>Feature sequence001 404 330 gene locus_tag LOCUS_t00010 404 330 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 752 510 gene locus_tag LOCUS_00010 752 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1501 926 gene locus_tag LOCUS_00020 1501 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3056 1563 gene locus_tag LOCUS_00030 3056 1563 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_00030 3235 3693 gene locus_tag LOCUS_00040 3235 3693 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_00040 3714 4547 gene locus_tag LOCUS_00050 gene speE 3714 4547 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_00050 4550 5407 gene locus_tag LOCUS_00060 gene speB 4550 5407 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808139.1 protein_id gnl|my_center|LOCUS_00060 5483 7144 gene locus_tag LOCUS_00070 5483 7144 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_00070 7151 7327 gene locus_tag LOCUS_00080 7151 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7933 7493 gene locus_tag LOCUS_00090 7933 7493 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_00090 8290 8021 gene locus_tag LOCUS_00100 8290 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8428 9111 gene locus_tag LOCUS_00110 8428 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9283 10731 gene locus_tag LOCUS_00120 gene pabB 9283 10731 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_00120 10715 11560 gene locus_tag LOCUS_00130 gene ilvE 10715 11560 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870521.1 protein_id gnl|my_center|LOCUS_00130 11765 12196 gene locus_tag LOCUS_00140 11765 12196 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881130.1 protein_id gnl|my_center|LOCUS_00140 12280 13752 gene locus_tag LOCUS_00150 12280 13752 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_00150 14638 13730 gene locus_tag LOCUS_00160 14638 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15064 17664 gene locus_tag LOCUS_00170 15064 17664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18196 17585 gene locus_tag LOCUS_00180 18196 17585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18724 18266 gene locus_tag LOCUS_00190 18724 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21462 19333 gene locus_tag LOCUS_00200 21462 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21882 21466 gene locus_tag LOCUS_00210 21882 21466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24103 21962 gene locus_tag LOCUS_00220 24103 21962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24944 24483 gene locus_tag LOCUS_00230 24944 24483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25026 25220 gene locus_tag LOCUS_00240 25026 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26122 27390 gene locus_tag LOCUS_00250 gene eam 26122 27390 CDS product glutamate 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094599.1 protein_id gnl|my_center|LOCUS_00250 27486 28844 gene locus_tag LOCUS_00260 27486 28844 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_00260 29278 29194 gene locus_tag LOCUS_t00020 29278 29194 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30122 29361 gene locus_tag LOCUS_00270 30122 29361 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_00270 30525 30124 gene locus_tag LOCUS_00280 30525 30124 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_00280 31743 30526 gene locus_tag LOCUS_00290 31743 30526 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_00290 32950 32126 gene locus_tag LOCUS_00300 32950 32126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33138 34358 gene locus_tag LOCUS_00310 33138 34358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34387 35634 gene locus_tag LOCUS_00320 34387 35634 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_00320 35622 36890 gene locus_tag LOCUS_00330 35622 36890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 37012 37371 gene locus_tag LOCUS_00340 37012 37371 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870086.1 protein_id gnl|my_center|LOCUS_00340 37813 38760 gene locus_tag LOCUS_00350 37813 38760 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_00350 38782 39918 gene locus_tag LOCUS_00360 38782 39918 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392489.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence002 522 668 gene locus_tag LOCUS_00370 522 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 646 852 gene locus_tag LOCUS_00380 646 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 2134 1013 gene locus_tag LOCUS_00390 2134 1013 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_00390 2462 2115 gene locus_tag LOCUS_00400 2462 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 2820 2599 gene locus_tag LOCUS_00410 2820 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 2755 2943 gene locus_tag LOCUS_00420 2755 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 3745 3050 gene locus_tag LOCUS_00430 3745 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 4227 3868 gene locus_tag LOCUS_00440 4227 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00440 6934 6704 gene locus_tag LOCUS_00450 6934 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 7458 7754 gene locus_tag LOCUS_00460 7458 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 7936 8292 gene locus_tag LOCUS_00470 7936 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 8292 8504 gene locus_tag LOCUS_00480 8292 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 8663 9664 gene locus_tag LOCUS_00490 8663 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 9681 11495 gene locus_tag LOCUS_00500 9681 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 12585 12755 gene locus_tag LOCUS_00510 12585 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 12740 15424 gene locus_tag LOCUS_00520 12740 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 15530 16996 gene locus_tag LOCUS_00530 15530 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 17071 17337 gene locus_tag LOCUS_00540 17071 17337 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392598.1 protein_id gnl|my_center|LOCUS_00540 17400 18194 gene locus_tag LOCUS_00550 17400 18194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 18303 18524 gene locus_tag LOCUS_00560 18303 18524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 18502 19044 gene locus_tag LOCUS_00570 18502 19044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 19065 20456 gene locus_tag LOCUS_00580 19065 20456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 20472 20678 gene locus_tag LOCUS_00590 20472 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 20821 21555 gene locus_tag LOCUS_00600 20821 21555 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392315.1 protein_id gnl|my_center|LOCUS_00600 21572 22072 gene locus_tag LOCUS_00610 21572 22072 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_00610 22295 26653 gene locus_tag LOCUS_00620 22295 26653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 27416 28390 gene locus_tag LOCUS_00630 27416 28390 CDS product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391888.1 protein_id gnl|my_center|LOCUS_00630 28573 28857 gene locus_tag LOCUS_00640 28573 28857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 28886 29170 gene locus_tag LOCUS_00650 28886 29170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 29122 29568 gene locus_tag LOCUS_00660 29122 29568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 29576 30223 gene locus_tag LOCUS_00670 29576 30223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 30444 31355 gene locus_tag LOCUS_00680 30444 31355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 31411 31551 gene locus_tag LOCUS_00690 31411 31551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 31735 31896 gene locus_tag LOCUS_00700 31735 31896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 32549 33709 gene locus_tag LOCUS_00710 32549 33709 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_00710 33816 34040 gene locus_tag LOCUS_00720 33816 34040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 34064 35782 gene locus_tag LOCUS_00730 34064 35782 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_00730 36000 37397 gene locus_tag LOCUS_00740 36000 37397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 37803 38078 gene locus_tag LOCUS_00750 37803 38078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 38346 38270 gene locus_tag LOCUS_t00030 38346 38270 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 255 440 gene locus_tag LOCUS_00760 255 440 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_00760 638 1036 gene locus_tag LOCUS_00770 gene rpsH 638 1036 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459105.1 protein_id gnl|my_center|LOCUS_00770 1051 1599 gene locus_tag LOCUS_00780 gene rplF 1051 1599 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_00780 1618 1983 gene locus_tag LOCUS_00790 gene rplR 1618 1983 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393921.1 protein_id gnl|my_center|LOCUS_00790 1999 2511 gene locus_tag LOCUS_00800 gene rpsE 1999 2511 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_00800 2511 2693 gene locus_tag LOCUS_00810 gene rpmD 2511 2693 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 protein_id gnl|my_center|LOCUS_00810 2712 3149 gene locus_tag LOCUS_00820 gene rplO 2712 3149 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_00820 3151 4410 gene locus_tag LOCUS_00830 gene secY 3151 4410 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_00830 4414 5160 gene locus_tag LOCUS_00840 gene map 4414 5160 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_00840 5178 5474 gene locus_tag LOCUS_00850 5178 5474 CDS product KOW domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393914.1 protein_id gnl|my_center|LOCUS_00850 5609 5827 gene locus_tag LOCUS_00860 gene infA 5609 5827 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_00860 6033 6404 gene locus_tag LOCUS_00870 gene rpsM 6033 6404 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_00870 6416 6802 gene locus_tag LOCUS_00880 gene rpsK 6416 6802 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_00880 6818 7441 gene locus_tag LOCUS_00890 gene rpsD 6818 7441 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_00890 7478 8422 gene locus_tag LOCUS_00900 7478 8422 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_00900 8511 8849 gene locus_tag LOCUS_00910 gene rplQ 8511 8849 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459109.1 protein_id gnl|my_center|LOCUS_00910 8846 9622 gene locus_tag LOCUS_00920 gene truA 8846 9622 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_00920 9804 10265 gene locus_tag LOCUS_00930 gene smpB 9804 10265 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_00930 10412 10764 gene locus_tag LOCUS_tm00010 10412 10764 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 12021 10849 gene locus_tag LOCUS_00940 12021 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 12256 12972 gene locus_tag LOCUS_00950 12256 12972 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_00950 13116 13715 gene locus_tag LOCUS_00960 13116 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 13744 16224 gene locus_tag LOCUS_00970 13744 16224 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_00970 17044 16370 gene locus_tag LOCUS_00980 17044 16370 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272841.1 protein_id gnl|my_center|LOCUS_00980 17282 17587 gene locus_tag LOCUS_00990 17282 17587 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393974.1 protein_id gnl|my_center|LOCUS_00990 17589 18617 gene locus_tag LOCUS_01000 gene holA 17589 18617 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_01000 18981 18715 gene locus_tag LOCUS_01010 gene rpsT 18981 18715 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816503.1 protein_id gnl|my_center|LOCUS_01010 19237 19584 gene locus_tag LOCUS_01020 19237 19584 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392117.1 protein_id gnl|my_center|LOCUS_01020 19938 21902 gene locus_tag LOCUS_01030 19938 21902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 22375 23121 gene locus_tag LOCUS_01040 22375 23121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 23140 23433 gene locus_tag LOCUS_01050 23140 23433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 23514 25316 gene locus_tag LOCUS_01060 gene lepA 23514 25316 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_01060 25313 26446 gene locus_tag LOCUS_01070 gene hemW 25313 26446 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_01070 26595 27635 gene locus_tag LOCUS_01080 gene hrcA 26595 27635 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_01080 27653 29230 gene locus_tag LOCUS_01090 27653 29230 CDS product TCP-1/cpn60 chaperonin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143737.1 protein_id gnl|my_center|LOCUS_01090 29214 29831 gene locus_tag LOCUS_01100 gene grpE 29214 29831 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 protein_id gnl|my_center|LOCUS_01100 29844 31655 gene locus_tag LOCUS_01110 gene dnaK 29844 31655 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_01110 31692 32837 gene locus_tag LOCUS_01120 gene dnaJ 31692 32837 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_01120 >Feature sequence004 41 1444 gene locus_tag LOCUS_01130 41 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 1545 2126 gene locus_tag LOCUS_01140 1545 2126 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392053.1 protein_id gnl|my_center|LOCUS_01140 3764 2295 gene locus_tag LOCUS_01150 gene lysS 3764 2295 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_01150 4265 3786 gene locus_tag LOCUS_01160 gene greA 4265 3786 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_01160 5689 4610 gene locus_tag LOCUS_01170 5689 4610 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391697.1 protein_id gnl|my_center|LOCUS_01170 6906 5932 gene locus_tag LOCUS_01180 gene dusB 6906 5932 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_01180 7654 6884 gene locus_tag LOCUS_01190 7654 6884 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_01190 8616 7651 gene locus_tag LOCUS_01200 8616 7651 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_01200 9491 8637 gene locus_tag LOCUS_01210 gene nadC 9491 8637 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_01210 11077 9494 gene locus_tag LOCUS_01220 gene nadB 11077 9494 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140848.1 protein_id gnl|my_center|LOCUS_01220 12009 11089 gene locus_tag LOCUS_01230 gene nadA 12009 11089 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_01230 12885 12502 gene locus_tag LOCUS_01240 12885 12502 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101061.1 protein_id gnl|my_center|LOCUS_01240 13749 12886 gene locus_tag LOCUS_01250 gene panC 13749 12886 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_01250 14805 13963 gene locus_tag LOCUS_01260 gene panB 14805 13963 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_01260 15670 14798 gene locus_tag LOCUS_01270 15670 14798 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_01270 15937 16815 gene locus_tag LOCUS_01280 15937 16815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 17034 18044 gene locus_tag LOCUS_01290 17034 18044 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_01290 18074 18817 gene locus_tag LOCUS_01300 18074 18817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966543.1 protein_id gnl|my_center|LOCUS_01300 18810 19940 gene locus_tag LOCUS_01310 18810 19940 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_01310 20311 20877 gene locus_tag LOCUS_01320 20311 20877 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813649.1 protein_id gnl|my_center|LOCUS_01320 21025 22659 gene locus_tag LOCUS_01330 21025 22659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 23333 22665 gene locus_tag LOCUS_01340 23333 22665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 23470 23330 gene locus_tag LOCUS_01350 23470 23330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 25087 23576 gene locus_tag LOCUS_01360 25087 23576 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461578.1 protein_id gnl|my_center|LOCUS_01360 25204 25599 gene locus_tag LOCUS_01370 25204 25599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 26064 26348 gene locus_tag LOCUS_01380 26064 26348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 26445 26864 gene locus_tag LOCUS_01390 26445 26864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01390 27504 27067 gene locus_tag LOCUS_01400 27504 27067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 27752 27501 gene locus_tag LOCUS_01410 27752 27501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 29351 27972 gene locus_tag LOCUS_01420 29351 27972 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948850.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence005 39 800 gene locus_tag LOCUS_01430 39 800 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768263.1 protein_id gnl|my_center|LOCUS_01430 1057 4458 gene locus_tag LOCUS_01440 1057 4458 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_01440 4653 4883 gene locus_tag LOCUS_01450 gene mtrB 4653 4883 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393370.1 protein_id gnl|my_center|LOCUS_01450 5005 5193 gene locus_tag LOCUS_01460 5005 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5358 6215 gene locus_tag LOCUS_01470 gene accD 5358 6215 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_01470 6199 7152 gene locus_tag LOCUS_01480 6199 7152 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814659.1 protein_id gnl|my_center|LOCUS_01480 7229 8191 gene locus_tag LOCUS_01490 gene pfkA 7229 8191 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393368.1 protein_id gnl|my_center|LOCUS_01490 8243 9994 gene locus_tag LOCUS_01500 gene pyk 8243 9994 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_01500 10048 10644 gene locus_tag LOCUS_01510 10048 10644 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967095.1 protein_id gnl|my_center|LOCUS_01510 10776 11474 gene locus_tag LOCUS_01520 gene sigI 10776 11474 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815544.1 protein_id gnl|my_center|LOCUS_01520 11492 12319 gene locus_tag LOCUS_01530 11492 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 12517 14241 gene locus_tag LOCUS_01540 12517 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 14353 15747 gene locus_tag LOCUS_01550 14353 15747 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_01550 15710 16435 gene locus_tag LOCUS_01560 15710 16435 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_01560 16577 16705 gene locus_tag LOCUS_01570 16577 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 16909 17643 gene locus_tag LOCUS_01580 16909 17643 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876426.1 protein_id gnl|my_center|LOCUS_01580 17790 18614 gene locus_tag LOCUS_01590 17790 18614 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_01590 18650 19819 gene locus_tag LOCUS_01600 18650 19819 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_01600 19868 21274 gene locus_tag LOCUS_01610 19868 21274 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_01610 21560 23902 gene locus_tag LOCUS_01620 21560 23902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 25578 24175 gene locus_tag LOCUS_01630 25578 24175 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930179.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence006 3381 2260 gene locus_tag LOCUS_01640 gene fliY 3381 2260 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392326.1 protein_id gnl|my_center|LOCUS_01640 4366 3374 gene locus_tag LOCUS_01650 gene fliM 4366 3374 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392325.1 protein_id gnl|my_center|LOCUS_01650 4761 4390 gene locus_tag LOCUS_01660 4761 4390 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_01660 5372 4782 gene locus_tag LOCUS_01670 5372 4782 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774235.1 protein_id gnl|my_center|LOCUS_01670 6168 5356 gene locus_tag LOCUS_01680 6168 5356 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392322.1 protein_id gnl|my_center|LOCUS_01680 6697 6176 gene locus_tag LOCUS_01690 6697 6176 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359122.1 protein_id gnl|my_center|LOCUS_01690 7492 6749 gene locus_tag LOCUS_01700 7492 6749 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943783.1 protein_id gnl|my_center|LOCUS_01700 7909 7496 gene locus_tag LOCUS_01710 7909 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 8677 7910 gene locus_tag LOCUS_01720 8677 7910 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392315.1 protein_id gnl|my_center|LOCUS_01720 9514 8864 gene locus_tag LOCUS_01730 9514 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 10402 9533 gene locus_tag LOCUS_01740 10402 9533 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392313.1 protein_id gnl|my_center|LOCUS_01740 11555 10365 gene locus_tag LOCUS_01750 gene flhF 11555 10365 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392312.1 protein_id gnl|my_center|LOCUS_01750 13623 11545 gene locus_tag LOCUS_01760 gene flhA 13623 11545 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392311.1 protein_id gnl|my_center|LOCUS_01760 14708 13644 gene locus_tag LOCUS_01770 gene flhB 14708 13644 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_01770 15467 14709 gene locus_tag LOCUS_01780 gene fliR 15467 14709 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_01780 15766 15497 gene locus_tag LOCUS_01790 gene fliQ 15766 15497 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811859.1 protein_id gnl|my_center|LOCUS_01790 16550 15798 gene locus_tag LOCUS_01800 16550 15798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 16964 16620 gene locus_tag LOCUS_01810 16964 16620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 17343 16957 gene locus_tag LOCUS_01820 17343 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 17838 17353 gene locus_tag LOCUS_01830 17838 17353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 18669 17851 gene locus_tag LOCUS_01840 18669 17851 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392300.1 protein_id gnl|my_center|LOCUS_01840 19125 18763 gene locus_tag LOCUS_01850 19125 18763 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_01850 19524 19126 gene locus_tag LOCUS_01860 gene flgD 19524 19126 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870071.1 protein_id gnl|my_center|LOCUS_01860 20247 19540 gene locus_tag LOCUS_01870 20247 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 21873 21421 gene locus_tag LOCUS_01880 21873 21421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 23193 21877 gene locus_tag LOCUS_01890 gene fliI 23193 21877 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_01890 23796 23203 gene locus_tag LOCUS_01900 23796 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 <24583 23861 gene locus_tag LOCUS_01910 <24583 23861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392293.1:flagellar motor switch protein FliG >Feature sequence007 164 496 gene locus_tag LOCUS_01920 gene trxA 164 496 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_01920 761 1228 gene locus_tag LOCUS_01930 761 1228 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_01930 1248 2369 gene locus_tag LOCUS_01940 gene nusA 1248 2369 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_01940 2606 2887 gene locus_tag LOCUS_01950 2606 2887 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_01950 2872 3183 gene locus_tag LOCUS_01960 2872 3183 CDS product L7Ae/L30e/S12e/Gadd45 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392563.1 protein_id gnl|my_center|LOCUS_01960 3209 6094 gene locus_tag LOCUS_01970 gene infB 3209 6094 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541506.1 protein_id gnl|my_center|LOCUS_01970 6112 6468 gene locus_tag LOCUS_01980 gene rbfA 6112 6468 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_01980 6461 7453 gene locus_tag LOCUS_01990 6461 7453 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_01990 7462 8388 gene locus_tag LOCUS_02000 gene truB 7462 8388 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392567.1 protein_id gnl|my_center|LOCUS_02000 8405 9340 gene locus_tag LOCUS_02010 8405 9340 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392568.1 protein_id gnl|my_center|LOCUS_02010 9501 9719 gene locus_tag LOCUS_02020 9501 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 9728 9949 gene locus_tag LOCUS_02030 9728 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 10021 10290 gene locus_tag LOCUS_02040 gene rpsO 10021 10290 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_02040 10332 12533 gene locus_tag LOCUS_02050 10332 12533 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541509.1 protein_id gnl|my_center|LOCUS_02050 12655 13398 gene locus_tag LOCUS_02060 12655 13398 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392571.1 protein_id gnl|my_center|LOCUS_02060 13511 14248 gene locus_tag LOCUS_02070 gene cwlD 13511 14248 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_02070 14327 15589 gene locus_tag LOCUS_02080 14327 15589 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_02080 15622 16050 gene locus_tag LOCUS_02090 gene dut 15622 16050 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_02090 16253 16600 gene locus_tag LOCUS_02100 16253 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 16622 16882 gene locus_tag LOCUS_02110 16622 16882 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774520.1 protein_id gnl|my_center|LOCUS_02110 17346 17008 gene locus_tag LOCUS_02120 17346 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 17521 17808 gene locus_tag LOCUS_02130 17521 17808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 18005 18991 gene locus_tag LOCUS_02140 18005 18991 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183783.1 protein_id gnl|my_center|LOCUS_02140 19070 19249 gene locus_tag LOCUS_02150 19070 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 19776 19294 gene locus_tag LOCUS_02160 19776 19294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 19851 20648 gene locus_tag LOCUS_02170 gene dapB 19851 20648 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_02170 20797 21699 gene locus_tag LOCUS_02180 gene dpsA 20797 21699 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392578.1 protein_id gnl|my_center|LOCUS_02180 21712 22299 gene locus_tag LOCUS_02190 21712 22299 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence008 92 167 gene locus_tag LOCUS_t00040 92 167 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 631 281 gene locus_tag LOCUS_02200 631 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 890 1312 gene locus_tag LOCUS_02210 890 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2162 1719 gene locus_tag LOCUS_02220 2162 1719 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545540.1 protein_id gnl|my_center|LOCUS_02220 3645 2182 gene locus_tag LOCUS_02230 3645 2182 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_02230 4615 3656 gene locus_tag LOCUS_02240 4615 3656 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_02240 5030 4605 gene locus_tag LOCUS_02250 5030 4605 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842401.1 protein_id gnl|my_center|LOCUS_02250 5924 5034 gene locus_tag LOCUS_02260 5924 5034 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546292.1 protein_id gnl|my_center|LOCUS_02260 6502 5921 gene locus_tag LOCUS_02270 6502 5921 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546510.1 protein_id gnl|my_center|LOCUS_02270 8528 6495 gene locus_tag LOCUS_02280 8528 6495 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546462.1 protein_id gnl|my_center|LOCUS_02280 8826 8910 gene locus_tag LOCUS_t00050 8826 8910 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9981 9091 gene locus_tag LOCUS_02290 9981 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 10242 10727 gene locus_tag LOCUS_02300 10242 10727 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371678.1 protein_id gnl|my_center|LOCUS_02300 10748 11254 gene locus_tag LOCUS_02310 10748 11254 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_02310 11255 12373 gene locus_tag LOCUS_02320 11255 12373 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_02320 12388 14814 gene locus_tag LOCUS_02330 gene clpC 12388 14814 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_02330 15065 16240 gene locus_tag LOCUS_02340 gene radA 15065 16240 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_02340 16406 17464 gene locus_tag LOCUS_02350 gene disA 16406 17464 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_02350 17595 18071 gene locus_tag LOCUS_02360 17595 18071 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_02360 18292 19344 gene locus_tag LOCUS_02370 18292 19344 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_02370 19337 20503 gene locus_tag LOCUS_02380 19337 20503 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_02380 20642 21298 gene locus_tag LOCUS_02390 gene cysE 20642 21298 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_02390 21339 22772 gene locus_tag LOCUS_02400 gene cysS 21339 22772 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393961.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence009 422 3175 gene locus_tag LOCUS_02410 422 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3301 5307 gene locus_tag LOCUS_02420 3301 5307 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_02420 5294 6454 gene locus_tag LOCUS_02430 5294 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392352.1 protein_id gnl|my_center|LOCUS_02430 6462 7283 gene locus_tag LOCUS_02440 gene hisJ 6462 7283 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_02440 7321 7917 gene locus_tag LOCUS_02450 7321 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7880 8554 gene locus_tag LOCUS_02460 gene hypB 7880 8554 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007234.1 protein_id gnl|my_center|LOCUS_02460 8491 10809 gene locus_tag LOCUS_02470 gene hypF 8491 10809 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393666.1 protein_id gnl|my_center|LOCUS_02470 10800 11069 gene locus_tag LOCUS_02480 10800 11069 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393665.1 protein_id gnl|my_center|LOCUS_02480 11017 12144 gene locus_tag LOCUS_02490 gene hypD 11017 12144 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393664.1 protein_id gnl|my_center|LOCUS_02490 12137 13144 gene locus_tag LOCUS_02500 gene hypE 12137 13144 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393663.1 protein_id gnl|my_center|LOCUS_02500 13145 13765 gene locus_tag LOCUS_02510 13145 13765 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393261.1 protein_id gnl|my_center|LOCUS_02510 14265 16175 gene locus_tag LOCUS_02520 gene thrS 14265 16175 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393260.1 protein_id gnl|my_center|LOCUS_02520 16234 16716 gene locus_tag LOCUS_02530 gene tsaA 16234 16716 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_02530 17007 17525 gene locus_tag LOCUS_02540 gene infC 17007 17525 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_02540 17491 17685 gene locus_tag LOCUS_02550 gene rpmI 17491 17685 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_02550 17778 18137 gene locus_tag LOCUS_02560 gene rplT 17778 18137 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138362.1 protein_id gnl|my_center|LOCUS_02560 18210 19574 gene locus_tag LOCUS_02570 18210 19574 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_02570 19588 20232 gene locus_tag LOCUS_02580 19588 20232 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_02580 20334 21032 gene locus_tag LOCUS_02590 20334 21032 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_02590 21596 22618 gene locus_tag LOCUS_02600 gene pheS 21596 22618 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence010 1137 874 gene locus_tag LOCUS_02610 gene rpmA 1137 874 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964571.1 protein_id gnl|my_center|LOCUS_02610 1515 1204 gene locus_tag LOCUS_02620 gene rplU 1515 1204 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_02620 2215 1733 gene locus_tag LOCUS_02630 2215 1733 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530095.1 protein_id gnl|my_center|LOCUS_02630 4550 2196 gene locus_tag LOCUS_02640 4550 2196 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_02640 4653 4811 gene locus_tag LOCUS_02650 4653 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5046 5975 gene locus_tag LOCUS_02660 gene selD 5046 5975 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_02660 7361 6039 gene locus_tag LOCUS_02670 7361 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 7736 7990 gene locus_tag LOCUS_02680 7736 7990 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815009.1 protein_id gnl|my_center|LOCUS_02680 8947 7991 gene locus_tag LOCUS_02690 gene rsmI 8947 7991 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_02690 9593 8919 gene locus_tag LOCUS_02700 9593 8919 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_02700 10707 9736 gene locus_tag LOCUS_02710 gene holB 10707 9736 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_02710 11327 10662 gene locus_tag LOCUS_02720 gene tmk 11327 10662 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_02720 12756 11329 gene locus_tag LOCUS_02730 12756 11329 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_02730 13694 12756 gene locus_tag LOCUS_02740 13694 12756 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_02740 14874 13696 gene locus_tag LOCUS_02750 14874 13696 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_02750 15170 14874 gene locus_tag LOCUS_02760 15170 14874 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_02760 15742 15167 gene locus_tag LOCUS_02770 15742 15167 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545865.1 protein_id gnl|my_center|LOCUS_02770 16272 16009 gene locus_tag LOCUS_02780 16272 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 17034 16435 gene locus_tag LOCUS_02790 gene recR 17034 16435 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_02790 17458 17147 gene locus_tag LOCUS_02800 17458 17147 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_02800 18822 17512 gene locus_tag LOCUS_02810 18822 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 19524 19432 gene locus_tag LOCUS_t00060 19524 19432 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19857 20648 gene locus_tag LOCUS_02820 19857 20648 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_02820 <21937 20771 gene locus_tag LOCUS_02830 <21937 20771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459889.1:M48 family metallopeptidase >Feature sequence011 763 86 gene locus_tag LOCUS_02840 763 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_02840 1632 802 gene locus_tag LOCUS_02850 1632 802 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419210.1 protein_id gnl|my_center|LOCUS_02850 2328 1633 gene locus_tag LOCUS_02860 2328 1633 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438150.1 protein_id gnl|my_center|LOCUS_02860 3261 2371 gene locus_tag LOCUS_02870 3261 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4398 3280 gene locus_tag LOCUS_02880 gene steA 4398 3280 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428389.1 protein_id gnl|my_center|LOCUS_02880 5325 4552 gene locus_tag LOCUS_02890 gene spo0A 5325 4552 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_02890 6554 5463 gene locus_tag LOCUS_02900 gene spoIVB 6554 5463 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393015.1 protein_id gnl|my_center|LOCUS_02900 8547 6895 gene locus_tag LOCUS_02910 gene recN 8547 6895 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_02910 9016 8549 gene locus_tag LOCUS_02920 gene argR 9016 8549 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_02920 9908 9024 gene locus_tag LOCUS_02930 9908 9024 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_02930 10771 9944 gene locus_tag LOCUS_02940 10771 9944 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_02940 12665 10773 gene locus_tag LOCUS_02950 gene dxs 12665 10773 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_02950 13263 12652 gene locus_tag LOCUS_02960 13263 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393021.1 protein_id gnl|my_center|LOCUS_02960 15009 14119 gene locus_tag LOCUS_02970 15009 14119 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_02970 15253 14999 gene locus_tag LOCUS_02980 15253 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 15873 15316 gene locus_tag LOCUS_02990 15873 15316 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_02990 16599 15961 gene locus_tag LOCUS_03000 16599 15961 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810935.1 protein_id gnl|my_center|LOCUS_03000 17462 16614 gene locus_tag LOCUS_03010 17462 16614 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460266.1 protein_id gnl|my_center|LOCUS_03010 18773 17574 gene locus_tag LOCUS_03020 gene xseA 18773 17574 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_03020 19269 18850 gene locus_tag LOCUS_03030 gene nusB 19269 18850 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_03030 19485 19276 gene locus_tag LOCUS_03040 19485 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 20032 19496 gene locus_tag LOCUS_03050 gene amaP 20032 19496 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393031.1 protein_id gnl|my_center|LOCUS_03050 20522 20121 gene locus_tag LOCUS_03060 20522 20121 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_03060 <21746 20584 gene locus_tag LOCUS_03070 <21746 20584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944627.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence012 646 116 gene locus_tag LOCUS_03080 646 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 777 2054 gene locus_tag LOCUS_03090 777 2054 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_03090 2604 2239 gene locus_tag LOCUS_03100 2604 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 2770 2576 gene locus_tag LOCUS_03110 2770 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 2887 4095 gene locus_tag LOCUS_03120 2887 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4554 4141 gene locus_tag LOCUS_03130 4554 4141 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964225.1 protein_id gnl|my_center|LOCUS_03130 5244 4567 gene locus_tag LOCUS_03140 5244 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6338 5529 gene locus_tag LOCUS_03150 6338 5529 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_03150 7153 6341 gene locus_tag LOCUS_03160 7153 6341 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_03160 8099 7155 gene locus_tag LOCUS_03170 8099 7155 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_03170 8538 8119 gene locus_tag LOCUS_03180 8538 8119 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392448.1 protein_id gnl|my_center|LOCUS_03180 8847 10121 gene locus_tag LOCUS_03190 8847 10121 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_03190 11611 10145 gene locus_tag LOCUS_03200 11611 10145 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_03200 12059 11703 gene locus_tag LOCUS_03210 gene spoVAE 12059 11703 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392887.1 protein_id gnl|my_center|LOCUS_03210 13274 12261 gene locus_tag LOCUS_03220 gene spoVAD 13274 12261 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_03220 13804 13304 gene locus_tag LOCUS_03230 gene spoVAC 13804 13304 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_03230 14206 14012 gene locus_tag LOCUS_03240 14206 14012 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393002.1 protein_id gnl|my_center|LOCUS_03240 15042 14281 gene locus_tag LOCUS_03250 gene sigF 15042 14281 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460233.1 protein_id gnl|my_center|LOCUS_03250 15548 15126 gene locus_tag LOCUS_03260 gene spoIIAB 15548 15126 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_03260 15894 15541 gene locus_tag LOCUS_03270 gene spoIIAA 15894 15541 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059135.1 protein_id gnl|my_center|LOCUS_03270 17162 16014 gene locus_tag LOCUS_03280 17162 16014 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811039.1 protein_id gnl|my_center|LOCUS_03280 17969 17772 gene locus_tag LOCUS_03290 17969 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 18859 18059 gene locus_tag LOCUS_03300 18859 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 19474 18902 gene locus_tag LOCUS_03310 19474 18902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 19451 19606 gene locus_tag LOCUS_03320 19451 19606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 20228 20034 gene locus_tag LOCUS_03330 20228 20034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence013 699 223 gene locus_tag LOCUS_03340 699 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1175 696 gene locus_tag LOCUS_03350 1175 696 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785477.1 protein_id gnl|my_center|LOCUS_03350 2167 1172 gene locus_tag LOCUS_03360 gene nirJ2 2167 1172 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_03360 3258 2281 gene locus_tag LOCUS_03370 gene hemB 3258 2281 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460178.1 protein_id gnl|my_center|LOCUS_03370 5033 3513 gene locus_tag LOCUS_03380 gene cobA 5033 3513 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_03380 5968 5030 gene locus_tag LOCUS_03390 gene hemC 5968 5030 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392763.1 protein_id gnl|my_center|LOCUS_03390 7275 5974 gene locus_tag LOCUS_03400 gene hemA 7275 5974 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_03400 7879 7250 gene locus_tag LOCUS_03410 7879 7250 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_03410 8855 7893 gene locus_tag LOCUS_03420 8855 7893 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_03420 9667 9017 gene locus_tag LOCUS_03430 9667 9017 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392385.1 protein_id gnl|my_center|LOCUS_03430 9994 9686 gene locus_tag LOCUS_03440 9994 9686 CDS product DUF5665 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392384.1 protein_id gnl|my_center|LOCUS_03440 11163 10204 gene locus_tag LOCUS_03450 11163 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 11411 12277 gene locus_tag LOCUS_03460 11411 12277 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836810.1 protein_id gnl|my_center|LOCUS_03460 12484 14655 gene locus_tag LOCUS_03470 12484 14655 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_03470 15166 16275 gene locus_tag LOCUS_03480 15166 16275 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937849.1 protein_id gnl|my_center|LOCUS_03480 18176 16710 gene locus_tag LOCUS_03490 18176 16710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 18809 18195 gene locus_tag LOCUS_03500 18809 18195 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_03500 <20374 18796 gene locus_tag LOCUS_03510 <20374 18796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015263309.1:sensor histidine kinase >Feature sequence014 174 1832 gene locus_tag LOCUS_03520 gene ilvB 174 1832 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393739.1 protein_id gnl|my_center|LOCUS_03520 1852 3387 gene locus_tag LOCUS_03530 1852 3387 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_03530 3586 4854 gene locus_tag LOCUS_03540 gene leuC 3586 4854 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_03540 4855 5343 gene locus_tag LOCUS_03550 gene leuD 4855 5343 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_03550 5486 7063 gene locus_tag LOCUS_03560 gene cimA 5486 7063 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_03560 7231 8595 gene locus_tag LOCUS_03570 gene glmM 7231 8595 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461863.1 protein_id gnl|my_center|LOCUS_03570 9234 11057 gene locus_tag LOCUS_03580 gene glmS 9234 11057 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_03580 11362 12330 gene locus_tag LOCUS_03590 gene cbiB 11362 12330 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392613.1 protein_id gnl|my_center|LOCUS_03590 12465 13565 gene locus_tag LOCUS_03600 gene cobD 12465 13565 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_03600 13988 13629 gene locus_tag LOCUS_03610 13988 13629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 14937 13972 gene locus_tag LOCUS_03620 14937 13972 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812740.1 protein_id gnl|my_center|LOCUS_03620 16040 14976 gene locus_tag LOCUS_03630 gene cobT 16040 14976 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_03630 17596 16220 gene locus_tag LOCUS_03640 17596 16220 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 protein_id gnl|my_center|LOCUS_03640 19425 17923 gene locus_tag LOCUS_03650 19425 17923 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence015 <1 944 gene locus_tag LOCUS_03660 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393897.1:thioredoxin-disulfide reductase 1871 948 gene locus_tag LOCUS_03670 1871 948 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_03670 2730 1873 gene locus_tag LOCUS_03680 2730 1873 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877413.1 protein_id gnl|my_center|LOCUS_03680 2969 3283 gene locus_tag LOCUS_03690 2969 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3358 6135 gene locus_tag LOCUS_03700 3358 6135 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459915.1 protein_id gnl|my_center|LOCUS_03700 6555 7148 gene locus_tag LOCUS_03710 6555 7148 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_03710 7145 8005 gene locus_tag LOCUS_03720 7145 8005 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_03720 8059 10044 gene locus_tag LOCUS_03730 8059 10044 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_03730 10035 10490 gene locus_tag LOCUS_03740 10035 10490 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_03740 10804 11769 gene locus_tag LOCUS_03750 10804 11769 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_03750 11864 12892 gene locus_tag LOCUS_03760 11864 12892 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_03760 12893 13735 gene locus_tag LOCUS_03770 12893 13735 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_03770 14722 13838 gene locus_tag LOCUS_03780 14722 13838 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393156.1 protein_id gnl|my_center|LOCUS_03780 16077 14806 gene locus_tag LOCUS_03790 16077 14806 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_03790 16432 16115 gene locus_tag LOCUS_03800 16432 16115 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808431.1 protein_id gnl|my_center|LOCUS_03800 16666 18651 gene locus_tag LOCUS_03810 16666 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence016 881 588 gene locus_tag LOCUS_03820 881 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 1996 941 gene locus_tag LOCUS_03830 1996 941 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878541.1 protein_id gnl|my_center|LOCUS_03830 4076 1983 gene locus_tag LOCUS_03840 4076 1983 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_03840 4586 4089 gene locus_tag LOCUS_03850 4586 4089 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_03850 4894 6531 gene locus_tag LOCUS_03860 4894 6531 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_03860 6624 7421 gene locus_tag LOCUS_03870 6624 7421 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081357594.1 protein_id gnl|my_center|LOCUS_03870 7408 8208 gene locus_tag LOCUS_03880 7408 8208 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_03880 8921 8442 gene locus_tag LOCUS_03890 8921 8442 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815079.1 protein_id gnl|my_center|LOCUS_03890 10351 8954 gene locus_tag LOCUS_03900 10351 8954 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948518.1 protein_id gnl|my_center|LOCUS_03900 11114 10326 gene locus_tag LOCUS_03910 11114 10326 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_03910 11286 11107 gene locus_tag LOCUS_03920 11286 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 11564 13621 gene locus_tag LOCUS_03930 11564 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 13602 15956 gene locus_tag LOCUS_03940 13602 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 16102 18057 gene locus_tag LOCUS_03950 16102 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence017 26 343 gene locus_tag LOCUS_03960 26 343 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_03960 459 1889 gene locus_tag LOCUS_03970 gene cobB 459 1889 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_03970 1919 2239 gene locus_tag LOCUS_03980 1919 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2227 2931 gene locus_tag LOCUS_03990 2227 2931 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 protein_id gnl|my_center|LOCUS_03990 3213 3905 gene locus_tag LOCUS_04000 gene sleB 3213 3905 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_04000 3942 5306 gene locus_tag LOCUS_04010 gene ypeB 3942 5306 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391745.1 protein_id gnl|my_center|LOCUS_04010 5461 5862 gene locus_tag LOCUS_04020 5461 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 5902 6810 gene locus_tag LOCUS_04030 5902 6810 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_04030 6980 7474 gene locus_tag LOCUS_04040 6980 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 7493 8788 gene locus_tag LOCUS_04050 7493 8788 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_04050 8909 9571 gene locus_tag LOCUS_04060 8909 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 9991 11622 gene locus_tag LOCUS_04070 9991 11622 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361309.1 protein_id gnl|my_center|LOCUS_04070 12125 12862 gene locus_tag LOCUS_04080 12125 12862 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_04080 13068 14450 gene locus_tag LOCUS_04090 gene csaB 13068 14450 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_04090 15794 14526 gene locus_tag LOCUS_04100 15794 14526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 16117 17238 gene locus_tag LOCUS_04110 16117 17238 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence018 91 561 gene locus_tag LOCUS_04120 gene ybeY 91 561 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_04120 564 944 gene locus_tag LOCUS_04130 gene cdd 564 944 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_04130 941 1846 gene locus_tag LOCUS_04140 gene era 941 1846 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_04140 1962 3320 gene locus_tag LOCUS_04150 gene mgtE 1962 3320 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_04150 3957 3403 gene locus_tag LOCUS_04160 3957 3403 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391642.1 protein_id gnl|my_center|LOCUS_04160 4435 4665 gene locus_tag LOCUS_04170 4435 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 5211 5804 gene locus_tag LOCUS_04180 5211 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04180 5814 6344 gene locus_tag LOCUS_04190 5814 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04190 6396 6779 gene locus_tag LOCUS_04200 6396 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 7691 6819 gene locus_tag LOCUS_04210 7691 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 7802 8599 gene locus_tag LOCUS_04220 7802 8599 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_04220 8635 9486 gene locus_tag LOCUS_04230 8635 9486 CDS product Spo0B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393085.1 protein_id gnl|my_center|LOCUS_04230 9696 11279 gene locus_tag LOCUS_04240 9696 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 11524 11760 gene locus_tag LOCUS_04250 11524 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 12462 11761 gene locus_tag LOCUS_04260 gene sigK 12462 11761 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393088.1 protein_id gnl|my_center|LOCUS_04260 12645 13685 gene locus_tag LOCUS_04270 gene mobAB 12645 13685 CDS product bifunctional molybdenum cofactor guanylyltransferase MobA/molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943769.1 protein_id gnl|my_center|LOCUS_04270 13679 14218 gene locus_tag LOCUS_04280 13679 14218 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_04280 14211 15107 gene locus_tag LOCUS_04290 14211 15107 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_04290 15290 16453 gene locus_tag LOCUS_04300 gene aroC 15290 16453 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 protein_id gnl|my_center|LOCUS_04300 16456 16971 gene locus_tag LOCUS_04310 16456 16971 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272425.1 protein_id gnl|my_center|LOCUS_04310 16968 18062 gene locus_tag LOCUS_04320 gene aroB 16968 18062 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence019 671 1177 gene locus_tag LOCUS_04330 671 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1951 1199 gene locus_tag LOCUS_04340 1951 1199 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812013.1 protein_id gnl|my_center|LOCUS_04340 2092 3204 gene locus_tag LOCUS_04350 2092 3204 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_04350 3295 3369 gene locus_tag LOCUS_t00070 3295 3369 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4031 4516 gene locus_tag LOCUS_04360 4031 4516 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439611.1 protein_id gnl|my_center|LOCUS_04360 4630 5454 gene locus_tag LOCUS_04370 4630 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5929 5498 gene locus_tag LOCUS_04380 5929 5498 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_04380 7245 5932 gene locus_tag LOCUS_04390 7245 5932 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_04390 7864 7268 gene locus_tag LOCUS_04400 7864 7268 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_04400 9678 7861 gene locus_tag LOCUS_04410 9678 7861 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542552.1 protein_id gnl|my_center|LOCUS_04410 11060 9675 gene locus_tag LOCUS_04420 11060 9675 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_04420 13983 11314 gene locus_tag LOCUS_04430 gene fdhF 13983 11314 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_04430 16064 14187 gene locus_tag LOCUS_04440 gene nuoF 16064 14187 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_04440 16690 16076 gene locus_tag LOCUS_04450 16690 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 17408 17226 gene locus_tag LOCUS_04460 17408 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence020 <1 2406 gene locus_tag LOCUS_04470 <1 2406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391557.1:DNA gyrase subunit A 2411 2878 gene locus_tag LOCUS_04480 2411 2878 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770721.1 protein_id gnl|my_center|LOCUS_04480 2983 3864 gene locus_tag LOCUS_04490 gene pdxS 2983 3864 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_04490 3867 4436 gene locus_tag LOCUS_04500 gene pdxT 3867 4436 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_04500 4610 5689 gene locus_tag LOCUS_04510 4610 5689 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_04510 5691 7274 gene locus_tag LOCUS_04520 gene serA 5691 7274 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391569.1 protein_id gnl|my_center|LOCUS_04520 7649 8929 gene locus_tag LOCUS_04530 gene serS 7649 8929 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_04530 9132 10724 gene locus_tag LOCUS_04540 9132 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 11358 11447 gene locus_tag LOCUS_t00080 11358 11447 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11593 11690 gene locus_tag LOCUS_t00090 11593 11690 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11711 11786 gene locus_tag LOCUS_t00100 11711 11786 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11897 11973 gene locus_tag LOCUS_t00110 11897 11973 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12052 12528 gene locus_tag LOCUS_04550 gene tadA 12052 12528 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_04550 12627 12720 gene locus_tag LOCUS_t00120 12627 12720 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12804 13715 gene locus_tag LOCUS_04560 12804 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 13969 14283 gene locus_tag LOCUS_04570 13969 14283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 14550 14855 gene locus_tag LOCUS_04580 14550 14855 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459031.1 protein_id gnl|my_center|LOCUS_04580 15103 17187 gene locus_tag LOCUS_04590 15103 17187 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462224.1 protein_id gnl|my_center|LOCUS_04590 17394 17200 gene locus_tag LOCUS_04600 17394 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence021 667 209 gene locus_tag LOCUS_04610 gene def 667 209 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_04610 2968 755 gene locus_tag LOCUS_04620 gene priA 2968 755 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965028.1 protein_id gnl|my_center|LOCUS_04620 4301 3114 gene locus_tag LOCUS_04630 gene coaBC 4301 3114 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_04630 4642 4421 gene locus_tag LOCUS_04640 4642 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5277 4681 gene locus_tag LOCUS_04650 gene gmk 5277 4681 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_04650 5547 5284 gene locus_tag LOCUS_04660 5547 5284 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_04660 6434 5565 gene locus_tag LOCUS_04670 6434 5565 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_04670 6872 7627 gene locus_tag LOCUS_04680 6872 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 8377 9006 gene locus_tag LOCUS_04690 8377 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392783.1 protein_id gnl|my_center|LOCUS_04690 9072 9275 gene locus_tag LOCUS_04700 9072 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 9566 10141 gene locus_tag LOCUS_04710 9566 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392783.1 protein_id gnl|my_center|LOCUS_04710 11517 10330 gene locus_tag LOCUS_04720 11517 10330 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_04720 12779 11604 gene locus_tag LOCUS_04730 12779 11604 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_04730 13626 12799 gene locus_tag LOCUS_04740 gene dapF 13626 12799 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_04740 14785 13652 gene locus_tag LOCUS_04750 14785 13652 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_04750 15449 14883 gene locus_tag LOCUS_04760 15449 14883 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_04760 16195 15449 gene locus_tag LOCUS_04770 16195 15449 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_04770 17260 16196 gene locus_tag LOCUS_04780 17260 16196 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence022 1538 99 gene locus_tag LOCUS_04790 1538 99 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461881.1 protein_id gnl|my_center|LOCUS_04790 2338 1556 gene locus_tag LOCUS_04800 2338 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2582 2397 gene locus_tag LOCUS_04810 2582 2397 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_04810 2964 2779 gene locus_tag LOCUS_04820 2964 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 4772 3438 gene locus_tag LOCUS_04830 gene murA 4772 3438 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_04830 5735 4863 gene locus_tag LOCUS_04840 5735 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393895.1 protein_id gnl|my_center|LOCUS_04840 6403 5840 gene locus_tag LOCUS_04850 6403 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 8044 6668 gene locus_tag LOCUS_04860 8044 6668 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393899.1 protein_id gnl|my_center|LOCUS_04860 9705 8374 gene locus_tag LOCUS_04870 gene scfB 9705 8374 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393900.1 protein_id gnl|my_center|LOCUS_04870 10605 9973 gene locus_tag LOCUS_04880 10605 9973 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392650.1 protein_id gnl|my_center|LOCUS_04880 10987 10913 gene locus_tag LOCUS_t00130 10987 10913 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11169 11094 gene locus_tag LOCUS_t00140 11169 11094 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12611 11328 gene locus_tag LOCUS_04890 12611 11328 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_04890 14000 12612 gene locus_tag LOCUS_04900 14000 12612 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_04900 15468 14131 gene locus_tag LOCUS_04910 gene dnaB 15468 14131 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_04910 15924 15478 gene locus_tag LOCUS_04920 gene rplI 15924 15478 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_04920 16416 16183 gene locus_tag LOCUS_04930 gene rpsR 16416 16183 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_04930 16899 16471 gene locus_tag LOCUS_04940 gene ssb 16899 16471 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391677.1 protein_id gnl|my_center|LOCUS_04940 17195 16911 gene locus_tag LOCUS_04950 gene rpsF 17195 16911 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence023 1156 1305 gene locus_tag LOCUS_04960 1156 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 1659 1321 gene locus_tag LOCUS_04970 1659 1321 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392814.1 protein_id gnl|my_center|LOCUS_04970 2126 3436 gene locus_tag LOCUS_04980 2126 3436 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095847.1 protein_id gnl|my_center|LOCUS_04980 3874 3488 gene locus_tag LOCUS_04990 3874 3488 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_04990 4546 3908 gene locus_tag LOCUS_05000 4546 3908 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392812.1 protein_id gnl|my_center|LOCUS_05000 4843 6684 gene locus_tag LOCUS_05010 gene asnB 4843 6684 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_05010 6992 8110 gene locus_tag LOCUS_05020 6992 8110 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392810.1 protein_id gnl|my_center|LOCUS_05020 8378 9079 gene locus_tag LOCUS_05030 8378 9079 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064061.1 protein_id gnl|my_center|LOCUS_05030 9122 9199 gene locus_tag LOCUS_t00150 9122 9199 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9968 10489 gene locus_tag LOCUS_05040 9968 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 10655 11701 gene locus_tag LOCUS_05050 10655 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 11809 12003 gene locus_tag LOCUS_05060 11809 12003 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393332.1 protein_id gnl|my_center|LOCUS_05060 12117 13253 gene locus_tag LOCUS_05070 12117 13253 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_05070 13418 15631 gene locus_tag LOCUS_05080 13418 15631 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861168.1 protein_id gnl|my_center|LOCUS_05080 15637 16422 gene locus_tag LOCUS_05090 15637 16422 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_05090 16606 16986 gene locus_tag LOCUS_05100 gene speD 16606 16986 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392796.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence024 1 1878 gene locus_tag LOCUS_05110 1 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 1989 3011 gene locus_tag LOCUS_05120 1989 3011 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_05120 3008 3550 gene locus_tag LOCUS_05130 3008 3550 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945496.1 protein_id gnl|my_center|LOCUS_05130 3593 4045 gene locus_tag LOCUS_05140 3593 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 4138 4596 gene locus_tag LOCUS_05150 gene rpiB 4138 4596 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_05150 4687 5934 gene locus_tag LOCUS_05160 4687 5934 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_05160 5936 6427 gene locus_tag LOCUS_05170 5936 6427 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_05170 6411 6728 gene locus_tag LOCUS_05180 6411 6728 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393865.1 protein_id gnl|my_center|LOCUS_05180 6752 7909 gene locus_tag LOCUS_05190 gene wecB 6752 7909 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_05190 8109 8372 gene locus_tag LOCUS_05200 8109 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8397 8801 gene locus_tag LOCUS_05210 8397 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 8837 9664 gene locus_tag LOCUS_05220 gene atpB 8837 9664 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_05220 9710 9946 gene locus_tag LOCUS_05230 9710 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 10076 10564 gene locus_tag LOCUS_05240 gene atpF 10076 10564 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462233.1 protein_id gnl|my_center|LOCUS_05240 10558 11106 gene locus_tag LOCUS_05250 10558 11106 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_05250 11122 12645 gene locus_tag LOCUS_05260 gene atpA 11122 12645 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_05260 12661 13530 gene locus_tag LOCUS_05270 gene atpG 12661 13530 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_05270 13558 14973 gene locus_tag LOCUS_05280 gene atpD 13558 14973 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_05280 14983 15408 gene locus_tag LOCUS_05290 14983 15408 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_05290 15733 16695 gene locus_tag LOCUS_05300 gene spoIID 15733 16695 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence025 12 1418 gene locus_tag LOCUS_05310 gene tilS 12 1418 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_05310 1670 3583 gene locus_tag LOCUS_05320 gene ftsH 1670 3583 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_05320 3866 4315 gene locus_tag LOCUS_05330 gene ndk 3866 4315 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_05330 4562 6265 gene locus_tag LOCUS_05340 4562 6265 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_05340 6392 6841 gene locus_tag LOCUS_05350 6392 6841 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_05350 6854 7735 gene locus_tag LOCUS_05360 6854 7735 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393156.1 protein_id gnl|my_center|LOCUS_05360 7907 9121 gene locus_tag LOCUS_05370 gene folP 7907 9121 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391658.1 protein_id gnl|my_center|LOCUS_05370 9357 9731 gene locus_tag LOCUS_05380 gene folB 9357 9731 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531873.1 protein_id gnl|my_center|LOCUS_05380 9716 10225 gene locus_tag LOCUS_05390 gene folK 9716 10225 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_05390 10228 10971 gene locus_tag LOCUS_05400 gene cobB 10228 10971 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 protein_id gnl|my_center|LOCUS_05400 14466 11374 gene locus_tag LOCUS_05410 14466 11374 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_05410 15649 14540 gene locus_tag LOCUS_05420 15649 14540 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_05420 16259 15642 gene locus_tag LOCUS_05430 16259 15642 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943169.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence026 313 687 gene locus_tag LOCUS_05440 313 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 726 2084 gene locus_tag LOCUS_05450 726 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2123 2545 gene locus_tag LOCUS_05460 gene fliS 2123 2545 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869575.1 protein_id gnl|my_center|LOCUS_05460 2549 2920 gene locus_tag LOCUS_05470 2549 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2961 7685 gene locus_tag LOCUS_05480 2961 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 7784 9520 gene locus_tag LOCUS_05490 7784 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 9788 9600 gene locus_tag LOCUS_05500 9788 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 9775 10944 gene locus_tag LOCUS_05510 9775 10944 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392269.1 protein_id gnl|my_center|LOCUS_05510 11299 11066 gene locus_tag LOCUS_05520 11299 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 11448 12692 gene locus_tag LOCUS_05530 gene pseC 11448 12692 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_05530 13034 13432 gene locus_tag LOCUS_05540 gene flgB 13034 13432 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_05540 13443 13856 gene locus_tag LOCUS_05550 gene flgC 13443 13856 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_05550 13965 14249 gene locus_tag LOCUS_05560 13965 14249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 14308 15831 gene locus_tag LOCUS_05570 gene fliF 14308 15831 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392292.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence027 79 1401 gene locus_tag LOCUS_05580 gene spoVR 79 1401 CDS product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233364.1 protein_id gnl|my_center|LOCUS_05580 1656 2405 gene locus_tag LOCUS_05590 1656 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2411 3301 gene locus_tag LOCUS_05600 2411 3301 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393147.1 protein_id gnl|my_center|LOCUS_05600 3391 4197 gene locus_tag LOCUS_05610 3391 4197 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_05610 5472 4276 gene locus_tag LOCUS_05620 gene qmoC 5472 4276 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_05620 7851 5620 gene locus_tag LOCUS_05630 7851 5620 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_05630 9097 7856 gene locus_tag LOCUS_05640 9097 7856 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_05640 11226 9340 gene locus_tag LOCUS_05650 gene aprA 11226 9340 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_05650 11688 11248 gene locus_tag LOCUS_05660 gene aprB 11688 11248 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_05660 12229 13032 gene locus_tag LOCUS_05670 12229 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 13166 13975 gene locus_tag LOCUS_05680 13166 13975 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 protein_id gnl|my_center|LOCUS_05680 14079 14324 gene locus_tag LOCUS_05690 14079 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 14859 14410 gene locus_tag LOCUS_05700 14859 14410 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393982.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence028 681 1040 gene locus_tag LOCUS_05710 681 1040 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392492.1 protein_id gnl|my_center|LOCUS_05710 1031 1639 gene locus_tag LOCUS_05720 1031 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1636 3300 gene locus_tag LOCUS_05730 1636 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3344 4435 gene locus_tag LOCUS_05740 gene nuoH 3344 4435 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_05740 4443 4907 gene locus_tag LOCUS_05750 4443 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4904 5431 gene locus_tag LOCUS_05760 4904 5431 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_05760 5431 5739 gene locus_tag LOCUS_05770 gene nuoK 5431 5739 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_05770 5776 7806 gene locus_tag LOCUS_05780 gene nuoL 5776 7806 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_05780 7803 9317 gene locus_tag LOCUS_05790 7803 9317 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_05790 9318 10745 gene locus_tag LOCUS_05800 9318 10745 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_05800 11035 11913 gene locus_tag LOCUS_05810 11035 11913 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545726.1 protein_id gnl|my_center|LOCUS_05810 11914 13539 gene locus_tag LOCUS_05820 11914 13539 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545333.1 protein_id gnl|my_center|LOCUS_05820 13864 14754 gene locus_tag LOCUS_05830 13864 14754 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545726.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence029 234 55 gene locus_tag LOCUS_05840 234 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 487 2277 gene locus_tag LOCUS_05850 487 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05850 2270 5308 gene locus_tag LOCUS_05860 2270 5308 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_05860 5388 5840 gene locus_tag LOCUS_05870 5388 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5945 6175 gene locus_tag LOCUS_05880 5945 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6546 7217 gene locus_tag LOCUS_05890 6546 7217 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_05890 7218 8300 gene locus_tag LOCUS_05900 7218 8300 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582913.1 protein_id gnl|my_center|LOCUS_05900 8462 9001 gene locus_tag LOCUS_05910 8462 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 9138 11198 gene locus_tag LOCUS_05920 9138 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 11214 11939 gene locus_tag LOCUS_05930 11214 11939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_05930 11878 13149 gene locus_tag LOCUS_05940 11878 13149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_05940 13178 13609 gene locus_tag LOCUS_05950 13178 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 14832 13642 gene locus_tag LOCUS_05960 gene aguA 14832 13642 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262731.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence030 108 989 gene locus_tag LOCUS_05970 gene rsgA 108 989 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_05970 986 1642 gene locus_tag LOCUS_05980 gene rpe 986 1642 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_05980 1893 2555 gene locus_tag LOCUS_05990 1893 2555 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_05990 2560 3036 gene locus_tag LOCUS_06000 2560 3036 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_06000 4985 3153 gene locus_tag LOCUS_06010 4985 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 5245 5322 gene locus_tag LOCUS_t00160 5245 5322 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5382 6026 gene locus_tag LOCUS_06020 5382 6026 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_06020 6170 5958 gene locus_tag LOCUS_06030 6170 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 6264 6446 gene locus_tag LOCUS_06040 6264 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6464 9160 gene locus_tag LOCUS_06050 6464 9160 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_06050 9251 10357 gene locus_tag LOCUS_06060 9251 10357 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_06060 10510 11019 gene locus_tag LOCUS_06070 10510 11019 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459789.1 protein_id gnl|my_center|LOCUS_06070 11062 11268 gene locus_tag LOCUS_06080 11062 11268 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057225.1 protein_id gnl|my_center|LOCUS_06080 11442 12368 gene locus_tag LOCUS_06090 11442 12368 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545343.1 protein_id gnl|my_center|LOCUS_06090 12401 13774 gene locus_tag LOCUS_06100 12401 13774 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939204.1 protein_id gnl|my_center|LOCUS_06100 14081 14299 gene locus_tag LOCUS_06110 gene tatA 14081 14299 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631606.1 protein_id gnl|my_center|LOCUS_06110 14360 15145 gene locus_tag LOCUS_06120 gene tatC 14360 15145 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392793.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence031 207 749 gene locus_tag LOCUS_06130 207 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 1045 761 gene locus_tag LOCUS_06140 1045 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1139 1582 gene locus_tag LOCUS_06150 1139 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 1620 2240 gene locus_tag LOCUS_06160 gene coaE 1620 2240 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_06160 2237 2788 gene locus_tag LOCUS_06170 2237 2788 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393337.1 protein_id gnl|my_center|LOCUS_06170 3030 3248 gene locus_tag LOCUS_06180 3030 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3677 4150 gene locus_tag LOCUS_06190 3677 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4176 4517 gene locus_tag LOCUS_06200 4176 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4514 4729 gene locus_tag LOCUS_06210 4514 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 7613 4830 gene locus_tag LOCUS_06220 gene ileS 7613 4830 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_06220 8523 8194 gene locus_tag LOCUS_06230 8523 8194 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_06230 8799 8527 gene locus_tag LOCUS_06240 8799 8527 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_06240 9677 8859 gene locus_tag LOCUS_06250 gene proC 9677 8859 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_06250 10113 9694 gene locus_tag LOCUS_06260 10113 9694 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_06260 10816 10091 gene locus_tag LOCUS_06270 10816 10091 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_06270 11545 10874 gene locus_tag LOCUS_06280 gene phoU 11545 10874 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_06280 12406 11651 gene locus_tag LOCUS_06290 gene pstB 12406 11651 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_06290 13287 12427 gene locus_tag LOCUS_06300 gene pstA 13287 12427 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994147.1 protein_id gnl|my_center|LOCUS_06300 14159 13284 gene locus_tag LOCUS_06310 gene pstC 14159 13284 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391660.1 protein_id gnl|my_center|LOCUS_06310 15008 14169 gene locus_tag LOCUS_06320 15008 14169 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence032 1104 40 gene locus_tag LOCUS_06330 gene ispG 1104 40 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_06330 2205 1174 gene locus_tag LOCUS_06340 gene rseP 2205 1174 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_06340 3362 2199 gene locus_tag LOCUS_06350 3362 2199 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_06350 4559 3492 gene locus_tag LOCUS_06360 gene ytvI 4559 3492 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392554.1 protein_id gnl|my_center|LOCUS_06360 5382 4564 gene locus_tag LOCUS_06370 5382 4564 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_06370 6196 5396 gene locus_tag LOCUS_06380 6196 5396 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_06380 6612 6406 gene locus_tag LOCUS_06390 6612 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 7170 6616 gene locus_tag LOCUS_06400 gene frr 7170 6616 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_06400 8000 7278 gene locus_tag LOCUS_06410 gene pyrH 8000 7278 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_06410 8702 8100 gene locus_tag LOCUS_06420 gene tsf 8702 8100 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_06420 9574 8831 gene locus_tag LOCUS_06430 gene rpsB 9574 8831 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_06430 10544 9762 gene locus_tag LOCUS_06440 gene codY 10544 9762 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810676.1 protein_id gnl|my_center|LOCUS_06440 11945 10557 gene locus_tag LOCUS_06450 gene hslU 11945 10557 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392544.1 protein_id gnl|my_center|LOCUS_06450 12573 12046 gene locus_tag LOCUS_06460 gene hslV 12573 12046 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_06460 13504 12593 gene locus_tag LOCUS_06470 gene xerC 13504 12593 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_06470 14986 13661 gene locus_tag LOCUS_06480 gene trmFO 14986 13661 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813284.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence033 278 72 gene locus_tag LOCUS_06490 278 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 875 968 gene locus_tag LOCUS_t00170 875 968 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1744 1013 gene locus_tag LOCUS_06500 1744 1013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_06500 2733 1894 gene locus_tag LOCUS_06510 2733 1894 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_06510 3988 2864 gene locus_tag LOCUS_06520 3988 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 6094 4064 gene locus_tag LOCUS_06530 6094 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 7047 6289 gene locus_tag LOCUS_06540 7047 6289 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_06540 7856 7047 gene locus_tag LOCUS_06550 7856 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 8818 7889 gene locus_tag LOCUS_06560 8818 7889 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_06560 9674 8850 gene locus_tag LOCUS_06570 9674 8850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_06570 12251 9885 gene locus_tag LOCUS_06580 12251 9885 CDS product copper amine oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393824.1 protein_id gnl|my_center|LOCUS_06580 13862 12456 gene locus_tag LOCUS_06590 13862 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence034 716 294 gene locus_tag LOCUS_06600 716 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 887 1105 gene locus_tag LOCUS_06610 887 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2820 1114 gene locus_tag LOCUS_06620 2820 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 4195 3014 gene locus_tag LOCUS_06630 gene metK 4195 3014 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_06630 4681 4412 gene locus_tag LOCUS_06640 4681 4412 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_06640 5714 4743 gene locus_tag LOCUS_06650 5714 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06650 6142 5699 gene locus_tag LOCUS_06660 6142 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06660 7128 6391 gene locus_tag LOCUS_06670 7128 6391 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391764.1 protein_id gnl|my_center|LOCUS_06670 8215 7289 gene locus_tag LOCUS_06680 8215 7289 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_06680 9087 8215 gene locus_tag LOCUS_06690 gene galU 9087 8215 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_06690 10163 9117 gene locus_tag LOCUS_06700 10163 9117 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_06700 10886 10422 gene locus_tag LOCUS_06710 gene fabZ 10886 10422 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420731.1 protein_id gnl|my_center|LOCUS_06710 12162 10900 gene locus_tag LOCUS_06720 12162 10900 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392912.1 protein_id gnl|my_center|LOCUS_06720 12229 12732 gene locus_tag LOCUS_06730 12229 12732 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144250.1 protein_id gnl|my_center|LOCUS_06730 14086 12776 gene locus_tag LOCUS_06740 14086 12776 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762251.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence035 558 1430 gene locus_tag LOCUS_06750 gene rsmA 558 1430 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_06750 1483 1959 gene locus_tag LOCUS_06760 1483 1959 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773636.1 protein_id gnl|my_center|LOCUS_06760 2115 2990 gene locus_tag LOCUS_06770 gene yabG 2115 2990 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458914.1 protein_id gnl|my_center|LOCUS_06770 3168 2914 gene locus_tag LOCUS_06780 3168 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3125 3502 gene locus_tag LOCUS_06790 3125 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 3542 3868 gene locus_tag LOCUS_06800 3542 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4224 4006 gene locus_tag LOCUS_06810 4224 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5249 4242 gene locus_tag LOCUS_06820 5249 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_06820 5512 5805 gene locus_tag LOCUS_06830 5512 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 5823 6365 gene locus_tag LOCUS_06840 5823 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7955 7239 gene locus_tag LOCUS_06850 7955 7239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_06850 8716 7949 gene locus_tag LOCUS_06860 8716 7949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_06860 9698 8709 gene locus_tag LOCUS_06870 9698 8709 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_06870 10681 9812 gene locus_tag LOCUS_06880 10681 9812 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_06880 11881 10691 gene locus_tag LOCUS_06890 11881 10691 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_06890 12164 12607 gene locus_tag LOCUS_06900 12164 12607 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391650.1 protein_id gnl|my_center|LOCUS_06900 13362 12625 gene locus_tag LOCUS_06910 13362 12625 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460948.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence036 1336 23 gene locus_tag LOCUS_06920 1336 23 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_06920 2036 1383 gene locus_tag LOCUS_06930 2036 1383 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_06930 3292 2033 gene locus_tag LOCUS_06940 3292 2033 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_06940 4423 3407 gene locus_tag LOCUS_06950 gene mtnA 4423 3407 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460451.1 protein_id gnl|my_center|LOCUS_06950 5214 4426 gene locus_tag LOCUS_06960 gene mtnP 5214 4426 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392226.1 protein_id gnl|my_center|LOCUS_06960 6440 5529 gene locus_tag LOCUS_06970 gene ftsY 6440 5529 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_06970 7128 6424 gene locus_tag LOCUS_06980 gene rnc 7128 6424 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460498.1 protein_id gnl|my_center|LOCUS_06980 8513 7272 gene locus_tag LOCUS_06990 gene fabF 8513 7272 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_06990 8802 8566 gene locus_tag LOCUS_07000 8802 8566 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719616.1 protein_id gnl|my_center|LOCUS_07000 9594 8851 gene locus_tag LOCUS_07010 gene fabG 9594 8851 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_07010 10669 9722 gene locus_tag LOCUS_07020 gene fabD 10669 9722 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_07020 11673 10684 gene locus_tag LOCUS_07030 11673 10684 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_07030 12616 11666 gene locus_tag LOCUS_07040 gene plsX 12616 11666 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_07040 13504 12962 gene locus_tag LOCUS_07050 13504 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence037 1157 126 gene locus_tag LOCUS_07060 1157 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1735 1217 gene locus_tag LOCUS_07070 1735 1217 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_07070 3060 1837 gene locus_tag LOCUS_07080 3060 1837 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_07080 4044 3133 gene locus_tag LOCUS_07090 gene thrB 4044 3133 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_07090 5462 4047 gene locus_tag LOCUS_07100 5462 4047 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_07100 6343 5783 gene locus_tag LOCUS_07110 6343 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7011 6397 gene locus_tag LOCUS_07120 7011 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 7554 7027 gene locus_tag LOCUS_07130 7554 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8758 7688 gene locus_tag LOCUS_07140 gene spoIIIAE 8758 7688 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393041.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07140 9237 8845 gene locus_tag LOCUS_07150 gene spoIIIAD 9237 8845 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393042.1 protein_id gnl|my_center|LOCUS_07150 9593 9393 gene locus_tag LOCUS_07160 gene spoIIIAC 9593 9393 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965391.1 protein_id gnl|my_center|LOCUS_07160 10123 9605 gene locus_tag LOCUS_07170 10123 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 11097 10117 gene locus_tag LOCUS_07180 gene spoIIIAA 11097 10117 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_07180 11569 11225 gene locus_tag LOCUS_07190 11569 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 12217 11660 gene locus_tag LOCUS_07200 gene efp 12217 11660 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_07200 13563 12490 gene locus_tag LOCUS_07210 gene pepQ 13563 12490 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_07210 14003 13560 gene locus_tag LOCUS_07220 gene aroQ 14003 13560 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence038 134 61 gene locus_tag LOCUS_t00180 134 61 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 878 285 gene locus_tag LOCUS_07230 878 285 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392057.1 protein_id gnl|my_center|LOCUS_07230 1617 835 gene locus_tag LOCUS_07240 gene rph 1617 835 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_07240 1824 2327 gene locus_tag LOCUS_07250 1824 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2477 3316 gene locus_tag LOCUS_07260 2477 3316 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_07260 3316 4989 gene locus_tag LOCUS_07270 gene acsA 3316 4989 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_07270 5236 7215 gene locus_tag LOCUS_07280 gene acs 5236 7215 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_07280 7232 8470 gene locus_tag LOCUS_07290 7232 8470 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459119.1 protein_id gnl|my_center|LOCUS_07290 8730 9131 gene locus_tag LOCUS_07300 8730 9131 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_07300 9325 10107 gene locus_tag LOCUS_07310 gene uppP 9325 10107 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_07310 10671 10210 gene locus_tag LOCUS_07320 10671 10210 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392625.1 protein_id gnl|my_center|LOCUS_07320 11967 10978 gene locus_tag LOCUS_07330 gene bioB 11967 10978 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_07330 12713 11964 gene locus_tag LOCUS_07340 12713 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 13390 12704 gene locus_tag LOCUS_07350 13390 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 <13984 13384 gene locus_tag LOCUS_07360 <13984 13384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939829.1:adenosylmethionine--8-amino-7-oxononanoate transaminase >Feature sequence039 19 1458 gene locus_tag LOCUS_07370 19 1458 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391643.1 protein_id gnl|my_center|LOCUS_07370 1448 2329 gene locus_tag LOCUS_07380 gene ubiA 1448 2329 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_07380 2349 3455 gene locus_tag LOCUS_07390 gene mqnE 2349 3455 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_07390 3457 4311 gene locus_tag LOCUS_07400 3457 4311 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393345.1 protein_id gnl|my_center|LOCUS_07400 4313 5371 gene locus_tag LOCUS_07410 gene mqnC 4313 5371 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044953.1 protein_id gnl|my_center|LOCUS_07410 5426 6820 gene locus_tag LOCUS_07420 gene selA 5426 6820 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_07420 6821 8728 gene locus_tag LOCUS_07430 gene selB 6821 8728 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_07430 8772 9167 gene locus_tag LOCUS_07440 8772 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391648.1 protein_id gnl|my_center|LOCUS_07440 9286 9660 gene locus_tag LOCUS_07450 9286 9660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 10027 11274 gene locus_tag LOCUS_07460 10027 11274 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_07460 11286 13739 gene locus_tag LOCUS_07470 11286 13739 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393425.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence040 1361 18 gene locus_tag LOCUS_07480 gene nifK 1361 18 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023795.1 protein_id gnl|my_center|LOCUS_07480 2614 1895 gene locus_tag LOCUS_07490 2614 1895 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545422.1 protein_id gnl|my_center|LOCUS_07490 3427 2777 gene locus_tag LOCUS_07500 3427 2777 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272548.1 protein_id gnl|my_center|LOCUS_07500 4113 3430 gene locus_tag LOCUS_07510 gene modB 4113 3430 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815806.1 protein_id gnl|my_center|LOCUS_07510 4943 4149 gene locus_tag LOCUS_07520 gene modA 4943 4149 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461081.1 protein_id gnl|my_center|LOCUS_07520 5861 4986 gene locus_tag LOCUS_07530 5861 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 6719 5877 gene locus_tag LOCUS_07540 6719 5877 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943426.1 protein_id gnl|my_center|LOCUS_07540 7954 6788 gene locus_tag LOCUS_07550 gene nifE 7954 6788 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877174.1 protein_id gnl|my_center|LOCUS_07550 9832 8351 gene locus_tag LOCUS_07560 9832 8351 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877173.1 protein_id gnl|my_center|LOCUS_07560 11280 9832 gene locus_tag LOCUS_07570 11280 9832 CDS product nitrogenase component I subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392088.1 protein_id gnl|my_center|LOCUS_07570 11732 11367 gene locus_tag LOCUS_07580 11732 11367 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392087.1 protein_id gnl|my_center|LOCUS_07580 12071 11754 gene locus_tag LOCUS_07590 12071 11754 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061089.1 protein_id gnl|my_center|LOCUS_07590 12912 12085 gene locus_tag LOCUS_07600 gene nifH 12912 12085 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061088.1 protein_id gnl|my_center|LOCUS_07600 13625 13287 gene locus_tag LOCUS_07610 13625 13287 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392814.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence041 <1 856 gene locus_tag LOCUS_07620 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723060.1:DAK2 domain-containing protein 875 1714 gene locus_tag LOCUS_07630 875 1714 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_07630 1762 1905 gene locus_tag LOCUS_07640 1762 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1909 2313 gene locus_tag LOCUS_07650 1909 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07650 2321 2479 gene locus_tag LOCUS_07660 2321 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3581 2517 gene locus_tag LOCUS_07670 3581 2517 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259751.1 protein_id gnl|my_center|LOCUS_07670 5694 3592 gene locus_tag LOCUS_07680 5694 3592 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_07680 6502 5888 gene locus_tag LOCUS_07690 6502 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 7955 6732 gene locus_tag LOCUS_07700 7955 6732 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_07700 8580 7942 gene locus_tag LOCUS_07710 8580 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 9728 9018 gene locus_tag LOCUS_07720 9728 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 10621 9878 gene locus_tag LOCUS_07730 10621 9878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392698.1 protein_id gnl|my_center|LOCUS_07730 11445 10636 gene locus_tag LOCUS_07740 11445 10636 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392699.1 protein_id gnl|my_center|LOCUS_07740 12423 11581 gene locus_tag LOCUS_07750 12423 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 12539 13018 gene locus_tag LOCUS_07760 12539 13018 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459677.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence042 466 26 gene locus_tag LOCUS_07770 466 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1431 481 gene locus_tag LOCUS_07780 1431 481 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546489.1 protein_id gnl|my_center|LOCUS_07780 2078 1641 gene locus_tag LOCUS_07790 2078 1641 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021476.1 protein_id gnl|my_center|LOCUS_07790 3573 2179 gene locus_tag LOCUS_07800 gene atoC 3573 2179 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_07800 5461 3578 gene locus_tag LOCUS_07810 gene atoS 5461 3578 CDS product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389138.1 protein_id gnl|my_center|LOCUS_07810 6696 5602 gene locus_tag LOCUS_07820 6696 5602 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940556.1 protein_id gnl|my_center|LOCUS_07820 6952 6713 gene locus_tag LOCUS_07830 6952 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7298 7098 gene locus_tag LOCUS_07840 7298 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 7719 7405 gene locus_tag LOCUS_07850 7719 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 8372 7941 gene locus_tag LOCUS_07860 8372 7941 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_07860 11006 8454 gene locus_tag LOCUS_07870 gene leuS 11006 8454 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_07870 11156 11082 gene locus_tag LOCUS_t00190 11156 11082 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11549 11187 gene locus_tag LOCUS_07880 gene rsfS 11549 11187 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_07880 11850 11587 gene locus_tag LOCUS_07890 11850 11587 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392102.1 protein_id gnl|my_center|LOCUS_07890 12558 11959 gene locus_tag LOCUS_07900 gene nadD 12558 11959 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_07900 <13353 12760 gene locus_tag LOCUS_07910 <13353 12760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542453.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence043 1468 1088 gene locus_tag LOCUS_07920 gene rplL 1468 1088 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_07920 2164 1643 gene locus_tag LOCUS_07930 gene rplJ 2164 1643 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_07930 3166 2474 gene locus_tag LOCUS_07940 gene rplA 3166 2474 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810196.1 protein_id gnl|my_center|LOCUS_07940 3650 3222 gene locus_tag LOCUS_07950 gene rplK 3650 3222 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_07950 4194 3667 gene locus_tag LOCUS_07960 gene nusG 4194 3667 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_07960 4651 4271 gene locus_tag LOCUS_07970 4651 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4821 4672 gene locus_tag LOCUS_07980 gene rpmG 4821 4672 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393952.1 protein_id gnl|my_center|LOCUS_07980 5320 5877 gene locus_tag LOCUS_07990 5320 5877 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546510.1 protein_id gnl|my_center|LOCUS_07990 5886 6776 gene locus_tag LOCUS_08000 5886 6776 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546292.1 protein_id gnl|my_center|LOCUS_08000 6924 6850 gene locus_tag LOCUS_t00200 6924 6850 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8134 7073 gene locus_tag LOCUS_08010 gene aroF 8134 7073 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_08010 9713 8661 gene locus_tag LOCUS_08020 9713 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 10894 9758 gene locus_tag LOCUS_08030 10894 9758 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942536.1 protein_id gnl|my_center|LOCUS_08030 11270 10884 gene locus_tag LOCUS_08040 11270 10884 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_08040 <13271 11286 gene locus_tag LOCUS_08050 <13271 11286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545601.1:hybrid sensor histidine kinase/response regulator >Feature sequence044 1253 972 gene locus_tag LOCUS_08060 gene gatC 1253 972 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_08060 3415 1391 gene locus_tag LOCUS_08070 gene ligA 3415 1391 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_08070 4303 3431 gene locus_tag LOCUS_08080 4303 3431 CDS product lipid II flippase Amj family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461588.1 protein_id gnl|my_center|LOCUS_08080 6423 4300 gene locus_tag LOCUS_08090 gene pcrA 6423 4300 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_08090 6622 6906 gene locus_tag LOCUS_08100 6622 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 7883 7029 gene locus_tag LOCUS_08110 7883 7029 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_08110 8718 7876 gene locus_tag LOCUS_08120 8718 7876 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_08120 9107 8715 gene locus_tag LOCUS_08130 9107 8715 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 protein_id gnl|my_center|LOCUS_08130 9518 9135 gene locus_tag LOCUS_08140 9518 9135 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024126.1 protein_id gnl|my_center|LOCUS_08140 10061 9687 gene locus_tag LOCUS_08150 10061 9687 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_08150 10927 10199 gene locus_tag LOCUS_08160 gene hisIE 10927 10199 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817209.1 protein_id gnl|my_center|LOCUS_08160 11750 10992 gene locus_tag LOCUS_08170 gene hisF 11750 10992 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_08170 12480 11740 gene locus_tag LOCUS_08180 gene hisA 12480 11740 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_08180 <13084 12474 gene locus_tag LOCUS_08190 <13084 12474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393529.1:imidazole glycerol phosphate synthase subunit HisH >Feature sequence045 284 1573 gene locus_tag LOCUS_08200 gene hcp 284 1573 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391685.1 protein_id gnl|my_center|LOCUS_08200 1640 1906 gene locus_tag LOCUS_08210 1640 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2118 2822 gene locus_tag LOCUS_08220 2118 2822 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_08220 4216 3119 gene locus_tag LOCUS_08230 4216 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 6363 4396 gene locus_tag LOCUS_08240 6363 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 7328 6489 gene locus_tag LOCUS_08250 7328 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 8784 7621 gene locus_tag LOCUS_08260 8784 7621 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_08260 9414 11447 gene locus_tag LOCUS_08270 9414 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 11444 12763 gene locus_tag LOCUS_08280 11444 12763 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence046 2044 578 gene locus_tag LOCUS_08290 2044 578 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392258.1 protein_id gnl|my_center|LOCUS_08290 2150 2788 gene locus_tag LOCUS_08300 2150 2788 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_08300 3310 2801 gene locus_tag LOCUS_08310 3310 2801 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 protein_id gnl|my_center|LOCUS_08310 4602 3313 gene locus_tag LOCUS_08320 4602 3313 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_08320 5371 4577 gene locus_tag LOCUS_08330 5371 4577 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_08330 6202 5375 gene locus_tag LOCUS_08340 6202 5375 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_08340 7421 6246 gene locus_tag LOCUS_08350 7421 6246 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_08350 7730 7645 gene locus_tag LOCUS_t00210 7730 7645 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7868 9124 gene locus_tag LOCUS_08360 gene hflX 7868 9124 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081386.1 protein_id gnl|my_center|LOCUS_08360 9129 9452 gene locus_tag LOCUS_08370 9129 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 9883 9551 gene locus_tag LOCUS_08380 9883 9551 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922600.1 protein_id gnl|my_center|LOCUS_08380 10409 11644 gene locus_tag LOCUS_08390 10409 11644 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790938.1 protein_id gnl|my_center|LOCUS_08390 11944 12072 gene locus_tag LOCUS_08400 11944 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence047 2289 2474 gene locus_tag LOCUS_08410 2289 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2485 2688 gene locus_tag LOCUS_08420 2485 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2703 3341 gene locus_tag LOCUS_08430 2703 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3262 4635 gene locus_tag LOCUS_08440 3262 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 4999 5364 gene locus_tag LOCUS_08450 4999 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5297 5467 gene locus_tag LOCUS_08460 5297 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5651 5845 gene locus_tag LOCUS_08470 5651 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 6535 7032 gene locus_tag LOCUS_08480 6535 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 7084 7794 gene locus_tag LOCUS_08490 7084 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 7810 8013 gene locus_tag LOCUS_08500 7810 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 8500 8006 gene locus_tag LOCUS_08510 8500 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 9032 8517 gene locus_tag LOCUS_08520 9032 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 10051 9722 gene locus_tag LOCUS_08530 10051 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 10268 10567 gene locus_tag LOCUS_08540 10268 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 10684 11922 gene locus_tag LOCUS_08550 10684 11922 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_08550 12144 12069 gene locus_tag LOCUS_t00220 12144 12069 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12415 12331 gene locus_tag LOCUS_t00230 12415 12331 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 2071 29 gene locus_tag LOCUS_08560 gene uvrB 2071 29 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_08560 3217 2171 gene locus_tag LOCUS_08570 3217 2171 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_08570 5553 3373 gene locus_tag LOCUS_08580 5553 3373 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_08580 6264 6476 gene locus_tag LOCUS_08590 6264 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7112 6498 gene locus_tag LOCUS_08600 7112 6498 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_08600 7375 7178 gene locus_tag LOCUS_08610 7375 7178 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943365.1 protein_id gnl|my_center|LOCUS_08610 8631 7459 gene locus_tag LOCUS_08620 8631 7459 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391791.1 protein_id gnl|my_center|LOCUS_08620 9927 8803 gene locus_tag LOCUS_08630 9927 8803 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_08630 11008 10118 gene locus_tag LOCUS_08640 gene ftsX 11008 10118 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_08640 11684 10998 gene locus_tag LOCUS_08650 gene ftsE 11684 10998 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence049 505 657 gene locus_tag LOCUS_08660 505 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 942 1655 gene locus_tag LOCUS_08670 942 1655 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393998.1 protein_id gnl|my_center|LOCUS_08670 1630 2250 gene locus_tag LOCUS_08680 1630 2250 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462331.1 protein_id gnl|my_center|LOCUS_08680 2301 3707 gene locus_tag LOCUS_08690 gene mnmE 2301 3707 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_08690 3719 5602 gene locus_tag LOCUS_08700 gene mnmG 3719 5602 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 protein_id gnl|my_center|LOCUS_08700 5720 6442 gene locus_tag LOCUS_08710 gene rsmG 5720 6442 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_08710 6527 7288 gene locus_tag LOCUS_08720 gene soj 6527 7288 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_08720 7281 8147 gene locus_tag LOCUS_08730 7281 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8160 8519 gene locus_tag LOCUS_08740 8160 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480251.1 protein_id gnl|my_center|LOCUS_08740 8764 8591 gene locus_tag LOCUS_08750 8764 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 8684 9064 gene locus_tag LOCUS_08760 8684 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 9117 9761 gene locus_tag LOCUS_08770 9117 9761 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_08770 9826 10092 gene locus_tag LOCUS_08780 9826 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 10733 10119 gene locus_tag LOCUS_08790 gene yyaC 10733 10119 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 protein_id gnl|my_center|LOCUS_08790 10969 11667 gene locus_tag LOCUS_08800 10969 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 11680 11871 gene locus_tag LOCUS_08810 11680 11871 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence050 78 1238 gene locus_tag LOCUS_08820 78 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1392 1595 gene locus_tag LOCUS_08830 1392 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1636 2016 gene locus_tag LOCUS_08840 1636 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2365 2850 gene locus_tag LOCUS_08850 2365 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3252 4733 gene locus_tag LOCUS_08860 3252 4733 CDS product CRISPR-associated protein Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258798.1 protein_id gnl|my_center|LOCUS_08860 4755 5858 gene locus_tag LOCUS_08870 gene cas7i 4755 5858 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258799.1 protein_id gnl|my_center|LOCUS_08870 5873 6628 gene locus_tag LOCUS_08880 gene cas5b 5873 6628 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909329.1 protein_id gnl|my_center|LOCUS_08880 6594 8933 gene locus_tag LOCUS_08890 6594 8933 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258801.1 protein_id gnl|my_center|LOCUS_08890 9273 9974 gene locus_tag LOCUS_08900 9273 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 10282 10548 gene locus_tag LOCUS_08910 10282 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 10532 10957 gene locus_tag LOCUS_08920 10532 10957 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681772.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence051 2297 219 gene locus_tag LOCUS_08930 gene fusA 2297 219 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_08930 2785 2315 gene locus_tag LOCUS_08940 gene rpsG 2785 2315 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_08940 3013 2801 gene locus_tag LOCUS_08950 3013 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3553 3302 gene locus_tag LOCUS_08960 3553 3302 CDS product 50S ribosomal protein L7Ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393943.1 protein_id gnl|my_center|LOCUS_08960 7158 3622 gene locus_tag LOCUS_08970 gene rpoC 7158 3622 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773568.1 protein_id gnl|my_center|LOCUS_08970 10708 7283 gene locus_tag LOCUS_08980 gene rpoB 10708 7283 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393945.1 protein_id gnl|my_center|LOCUS_08980 11427 11167 gene locus_tag LOCUS_08990 11427 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence052 876 448 gene locus_tag LOCUS_09000 876 448 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_09000 1434 1162 gene locus_tag LOCUS_09010 1434 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2440 1526 gene locus_tag LOCUS_09020 2440 1526 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_09020 3423 2449 gene locus_tag LOCUS_09030 3423 2449 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_09030 3740 3477 gene locus_tag LOCUS_09040 3740 3477 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_09040 5327 4134 gene locus_tag LOCUS_09050 gene hybB 5327 4134 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815882.1 protein_id gnl|my_center|LOCUS_09050 6160 5366 gene locus_tag LOCUS_09060 6160 5366 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815883.1 protein_id gnl|my_center|LOCUS_09060 7365 6238 gene locus_tag LOCUS_09070 7365 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9601 7967 gene locus_tag LOCUS_09080 9601 7967 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878050.1 protein_id gnl|my_center|LOCUS_09080 <11382 10027 gene locus_tag LOCUS_09090 <11382 10027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878050.1:(Fe-S)-binding protein >Feature sequence053 258 1796 gene locus_tag LOCUS_09100 gene rny 258 1796 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_09100 1812 2591 gene locus_tag LOCUS_09110 1812 2591 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_09110 2706 3458 gene locus_tag LOCUS_09120 gene recO 2706 3458 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460852.1 protein_id gnl|my_center|LOCUS_09120 3486 4358 gene locus_tag LOCUS_09130 gene glyQ 3486 4358 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_09130 4364 6460 gene locus_tag LOCUS_09140 gene glyS 4364 6460 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_09140 6869 7504 gene locus_tag LOCUS_09150 6869 7504 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392142.1 protein_id gnl|my_center|LOCUS_09150 7512 8345 gene locus_tag LOCUS_09160 7512 8345 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392143.1 protein_id gnl|my_center|LOCUS_09160 8362 10710 gene locus_tag LOCUS_09170 gene ppsA 8362 10710 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846514.1 protein_id gnl|my_center|LOCUS_09170 10745 11341 gene locus_tag LOCUS_09180 gene thpR 10745 11341 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence054 703 62 gene locus_tag LOCUS_09190 gene spoIIR 703 62 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768304.1 protein_id gnl|my_center|LOCUS_09190 1479 736 gene locus_tag LOCUS_09200 gene sigG 1479 736 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944988.1 protein_id gnl|my_center|LOCUS_09200 1824 3251 gene locus_tag LOCUS_09210 1824 3251 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_09210 3866 3297 gene locus_tag LOCUS_09220 3866 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4043 6253 gene locus_tag LOCUS_09230 4043 6253 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_09230 6237 7268 gene locus_tag LOCUS_09240 6237 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393763.1 protein_id gnl|my_center|LOCUS_09240 7706 8143 gene locus_tag LOCUS_09250 7706 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 8417 8818 gene locus_tag LOCUS_09260 8417 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9058 9549 gene locus_tag LOCUS_09270 9058 9549 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020819.1 protein_id gnl|my_center|LOCUS_09270 9636 9866 gene locus_tag LOCUS_09280 9636 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 10269 11150 gene locus_tag LOCUS_09290 10269 11150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence055 2 574 gene locus_tag LOCUS_09300 2 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 585 1247 gene locus_tag LOCUS_09310 585 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1386 1736 gene locus_tag LOCUS_09320 1386 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1946 2620 gene locus_tag LOCUS_09330 1946 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393882.1 protein_id gnl|my_center|LOCUS_09330 2839 3702 gene locus_tag LOCUS_09340 2839 3702 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462252.1 protein_id gnl|my_center|LOCUS_09340 3819 4475 gene locus_tag LOCUS_09350 gene fsa 3819 4475 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393880.1 protein_id gnl|my_center|LOCUS_09350 4940 6262 gene locus_tag LOCUS_09360 gene rho 4940 6262 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393879.1 protein_id gnl|my_center|LOCUS_09360 6417 7259 gene locus_tag LOCUS_09370 6417 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 8720 7458 gene locus_tag LOCUS_09380 8720 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 8951 10222 gene locus_tag LOCUS_09390 8951 10222 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048213.1 protein_id gnl|my_center|LOCUS_09390 10231 10986 gene locus_tag LOCUS_09400 10231 10986 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943576.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence056 12 560 gene locus_tag LOCUS_09410 12 560 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393991.1 protein_id gnl|my_center|LOCUS_09410 679 4608 gene locus_tag LOCUS_09420 679 4608 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393841.1 protein_id gnl|my_center|LOCUS_09420 5716 4670 gene locus_tag LOCUS_09430 5716 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 6310 5717 gene locus_tag LOCUS_09440 6310 5717 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_09440 6717 7418 gene locus_tag LOCUS_09450 6717 7418 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_09450 7375 7794 gene locus_tag LOCUS_09460 7375 7794 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393712.1 protein_id gnl|my_center|LOCUS_09460 8090 9298 gene locus_tag LOCUS_09470 8090 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 9434 10897 gene locus_tag LOCUS_09480 gene guaB 9434 10897 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541542.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence057 1432 416 gene locus_tag LOCUS_09490 1432 416 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461076.1 protein_id gnl|my_center|LOCUS_09490 2699 1572 gene locus_tag LOCUS_09500 2699 1572 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_09500 3033 3572 gene locus_tag LOCUS_09510 3033 3572 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964741.1 protein_id gnl|my_center|LOCUS_09510 3798 4577 gene locus_tag LOCUS_09520 3798 4577 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393638.1 protein_id gnl|my_center|LOCUS_09520 4947 5582 gene locus_tag LOCUS_09530 4947 5582 CDS product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948122.1 protein_id gnl|my_center|LOCUS_09530 6060 6533 gene locus_tag LOCUS_09540 6060 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 6554 7177 gene locus_tag LOCUS_09550 6554 7177 CDS product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356053.1 protein_id gnl|my_center|LOCUS_09550 7521 9215 gene locus_tag LOCUS_09560 7521 9215 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948117.1 protein_id gnl|my_center|LOCUS_09560 10007 9231 gene locus_tag LOCUS_09570 10007 9231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_09570 <10908 10007 gene locus_tag LOCUS_09580 <10908 10007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393780.1:daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein >Feature sequence058 1167 424 gene locus_tag LOCUS_09590 1167 424 CDS product peptidoglycan endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393594.1 protein_id gnl|my_center|LOCUS_09590 2650 1196 gene locus_tag LOCUS_09600 2650 1196 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_09600 4249 2828 gene locus_tag LOCUS_09610 gene rtcB 4249 2828 CDS product RNA ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228915.1 protein_id gnl|my_center|LOCUS_09610 5797 4685 gene locus_tag LOCUS_09620 gene alr 5797 4685 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09620 7390 5831 gene locus_tag LOCUS_09630 7390 5831 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_09630 7775 7395 gene locus_tag LOCUS_09640 gene acpS 7775 7395 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_09640 8697 7939 gene locus_tag LOCUS_09650 8697 7939 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_09650 10012 8687 gene locus_tag LOCUS_09660 10012 8687 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393658.1 protein_id gnl|my_center|LOCUS_09660 10191 10265 gene locus_tag LOCUS_t00240 10191 10265 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence059 1043 282 gene locus_tag LOCUS_09670 1043 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1254 1006 gene locus_tag LOCUS_09680 1254 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1495 1256 gene locus_tag LOCUS_09690 1495 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2507 2001 gene locus_tag LOCUS_09700 2507 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 4584 3619 gene locus_tag LOCUS_09710 4584 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5399 4683 gene locus_tag LOCUS_09720 5399 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7609 5561 gene locus_tag LOCUS_09730 gene brxL 7609 5561 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_09730 9969 7612 gene locus_tag LOCUS_09740 gene pglZ 9969 7612 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence060 <1 1158 gene locus_tag LOCUS_09750 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256574.1:FAD-linked oxidase C-terminal domain-containing protein 1151 2431 gene locus_tag LOCUS_09760 1151 2431 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229519.1 protein_id gnl|my_center|LOCUS_09760 3211 3432 gene locus_tag LOCUS_09770 3211 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3629 3847 gene locus_tag LOCUS_09780 3629 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4000 4434 gene locus_tag LOCUS_09790 4000 4434 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_09790 4717 4523 gene locus_tag LOCUS_09800 4717 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 5038 5319 gene locus_tag LOCUS_09810 5038 5319 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546461.1 protein_id gnl|my_center|LOCUS_09810 5341 6021 gene locus_tag LOCUS_09820 5341 6021 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941418.1 protein_id gnl|my_center|LOCUS_09820 6740 6060 gene locus_tag LOCUS_09830 6740 6060 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273131.1 protein_id gnl|my_center|LOCUS_09830 7018 6740 gene locus_tag LOCUS_09840 7018 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 8468 7011 gene locus_tag LOCUS_09850 8468 7011 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110011.1 protein_id gnl|my_center|LOCUS_09850 9457 8456 gene locus_tag LOCUS_09860 9457 8456 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670942.1 protein_id gnl|my_center|LOCUS_09860 <10785 9652 gene locus_tag LOCUS_09870 <10785 9652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890055.1:ATP-binding protein >Feature sequence061 1940 249 gene locus_tag LOCUS_09880 gene argS 1940 249 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_09880 2364 1942 gene locus_tag LOCUS_09890 2364 1942 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393888.1 protein_id gnl|my_center|LOCUS_09890 3749 2520 gene locus_tag LOCUS_09900 3749 2520 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_09900 4243 3746 gene locus_tag LOCUS_09910 4243 3746 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_09910 5445 4651 gene locus_tag LOCUS_09920 5445 4651 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_09920 5649 6701 gene locus_tag LOCUS_09930 5649 6701 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393376.1 protein_id gnl|my_center|LOCUS_09930 6910 7341 gene locus_tag LOCUS_09940 gene lspA 6910 7341 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_09940 7404 8348 gene locus_tag LOCUS_09950 7404 8348 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_09950 9082 8327 gene locus_tag LOCUS_09960 9082 8327 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391666.1 protein_id gnl|my_center|LOCUS_09960 10474 9245 gene locus_tag LOCUS_09970 10474 9245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence062 1180 479 gene locus_tag LOCUS_09980 1180 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2440 1337 gene locus_tag LOCUS_09990 2440 1337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066039.1 protein_id gnl|my_center|LOCUS_09990 3123 2497 gene locus_tag LOCUS_10000 3123 2497 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_10000 3744 3160 gene locus_tag LOCUS_10010 3744 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5507 3777 gene locus_tag LOCUS_10020 gene polX 5507 3777 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_10020 6614 5790 gene locus_tag LOCUS_10030 6614 5790 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941065.1 protein_id gnl|my_center|LOCUS_10030 7939 6887 gene locus_tag LOCUS_10040 7939 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173689.1 protein_id gnl|my_center|LOCUS_10040 8921 8013 gene locus_tag LOCUS_10050 8921 8013 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_10050 9382 8930 gene locus_tag LOCUS_10060 9382 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9675 9388 gene locus_tag LOCUS_10070 9675 9388 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941553.1 protein_id gnl|my_center|LOCUS_10070 10382 9714 gene locus_tag LOCUS_10080 10382 9714 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392790.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence063 <1 1610 gene locus_tag LOCUS_10090 <1 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392090.1:NAD+ synthase 1862 2458 gene locus_tag LOCUS_10100 1862 2458 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_10100 2635 3765 gene locus_tag LOCUS_10110 2635 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791395.1 protein_id gnl|my_center|LOCUS_10110 3729 5387 gene locus_tag LOCUS_10120 3729 5387 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940548.1 protein_id gnl|my_center|LOCUS_10120 5508 7841 gene locus_tag LOCUS_10130 5508 7841 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940549.1 protein_id gnl|my_center|LOCUS_10130 9171 7975 gene locus_tag LOCUS_10140 gene lhgO 9171 7975 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_10140 9455 10030 gene locus_tag LOCUS_10150 9455 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence064 535 56 gene locus_tag LOCUS_10160 gene moaC 535 56 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545678.1 protein_id gnl|my_center|LOCUS_10160 2710 785 gene locus_tag LOCUS_10170 2710 785 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_10170 4066 2840 gene locus_tag LOCUS_10180 4066 2840 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_10180 5278 4265 gene locus_tag LOCUS_10190 gene splB 5278 4265 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393427.1 protein_id gnl|my_center|LOCUS_10190 5632 5760 gene locus_tag LOCUS_10200 5632 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 6826 5969 gene locus_tag LOCUS_10210 6826 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 7558 6860 gene locus_tag LOCUS_10220 7558 6860 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815883.1 protein_id gnl|my_center|LOCUS_10220 10029 7594 gene locus_tag LOCUS_10230 gene fdnG 10029 7594 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence065 736 53 gene locus_tag LOCUS_10240 736 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 932 1129 gene locus_tag LOCUS_10250 932 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1425 2363 gene locus_tag LOCUS_10260 1425 2363 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838058.1 protein_id gnl|my_center|LOCUS_10260 2779 2465 gene locus_tag LOCUS_10270 2779 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3913 3185 gene locus_tag LOCUS_10280 3913 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 4750 3989 gene locus_tag LOCUS_10290 gene surE 4750 3989 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392658.1 protein_id gnl|my_center|LOCUS_10290 4961 4776 gene locus_tag LOCUS_10300 4961 4776 CDS product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392659.1 protein_id gnl|my_center|LOCUS_10300 5831 5253 gene locus_tag LOCUS_10310 gene folE 5831 5253 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794265.1 protein_id gnl|my_center|LOCUS_10310 6715 5963 gene locus_tag LOCUS_10320 6715 5963 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_10320 7260 6691 gene locus_tag LOCUS_10330 7260 6691 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024083.1 protein_id gnl|my_center|LOCUS_10330 7918 7262 gene locus_tag LOCUS_10340 gene queC 7918 7262 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_10340 8289 7915 gene locus_tag LOCUS_10350 gene queD 8289 7915 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_10350 10366 8666 gene locus_tag LOCUS_10360 10366 8666 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence066 1093 86 gene locus_tag LOCUS_10370 gene mltG 1093 86 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_10370 1466 1221 gene locus_tag LOCUS_10380 1466 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2907 1423 gene locus_tag LOCUS_10390 2907 1423 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460967.1 protein_id gnl|my_center|LOCUS_10390 3192 2923 gene locus_tag LOCUS_10400 3192 2923 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810865.1 protein_id gnl|my_center|LOCUS_10400 3691 3263 gene locus_tag LOCUS_10410 gene ruvX 3691 3263 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_10410 4053 3784 gene locus_tag LOCUS_10420 4053 3784 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_10420 6817 4166 gene locus_tag LOCUS_10430 gene alaS 6817 4166 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_10430 7996 7301 gene locus_tag LOCUS_10440 gene deoC 7996 7301 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_10440 8933 7998 gene locus_tag LOCUS_10450 8933 7998 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_10450 9122 10093 gene locus_tag LOCUS_10460 9122 10093 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391635.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence067 2004 2807 gene locus_tag LOCUS_10470 2004 2807 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544947.1 protein_id gnl|my_center|LOCUS_10470 3123 4388 gene locus_tag LOCUS_10480 3123 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4750 5130 gene locus_tag LOCUS_10490 4750 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6940 5246 gene locus_tag LOCUS_10500 6940 5246 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_10500 7305 7496 gene locus_tag LOCUS_10510 7305 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 9209 7500 gene locus_tag LOCUS_10520 9209 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence068 <1 1306 gene locus_tag LOCUS_10530 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit 1299 3503 gene locus_tag LOCUS_10540 gene acsB 1299 3503 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_10540 3749 5083 gene locus_tag LOCUS_10550 gene acsC 3749 5083 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_10550 5095 6996 gene locus_tag LOCUS_10560 5095 6996 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_10560 7001 7753 gene locus_tag LOCUS_10570 7001 7753 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392713.1 protein_id gnl|my_center|LOCUS_10570 7771 8715 gene locus_tag LOCUS_10580 gene cdhD 7771 8715 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_10580 9007 9801 gene locus_tag LOCUS_10590 9007 9801 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944231.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence069 1410 301 gene locus_tag LOCUS_10600 1410 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2748 1648 gene locus_tag LOCUS_10610 2748 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4069 2825 gene locus_tag LOCUS_10620 4069 2825 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941362.1 protein_id gnl|my_center|LOCUS_10620 5528 4386 gene locus_tag LOCUS_10630 5528 4386 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_10630 6312 5557 gene locus_tag LOCUS_10640 6312 5557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_10640 7162 6314 gene locus_tag LOCUS_10650 7162 6314 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_10650 9610 7280 gene locus_tag LOCUS_10660 9610 7280 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence070 <1 1306 gene locus_tag LOCUS_10670 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit 1299 3503 gene locus_tag LOCUS_10680 gene acsB 1299 3503 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_10680 3530 4864 gene locus_tag LOCUS_10690 gene acsC 3530 4864 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_10690 4881 6794 gene locus_tag LOCUS_10700 4881 6794 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_10700 6873 7553 gene locus_tag LOCUS_10710 6873 7553 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811722.1 protein_id gnl|my_center|LOCUS_10710 7555 7704 gene locus_tag LOCUS_10720 7555 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 7679 8569 gene locus_tag LOCUS_10730 gene cdhD 7679 8569 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_10730 8582 9379 gene locus_tag LOCUS_10740 8582 9379 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence071 167 1297 gene locus_tag LOCUS_10750 167 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1802 1632 gene locus_tag LOCUS_10760 1802 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2137 1850 gene locus_tag LOCUS_10770 2137 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3059 2652 gene locus_tag LOCUS_10780 3059 2652 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249289.1 protein_id gnl|my_center|LOCUS_10780 3345 3052 gene locus_tag LOCUS_10790 3345 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3717 3523 gene locus_tag LOCUS_10800 3717 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4468 3845 gene locus_tag LOCUS_10810 gene yedF 4468 3845 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_10810 5824 4514 gene locus_tag LOCUS_10820 5824 4514 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545072.1 protein_id gnl|my_center|LOCUS_10820 6039 5821 gene locus_tag LOCUS_10830 6039 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6086 6307 gene locus_tag LOCUS_10840 6086 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 7354 7070 gene locus_tag LOCUS_10850 7354 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7862 9452 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcaccacttgccccgatgacaaggggactgaaac >Feature sequence072 <1 1029 gene locus_tag LOCUS_10860 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392953.1:YedE family putative selenium transporter 1063 1278 gene locus_tag LOCUS_10870 1063 1278 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546446.1 protein_id gnl|my_center|LOCUS_10870 1499 1744 gene locus_tag LOCUS_10880 1499 1744 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393102.1 protein_id gnl|my_center|LOCUS_10880 1751 2842 gene locus_tag LOCUS_10890 1751 2842 CDS product PBS lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393103.1 protein_id gnl|my_center|LOCUS_10890 3516 2899 gene locus_tag LOCUS_10900 3516 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_10900 4166 3534 gene locus_tag LOCUS_10910 4166 3534 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393104.1 protein_id gnl|my_center|LOCUS_10910 4500 4255 gene locus_tag LOCUS_10920 4500 4255 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393105.1 protein_id gnl|my_center|LOCUS_10920 5718 4531 gene locus_tag LOCUS_10930 gene dsrB 5718 4531 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393106.1 protein_id gnl|my_center|LOCUS_10930 7149 5731 gene locus_tag LOCUS_10940 gene dsrA 7149 5731 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393107.1 protein_id gnl|my_center|LOCUS_10940 8054 7845 gene locus_tag LOCUS_10950 8054 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 8885 8139 gene locus_tag LOCUS_10960 8885 8139 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391622.1 protein_id gnl|my_center|LOCUS_10960 9565 8882 gene locus_tag LOCUS_10970 9565 8882 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence073 440 676 gene locus_tag LOCUS_10980 440 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 673 1098 gene locus_tag LOCUS_10990 673 1098 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_10990 1269 1889 gene locus_tag LOCUS_11000 1269 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1886 2101 gene locus_tag LOCUS_11010 1886 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2470 2634 gene locus_tag LOCUS_11020 2470 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2905 3279 gene locus_tag LOCUS_11030 2905 3279 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228087.1 protein_id gnl|my_center|LOCUS_11030 3614 4681 gene locus_tag LOCUS_11040 3614 4681 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_11040 4698 5159 gene locus_tag LOCUS_11050 4698 5159 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_11050 5216 6073 gene locus_tag LOCUS_11060 gene rfbD 5216 6073 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_11060 6070 7074 gene locus_tag LOCUS_11070 gene rfbB 6070 7074 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_11070 7240 7458 gene locus_tag LOCUS_11080 7240 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 7632 7907 gene locus_tag LOCUS_11090 7632 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7891 8292 gene locus_tag LOCUS_11100 7891 8292 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_11100 8292 9299 gene locus_tag LOCUS_11110 gene galE 8292 9299 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583707.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence074 1028 204 gene locus_tag LOCUS_11120 1028 204 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_11120 2090 1245 gene locus_tag LOCUS_11130 2090 1245 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_11130 3336 2314 gene locus_tag LOCUS_11140 gene prfB 3336 2314 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_11140 6384 3697 gene locus_tag LOCUS_11150 gene secA 6384 3697 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_11150 7278 6625 gene locus_tag LOCUS_11160 7278 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272208.1 protein_id gnl|my_center|LOCUS_11160 7835 7302 gene locus_tag LOCUS_11170 gene raiA 7835 7302 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_11170 8228 8028 gene locus_tag LOCUS_11180 8228 8028 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_11180 8818 8330 gene locus_tag LOCUS_11190 8818 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence075 <1 982 gene locus_tag LOCUS_11200 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388548.1:phenylacetate--CoA ligase 1067 2173 gene locus_tag LOCUS_11210 1067 2173 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_11210 2195 2995 gene locus_tag LOCUS_11220 2195 2995 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_11220 3085 3270 gene locus_tag LOCUS_11230 3085 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3531 4925 gene locus_tag LOCUS_11240 3531 4925 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_11240 5537 5343 gene locus_tag LOCUS_11250 5537 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 7566 5677 gene locus_tag LOCUS_11260 7566 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8648 7614 gene locus_tag LOCUS_11270 8648 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence076 86 1642 gene locus_tag LOCUS_11280 gene atpA 86 1642 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_11280 1626 2465 gene locus_tag LOCUS_11290 gene atpG 1626 2465 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_11290 2489 3913 gene locus_tag LOCUS_11300 gene atpD 2489 3913 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_11300 3910 4326 gene locus_tag LOCUS_11310 3910 4326 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_11310 4531 5679 gene locus_tag LOCUS_11320 4531 5679 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_11320 5923 5750 gene locus_tag LOCUS_11330 5923 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6479 6805 gene locus_tag LOCUS_11340 6479 6805 CDS product YtrH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393373.1 protein_id gnl|my_center|LOCUS_11340 6802 7287 gene locus_tag LOCUS_11350 6802 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 8347 7388 gene locus_tag LOCUS_11360 8347 7388 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence077 <1 801 gene locus_tag LOCUS_11370 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391812.1:DUF72 domain-containing protein 740 1399 gene locus_tag LOCUS_11380 gene udg 740 1399 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_11380 1433 1666 gene locus_tag LOCUS_11390 1433 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2922 1711 gene locus_tag LOCUS_11400 2922 1711 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_11400 3379 3041 gene locus_tag LOCUS_11410 3379 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4076 4285 gene locus_tag LOCUS_11420 4076 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4282 4659 gene locus_tag LOCUS_11430 4282 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4882 6249 gene locus_tag LOCUS_11440 4882 6249 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392943.1 protein_id gnl|my_center|LOCUS_11440 6440 6865 gene locus_tag LOCUS_11450 6440 6865 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_11450 7789 7223 gene locus_tag LOCUS_11460 7789 7223 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_11460 7896 8078 gene locus_tag LOCUS_11470 7896 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 8367 8834 gene locus_tag LOCUS_11480 8367 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence078 1076 207 gene locus_tag LOCUS_11490 1076 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1400 2185 gene locus_tag LOCUS_11500 1400 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2167 2547 gene locus_tag LOCUS_11510 2167 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11510 2561 3268 gene locus_tag LOCUS_11520 2561 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11520 3231 3842 gene locus_tag LOCUS_11530 3231 3842 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 protein_id gnl|my_center|LOCUS_11530 4185 5567 gene locus_tag LOCUS_11540 4185 5567 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156272834.1 protein_id gnl|my_center|LOCUS_11540 5579 6208 gene locus_tag LOCUS_11550 5579 6208 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_11550 6720 6866 gene locus_tag LOCUS_11560 6720 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6941 7249 gene locus_tag LOCUS_11570 6941 7249 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_11570 7233 7466 gene locus_tag LOCUS_11580 7233 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11580 7451 7600 gene locus_tag LOCUS_11590 7451 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 7759 7980 gene locus_tag LOCUS_11600 7759 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 8260 8141 gene locus_tag LOCUS_11610 8260 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence079 <1 1035 gene locus_tag LOCUS_11620 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460694.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1174 1986 gene locus_tag LOCUS_11630 1174 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1904 2611 gene locus_tag LOCUS_11640 1904 2611 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393732.1 protein_id gnl|my_center|LOCUS_11640 2612 3304 gene locus_tag LOCUS_11650 2612 3304 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393732.1 protein_id gnl|my_center|LOCUS_11650 3436 3795 gene locus_tag LOCUS_11660 3436 3795 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_11660 4056 5105 gene locus_tag LOCUS_11670 gene ftsZ 4056 5105 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_11670 5291 6190 gene locus_tag LOCUS_11680 gene spoIIGA 5291 6190 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_11680 6437 7156 gene locus_tag LOCUS_11690 gene sigE 6437 7156 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811355.1 protein_id gnl|my_center|LOCUS_11690 7436 7224 gene locus_tag LOCUS_11700 7436 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 8311 7499 gene locus_tag LOCUS_11710 8311 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence080 776 195 gene locus_tag LOCUS_11720 gene pabA 776 195 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_11720 2418 952 gene locus_tag LOCUS_11730 gene trpE 2418 952 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392855.1 protein_id gnl|my_center|LOCUS_11730 2934 2707 gene locus_tag LOCUS_11740 2934 2707 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812072.1 protein_id gnl|my_center|LOCUS_11740 4538 2967 gene locus_tag LOCUS_11750 4538 2967 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392657.1 protein_id gnl|my_center|LOCUS_11750 4864 6873 gene locus_tag LOCUS_11760 gene fusA 4864 6873 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_11760 8359 7160 gene locus_tag LOCUS_11770 8359 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence081 1811 558 gene locus_tag LOCUS_11780 gene clpX 1811 558 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_11780 2427 1828 gene locus_tag LOCUS_11790 gene clpP 2427 1828 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_11790 3867 2485 gene locus_tag LOCUS_11800 gene tig 3867 2485 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_11800 5197 4145 gene locus_tag LOCUS_11810 5197 4145 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_11810 5611 5390 gene locus_tag LOCUS_11820 5611 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 7084 5705 gene locus_tag LOCUS_11830 gene argH 7084 5705 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_11830 8446 7208 gene locus_tag LOCUS_11840 8446 7208 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence082 396 719 gene locus_tag LOCUS_11850 396 719 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767610.1 protein_id gnl|my_center|LOCUS_11850 2732 1359 gene locus_tag LOCUS_11860 2732 1359 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_11860 3002 3445 gene locus_tag LOCUS_11870 gene mraZ 3002 3445 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_11870 3467 4405 gene locus_tag LOCUS_11880 gene rsmH 3467 4405 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_11880 4464 4952 gene locus_tag LOCUS_11890 4464 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5136 7289 gene locus_tag LOCUS_11900 5136 7289 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence083 280 1617 gene locus_tag LOCUS_11910 280 1617 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_11910 1654 2424 gene locus_tag LOCUS_11920 1654 2424 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_11920 2674 3384 gene locus_tag LOCUS_11930 2674 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3631 3485 gene locus_tag LOCUS_11940 3631 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3820 4551 gene locus_tag LOCUS_11950 gene nadE 3820 4551 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869673.1 protein_id gnl|my_center|LOCUS_11950 4631 5026 gene locus_tag LOCUS_11960 4631 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11960 5090 5386 gene locus_tag LOCUS_11970 5090 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11970 5450 6043 gene locus_tag LOCUS_11980 5450 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6259 6759 gene locus_tag LOCUS_11990 gene ruvC 6259 6759 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_11990 6777 7364 gene locus_tag LOCUS_12000 gene ruvA 6777 7364 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_12000 7361 8389 gene locus_tag LOCUS_12010 gene ruvB 7361 8389 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence084 169 1200 gene locus_tag LOCUS_12020 169 1200 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_12020 1203 2027 gene locus_tag LOCUS_12030 gene mreC 1203 2027 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945174.1 protein_id gnl|my_center|LOCUS_12030 2438 2935 gene locus_tag LOCUS_12040 gene mreD 2438 2935 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816787.1 protein_id gnl|my_center|LOCUS_12040 2938 4923 gene locus_tag LOCUS_12050 gene mrdA 2938 4923 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392077.1 protein_id gnl|my_center|LOCUS_12050 5269 5724 gene locus_tag LOCUS_12060 gene minC 5269 5724 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392078.1 protein_id gnl|my_center|LOCUS_12060 5865 6659 gene locus_tag LOCUS_12070 gene minD 5865 6659 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_12070 6687 6968 gene locus_tag LOCUS_12080 gene minE 6687 6968 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392080.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence085 15 410 gene locus_tag LOCUS_12090 15 410 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_12090 2136 421 gene locus_tag LOCUS_12100 2136 421 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_12100 4010 2223 gene locus_tag LOCUS_12110 gene aspS 4010 2223 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_12110 5291 4029 gene locus_tag LOCUS_12120 gene hisS 5291 4029 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_12120 5534 5932 gene locus_tag LOCUS_12130 5534 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 7124 5937 gene locus_tag LOCUS_12140 7124 5937 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence086 <1 913 gene locus_tag LOCUS_12150 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392060.1:stalk domain-containing protein 1078 1452 gene locus_tag LOCUS_12160 1078 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1449 1943 gene locus_tag LOCUS_12170 1449 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3359 1908 gene locus_tag LOCUS_12180 3359 1908 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261871.1 protein_id gnl|my_center|LOCUS_12180 4047 3361 gene locus_tag LOCUS_12190 4047 3361 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_12190 4597 6138 gene locus_tag LOCUS_12200 gene metG 4597 6138 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_12200 6142 6909 gene locus_tag LOCUS_12210 6142 6909 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_12210 6900 7478 gene locus_tag LOCUS_12220 gene cobO 6900 7478 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812393.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence087 1464 145 gene locus_tag LOCUS_12230 gene rimO 1464 145 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_12230 2452 1670 gene locus_tag LOCUS_12240 2452 1670 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392587.1 protein_id gnl|my_center|LOCUS_12240 4765 2564 gene locus_tag LOCUS_12250 4765 2564 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_12250 4908 6062 gene locus_tag LOCUS_12260 gene bioF 4908 6062 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_12260 6237 7031 gene locus_tag LOCUS_12270 gene bioD 6237 7031 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence088 1615 644 gene locus_tag LOCUS_12280 gene trpS 1615 644 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460225.1 protein_id gnl|my_center|LOCUS_12280 2278 1649 gene locus_tag LOCUS_12290 2278 1649 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_12290 4910 2271 gene locus_tag LOCUS_12300 4910 2271 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_12300 6208 4886 gene locus_tag LOCUS_12310 gene lysA 6208 4886 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_12310 7566 6211 gene locus_tag LOCUS_12320 7566 6211 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence089 37 606 gene locus_tag LOCUS_12330 gene pth 37 606 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545410.1 protein_id gnl|my_center|LOCUS_12330 619 4089 gene locus_tag LOCUS_12340 gene mfd 619 4089 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_12340 4237 4797 gene locus_tag LOCUS_12350 gene spoVT 4237 4797 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_12350 4932 6473 gene locus_tag LOCUS_12360 gene mazG 4932 6473 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391632.1 protein_id gnl|my_center|LOCUS_12360 6676 6951 gene locus_tag LOCUS_12370 6676 6951 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_12370 6961 7203 gene locus_tag LOCUS_12380 6961 7203 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence090 71 2662 gene locus_tag LOCUS_12390 gene mutS 71 2662 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541545.1 protein_id gnl|my_center|LOCUS_12390 2662 4407 gene locus_tag LOCUS_12400 gene mutL 2662 4407 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392628.1 protein_id gnl|my_center|LOCUS_12400 4414 5208 gene locus_tag LOCUS_12410 4414 5208 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_12410 5205 6140 gene locus_tag LOCUS_12420 gene miaA 5205 6140 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392629.1 protein_id gnl|my_center|LOCUS_12420 6300 6548 gene locus_tag LOCUS_12430 gene hfq 6300 6548 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence091 57 1955 gene locus_tag LOCUS_12440 57 1955 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768290.1 protein_id gnl|my_center|LOCUS_12440 2061 2528 gene locus_tag LOCUS_12450 2061 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2533 2961 gene locus_tag LOCUS_12460 2533 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 3228 5627 gene locus_tag LOCUS_12470 3228 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 6079 6726 gene locus_tag LOCUS_12480 6079 6726 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_12480 6940 7413 gene locus_tag LOCUS_12490 6940 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence092 837 10 gene locus_tag LOCUS_12500 gene ylqF 837 10 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460442.1 protein_id gnl|my_center|LOCUS_12500 1369 851 gene locus_tag LOCUS_12510 gene lepB 1369 851 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_12510 1837 1496 gene locus_tag LOCUS_12520 gene rplS 1837 1496 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186516.1 protein_id gnl|my_center|LOCUS_12520 2716 1940 gene locus_tag LOCUS_12530 gene trmD 2716 1940 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_12530 3288 2752 gene locus_tag LOCUS_12540 gene rimM 3288 2752 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_12540 3661 3266 gene locus_tag LOCUS_12550 3661 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3904 3677 gene locus_tag LOCUS_12560 3904 3677 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_12560 4173 3907 gene locus_tag LOCUS_12570 gene rpsP 4173 3907 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_12570 5618 4278 gene locus_tag LOCUS_12580 gene ffh 5618 4278 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_12580 5904 7298 gene locus_tag LOCUS_12590 5904 7298 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393286.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence093 <1 1391 gene locus_tag LOCUS_12600 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256972.1:long-chain fatty acid--CoA ligase 1391 2269 gene locus_tag LOCUS_12610 1391 2269 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_12610 2338 3342 gene locus_tag LOCUS_12620 2338 3342 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_12620 3431 4633 gene locus_tag LOCUS_12630 3431 4633 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_12630 4852 5646 gene locus_tag LOCUS_12640 4852 5646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_12640 5643 6833 gene locus_tag LOCUS_12650 5643 6833 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence094 1338 664 gene locus_tag LOCUS_12660 1338 664 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_12660 3012 1387 gene locus_tag LOCUS_12670 gene nuoF 3012 1387 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_12670 3495 3013 gene locus_tag LOCUS_12680 gene nuoE 3495 3013 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_12680 6181 3464 gene locus_tag LOCUS_12690 gene fdhF 6181 3464 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_12690 6420 7391 gene locus_tag LOCUS_12700 6420 7391 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868898.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence095 1456 17 gene locus_tag LOCUS_12710 gene amrA 1456 17 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_12710 2252 1488 gene locus_tag LOCUS_12720 2252 1488 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_12720 2999 2259 gene locus_tag LOCUS_12730 2999 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3170 4009 gene locus_tag LOCUS_12740 3170 4009 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393282.1 protein_id gnl|my_center|LOCUS_12740 4924 4169 gene locus_tag LOCUS_12750 4924 4169 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591230.1 protein_id gnl|my_center|LOCUS_12750 5803 5411 gene locus_tag LOCUS_12760 gene rpsI 5803 5411 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_12760 6242 5814 gene locus_tag LOCUS_12770 gene rplM 6242 5814 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_12770 7371 6310 gene locus_tag LOCUS_12780 7371 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence096 167 790 gene locus_tag LOCUS_12790 167 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 790 1683 gene locus_tag LOCUS_12800 790 1683 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392086.1 protein_id gnl|my_center|LOCUS_12800 1810 3666 gene locus_tag LOCUS_12810 1810 3666 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_12810 3755 4342 gene locus_tag LOCUS_12820 3755 4342 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_12820 4366 5631 gene locus_tag LOCUS_12830 4366 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5718 7202 gene locus_tag LOCUS_12840 gene gltX 5718 7202 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_12840 7260 7333 gene locus_tag LOCUS_t00250 7260 7333 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 474 2474 gene locus_tag LOCUS_12850 474 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2561 4327 gene locus_tag LOCUS_12860 2561 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 4318 5871 gene locus_tag LOCUS_12870 4318 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence098 365 48 gene locus_tag LOCUS_12880 365 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 543 1538 gene locus_tag LOCUS_12890 543 1538 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391645.1 protein_id gnl|my_center|LOCUS_12890 1538 2287 gene locus_tag LOCUS_12900 1538 2287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391646.1 protein_id gnl|my_center|LOCUS_12900 2287 3024 gene locus_tag LOCUS_12910 2287 3024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285593.1 protein_id gnl|my_center|LOCUS_12910 3054 3197 gene locus_tag LOCUS_12920 3054 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3803 3216 gene locus_tag LOCUS_12930 3803 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5087 3873 gene locus_tag LOCUS_12940 5087 3873 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808454.1 protein_id gnl|my_center|LOCUS_12940 5402 7243 gene locus_tag LOCUS_12950 gene accB 5402 7243 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393034.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence099 2482 56 gene locus_tag LOCUS_12960 2482 56 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_12960 3533 4117 gene locus_tag LOCUS_12970 3533 4117 CDS product DUF2318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943390.1 protein_id gnl|my_center|LOCUS_12970 4194 5339 gene locus_tag LOCUS_12980 4194 5339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817388.1 protein_id gnl|my_center|LOCUS_12980 5449 6159 gene locus_tag LOCUS_12990 5449 6159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817390.1 protein_id gnl|my_center|LOCUS_12990 6122 7267 gene locus_tag LOCUS_13000 6122 7267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184119.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence100 82 1371 gene locus_tag LOCUS_13010 82 1371 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_13010 4290 1387 gene locus_tag LOCUS_13020 gene treY 4290 1387 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 protein_id gnl|my_center|LOCUS_13020 6718 4292 gene locus_tag LOCUS_13030 6718 4292 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence101 1560 1153 gene locus_tag LOCUS_13040 1560 1153 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022904.1 protein_id gnl|my_center|LOCUS_13040 2481 1726 gene locus_tag LOCUS_13050 2481 1726 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_13050 2734 2889 gene locus_tag LOCUS_13060 2734 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2919 3767 gene locus_tag LOCUS_13070 2919 3767 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_13070 4039 4221 gene locus_tag LOCUS_13080 4039 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4249 4524 gene locus_tag LOCUS_13090 4249 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4875 5192 gene locus_tag LOCUS_13100 4875 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5217 5738 gene locus_tag LOCUS_13110 5217 5738 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065210.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence102 586 44 gene locus_tag LOCUS_13120 gene rplE 586 44 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_13120 1088 768 gene locus_tag LOCUS_13130 gene rplX 1088 768 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_13130 1478 1110 gene locus_tag LOCUS_13140 gene rplN 1478 1110 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459101.1 protein_id gnl|my_center|LOCUS_13140 1840 1550 gene locus_tag LOCUS_13150 gene rpsQ 1840 1550 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_13150 2163 1948 gene locus_tag LOCUS_13160 gene rpmC 2163 1948 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_13160 2584 2153 gene locus_tag LOCUS_13170 gene rplP 2584 2153 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_13170 3240 2590 gene locus_tag LOCUS_13180 gene rpsC 3240 2590 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_13180 3604 3242 gene locus_tag LOCUS_13190 gene rplV 3604 3242 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393932.1 protein_id gnl|my_center|LOCUS_13190 3985 3701 gene locus_tag LOCUS_13200 gene rpsS 3985 3701 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_13200 4822 3998 gene locus_tag LOCUS_13210 gene rplB 4822 3998 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_13210 5175 4888 gene locus_tag LOCUS_13220 gene rplW 5175 4888 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_13220 5801 5172 gene locus_tag LOCUS_13230 gene rplD 5801 5172 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_13230 6570 5932 gene locus_tag LOCUS_13240 gene rplC 6570 5932 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_13240 6904 6584 gene locus_tag LOCUS_13250 gene rpsJ 6904 6584 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence103 346 11 gene locus_tag LOCUS_13260 346 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1171 542 gene locus_tag LOCUS_13270 1171 542 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_13270 1882 1427 gene locus_tag LOCUS_13280 1882 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2276 1866 gene locus_tag LOCUS_13290 2276 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3093 2584 gene locus_tag LOCUS_13300 3093 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3627 3397 gene locus_tag LOCUS_13310 3627 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4008 3673 gene locus_tag LOCUS_13320 4008 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 4168 4025 gene locus_tag LOCUS_13330 4168 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 4854 4708 gene locus_tag LOCUS_13340 4854 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5552 5082 gene locus_tag LOCUS_13350 5552 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6052 5657 gene locus_tag LOCUS_13360 6052 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6770 6345 gene locus_tag LOCUS_13370 6770 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence104 122 2962 gene locus_tag LOCUS_13380 gene uvrA 122 2962 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_13380 3131 4969 gene locus_tag LOCUS_13390 gene uvrC 3131 4969 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_13390 5043 5852 gene locus_tag LOCUS_13400 5043 5852 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_13400 5849 6805 gene locus_tag LOCUS_13410 5849 6805 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence105 492 301 gene locus_tag LOCUS_13420 492 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2329 1187 gene locus_tag LOCUS_13430 2329 1187 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_13430 3112 2357 gene locus_tag LOCUS_13440 3112 2357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_13440 3977 3114 gene locus_tag LOCUS_13450 3977 3114 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_13450 6410 4080 gene locus_tag LOCUS_13460 6410 4080 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence106 16 1095 gene locus_tag LOCUS_13470 gene carA 16 1095 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_13470 1099 4329 gene locus_tag LOCUS_13480 gene carB 1099 4329 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_13480 4326 5105 gene locus_tag LOCUS_13490 4326 5105 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_13490 5102 6022 gene locus_tag LOCUS_13500 5102 6022 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_13500 6041 6826 gene locus_tag LOCUS_13510 gene pyrF 6041 6826 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence107 113 823 gene locus_tag LOCUS_13520 113 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 801 2612 gene locus_tag LOCUS_13530 801 2612 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_13530 4201 2774 gene locus_tag LOCUS_13540 4201 2774 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172635924.1 protein_id gnl|my_center|LOCUS_13540 4895 4182 gene locus_tag LOCUS_13550 4895 4182 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_13550 6453 5074 gene locus_tag LOCUS_13560 6453 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence108 365 1645 gene locus_tag LOCUS_13570 gene eno 365 1645 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815650.1 protein_id gnl|my_center|LOCUS_13570 1772 2143 gene locus_tag LOCUS_13580 1772 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2307 2522 gene locus_tag LOCUS_13590 2307 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 3760 2717 gene locus_tag LOCUS_13600 3760 2717 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546725.1 protein_id gnl|my_center|LOCUS_13600 4109 4675 gene locus_tag LOCUS_13610 4109 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545718.1 protein_id gnl|my_center|LOCUS_13610 5267 4797 gene locus_tag LOCUS_13620 5267 4797 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_13620 6264 5296 gene locus_tag LOCUS_13630 6264 5296 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546038.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence109 17 283 gene locus_tag LOCUS_13640 17 283 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_13640 469 966 gene locus_tag LOCUS_13650 gene nrdR 469 966 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_13650 1035 3065 gene locus_tag LOCUS_13660 1035 3065 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963802.1 protein_id gnl|my_center|LOCUS_13660 3152 3667 gene locus_tag LOCUS_13670 gene nrdG 3152 3667 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_13670 3776 4459 gene locus_tag LOCUS_13680 3776 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391776.1 protein_id gnl|my_center|LOCUS_13680 4560 5948 gene locus_tag LOCUS_13690 4560 5948 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156272834.1 protein_id gnl|my_center|LOCUS_13690 6282 6073 gene locus_tag LOCUS_13700 6282 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence110 1464 526 gene locus_tag LOCUS_13710 1464 526 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_13710 2217 1672 gene locus_tag LOCUS_13720 gene pyrR 2217 1672 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_13720 2517 2768 gene locus_tag LOCUS_13730 2517 2768 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392529.1 protein_id gnl|my_center|LOCUS_13730 3618 2923 gene locus_tag LOCUS_13740 3618 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3883 4185 gene locus_tag LOCUS_13750 3883 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4237 4431 gene locus_tag LOCUS_13760 4237 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5871 4645 gene locus_tag LOCUS_13770 5871 4645 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790938.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence111 1191 346 gene locus_tag LOCUS_13780 1191 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1681 2184 gene locus_tag LOCUS_13790 1681 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2159 2398 gene locus_tag LOCUS_13800 2159 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2601 5729 gene locus_tag LOCUS_13810 2601 5729 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_13810 5982 5755 gene locus_tag LOCUS_13820 5982 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6209 5988 gene locus_tag LOCUS_13830 6209 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence112 185 2227 gene locus_tag LOCUS_13840 185 2227 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_13840 2214 3281 gene locus_tag LOCUS_13850 2214 3281 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_13850 3342 4220 gene locus_tag LOCUS_13860 gene rapZ 3342 4220 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_13860 4360 5190 gene locus_tag LOCUS_13870 4360 5190 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064011.1 protein_id gnl|my_center|LOCUS_13870 5260 6228 gene locus_tag LOCUS_13880 gene whiA 5260 6228 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence113 576 244 gene locus_tag LOCUS_13890 576 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1065 1535 gene locus_tag LOCUS_13900 gene spoVAC 1065 1535 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 protein_id gnl|my_center|LOCUS_13900 1593 2609 gene locus_tag LOCUS_13910 gene spoVAD 1593 2609 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_13910 2624 2983 gene locus_tag LOCUS_13920 gene spoVAE 2624 2983 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_13920 3019 3240 gene locus_tag LOCUS_13930 3019 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4217 3435 gene locus_tag LOCUS_13940 4217 3435 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_13940 6127 4214 gene locus_tag LOCUS_13950 6127 4214 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence114 167 1144 gene locus_tag LOCUS_13960 167 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3585 1210 gene locus_tag LOCUS_13970 gene lon 3585 1210 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_13970 5415 3715 gene locus_tag LOCUS_13980 gene lonB 5415 3715 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392067.1 protein_id gnl|my_center|LOCUS_13980 5758 5684 gene locus_tag LOCUS_t00260 5758 5684 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence115 251 330 gene locus_tag LOCUS_t00270 251 330 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 338 413 gene locus_tag LOCUS_t00280 338 413 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 592 666 gene locus_tag LOCUS_t00290 592 666 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1613 804 gene locus_tag LOCUS_13990 1613 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3084 1696 gene locus_tag LOCUS_14000 3084 1696 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_14000 3472 4599 gene locus_tag LOCUS_14010 3472 4599 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_14010 4919 6067 gene locus_tag LOCUS_14020 4919 6067 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence116 1201 56 gene locus_tag LOCUS_14030 1201 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1152 1322 gene locus_tag LOCUS_14040 1152 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1557 1748 gene locus_tag LOCUS_14050 1557 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 2234 2443 gene locus_tag LOCUS_14060 2234 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2440 3297 gene locus_tag LOCUS_14070 2440 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3536 4321 gene locus_tag LOCUS_14080 3536 4321 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460401.1 protein_id gnl|my_center|LOCUS_14080 4389 5207 gene locus_tag LOCUS_14090 4389 5207 CDS product Spo0B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393085.1 protein_id gnl|my_center|LOCUS_14090 5595 5371 gene locus_tag LOCUS_14100 5595 5371 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812072.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence117 21 413 gene locus_tag LOCUS_14110 21 413 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_14110 444 1580 gene locus_tag LOCUS_14120 gene nifV 444 1580 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583977.1 protein_id gnl|my_center|LOCUS_14120 1584 2864 gene locus_tag LOCUS_14130 1584 2864 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_14130 3175 3672 gene locus_tag LOCUS_14140 3175 3672 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583979.1 protein_id gnl|my_center|LOCUS_14140 3859 4857 gene locus_tag LOCUS_14150 3859 4857 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_14150 <6095 4860 gene locus_tag LOCUS_14160 <6095 4860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869220.1:phosphomannomutase/phosphoglucomutase >Feature sequence118 964 1452 gene locus_tag LOCUS_14170 964 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2282 1569 gene locus_tag LOCUS_14180 2282 1569 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066013.1 protein_id gnl|my_center|LOCUS_14180 3277 2360 gene locus_tag LOCUS_14190 3277 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5138 3684 gene locus_tag LOCUS_14200 5138 3684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_14200 5522 5367 gene locus_tag LOCUS_14210 5522 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5713 5519 gene locus_tag LOCUS_14220 5713 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence119 1668 487 gene locus_tag LOCUS_14230 gene secD 1668 487 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291172.1 protein_id gnl|my_center|LOCUS_14230 1555 1806 gene locus_tag LOCUS_14240 1555 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2462 1803 gene locus_tag LOCUS_14250 2462 1803 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_14250 2904 2620 gene locus_tag LOCUS_14260 gene yajC 2904 2620 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393195.1 protein_id gnl|my_center|LOCUS_14260 4115 2991 gene locus_tag LOCUS_14270 gene tgt 4115 2991 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_14270 5158 4274 gene locus_tag LOCUS_14280 gene ligD 5158 4274 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393573.1 protein_id gnl|my_center|LOCUS_14280 <5902 5159 gene locus_tag LOCUS_14290 <5902 5159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392997.1:non-homologous end-joining DNA ligase >Feature sequence120 319 110 gene locus_tag LOCUS_14300 319 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 820 380 gene locus_tag LOCUS_14310 820 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2361 946 gene locus_tag LOCUS_14320 gene atoC 2361 946 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125283.1 protein_id gnl|my_center|LOCUS_14320 4174 2354 gene locus_tag LOCUS_14330 gene atoS 4174 2354 CDS product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389138.1 protein_id gnl|my_center|LOCUS_14330 5475 4669 gene locus_tag LOCUS_14340 5475 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence121 225 1079 gene locus_tag LOCUS_14350 225 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1082 2065 gene locus_tag LOCUS_14360 1082 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 protein_id gnl|my_center|LOCUS_14360 2079 3011 gene locus_tag LOCUS_14370 2079 3011 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876043.1 protein_id gnl|my_center|LOCUS_14370 3221 4000 gene locus_tag LOCUS_14380 3221 4000 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227843.1 protein_id gnl|my_center|LOCUS_14380 4122 4643 gene locus_tag LOCUS_14390 gene purE 4122 4643 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence122 1069 1875 gene locus_tag LOCUS_14400 1069 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2875 1961 gene locus_tag LOCUS_14410 2875 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173196.1 protein_id gnl|my_center|LOCUS_14410 3620 2964 gene locus_tag LOCUS_14420 3620 2964 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_14420 4804 3629 gene locus_tag LOCUS_14430 4804 3629 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_14430 5000 5233 gene locus_tag LOCUS_14440 5000 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5448 5245 gene locus_tag LOCUS_14450 5448 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence123 2172 100 gene locus_tag LOCUS_14460 gene topA 2172 100 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_14460 3419 2289 gene locus_tag LOCUS_14470 gene dprA 3419 2289 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_14470 3633 4415 gene locus_tag LOCUS_14480 3633 4415 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022504.1 protein_id gnl|my_center|LOCUS_14480 4611 4829 gene locus_tag LOCUS_14490 4611 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 <5468 4826 gene locus_tag LOCUS_14500 <5468 4826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948933.1:cell wall hydrolase >Feature sequence124 165 1202 gene locus_tag LOCUS_14510 165 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1317 2015 gene locus_tag LOCUS_14520 1317 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2926 1979 gene locus_tag LOCUS_14530 2926 1979 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_14530 4339 2972 gene locus_tag LOCUS_14540 gene glmU 4339 2972 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 protein_id gnl|my_center|LOCUS_14540 4752 4489 gene locus_tag LOCUS_14550 gene spoVG 4752 4489 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421453.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence125 1421 762 gene locus_tag LOCUS_14560 1421 762 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_14560 2582 1923 gene locus_tag LOCUS_14570 2582 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 4644 2890 gene locus_tag LOCUS_14580 4644 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence126 357 1454 gene locus_tag LOCUS_14590 357 1454 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_14590 3019 1439 gene locus_tag LOCUS_14600 3019 1439 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_14600 3783 3022 gene locus_tag LOCUS_14610 3783 3022 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393414.1 protein_id gnl|my_center|LOCUS_14610 3887 4075 gene locus_tag LOCUS_14620 3887 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4214 4636 gene locus_tag LOCUS_14630 4214 4636 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076491.1 protein_id gnl|my_center|LOCUS_14630 4633 5091 gene locus_tag LOCUS_14640 gene trmL 4633 5091 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence127 <1 828 gene locus_tag LOCUS_14650 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259630.1:response regulator 853 2184 gene locus_tag LOCUS_14660 853 2184 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_14660 2197 3150 gene locus_tag LOCUS_14670 2197 3150 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_14670 3161 4081 gene locus_tag LOCUS_14680 3161 4081 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence128 908 627 gene locus_tag LOCUS_14690 908 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1945 1016 gene locus_tag LOCUS_14700 1945 1016 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_14700 2170 2448 gene locus_tag LOCUS_14710 2170 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4096 2624 gene locus_tag LOCUS_14720 gene spoIVA 4096 2624 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_14720 <5081 4473 gene locus_tag LOCUS_14730 <5081 4473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392833.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence129 376 50 gene locus_tag LOCUS_14740 376 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2070 763 gene locus_tag LOCUS_14750 2070 763 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_14750 4936 2291 gene locus_tag LOCUS_14760 4936 2291 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence130 976 2 gene locus_tag LOCUS_14770 976 2 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943556.1 protein_id gnl|my_center|LOCUS_14770 1821 1024 gene locus_tag LOCUS_14780 gene murI 1821 1024 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392055.1 protein_id gnl|my_center|LOCUS_14780 3803 1998 gene locus_tag LOCUS_14790 3803 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 <5032 3824 gene locus_tag LOCUS_14800 <5032 3824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392054.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence131 <1 925 gene locus_tag LOCUS_14810 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941696.1:methyl-accepting chemotaxis protein 2617 977 gene locus_tag LOCUS_14820 gene groL 2617 977 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_14820 2941 2660 gene locus_tag LOCUS_14830 gene groES 2941 2660 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_14830 3556 4005 gene locus_tag LOCUS_14840 3556 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4002 4481 gene locus_tag LOCUS_14850 gene nuoE 4002 4481 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence132 73 1758 gene locus_tag LOCUS_14860 gene ilvD 73 1758 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_14860 1772 3433 gene locus_tag LOCUS_14870 1772 3433 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_14870 3457 3969 gene locus_tag LOCUS_14880 gene ilvN 3457 3969 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_14880 3966 4958 gene locus_tag LOCUS_14890 gene ilvC 3966 4958 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence133 <1 2649 gene locus_tag LOCUS_14900 <1 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530065.1:cation-translocating P-type ATPase 2705 3412 gene locus_tag LOCUS_14910 2705 3412 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812980.1 protein_id gnl|my_center|LOCUS_14910 4386 3499 gene locus_tag LOCUS_14920 gene dapA 4386 3499 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence134 124 717 gene locus_tag LOCUS_14930 124 717 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392158.1 protein_id gnl|my_center|LOCUS_14930 796 1794 gene locus_tag LOCUS_14940 796 1794 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_14940 1885 3720 gene locus_tag LOCUS_14950 1885 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3671 4756 gene locus_tag LOCUS_14960 gene rpoD 3671 4756 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_14960 4811 4886 gene locus_tag LOCUS_t00300 4811 4886 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 2360 870 gene locus_tag LOCUS_14970 gene glgA 2360 870 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_14970 3399 2353 gene locus_tag LOCUS_14980 gene galT 3399 2353 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_14980 3599 4324 gene locus_tag LOCUS_14990 gene minC 3599 4324 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816782.1 protein_id gnl|my_center|LOCUS_14990 4860 4321 gene locus_tag LOCUS_15000 4860 4321 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence136 2296 1241 gene locus_tag LOCUS_15010 2296 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4700 2289 gene locus_tag LOCUS_15020 4700 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence137 1908 718 gene locus_tag LOCUS_15030 gene trpB 1908 718 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392850.1 protein_id gnl|my_center|LOCUS_15030 2567 1908 gene locus_tag LOCUS_15040 2567 1908 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392851.1 protein_id gnl|my_center|LOCUS_15040 3477 2695 gene locus_tag LOCUS_15050 gene trpC 3477 2695 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_15050 4492 3470 gene locus_tag LOCUS_15060 gene trpD 4492 3470 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence138 1805 345 gene locus_tag LOCUS_15070 1805 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533628.1 protein_id gnl|my_center|LOCUS_15070 2021 2545 gene locus_tag LOCUS_15080 2021 2545 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_15080 2617 3765 gene locus_tag LOCUS_15090 2617 3765 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_15090 <4606 3809 gene locus_tag LOCUS_15100 <4606 3809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546236.1:DUF763 domain-containing protein >Feature sequence139 2534 2046 gene locus_tag LOCUS_15110 2534 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3602 2694 gene locus_tag LOCUS_15120 gene gvpN 3602 2694 CDS product gas vesicle protein GvpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890517.1 protein_id gnl|my_center|LOCUS_15120 3893 3615 gene locus_tag LOCUS_15130 3893 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4133 4441 gene locus_tag LOCUS_15140 4133 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence140 782 126 gene locus_tag LOCUS_15150 782 126 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200392305.1 protein_id gnl|my_center|LOCUS_15150 1710 1213 gene locus_tag LOCUS_15160 1710 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3328 2108 gene locus_tag LOCUS_15170 3328 2108 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_15170 <4549 3409 gene locus_tag LOCUS_15180 <4549 3409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393062.1:type IV pilus twitching motility protein PilT >Feature sequence141 1432 71 gene locus_tag LOCUS_15190 1432 71 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_15190 2120 1413 gene locus_tag LOCUS_15200 2120 1413 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_15200 2896 2123 gene locus_tag LOCUS_15210 gene pgeF 2896 2123 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_15210 <4522 3077 gene locus_tag LOCUS_15220 <4522 3077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392701.1:MBL fold metallo-hydrolase >Feature sequence142 413 544 gene locus_tag LOCUS_15230 413 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 957 1505 gene locus_tag LOCUS_15240 957 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1498 2970 gene locus_tag LOCUS_15250 1498 2970 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392591.1 protein_id gnl|my_center|LOCUS_15250 3120 4376 gene locus_tag LOCUS_15260 3120 4376 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence143 150 836 gene locus_tag LOCUS_15270 150 836 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294610.1 protein_id gnl|my_center|LOCUS_15270 968 1318 gene locus_tag LOCUS_15280 968 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1483 3141 gene locus_tag LOCUS_15290 1483 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3535 3230 gene locus_tag LOCUS_15300 3535 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4007 4345 gene locus_tag LOCUS_15310 4007 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence144 <1 907 gene locus_tag LOCUS_15320 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012615304.1:DNA polymerase III subunit beta 927 2021 gene locus_tag LOCUS_15330 gene recF 927 2021 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662310.1 protein_id gnl|my_center|LOCUS_15330 2136 2387 gene locus_tag LOCUS_15340 2136 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2494 4401 gene locus_tag LOCUS_15350 gene gyrB 2494 4401 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence145 310 1206 gene locus_tag LOCUS_15360 310 1206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542058.1 protein_id gnl|my_center|LOCUS_15360 2192 1263 gene locus_tag LOCUS_15370 gene cbiQ 2192 1263 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393362.1 protein_id gnl|my_center|LOCUS_15370 2288 2911 gene locus_tag LOCUS_15380 2288 2911 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_15380 2919 3245 gene locus_tag LOCUS_15390 2919 3245 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877314.1 protein_id gnl|my_center|LOCUS_15390 <4400 3246 gene locus_tag LOCUS_15400 <4400 3246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392405.1:NFACT RNA binding domain-containing protein >Feature sequence146 2150 24 gene locus_tag LOCUS_15410 2150 24 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_15410 3124 2156 gene locus_tag LOCUS_15420 3124 2156 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392130.1 protein_id gnl|my_center|LOCUS_15420 4346 3144 gene locus_tag LOCUS_15430 gene yqfD 4346 3144 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence147 80 2437 gene locus_tag LOCUS_15440 gene hdrA2 80 2437 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_15440 2434 3408 gene locus_tag LOCUS_15450 2434 3408 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence148 2362 491 gene locus_tag LOCUS_15460 gene nuoF 2362 491 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_15460 2822 2355 gene locus_tag LOCUS_15470 gene nuoE 2822 2355 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_15470 3585 2806 gene locus_tag LOCUS_15480 3585 2806 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392718.1 protein_id gnl|my_center|LOCUS_15480 4251 3889 gene locus_tag LOCUS_15490 4251 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence149 537 2405 gene locus_tag LOCUS_15500 537 2405 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 protein_id gnl|my_center|LOCUS_15500 2531 3022 gene locus_tag LOCUS_15510 2531 3022 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393623.1 protein_id gnl|my_center|LOCUS_15510 3078 3986 gene locus_tag LOCUS_15520 3078 3986 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943779.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence150 227 757 gene locus_tag LOCUS_15530 227 757 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_15530 983 1207 gene locus_tag LOCUS_15540 983 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1330 3507 gene locus_tag LOCUS_15550 1330 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence151 867 1538 gene locus_tag LOCUS_15560 gene ccsB 867 1538 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence152 78 3 gene locus_tag LOCUS_t00310 78 3 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1698 145 gene locus_tag LOCUS_15570 gene guaA 1698 145 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_15570 2227 1685 gene locus_tag LOCUS_15580 gene hpt 2227 1685 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_15580 3256 2492 gene locus_tag LOCUS_15590 3256 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence153 88 1173 gene locus_tag LOCUS_15600 gene hisC 88 1173 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_15600 1195 2211 gene locus_tag LOCUS_15610 gene aroF 1195 2211 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_15610 2211 3050 gene locus_tag LOCUS_15620 gene pheA 2211 3050 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_15620 3044 4141 gene locus_tag LOCUS_15630 3044 4141 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence154 3 78 gene locus_tag LOCUS_t00320 3 78 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence155 479 1612 gene locus_tag LOCUS_15640 479 1612 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_15640 1616 3331 gene locus_tag LOCUS_15650 1616 3331 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_15650 3346 4002 gene locus_tag LOCUS_15660 gene cybH 3346 4002 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence156 38 673 gene locus_tag LOCUS_15670 38 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1310 651 gene locus_tag LOCUS_15680 1310 651 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_15680 2542 1400 gene locus_tag LOCUS_15690 2542 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3254 2556 gene locus_tag LOCUS_15700 gene sigI 3254 2556 CDS product RNA polymerase sigma-I factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272269.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence157 1039 74 gene locus_tag LOCUS_15710 gene murB 1039 74 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_15710 2543 1170 gene locus_tag LOCUS_15720 gene murC 2543 1170 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_15720 3785 2652 gene locus_tag LOCUS_15730 gene murG 3785 2652 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence158 626 1705 gene locus_tag LOCUS_15740 gene ychF 626 1705 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_15740 2061 3422 gene locus_tag LOCUS_15750 gene sat 2061 3422 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064439.1 protein_id gnl|my_center|LOCUS_15750 3438 3794 gene locus_tag LOCUS_15760 3438 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064720.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence159 67 249 gene locus_tag LOCUS_15770 67 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1441 311 gene locus_tag LOCUS_15780 gene fbp 1441 311 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_15780 1642 1866 gene locus_tag LOCUS_15790 1642 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1962 2099 gene locus_tag LOCUS_15800 1962 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2283 2140 gene locus_tag LOCUS_15810 2283 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2453 2608 gene locus_tag LOCUS_15820 2453 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2739 3119 gene locus_tag LOCUS_15830 2739 3119 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545480.1 protein_id gnl|my_center|LOCUS_15830 3435 3989 gene locus_tag LOCUS_15840 3435 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence160 135 350 gene locus_tag LOCUS_15850 135 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 651 382 gene locus_tag LOCUS_15860 651 382 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_15860 2332 1007 gene locus_tag LOCUS_15870 gene der 2332 1007 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_15870 3847 2558 gene locus_tag LOCUS_15880 3847 2558 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence161 611 1081 gene locus_tag LOCUS_15890 611 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1065 2081 gene locus_tag LOCUS_15900 1065 2081 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_15900 2081 2863 gene locus_tag LOCUS_15910 2081 2863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_15910 3243 3031 gene locus_tag LOCUS_15920 3243 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence162 217 3048 gene locus_tag LOCUS_15930 gene purL 217 3048 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259203.1 protein_id gnl|my_center|LOCUS_15930 3045 3815 gene locus_tag LOCUS_15940 gene purQ 3045 3815 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence163 41 2437 gene locus_tag LOCUS_15950 gene pheT 41 2437 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_15950 2597 2857 gene locus_tag LOCUS_15960 2597 2857 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393250.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence164 483 19 gene locus_tag LOCUS_15970 gene ribE 483 19 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_15970 1754 522 gene locus_tag LOCUS_15980 1754 522 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_15980 2410 1769 gene locus_tag LOCUS_15990 2410 1769 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_15990 3534 2395 gene locus_tag LOCUS_16000 gene ribD 3534 2395 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence165 1603 404 gene locus_tag LOCUS_16010 1603 404 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_16010 1721 1855 gene locus_tag LOCUS_16020 1721 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 3567 1945 gene locus_tag LOCUS_16030 3567 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence166 1687 1100 gene locus_tag LOCUS_16040 1687 1100 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_16040 2353 1694 gene locus_tag LOCUS_16050 gene cmk 2353 1694 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_16050 <3743 2472 gene locus_tag LOCUS_16060 <3743 2472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392845.1:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence167 1352 414 gene locus_tag LOCUS_16070 gene argF 1352 414 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_16070 2652 1420 gene locus_tag LOCUS_16080 2652 1420 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_16080 3664 2777 gene locus_tag LOCUS_16090 gene argB 3664 2777 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence168 173 1183 gene locus_tag LOCUS_16100 gene amrS 173 1183 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393777.1 protein_id gnl|my_center|LOCUS_16100 1318 2358 gene locus_tag LOCUS_16110 gene argC 1318 2358 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_16110 2480 3676 gene locus_tag LOCUS_16120 gene argJ 2480 3676 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence169 45 569 gene locus_tag LOCUS_16130 45 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 575 1873 gene locus_tag LOCUS_16140 gene obgE 575 1873 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_16140 1870 2994 gene locus_tag LOCUS_16150 gene proB 1870 2994 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence170 2453 1740 gene locus_tag LOCUS_16160 2453 1740 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_16160 3612 2539 gene locus_tag LOCUS_16170 gene rlmN 3612 2539 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence171 1950 1246 gene locus_tag LOCUS_16180 1950 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3575 2115 gene locus_tag LOCUS_16190 3575 2115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583190.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence172 71 340 gene locus_tag LOCUS_16200 71 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 477 1364 gene locus_tag LOCUS_16210 gene xerD 477 1364 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_16210 1543 2724 gene locus_tag LOCUS_16220 1543 2724 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence173 33 566 gene locus_tag LOCUS_16230 33 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 571 960 gene locus_tag LOCUS_16240 571 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 972 1880 gene locus_tag LOCUS_16250 972 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1917 2201 gene locus_tag LOCUS_16260 1917 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2289 3056 gene locus_tag LOCUS_16270 2289 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence174 200 736 gene locus_tag LOCUS_16280 200 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 957 808 gene locus_tag LOCUS_16290 957 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1206 1547 gene locus_tag LOCUS_16300 1206 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1785 1591 gene locus_tag LOCUS_16310 1785 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2006 2248 gene locus_tag LOCUS_16320 2006 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2614 2396 gene locus_tag LOCUS_16330 2614 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2800 3480 gene locus_tag LOCUS_16340 2800 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence175 1465 704 gene locus_tag LOCUS_16350 gene tpiA 1465 704 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_16350 2768 1587 gene locus_tag LOCUS_16360 2768 1587 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_16360 <3529 2969 gene locus_tag LOCUS_16370 <3529 2969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391806.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence176 <1 1104 gene locus_tag LOCUS_16380 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986841.1:glycosyltransferase family 87 protein 1964 1158 gene locus_tag LOCUS_16390 1964 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2181 2399 gene locus_tag LOCUS_16400 2181 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2797 3267 gene locus_tag LOCUS_16410 2797 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence177 1782 715 gene locus_tag LOCUS_16420 gene prfA 1782 715 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_16420 2656 1757 gene locus_tag LOCUS_16430 2656 1757 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_16430 3045 2848 gene locus_tag LOCUS_16440 gene rpmE 3045 2848 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393876.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence178 1179 22 gene locus_tag LOCUS_16450 gene purM 1179 22 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_16450 2620 1196 gene locus_tag LOCUS_16460 gene purF 2620 1196 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_16460 3332 2622 gene locus_tag LOCUS_16470 3332 2622 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393547.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence179 948 2108 gene locus_tag LOCUS_16480 948 2108 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_16480 3161 2262 gene locus_tag LOCUS_16490 3161 2262 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence180 1714 1103 gene locus_tag LOCUS_16500 1714 1103 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_16500 1981 2748 gene locus_tag LOCUS_16510 1981 2748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence181 1476 2189 gene locus_tag LOCUS_16520 1476 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2567 2202 gene locus_tag LOCUS_16530 2567 2202 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_16530 3274 2567 gene locus_tag LOCUS_16540 3274 2567 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence182 398 1594 gene locus_tag LOCUS_16550 398 1594 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_16550 1597 2037 gene locus_tag LOCUS_16560 1597 2037 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_16560 2124 2519 gene locus_tag LOCUS_16570 2124 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence183 294 100 gene locus_tag LOCUS_16580 294 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 380 1078 gene locus_tag LOCUS_16590 gene fdhD 380 1078 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802665.1 protein_id gnl|my_center|LOCUS_16590 2970 1471 gene locus_tag LOCUS_16600 2970 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence184 562 437 gene locus_tag LOCUS_16610 562 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 894 646 gene locus_tag LOCUS_16620 894 646 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_16620 1268 1149 gene locus_tag LOCUS_16630 1268 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1860 1567 gene locus_tag LOCUS_16640 1860 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2400 2170 gene locus_tag LOCUS_16650 2400 2170 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393299.1 protein_id gnl|my_center|LOCUS_16650 2858 2505 gene locus_tag LOCUS_16660 2858 2505 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062280560.1 protein_id gnl|my_center|LOCUS_16660 3171 2851 gene locus_tag LOCUS_16670 3171 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393803.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence185 2321 1614 gene locus_tag LOCUS_16680 2321 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2606 3346 gene locus_tag LOCUS_16690 2606 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence186 1180 5 gene locus_tag LOCUS_16700 gene nifS 1180 5 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_16700 2206 1199 gene locus_tag LOCUS_16710 gene nadA 2206 1199 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_16710 2660 2187 gene locus_tag LOCUS_16720 2660 2187 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_16720 3115 2666 gene locus_tag LOCUS_16730 3115 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence187 656 78 gene locus_tag LOCUS_16740 656 78 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545712.1 protein_id gnl|my_center|LOCUS_16740 2075 669 gene locus_tag LOCUS_16750 2075 669 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359027.1 protein_id gnl|my_center|LOCUS_16750 3243 2251 gene locus_tag LOCUS_16760 3243 2251 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459323.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence188 135 260 gene locus_tag LOCUS_16770 135 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 282 533 gene locus_tag LOCUS_16780 282 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 547 711 gene locus_tag LOCUS_16790 547 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1381 2127 gene locus_tag LOCUS_16800 1381 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3255 2167 gene locus_tag LOCUS_16810 3255 2167 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence189 2029 3279 gene locus_tag LOCUS_16820 2029 3279 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246276.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence190 64 1485 gene locus_tag LOCUS_16830 64 1485 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_16830 1809 3230 gene locus_tag LOCUS_16840 gene glnA 1809 3230 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence191 1468 182 gene locus_tag LOCUS_16850 1468 182 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_16850 1874 1533 gene locus_tag LOCUS_16860 1874 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2158 1970 gene locus_tag LOCUS_16870 2158 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2178 3110 gene locus_tag LOCUS_16880 2178 3110 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393326.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence192 2226 1027 gene locus_tag LOCUS_16890 gene nifS 2226 1027 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_16890 2962 2621 gene locus_tag LOCUS_16900 2962 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence193 <1 1304 gene locus_tag LOCUS_16910 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272549.1:diguanylate cyclase 1768 1415 gene locus_tag LOCUS_16920 1768 1415 CDS product DUF2512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966623.1 protein_id gnl|my_center|LOCUS_16920 1885 2199 gene locus_tag LOCUS_16930 1885 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16930 2329 3108 gene locus_tag LOCUS_16940 2329 3108 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence194 311 108 gene locus_tag LOCUS_16950 311 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 582 355 gene locus_tag LOCUS_16960 582 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 910 1278 gene locus_tag LOCUS_16970 910 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1445 3115 gene locus_tag LOCUS_16980 gene mrdA 1445 3115 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence195 <1 2223 gene locus_tag LOCUS_16990 <1 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393212.1:PBP1A family penicillin-binding protein >Feature sequence196 17 1552 gene locus_tag LOCUS_17000 gene purH 17 1552 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_17000 1786 3045 gene locus_tag LOCUS_17010 gene purD 1786 3045 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence197 360 166 gene locus_tag LOCUS_17020 360 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 576 364 gene locus_tag LOCUS_17030 576 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 920 729 gene locus_tag LOCUS_17040 gene rpmB 920 729 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_17040 2110 1097 gene locus_tag LOCUS_17050 2110 1097 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393244.1 protein_id gnl|my_center|LOCUS_17050 <3069 2116 gene locus_tag LOCUS_17060 <3069 2116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393243.1:acyl-CoA dehydratase activase-related protein >Feature sequence198 <1 1165 gene locus_tag LOCUS_17070 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392758.1:glutamate-1-semialdehyde 2,1-aminomutase 1205 1555 gene locus_tag LOCUS_17080 1205 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2303 1626 gene locus_tag LOCUS_17090 2303 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2456 2983 gene locus_tag LOCUS_17100 2456 2983 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392537.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence199 1095 73 gene locus_tag LOCUS_17110 gene tsaD 1095 73 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_17110 1589 1092 gene locus_tag LOCUS_17120 gene rimI 1589 1092 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_17120 2272 1586 gene locus_tag LOCUS_17130 gene tsaB 2272 1586 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_17130 2738 2250 gene locus_tag LOCUS_17140 gene tsaE 2738 2250 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence200 346 119 gene locus_tag LOCUS_17150 346 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2668 599 gene locus_tag LOCUS_17160 gene recG 2668 599 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence201 592 41 gene locus_tag LOCUS_17170 592 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1068 574 gene locus_tag LOCUS_17180 1068 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1380 1147 gene locus_tag LOCUS_17190 1380 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2152 1385 gene locus_tag LOCUS_17200 gene atpB 2152 1385 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_17200 <2973 2428 gene locus_tag LOCUS_17210 <2973 2428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141968.1:serpin family protein >Feature sequence202 <1 534 gene locus_tag LOCUS_17220 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460653.1:orotate phosphoribosyltransferase 2852 570 gene locus_tag LOCUS_17230 2852 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence203 <1 682 gene locus_tag LOCUS_17240 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966431.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB 660 1184 gene locus_tag LOCUS_17250 660 1184 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393957.1 protein_id gnl|my_center|LOCUS_17250 1266 1913 gene locus_tag LOCUS_17260 gene sigH 1266 1913 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_17260 2328 1918 gene locus_tag LOCUS_17270 2328 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2367 2633 gene locus_tag LOCUS_17280 2367 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence204 864 415 gene locus_tag LOCUS_17290 864 415 CDS product DUF3189 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392838.1 protein_id gnl|my_center|LOCUS_17290 2034 865 gene locus_tag LOCUS_17300 2034 865 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392839.1 protein_id gnl|my_center|LOCUS_17300 2746 2024 gene locus_tag LOCUS_17310 2746 2024 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392840.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence205 1660 992 gene locus_tag LOCUS_17320 1660 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2510 1878 gene locus_tag LOCUS_17330 2510 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence206 910 29 gene locus_tag LOCUS_17340 gene ilvE 910 29 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_17340 1299 1147 gene locus_tag LOCUS_17350 1299 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2221 1487 gene locus_tag LOCUS_17360 2221 1487 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_17360 2311 2502 gene locus_tag LOCUS_17370 2311 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence207 1050 64 gene locus_tag LOCUS_17380 gene mraY 1050 64 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460699.1 protein_id gnl|my_center|LOCUS_17380 2429 1047 gene locus_tag LOCUS_17390 2429 1047 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence208 93 329 gene locus_tag LOCUS_17400 93 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 326 685 gene locus_tag LOCUS_17410 326 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1759 770 gene locus_tag LOCUS_17420 1759 770 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_17420 2756 1734 gene locus_tag LOCUS_17430 2756 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence209 670 365 gene locus_tag LOCUS_17440 670 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2226 727 gene locus_tag LOCUS_17450 gene thrC 2226 727 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986278.1 protein_id gnl|my_center|LOCUS_17450 2691 2356 gene locus_tag LOCUS_17460 2691 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence210 >Feature sequence211 2652 97 gene locus_tag LOCUS_17470 2652 97 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence212 267 1484 gene locus_tag LOCUS_17480 gene tyrS 267 1484 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_17480 1602 2255 gene locus_tag LOCUS_17490 gene yunB 1602 2255 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence213 1330 389 gene locus_tag LOCUS_17500 1330 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence214 1249 1482 gene locus_tag LOCUS_17510 1249 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1955 1524 gene locus_tag LOCUS_17520 1955 1524 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582921.1 protein_id gnl|my_center|LOCUS_17520 2451 1948 gene locus_tag LOCUS_17530 2451 1948 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393832.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence215 193 924 gene locus_tag LOCUS_17540 193 924 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_17540 996 1460 gene locus_tag LOCUS_17550 996 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811083.1 protein_id gnl|my_center|LOCUS_17550 1540 1875 gene locus_tag LOCUS_17560 gene aroH 1540 1875 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_17560 <2558 1872 gene locus_tag LOCUS_17570 <2558 1872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392058.1:CBS domain-containing protein >Feature sequence216 102 1145 gene locus_tag LOCUS_17580 gene pilM 102 1145 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887416.1 protein_id gnl|my_center|LOCUS_17580 1145 1774 gene locus_tag LOCUS_17590 1145 1774 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393053.1 protein_id gnl|my_center|LOCUS_17590