COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..39937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1068..1235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1371..1598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1671..2408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2490..3140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(3137..3370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(3446..4060) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene radC CDS complement(4169..4348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(4761..4976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 4933..5136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 5156..5338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(5368..5910) product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(6062..6496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 6608..6826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 7104..7304 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113932710.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 7301..9301 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 9311..10393 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 10393..11076 product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 11073..13859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 13909..16566 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484637.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 16578..17819 product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(17855..18259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(18287..18724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(18777..18971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(19103..20101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(20230..21684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(21774..22205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(22202..22759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(22756..24348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(24345..25247) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 25464..25760 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 25757..26248 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 26296..26598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 26603..27442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(27559..28443) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 28535..29011 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 29050..29358 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(29370..30773) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 30905..31408 product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 31833..32201 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187552.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 32201..32794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 32851..33198 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114600.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(33406..33942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(34058..34498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(34758..34940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(34990..35397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(35694..35921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 36356..37396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(37567..38319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 38526..39689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 sequence002 source 1..39714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(838..1524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 note possible pseudo, frameshifted CDS complement(1470..1775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 note possible pseudo, frameshifted CDS complement(2244..2891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(2907..3572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(3767..4042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 4041..4604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 4934..5671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 5715..6566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 7038..7922 product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(7991..11083) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544913.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(11312..12769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(12762..13598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 13819..15231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 15225..15875 product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 15868..19368 product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 19365..20540 product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 20574..21086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(21107..21256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(21432..22904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 23167..24573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(24588..25592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(25845..26054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(26051..26266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 26904..27071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 27315..30107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(30104..30703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 30932..31279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 tRNA complement(31807..31891) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(31948..33198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(33296..34534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(34824..35783) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 35995..36660 product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 36670..37275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 37411..38991 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 39043..39474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 sequence003 source 1..29640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..545 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002213540.1:IMP dehydrogenase locus_tag LOCUS_00850 CDS 630..956 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 963..2525 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene guaA CDS 2889..4085 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(4072..4320) product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(4457..5158) product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007251563.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(5158..7227) product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene traD CDS complement(7224..9404) product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088056948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene mobH CDS 9742..11637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 11634..13160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 13163..18568 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148619099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(18571..20598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(20598..22955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(23016..23858) product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(23851..24783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(24698..27181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 note possible pseudo, frameshifted CDS complement(27174..28100) product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 28536..28985 product type III secretion system invasion protein IagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097340.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene iagB CDS 28985..29275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 sequence004 source 1..20922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1258..1797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(2714..3124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(3078..3878) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 4660..4887 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006870829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 4880..5185 product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 5182..6330 product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027224428.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 6423..7886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 8009..8161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 8383..8772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(8871..9089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 9029..10126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 10260..10646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 10660..11025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 11127..11981 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(11946..12950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 13220..14230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(14369..15403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 15505..15849 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(15794..16117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 16248..16622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 16770..17144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 17252..19348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(19328..19495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(19470..19697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(19754..20293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(20409..20720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 sequence005 source 1..20244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..800 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198406157.1:iron ABC transporter permease locus_tag LOCUS_01300 CDS complement(1654..1884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 1906..2904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 2901..4424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 4424..9823 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148619099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 9859..11691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(11763..12602) product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(12595..15927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(15924..16850) product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(17048..18079) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 18256..18750 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(18761..19462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(19431..19940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 sequence006 source 1..18596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 622..1053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(1242..2177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(2343..4571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(4575..4955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(5314..5517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(6038..6175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 6307..8331 product FxsB family radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 8913..9332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 9424..9795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(9813..9992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 10331..11431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(11463..12914) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(12922..13368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 13643..14242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(15255..15845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(15915..16142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 16520..17257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 17307..17567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 17614..18051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(18101..18436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 sequence007 source 1..18338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..1468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(1520..4135) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(4296..5213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 5375..5947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 5944..7335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 7319..8509 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 8484..9155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(9162..10079) product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394832.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 10588..12276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(12718..13887) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(14261..15424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 tRNA complement(15596..15672) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(15822..16502) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(16597..17811) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene mnmA sequence008 source 1..16279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(357..677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(702..1187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(1184..1972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(2406..3242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142031.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(3239..3778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(3775..6867) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(6867..8669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(8669..9958) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(10018..10386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 10528..11190 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258297.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(11202..12089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(12133..12393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 12632..13045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(13102..13308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(13409..13801) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939394.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene cueR CDS 13987..14628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 14679..16007 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 sequence009 source 1..16157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..1164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 1161..1400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(1588..2757) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 3130..4107 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 4197..5282 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021199.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 5426..5608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(5730..6632) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667661.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene fsa CDS complement(6681..7211) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene gmhB CDS complement(7208..7774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 note possible pseudo, frameshifted CDS complement(7765..8721) product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(8769..9473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(9470..10414) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(10411..11259) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(11272..12252) product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene rfaE1 CDS complement(12267..12518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(12515..13183) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 13235..13717 product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 13722..14132 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 14134..14697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 14829..15233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(15234..15890) product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 sequence010 source 1..13580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1229..1432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(1429..1698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(1805..2341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(2635..3285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(3282..3518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(3594..4208) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053959.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene radC CDS complement(4320..4523) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(4516..4758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(4824..5048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(5683..5901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(5999..6400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(6841..7392) product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 7471..7713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(7856..8320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(8449..8595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(8608..8877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(9413..9622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(9622..9909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(9906..10238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(10240..10596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(10608..11003) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(11044..11469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(11861..12850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 sequence011 source 1..12885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(16..150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 664..1230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 1238..1930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 1927..2184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 2305..2730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(2797..3114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(3101..3466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 3398..3607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 3601..3924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(3869..4216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 4319..5353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(6228..8141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(8532..8957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(8957..9763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(9764..9973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(10153..10746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(10752..11162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(11209..12069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(12062..12643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 sequence012 source 1..12252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1637..4561 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(4636..4953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 5246..6307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 6399..6710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 6872..7996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(8083..10002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 tRNA complement(10112..10185) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(10301..12103) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 sequence013 source 1..11532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..1118) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268129.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 1390..2118 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene phnF CDS 2169..3116 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 3183..3977 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene phnC CDS 3985..5007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 5079..5558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 5551..6126 product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene phnH CDS 6126..7250 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 7247..8143 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 8140..8970 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 8981..9703 product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene phnL CDS 9700..10854 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 10866..11432 product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194016.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene phnN sequence014 source 1..10139 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1019..2131) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(2158..3288) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(3290..4186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(4197..5492) product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064482.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(5578..7278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(7611..8066) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 sequence015 source 1..9327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 296..718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 851..1009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 1348..2040 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 2204..2380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 2377..3531 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 3544..4776 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 4792..5913 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 5958..6923 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 7234..8448 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 8777..9085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 tRNA complement(9210..9285) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 sequence016 source 1..9259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..2124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 2929..7077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 7232..7567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 7663..8145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 8535..8927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 sequence017 source 1..8900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 838..2607 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(2742..7952) product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 sequence018 source 1..7856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(547..1944) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224018.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(1950..2666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 2895..3203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 3200..4135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 4268..5161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 5171..5407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(5589..6089) product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 6103..6750 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene nth CDS complement(6772..7338) product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762644.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 sequence019 source 1..7836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 642..1295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 1398..1649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 1741..3369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 3486..3719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 3738..4013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 4533..4898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 5014..6249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 6798..7247 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(7338..7835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 sequence020 source 1..7817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(539..913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 984..2297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 2381..2977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(2992..3750) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(4045..4296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 4877..5497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(5507..5983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(6115..6753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 6820..7728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 sequence021 source 1..7558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..440) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(494..766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(793..1200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 1778..2119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 2274..2846 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 2843..2974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(3344..4183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 4291..4638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 4971..5426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 5416..5973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 5973..6278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 6294..6506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 6503..6928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 sequence022 source 1..6882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..1782 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(2139..3167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(3203..4030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(4296..4709) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(5240..6691) product SEFIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 sequence023 source 1..6584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 454..2010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(2524..4296) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 4427..4648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 4687..6513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 sequence024 source 1..6407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 67..939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 932..1342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 2733..3059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 3605..3994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(4598..5005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(5002..5196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 sequence025 source 1..6392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 455..778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(831..1454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(1451..1957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(2417..2761) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 2853..3887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(4093..4389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(4553..5401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 5479..5787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 sequence026 source 1..6340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 718..3879 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 3903..4937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(5216..5605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 sequence027 source 1..6268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 465..809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(974..1300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 1749..5156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 5166..6128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 sequence028 source 1..6166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 699..1535 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 1539..3113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(3110..4042) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462872.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(4061..5401) product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 5582..6076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 sequence029 source 1..6133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 654..3194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(3570..4130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(4146..4391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(4700..5446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 sequence030 source 1..5881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 659..883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 880..3759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(3766..5400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 sequence031 source 1..5814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..343) product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250273.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene rpl18a CDS complement(354..1016) product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(1029..1283) product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(1292..1447) product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(1449..1790) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(1783..2229) product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(2406..2717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(2707..3414) product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 3313..3966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 3977..4645 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941515.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(4689..5126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(5111..5359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 sequence032 source 1..5785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(430..672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(687..1640) product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(1637..3097) product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(3145..3363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(3381..4010) product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene parA CDS complement(4102..4734) product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene mobC CDS 5057..5431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 sequence033 source 1..5758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(606..2783) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene katG CDS complement(2860..3339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(3444..3902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(3924..4133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(4138..4608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(4733..4999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(5088..5273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 sequence034 source 1..5722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1017..1469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(1535..2044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(2208..2429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(2533..3075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(3619..3915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(4539..4922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 sequence035 source 1..5643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..442 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968496.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 704..2212 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(2381..2878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 3175..3720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 4354..4665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 sequence036 source 1..5594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..770) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 1720..2079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 2183..2365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(2379..3182) product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(3179..4435) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 sequence037 source 1..5582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..431) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(431..757) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 861..1064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(1183..2118) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 2387..3337 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268129.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 3574..4098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 4100..4693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(4758..5054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(5205..5543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 sequence038 source 1..5570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..712 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259194.1:2-dehydropantoate 2-reductase locus_tag LOCUS_04360 CDS 1328..1579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 1659..1838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 2099..3181 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321414.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(3205..3867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 3755..4171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 tRNA complement(4794..4889) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 sequence039 source 1..5539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1390..2001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 2046..2720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 sequence040 source 1..5397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206681.1:chromate efflux transporter locus_tag LOCUS_04440 CDS 1063..1548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(1618..1815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 1974..4481 product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187006353.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 4573..5199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 sequence041 source 1..5393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 373..5250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 sequence042 source 1..5380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1661..2005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(1977..2207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(2315..3625) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868644.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 sequence043 source 1..5316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..1303) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(1307..1588) product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876898.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(1563..1949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 note possible pseudo, frameshifted CDS complement(1925..2206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 note possible pseudo, frameshifted CDS 2959..3822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(3778..4785) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 sequence044 source 1..5215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..825 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037390999.1:DMT family transporter locus_tag LOCUS_04590 CDS 888..2171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 2178..5174 product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153164114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 sequence045 source 1..5165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(396..1244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 1255..1458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(1774..2466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(2876..3079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(3459..4109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 repeat_region 4212..5163 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatccctttcaaatcagggcattcttgaatc sequence046 source 1..5147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(591..1934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(2370..4838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 sequence047 source 1..5030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(983..1345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(1345..1644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(1646..1951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(1953..2270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 2429..2629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(2571..2873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(2905..3423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(3626..4576) product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 sequence048 source 1..4948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(266..508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(587..970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(948..1382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 1451..2602 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 2641..3369 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 3411..4316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 4317..4793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 sequence049 source 1..4919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..1050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 1284..1892 product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054659530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 2118..2678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 2729..3334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 3602..3832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 4002..4367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 sequence050 source 1..4865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(933..1988) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene trpD CDS complement(1990..3513) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene trpE CDS 3656..4042 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 4039..4218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 misc_feature complement(4236..>4865) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021413.1:amino acid-binding protein locus_tag LOCUS_04960 sequence051 source 1..4839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 4..1132 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccacgcgcattcacgcgtggagac CDS complement(1177..1344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(1351..1641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(1641..3302) product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene cas1 CDS 3564..4013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 4121..4324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 sequence052 source 1..4827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1017 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250274.1:glycosyltransferase family 4 protein locus_tag LOCUS_05020 CDS 992..1720 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 1717..2709 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 2797..3855 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583970.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 misc_feature complement(3852..>4827) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583970.1:glycosyltransferase family 4 protein locus_tag LOCUS_05060 sequence053 source 1..4804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(893..1834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(1878..2456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(2788..3471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(3535..4086) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(4118..4318) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(4302..4715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 sequence054 source 1..4717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1515 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000384831.1:class I SAM-dependent DNA methyltransferase locus_tag LOCUS_05130 CDS 1728..3377 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(3693..4232) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 sequence055 source 1..4694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1106..2092) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene ilvC CDS complement(2144..2632) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene ilvN CDS complement(2641..4320) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 sequence056 source 1..4674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..539 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 553..1338 product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 tRNA 1389..1476 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 1614..1811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 1798..2082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 2327..3334 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 3412..3999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 note possible pseudo, internal stop codon CDS 4003..4563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 note possible pseudo, internal stop codon sequence057 source 1..4575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(159..332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(325..792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(792..1511) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(1511..4459) product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 sequence058 source 1..4449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(444..1652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(1670..1894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(1906..3243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(3559..3879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(3834..4094) product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 sequence059 source 1..4342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(585..1070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(2182..2469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(2771..3022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 note possible pseudo, frameshifted CDS complement(3094..3381) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(3378..3644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 sequence060 source 1..4294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..797 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942084.1:M48 family metallopeptidase locus_tag LOCUS_05410 CDS complement(1745..2302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(2409..2621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(2716..2943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(2955..3491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(3588..4085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 sequence061 source 1..4256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 1116..1316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(1421..1897) product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene cadR CDS 2066..2626 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 2743..3114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 3269..3619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 sequence062 source 1..4251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 1533..3302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 3318..4001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 sequence063 source 1..4243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 112..366 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 363..785 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 922..1287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 1390..2562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 sequence064 source 1..4237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1146..1478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 1365..4127 product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 sequence065 source 1..4203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 227..568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 662..1027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 1090..1401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 1670..1885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 1953..2468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 2930..3646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 3947..4090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 sequence066 source 1..4165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 894..1148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 1145..2266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 2271..2528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 2536..3189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 3186..3782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 3776..4009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 sequence067 source 1..4119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(845..1339) product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 1406..2530 product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 2601..3194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 3191..3604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(3763..4119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 sequence068 source 1..4045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 488..928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 1228..1659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 1656..1910 product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 1921..3015 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 3022..3324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 3321..3479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 sequence069 source 1..4029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 578..946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 1077..1799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(1743..1967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(2524..2688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 2997..3233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 3420..3944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 sequence070 source 1..3991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 680..1270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 1405..2019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 2123..3034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 3111..3701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 sequence071 source 1..3984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1996..2721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(2731..3963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 sequence072 source 1..3977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(27..428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(710..1102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 1446..2600 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 misc_feature complement(2778..>3977) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065226.1:replication factor C large subunit locus_tag LOCUS_06030 sequence073 source 1..3905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1483 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052292216.1:radical SAM protein locus_tag LOCUS_06040 CDS 1497..1805 product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 1828..2433 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(2476..2886) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(2883..3137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 sequence074 source 1..3881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(277..993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(1141..1602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(1681..2226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(2255..2608) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(2605..2931) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(3092..3370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(3327..3602) product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 sequence075 source 1..3853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(529..2550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(2630..3439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 sequence076 source 1..3835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..1255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 1261..2316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 2430..3680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 sequence077 source 1..3832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 81..884 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(1053..2405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 2628..2966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 misc_feature complement(2905..>3832) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876684.1:translation elongation factor EF-1 subunit alpha locus_tag LOCUS_06240 sequence078 source 1..3776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(425..943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(1120..1683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 note possible pseudo, frameshifted CDS complement(1728..3035) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 sequence079 source 1..3732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(682..1203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(1208..1462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 1915..2883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(2892..3239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 tRNA complement(3404..3479) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 sequence080 source 1..3718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..583 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060905.1:5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH locus_tag LOCUS_06320 CDS complement(508..1455) product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene cofD CDS complement(1460..2200) product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene cofE CDS 2254..3228 product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene mer CDS complement(3230..3718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 sequence081 source 1..3656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1422 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083750460.1:CpaF family protein locus_tag LOCUS_06370 CDS 1404..3374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 sequence082 source 1..3625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1062..1493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 1598..1909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 2325..2999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 sequence083 source 1..3593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..1099 product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene eif2g CDS 1144..1533 product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250895.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 1541..3550 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 sequence084 source 1..3577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(839..3079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 sequence085 source 1..3529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..905 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388138.1:gamma-glutamyltransferase locus_tag LOCUS_06460 CDS 931..3198 product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 3173..3442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 sequence086 source 1..3511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(582..1013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(1020..1475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 1474..1719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 1721..1945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(1937..2908) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867338.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 misc_feature complement(2893..>3511) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436928.1:radical SAM protein locus_tag LOCUS_06540 sequence087 source 1..3497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(366..1541) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 misc_feature complement(1538..>3497) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546388.1:transketolase locus_tag LOCUS_06560 sequence088 source 1..3493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 517..918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(2029..2205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 2482..2958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 sequence089 source 1..3488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..661 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein locus_tag LOCUS_06600 CDS 670..1053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(1059..1283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(1295..1525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(1539..1928) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(1925..2260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(2273..2542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 sequence090 source 1..3478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1164..2447 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(2606..3364) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249902.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 sequence091 source 1..3467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(655..1218) product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024831595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(1211..2332) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(2301..2636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(2637..3050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 sequence092 source 1..3459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..1135) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(1132..2109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(2102..3328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 sequence093 source 1..3429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(578..649) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(705..2315) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene lysS CDS complement(2374..2682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 sequence094 source 1..3415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(433..1161) product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(1363..1998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(2003..2410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(2686..3153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 sequence095 source 1..3406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..1234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 1510..2772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 sequence096 source 1..3372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 383..1537 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene cobD CDS 1880..2821 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene cbiB sequence097 source 1..3364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..757 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965993.1:branched-chain amino acid ABC transporter permease locus_tag LOCUS_06860 CDS 754..1725 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 1706..2491 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 2481..3200 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 sequence098 source 1..3354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(372..737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(1423..2052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(2479..2874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 sequence099 source 1..3353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(86..859) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene truA CDS 932..1417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 1529..2245 product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 sequence100 source 1..3350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..894 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529345.1:IS1595 family transposase locus_tag LOCUS_06960 CDS 1095..1505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 tRNA 1547..1640 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 2216..2611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 sequence101 source 1..3336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..548 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868483.1:pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma locus_tag LOCUS_06990 CDS 548..808 product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene porD CDS 805..1989 product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene porA CDS 2064..2858 product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene porB sequence102 source 1..3329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 583..1443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 1433..2083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(2171..3319) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 sequence103 source 1..3271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 note possible pseudo, frameshifted CDS complement(414..776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 note possible pseudo, frameshifted CDS complement(997..2193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 misc_feature complement(2242..>3271) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391684.1:DUF763 domain-containing protein locus_tag LOCUS_07100 sequence104 source 1..3269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 238..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 460..1557 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene ftsZ CDS complement(1578..2213) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 misc_feature complement(2214..>3269) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080396.1:methionine--tRNA ligase locus_tag LOCUS_07140 sequence105 source 1..3259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1860..2783) product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 sequence106 source 1..3258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..1003) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(1134..1670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(1682..2962) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878920.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 sequence107 source 1..3254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..1332 product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 1396..2946 product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene fdrA sequence108 source 1..3239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(334..1494) product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(1527..2576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 sequence109 source 1..3234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..3158 product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 sequence110 source 1..3231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 44..688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(987..1160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(1157..1744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 sequence111 source 1..3201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 324..1025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(1232..1900) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 misc_feature complement(1897..>3201) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391571.1:histidine kinase locus_tag LOCUS_07290 sequence112 source 1..3186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 754..1896 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 misc_feature complement(1999..>3186) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878082.1:M28 family metallopeptidase locus_tag LOCUS_07310 sequence113 source 1..3184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(312..830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(991..1242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(1239..3065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 sequence114 source 1..3182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..1091) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 1209..1508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 1613..2509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(2528..3181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 sequence115 source 1..3177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 674..1657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 2129..2395 product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(2436..2630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 sequence116 source 1..3137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(293..1321) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(1326..2003) product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 misc_feature complement(2035..>3137) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250738.1:tripartite tricarboxylate transporter permease locus_tag LOCUS_07440 sequence117 source 1..3096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(432..1637) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(1650..2078) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene argR CDS complement(2095..3027) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene argF sequence118 source 1..3094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 452..1714 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 1760..2965 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742961.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 sequence119 source 1..3085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(718..1299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(1296..2498) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 sequence120 source 1..3078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(480..2423) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(2436..2753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 sequence121 source 1..3076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 1374..2723 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene ltrA sequence122 source 1..3072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(26..904) product IS481-like element ISA0963-3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 1223..1486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(1584..2459) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(2456..2878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 sequence123 source 1..3063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(228..1052) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene hisF CDS complement(1055..1675) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene hisH sequence124 source 1..3050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 752..1609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 1778..2257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 sequence125 source 1..3047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(465..830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(887..2689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 sequence126 source 1..2996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 55..1362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 1283..1756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 sequence127 source 1..2979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 364..1494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 sequence128 source 1..2978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(1245..1382) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(1806..2681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 sequence129 source 1..2969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1250..1906 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 sequence130 source 1..2963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..704 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 722..958 product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 960..1946 product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250460.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(1947..2228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 tRNA 2331..2419 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 2429..2905 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 sequence131 source 1..2960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..2085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(2057..2419) product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 sequence132 source 1..2939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(255..1388) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 1662..2027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 sequence133 source 1..2922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(684..1154) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(1209..1448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(1449..2450) product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 2575..2697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 sequence134 source 1..2922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence135 source 1..2906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 862..1857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 1861..2244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(2455..2655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 sequence136 source 1..2905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..963 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251108.1:carbamate kinase locus_tag LOCUS_07920 CDS complement(972..1625) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(1616..2374) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene cobS misc_feature complement(2377..>2905) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065005.1:alpha-ribazole phosphatase CobZ locus_tag LOCUS_07950 sequence137 source 1..2898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..2497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 sequence138 source 1..2898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(439..1146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(1268..2260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(2357..2782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 sequence139 source 1..2896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 828..2219 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 sequence140 source 1..2894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(811..887) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(956..1750) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(1752..2606) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060997.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 sequence141 source 1..2894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(77..502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(499..693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 818..1078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 sequence142 source 1..2886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2685 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250571.1:MCM2/3/5 family DNA replication licensing factor locus_tag LOCUS_08060 sequence143 source 1..2871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 311..742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(746..2230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(2274..2720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 sequence144 source 1..2854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1961) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(1948..2643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 sequence145 source 1..2828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(467..2710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 sequence146 source 1..2810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..1201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 1303..1551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 1548..1958 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902004.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 1974..2522 product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 sequence147 source 1..2810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2136..2471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(2487..2669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 sequence148 source 1..2807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 325..1851 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052821263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene istA CDS 1848..2654 product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971012.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene istB sequence149 source 1..2805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 62..1363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(1448..2788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 sequence150 source 1..2788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(203..907) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(912..1460) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(1457..1768) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 sequence151 source 1..2783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 746..1570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022387.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(1705..1878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 sequence152 source 1..2780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(528..2402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 sequence153 source 1..2780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1913..2359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 sequence154 source 1..2758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..676 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876421.1:ribose-phosphate diphosphokinase locus_tag LOCUS_08310 CDS complement(669..1937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 sequence155 source 1..2758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(159..320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 486..1175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 1380..2489 product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 sequence156 source 1..2750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1256..1534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 1537..2025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 2260..2505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 2444..2740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 sequence157 source 1..2738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..556 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545277.1:dihydropteroate synthase locus_tag LOCUS_08400 CDS 591..1352 product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene cofE tRNA complement(1353..1425) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(1479..1898) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146813.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(1862..2113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(2180..2416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 sequence158 source 1..2715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(297..497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(972..1415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(1412..1600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 sequence159 source 1..2710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(562..870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(984..1451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(1597..1824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 note possible pseudo, internal stop codon CDS complement(2140..2496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 sequence160 source 1..2708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(124..1434) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(1443..1955) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 sequence161 source 1..2704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(308..589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(1875..1994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 sequence162 source 1..2704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 470..1660 product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429732.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(1765..2058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(2167..2406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 sequence163 source 1..2698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1104..2225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 sequence164 source 1..2695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 39..998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 1377..2318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 sequence165 source 1..2692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 440..610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(650..1045) product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(1038..1313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 1366..1494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 misc_feature complement(1513..>2692) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023091.1:ATP-binding protein locus_tag LOCUS_08660 sequence166 source 1..2689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..977) product tRNA (adenine(57)-N(1)/adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867553.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene trmI CDS 1037..1918 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 sequence167 source 1..2684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(345..623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(616..846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(1642..1761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 misc_feature complement(1776..>2684) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171602985.1:adenylate/guanylate cyclase domain-containing protein locus_tag LOCUS_08730 sequence168 source 1..2684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 23..253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 261..905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 918..1583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 1580..1705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 1702..2025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 sequence169 source 1..2683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..1311 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene asd CDS complement(1411..1929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 sequence170 source 1..2670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 237..1307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 1326..2417 product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene amrS sequence171 source 1..2657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(203..1111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(1190..1702) product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(1699..2004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 misc_feature complement(2154..>2657) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249461.1:redox-regulated ATPase YchF locus_tag LOCUS_08860 sequence172 source 1..2653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..883) product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene istB CDS complement(898..2445) product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene istA sequence173 source 1..2650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(521..742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(744..1982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 misc_feature complement(1983..>2650) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249304.1:cell division ATPase MinD locus_tag LOCUS_08910 sequence174 source 1..2646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4..594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(739..1425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(1528..2175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 sequence175 source 1..2634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 327..2543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 sequence176 source 1..2633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 501..740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 715..2058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 sequence177 source 1..2619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 506..2017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 2097..2360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 sequence178 source 1..2619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 506..850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 853..2244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(2270..2587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 sequence179 source 1..2613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(19..94) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(307..385) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(562..1164) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(1145..1897) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene rph CDS complement(1916..2290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 2246..2530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 sequence180 source 1..2607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..2536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 sequence181 source 1..2598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 738..2393 product IS4-like element ISLpn5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 sequence182 source 1..2590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..1200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(1200..2462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 sequence183 source 1..2585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1869..2486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 sequence184 source 1..2584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(339..1325) product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1432..2352 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene mvk sequence185 source 1..2568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 519..1820 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(1840..2445) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene tmk sequence186 source 1..2554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1185..2384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 sequence187 source 1..2549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 401..733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(923..1660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 sequence188 source 1..2548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 702..1715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 misc_feature complement(1709..>2548) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867667.1:ATP-dependent DNA ligase locus_tag LOCUS_09210 sequence189 source 1..2544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(430..1383) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(1380..1820) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(1862..2044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 sequence190 source 1..2540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(708..998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(1008..1811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 1941..2279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 sequence191 source 1..2529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(847..1764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 sequence192 source 1..2526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(669..815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1485..1691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1833..2093) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 sequence193 source 1..2523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 240..1382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 sequence194 source 1..2517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..709) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(700..1368) product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(1359..2339) product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868890.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene kae1 sequence195 source 1..2515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..664 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338051.1:NAD-dependent dihydropyrimidine dehydrogenase subunit PreA locus_tag LOCUS_09360 CDS 586..2031 product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene ssnA sequence196 source 1..2512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..704 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039182.1:branched-chain amino acid transaminase locus_tag LOCUS_09380 CDS 766..1137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1207..2175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 sequence197 source 1..2510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..1063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 1050..2435 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 sequence198 source 1..2508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence199 source 1..2505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1104..1673) product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(1738..2253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 sequence200 source 1..2495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..751) product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene istB CDS complement(768..2312) product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene istA sequence201 source 1..2491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 531..716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 751..1068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1273..1767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(2343..2486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 sequence202 source 1..2490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(818..1177) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 misc_feature complement(1292..>2490) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940712.1:molecular chaperone DnaJ locus_tag LOCUS_09520 sequence203 source 1..2475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(854..1138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1531..1974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1971..2159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 sequence204 source 1..2470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..472) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(450..791) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(979..1731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1832..1960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 sequence205 source 1..2467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(324..986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1000..1554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(1547..1915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 tRNA 2054..2127 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence206 source 1..2466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 39..335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 359..871 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene apt CDS 1650..1823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 sequence207 source 1..2465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1848..>2465) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228417.1:Xaa-Pro peptidase family protein locus_tag LOCUS_09660 sequence208 source 1..2460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence209 source 1..2451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 608..2275 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 sequence210 source 1..2446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(734..1273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1270..1956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 sequence211 source 1..2442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1160 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393738.1:2-isopropylmalate synthase locus_tag LOCUS_09710 sequence212 source 1..2432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1050 product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1068..1406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1481..1690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1704..2363) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 sequence213 source 1..2422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(261..1940) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879349.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 sequence214 source 1..2419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001309284.1:DUF2877 domain-containing protein locus_tag LOCUS_09770 CDS complement(562..1350) product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene gctB CDS complement(1354..2319) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 sequence215 source 1..2406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 84..434 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 436..771 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene tnpB CDS 834..2390 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 sequence216 source 1..2406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1528..1905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 sequence217 source 1..2400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 20..460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(575..1339) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1344..2171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 sequence218 source 1..2392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..609 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903201.1:N-(5'-phosphoribosyl)anthranilate isomerase locus_tag LOCUS_09870 CDS 609..1799 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496708.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene trpB sequence219 source 1..2388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 214..903 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 952..2214 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 sequence220 source 1..2388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 318..530 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1181..1789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 sequence221 source 1..2387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 957..2363 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 sequence222 source 1..2379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..1580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 sequence223 source 1..2374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 505..2103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 sequence224 source 1..2370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 88..666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 738..1334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1386..2270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 sequence225 source 1..2368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..544 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876682.1:30S ribosomal protein S7 locus_tag LOCUS_09990 CDS 608..1870 product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene tuf CDS 1910..2230 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene rpsJ tRNA 2280..2368 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence226 source 1..2363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(63..1421) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1548..2180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 sequence227 source 1..2360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 537..1664 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1688..2035) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 sequence228 source 1..2359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..1313) product LAGLIDADG family homing endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869812.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1475..1897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1894..2313) product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 sequence229 source 1..2356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1101..2045) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 sequence230 source 1..2353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..523 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250576.1:sodium ion-translocating decarboxylase subunit beta locus_tag LOCUS_10100 CDS complement(715..1455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1719..1850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 sequence231 source 1..2328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 590..871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 sequence232 source 1..2328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 74..1114 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene rseP CDS 1115..2197 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene ispG sequence233 source 1..2328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1187..1879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 sequence234 source 1..2304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(39..419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 565..837 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 868..1383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1394..2008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 sequence235 source 1..2304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 342..1607 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene eno CDS 1598..2212 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene rpsB sequence236 source 1..2303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(774..1334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 sequence237 source 1..2296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 20..508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 508..870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 867..1634 product DUF2101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1658..1849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 sequence238 source 1..2295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 233..481 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 471..767 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 900..1163 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1150..1554 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1641..1886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1779..2222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 sequence239 source 1..2279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(659..1213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1195..1377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1681..2247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 sequence240 source 1..2275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(672..749) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 801..1577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1752..2201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 sequence241 source 1..2274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence242 source 1..2270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..1114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1373..1756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 sequence243 source 1..2264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(620..1663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1673..2116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 sequence244 source 1..2263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(405..614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 752..1621 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1621..2178 product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 sequence245 source 1..2254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(14..211) product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762842.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(291..467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1246..2253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 sequence246 source 1..2242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(331..1170) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876384.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1438..1977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 sequence247 source 1..2241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..993 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868419.1:ATP-binding protein locus_tag LOCUS_10520 CDS complement(1086..1832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 sequence248 source 1..2237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 412..870 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1065..1373 product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1445..2197 product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene psmA sequence249 source 1..2235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 sequence250 source 1..2227 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 304..1107 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 misc_feature complement(1128..>2227) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023091.1:ATP-binding protein locus_tag LOCUS_10590 sequence251 source 1..2226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(715..1788) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene hisC sequence252 source 1..2206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..1438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1573..2010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 sequence253 source 1..2206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..1489 product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 sequence254 source 1..2205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 304..861 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene thpR misc_feature complement(893..>2205) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023473.1:CCA tRNA nucleotidyltransferase locus_tag LOCUS_10650 sequence255 source 1..2205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..908 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870515.1:diadenylate cyclase locus_tag LOCUS_10660 CDS complement(914..1780) product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 sequence256 source 1..2205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1207 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA locus_tag LOCUS_10680 sequence257 source 1..2205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..459) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(459..1061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1045..1641) product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1694..1972) product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876930.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 sequence258 source 1..2204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..236) product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene hpkA CDS complement(270..1553) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 sequence259 source 1..2204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..792 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940799.1:hydrogenase small subunit locus_tag LOCUS_10750 sequence260 source 1..2197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..555 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870830.1:aconitase X locus_tag LOCUS_10760 CDS 552..935 product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 978..1937 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 sequence261 source 1..2181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(239..487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(606..875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1113..1376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 sequence262 source 1..2180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 585..1988 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene ltrA sequence263 source 1..2179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1794 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878724.1:hydrophobe/amphiphile efflux-3 (HAE3) family transporter locus_tag LOCUS_10830 sequence264 source 1..2176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 468..968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1043..1201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1405..1833 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926524.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 sequence265 source 1..2173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(730..2082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 sequence266 source 1..2172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 505..1275 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1276..1644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 sequence267 source 1..2171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..1415) product IS4-like element ISDha2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943229.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 sequence268 source 1..2163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(462..716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(736..1224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1221..2012) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219772.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene lsrF CDS complement(2025..2162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 sequence269 source 1..2159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence270 source 1..2159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 473..778 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1149..1637 product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1768..2154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 sequence271 source 1..2155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(564..1283) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728711.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 misc_feature complement(1374..>2155) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027160700.1:xanthine dehydrogenase family protein molybdopterin-binding subunit locus_tag LOCUS_11010 sequence272 source 1..2150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(490..>2150) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009195517.1:ABC transporter permease locus_tag LOCUS_11020 sequence273 source 1..2147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(819..1100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1159..1371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1368..1679) product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 sequence274 source 1..2145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 309..1034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1372..2121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 sequence275 source 1..2141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..525 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546236.1:DUF763 domain-containing protein locus_tag LOCUS_11080 CDS 856..1500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 rRNA 1702..1839 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA 1888..1963 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 sequence276 source 1..2133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..944) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene dcd CDS complement(996..1763) product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249752.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1773..2057) product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876635.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene eif1A sequence277 source 1..2128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence278 source 1..2126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 282..659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 664..1290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 misc_feature complement(1312..>2126) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023138.1:ATP-dependent DNA helicase locus_tag LOCUS_11150 sequence279 source 1..2120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence280 source 1..2108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002376739.1:cysteine desulfurase locus_tag LOCUS_11160 CDS 881..1258 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330765.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1259..1465 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583141.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 sequence281 source 1..2103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..1793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 sequence282 source 1..2101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(483..1889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 sequence283 source 1..2096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(944..2050) product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 sequence284 source 1..2096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(324..1664) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 sequence285 source 1..2095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 810..965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 985..1746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 sequence286 source 1..2092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 34..129 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 964..1380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 tRNA 1417..1508 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(1521..1751) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 sequence287 source 1..2090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 498..1181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1525..1788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1769..2047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 sequence288 source 1..2082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 368..1369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1559..1978 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 sequence289 source 1..2077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(914..1771) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene accD sequence290 source 1..2073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 467..973 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1128..1517 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1531..2061 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 sequence291 source 1..2069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..851 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421624.1:ACR3 family arsenite efflux transporter locus_tag LOCUS_11370 CDS complement(1154..1438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1441..1986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 sequence292 source 1..2068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(716..1039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1123..1638) product AAA-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 sequence293 source 1..2061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(627..1100) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1181..1456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 sequence294 source 1..2061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(457..981) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 misc_feature complement(1283..>2061) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977330.1:chorismate synthase locus_tag LOCUS_11460 sequence295 source 1..2060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1069 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870985.1:threonine synthase locus_tag LOCUS_11470 sequence296 source 1..2059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1208..1675) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene rpiB sequence297 source 1..2056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(654..1034) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene rplX CDS complement(1040..1465) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1467..1793) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 sequence298 source 1..2047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..732 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein locus_tag LOCUS_11520 CDS 813..1127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 sequence299 source 1..2047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence300 source 1..2038 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(951..1334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1421..1657 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1833..1997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 sequence301 source 1..2033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..1893) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene ppcA sequence302 source 1..2033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1048 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902167.1:RNA-guided endonuclease TnpB family protein locus_tag LOCUS_11590 CDS complement(1061..1579) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 sequence303 source 1..2028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1140..>2028) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990858.1:SBBP repeat-containing protein locus_tag LOCUS_11610 sequence304 source 1..2023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 403..1929 product IS1182-like element ISMac20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 sequence305 source 1..2022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 205..1005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 992..1801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1776..1976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 sequence306 source 1..2016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 212..1660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1740..1997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 sequence307 source 1..2014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(695..931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 note possible pseudo, frameshifted CDS complement(921..1295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1295..1558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 sequence308 source 1..2014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 96..1049 product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1051..1377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 sequence309 source 1..2009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(613..957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 898..1215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 note possible pseudo, internal stop codon CDS complement(1486..1824) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 sequence310 source 1..2007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 232..696 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868086.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(744..1016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1070..1480) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene hisI sequence311 source 1..2005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1059..>2005) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250266.1:phosphoadenosine phosphosulfate reductase family protein locus_tag LOCUS_11810 sequence312 source 1..2002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..598 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein locus_tag LOCUS_11820 CDS 613..993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1021..1425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1437..1700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 sequence313 source 1..1460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1221 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113167.1:tyrosine--tRNA ligase locus_tag LOCUS_11860