >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 615 1013 gene locus_tag LOCUS_59820 615 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 >Feature sequence1138 <1676 479 gene locus_tag LOCUS_59830 <1676 479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120614.1:tetratricopeptide repeat protein >Feature sequence1139 >Feature sequence1140 76 2 gene locus_tag LOCUS_t00770 76 2 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1141 611 189 gene locus_tag LOCUS_59840 611 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 >Feature sequence1142 1126 53 gene locus_tag LOCUS_59850 1126 53 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122163.1 protein_id gnl|my_center|LOCUS_59850 >Feature sequence1143 >Feature sequence1144 593 240 gene locus_tag LOCUS_59860 593 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 924 631 gene locus_tag LOCUS_59870 924 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 <1654 959 gene locus_tag LOCUS_59880 <1654 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583420.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence1145 1304 711 gene locus_tag LOCUS_59890 1304 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 >Feature sequence1146 <1 1098 gene locus_tag LOCUS_59900 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454162.1:arylsulfatase >Feature sequence1147 580 508 gene locus_tag LOCUS_t00780 580 508 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 891 589 gene locus_tag LOCUS_59910 891 589 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015477.1 protein_id gnl|my_center|LOCUS_59910 1424 906 gene locus_tag LOCUS_59920 gene hscB 1424 906 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_59920 >Feature sequence1148 1083 1574 gene locus_tag LOCUS_59930 gene purE 1083 1574 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106314.1 protein_id gnl|my_center|LOCUS_59930 >Feature sequence1149 120 1010 gene locus_tag LOCUS_59940 120 1010 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_59940 <1647 1111 gene locus_tag LOCUS_59950 <1647 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000799194.1:cardiolipin synthase >Feature sequence1150 <1 853 gene locus_tag LOCUS_59960 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032555800.1:transglutaminase domain-containing protein >Feature sequence1151 810 94 gene locus_tag LOCUS_59970 810 94 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391460.1 protein_id gnl|my_center|LOCUS_59970 1008 811 gene locus_tag LOCUS_59980 1008 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 >Feature sequence1152 <1 864 gene locus_tag LOCUS_59990 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948543.1:VWA domain-containing protein >Feature sequence1153 <1 1385 gene locus_tag LOCUS_60000 <1 1385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335517.1:DUF1501 domain-containing protein >Feature sequence1154 >Feature sequence1155 1114 659 gene locus_tag LOCUS_60010 gene dtd 1114 659 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_60010 >Feature sequence1156 >Feature sequence1157 120 497 gene locus_tag LOCUS_60020 120 497 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_60020 632 1507 gene locus_tag LOCUS_60030 632 1507 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_60030 >Feature sequence1158 1465 626 gene locus_tag LOCUS_60040 1465 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 >Feature sequence1159 1159 1064 gene locus_tag LOCUS_t00790 1159 1064 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1160 <1 666 gene locus_tag LOCUS_60050 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389119.1:substrate-binding domain-containing protein >Feature sequence1161 >Feature sequence1162 1530 241 gene locus_tag LOCUS_60060 1530 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 >Feature sequence1163 290 126 gene locus_tag LOCUS_60070 290 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 >Feature sequence1164 50 919 gene locus_tag LOCUS_60080 50 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 992 1504 gene locus_tag LOCUS_60090 992 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 >Feature sequence1165 265 1437 gene locus_tag LOCUS_60100 265 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921862.1 protein_id gnl|my_center|LOCUS_60100 >Feature sequence1166 <1 1448 gene locus_tag LOCUS_60110 <1 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008671048.1:BBP7 family outer membrane beta-barrel protein >Feature sequence1167 <1 1519 gene locus_tag LOCUS_60120 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332180.1:SpoIIE family protein phosphatase >Feature sequence1168 580 314 gene locus_tag LOCUS_60130 gene rpsS 580 314 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_60130 <1598 723 gene locus_tag LOCUS_60140 <1598 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121603.1:50S ribosomal protein L2 >Feature sequence1169 <1 1256 gene locus_tag LOCUS_60150 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052279147.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase >Feature sequence1170 >Feature sequence1171 1486 326 gene locus_tag LOCUS_60160 1486 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 >Feature sequence1172 >Feature sequence1173 >Feature sequence1174 <1 1519 gene locus_tag LOCUS_60170 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048693189.1:cytochrome c biogenesis protein CcdA >Feature sequence1175 377 823 gene locus_tag LOCUS_60180 377 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 911 1453 gene locus_tag LOCUS_60190 911 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 >Feature sequence1176 <1569 377 gene locus_tag LOCUS_60200 <1569 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883557.1:AMP-binding protein >Feature sequence1177 717 1463 gene locus_tag LOCUS_60210 717 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 >Feature sequence1178 >Feature sequence1179 1113 196 gene locus_tag LOCUS_60220 1113 196 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_60220 >Feature sequence1180 >Feature sequence1181 621 67 gene locus_tag LOCUS_60230 621 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 1383 637 gene locus_tag LOCUS_60240 1383 637 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338966.1 protein_id gnl|my_center|LOCUS_60240 >Feature sequence1182 350 595 gene locus_tag LOCUS_60250 350 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 712 1011 gene locus_tag LOCUS_60260 712 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 >Feature sequence1183 1078 386 gene locus_tag LOCUS_60270 1078 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 >Feature sequence1184 220 813 gene locus_tag LOCUS_60280 220 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 >Feature sequence1185 905 129 gene locus_tag LOCUS_60290 905 129 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_60290 >Feature sequence1186 <1535 189 gene locus_tag LOCUS_60300 <1535 189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008671048.1:BBP7 family outer membrane beta-barrel protein >Feature sequence1187 1443 694 gene locus_tag LOCUS_60310 1443 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 >Feature sequence1188 236 628 gene locus_tag LOCUS_60320 236 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 >Feature sequence1189 >Feature sequence1190 1084 17 gene locus_tag LOCUS_60330 1084 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60330 >Feature sequence1191 >Feature sequence1192 <1509 272 gene locus_tag LOCUS_60340 <1509 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083552.1:tetratricopeptide repeat protein >Feature sequence1193 <1 920 gene locus_tag LOCUS_60350 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927045.1:acetate/propionate family kinase