>Feature sequence001 1235 1068 gene locus_tag LOCUS_00010 1235 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1598 1371 gene locus_tag LOCUS_00020 1598 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2408 1671 gene locus_tag LOCUS_00030 2408 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3140 2490 gene locus_tag LOCUS_00040 3140 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3370 3137 gene locus_tag LOCUS_00050 3370 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4060 3446 gene locus_tag LOCUS_00060 gene radC 4060 3446 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053959.1 protein_id gnl|my_center|LOCUS_00060 4348 4169 gene locus_tag LOCUS_00070 4348 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4976 4761 gene locus_tag LOCUS_00080 4976 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_00080 4933 5136 gene locus_tag LOCUS_00090 4933 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5156 5338 gene locus_tag LOCUS_00100 5156 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 5910 5368 gene locus_tag LOCUS_00110 5910 5368 CDS product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267039.1 protein_id gnl|my_center|LOCUS_00110 6496 6062 gene locus_tag LOCUS_00120 6496 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 6608 6826 gene locus_tag LOCUS_00130 6608 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7104 7304 gene locus_tag LOCUS_00140 7104 7304 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113932710.1 protein_id gnl|my_center|LOCUS_00140 7301 9301 gene locus_tag LOCUS_00150 7301 9301 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 protein_id gnl|my_center|LOCUS_00150 9311 10393 gene locus_tag LOCUS_00160 9311 10393 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_00160 10393 11076 gene locus_tag LOCUS_00170 10393 11076 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_00170 11073 13859 gene locus_tag LOCUS_00180 11073 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13909 16566 gene locus_tag LOCUS_00190 13909 16566 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484637.1 protein_id gnl|my_center|LOCUS_00190 16578 17819 gene locus_tag LOCUS_00200 16578 17819 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_00200 18259 17855 gene locus_tag LOCUS_00210 18259 17855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 18724 18287 gene locus_tag LOCUS_00220 18724 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 18971 18777 gene locus_tag LOCUS_00230 18971 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 20101 19103 gene locus_tag LOCUS_00240 20101 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 21684 20230 gene locus_tag LOCUS_00250 21684 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 22205 21774 gene locus_tag LOCUS_00260 22205 21774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 22759 22202 gene locus_tag LOCUS_00270 22759 22202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24348 22756 gene locus_tag LOCUS_00280 24348 22756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25247 24345 gene locus_tag LOCUS_00290 25247 24345 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_00290 25464 25760 gene locus_tag LOCUS_00300 25464 25760 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038219.1 protein_id gnl|my_center|LOCUS_00300 25757 26248 gene locus_tag LOCUS_00310 25757 26248 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038220.1 protein_id gnl|my_center|LOCUS_00310 26296 26598 gene locus_tag LOCUS_00320 26296 26598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 26603 27442 gene locus_tag LOCUS_00330 26603 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 28443 27559 gene locus_tag LOCUS_00340 28443 27559 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 protein_id gnl|my_center|LOCUS_00340 28535 29011 gene locus_tag LOCUS_00350 28535 29011 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963690.1 protein_id gnl|my_center|LOCUS_00350 29050 29358 gene locus_tag LOCUS_00360 29050 29358 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 protein_id gnl|my_center|LOCUS_00360 30773 29370 gene locus_tag LOCUS_00370 30773 29370 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_00370 30905 31408 gene locus_tag LOCUS_00380 30905 31408 CDS product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 protein_id gnl|my_center|LOCUS_00380 31833 32201 gene locus_tag LOCUS_00390 31833 32201 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187552.1 protein_id gnl|my_center|LOCUS_00390 32201 32794 gene locus_tag LOCUS_00400 32201 32794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 protein_id gnl|my_center|LOCUS_00400 32851 33198 gene locus_tag LOCUS_00410 32851 33198 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114600.1 protein_id gnl|my_center|LOCUS_00410 33942 33406 gene locus_tag LOCUS_00420 33942 33406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 34498 34058 gene locus_tag LOCUS_00430 34498 34058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 34940 34758 gene locus_tag LOCUS_00440 34940 34758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 35397 34990 gene locus_tag LOCUS_00450 35397 34990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 35921 35694 gene locus_tag LOCUS_00460 35921 35694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 36356 37396 gene locus_tag LOCUS_00470 36356 37396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 38319 37567 gene locus_tag LOCUS_00480 38319 37567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 38526 39689 gene locus_tag LOCUS_00490 38526 39689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 >Feature sequence002 460 125 gene locus_tag LOCUS_00500 460 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 1524 838 gene locus_tag LOCUS_00510 1524 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 1775 1470 gene locus_tag LOCUS_00520 1775 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00520 2891 2244 gene locus_tag LOCUS_00530 2891 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3572 2907 gene locus_tag LOCUS_00540 3572 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4042 3767 gene locus_tag LOCUS_00550 4042 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 4041 4604 gene locus_tag LOCUS_00560 4041 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 4934 5671 gene locus_tag LOCUS_00570 4934 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 5715 6566 gene locus_tag LOCUS_00580 5715 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 7038 7922 gene locus_tag LOCUS_00590 7038 7922 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974282.1 protein_id gnl|my_center|LOCUS_00590 11083 7991 gene locus_tag LOCUS_00600 11083 7991 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544913.1 protein_id gnl|my_center|LOCUS_00600 12769 11312 gene locus_tag LOCUS_00610 12769 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 13598 12762 gene locus_tag LOCUS_00620 13598 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 13819 15231 gene locus_tag LOCUS_00630 13819 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 15225 15875 gene locus_tag LOCUS_00640 15225 15875 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084479.1 protein_id gnl|my_center|LOCUS_00640 15868 19368 gene locus_tag LOCUS_00650 15868 19368 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084480.1 protein_id gnl|my_center|LOCUS_00650 19365 20540 gene locus_tag LOCUS_00660 19365 20540 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084481.1 protein_id gnl|my_center|LOCUS_00660 20574 21086 gene locus_tag LOCUS_00670 20574 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 21256 21107 gene locus_tag LOCUS_00680 21256 21107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 22904 21432 gene locus_tag LOCUS_00690 22904 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 23167 24573 gene locus_tag LOCUS_00700 23167 24573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 25592 24588 gene locus_tag LOCUS_00710 25592 24588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 26054 25845 gene locus_tag LOCUS_00720 26054 25845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 26266 26051 gene locus_tag LOCUS_00730 26266 26051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 26904 27071 gene locus_tag LOCUS_00740 26904 27071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 27315 30107 gene locus_tag LOCUS_00750 27315 30107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 30703 30104 gene locus_tag LOCUS_00760 30703 30104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 30932 31279 gene locus_tag LOCUS_00770 30932 31279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 31891 31807 gene locus_tag LOCUS_t00010 31891 31807 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33198 31948 gene locus_tag LOCUS_00780 33198 31948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 34534 33296 gene locus_tag LOCUS_00790 34534 33296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 35783 34824 gene locus_tag LOCUS_00800 35783 34824 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 protein_id gnl|my_center|LOCUS_00800 35995 36660 gene locus_tag LOCUS_00810 35995 36660 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_00810 36670 37275 gene locus_tag LOCUS_00820 36670 37275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 37411 38991 gene locus_tag LOCUS_00830 37411 38991 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 protein_id gnl|my_center|LOCUS_00830 39043 39474 gene locus_tag LOCUS_00840 39043 39474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence003 <1 545 gene locus_tag LOCUS_00850 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002213540.1:IMP dehydrogenase 630 956 gene locus_tag LOCUS_00860 630 956 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_00860 963 2525 gene locus_tag LOCUS_00870 gene guaA 963 2525 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_00870 2889 4085 gene locus_tag LOCUS_00880 2889 4085 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 protein_id gnl|my_center|LOCUS_00880 4320 4072 gene locus_tag LOCUS_00890 4320 4072 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 protein_id gnl|my_center|LOCUS_00890 5158 4457 gene locus_tag LOCUS_00900 5158 4457 CDS product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007251563.1 protein_id gnl|my_center|LOCUS_00900 7227 5158 gene locus_tag LOCUS_00910 gene traD 7227 5158 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_00910 9404 7224 gene locus_tag LOCUS_00920 gene mobH 9404 7224 CDS product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088056948.1 protein_id gnl|my_center|LOCUS_00920 9742 11637 gene locus_tag LOCUS_00930 9742 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 11634 13160 gene locus_tag LOCUS_00940 11634 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 13163 18568 gene locus_tag LOCUS_00950 13163 18568 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148619099.1 protein_id gnl|my_center|LOCUS_00950 20598 18571 gene locus_tag LOCUS_00960 20598 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 22955 20598 gene locus_tag LOCUS_00970 22955 20598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 23858 23016 gene locus_tag LOCUS_00980 23858 23016 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_00980 24783 23851 gene locus_tag LOCUS_00990 24783 23851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 27181 24698 gene locus_tag LOCUS_01000 27181 24698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01000 28100 27174 gene locus_tag LOCUS_01010 28100 27174 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_01010 28536 28985 gene locus_tag LOCUS_01020 gene iagB 28536 28985 CDS product type III secretion system invasion protein IagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097340.1 protein_id gnl|my_center|LOCUS_01020 28985 29275 gene locus_tag LOCUS_01030 28985 29275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 >Feature sequence004 1797 1258 gene locus_tag LOCUS_01040 1797 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 3124 2714 gene locus_tag LOCUS_01050 3124 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 3878 3078 gene locus_tag LOCUS_01060 3878 3078 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_01060 4660 4887 gene locus_tag LOCUS_01070 4660 4887 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006870829.1 protein_id gnl|my_center|LOCUS_01070 4880 5185 gene locus_tag LOCUS_01080 4880 5185 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948073.1 protein_id gnl|my_center|LOCUS_01080 5182 6330 gene locus_tag LOCUS_01090 5182 6330 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027224428.1 protein_id gnl|my_center|LOCUS_01090 6423 7886 gene locus_tag LOCUS_01100 6423 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 8009 8161 gene locus_tag LOCUS_01110 8009 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 8383 8772 gene locus_tag LOCUS_01120 8383 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 9089 8871 gene locus_tag LOCUS_01130 9089 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9029 10126 gene locus_tag LOCUS_01140 9029 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 10260 10646 gene locus_tag LOCUS_01150 10260 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 10660 11025 gene locus_tag LOCUS_01160 10660 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 11127 11981 gene locus_tag LOCUS_01170 11127 11981 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774874.1 protein_id gnl|my_center|LOCUS_01170 12950 11946 gene locus_tag LOCUS_01180 12950 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 13220 14230 gene locus_tag LOCUS_01190 13220 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 15403 14369 gene locus_tag LOCUS_01200 15403 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 15505 15849 gene locus_tag LOCUS_01210 15505 15849 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919247.1 protein_id gnl|my_center|LOCUS_01210 16117 15794 gene locus_tag LOCUS_01220 16117 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 16248 16622 gene locus_tag LOCUS_01230 16248 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 16770 17144 gene locus_tag LOCUS_01240 16770 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 17252 19348 gene locus_tag LOCUS_01250 17252 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 19495 19328 gene locus_tag LOCUS_01260 19495 19328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 19697 19470 gene locus_tag LOCUS_01270 19697 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 20293 19754 gene locus_tag LOCUS_01280 20293 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 20720 20409 gene locus_tag LOCUS_01290 20720 20409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence005 <1 800 gene locus_tag LOCUS_01300 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198406157.1:iron ABC transporter permease 1884 1654 gene locus_tag LOCUS_01310 1884 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 1906 2904 gene locus_tag LOCUS_01320 1906 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 2901 4424 gene locus_tag LOCUS_01330 2901 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4424 9823 gene locus_tag LOCUS_01340 4424 9823 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148619099.1 protein_id gnl|my_center|LOCUS_01340 9859 11691 gene locus_tag LOCUS_01350 9859 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 12602 11763 gene locus_tag LOCUS_01360 12602 11763 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_01360 15927 12595 gene locus_tag LOCUS_01370 15927 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_01370 16850 15924 gene locus_tag LOCUS_01380 16850 15924 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_01380 18079 17048 gene locus_tag LOCUS_01390 18079 17048 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_01390 18256 18750 gene locus_tag LOCUS_01400 18256 18750 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_01400 19462 18761 gene locus_tag LOCUS_01410 19462 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 19940 19431 gene locus_tag LOCUS_01420 19940 19431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 >Feature sequence006 622 1053 gene locus_tag LOCUS_01430 622 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 2177 1242 gene locus_tag LOCUS_01440 2177 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4571 2343 gene locus_tag LOCUS_01450 4571 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 4955 4575 gene locus_tag LOCUS_01460 4955 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5517 5314 gene locus_tag LOCUS_01470 5517 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6175 6038 gene locus_tag LOCUS_01480 6175 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 6307 8331 gene locus_tag LOCUS_01490 6307 8331 CDS product FxsB family radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267855.1 protein_id gnl|my_center|LOCUS_01490 8913 9332 gene locus_tag LOCUS_01500 8913 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 9424 9795 gene locus_tag LOCUS_01510 9424 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 9992 9813 gene locus_tag LOCUS_01520 9992 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10331 11431 gene locus_tag LOCUS_01530 10331 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 12914 11463 gene locus_tag LOCUS_01540 12914 11463 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287699.1 protein_id gnl|my_center|LOCUS_01540 13368 12922 gene locus_tag LOCUS_01550 13368 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 13643 14242 gene locus_tag LOCUS_01560 13643 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 15845 15255 gene locus_tag LOCUS_01570 15845 15255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 16142 15915 gene locus_tag LOCUS_01580 16142 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 16520 17257 gene locus_tag LOCUS_01590 16520 17257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 17307 17567 gene locus_tag LOCUS_01600 17307 17567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 17614 18051 gene locus_tag LOCUS_01610 17614 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 18436 18101 gene locus_tag LOCUS_01620 18436 18101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence007 155 1468 gene locus_tag LOCUS_01630 155 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4135 1520 gene locus_tag LOCUS_01640 4135 1520 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_01640 5213 4296 gene locus_tag LOCUS_01650 5213 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 5375 5947 gene locus_tag LOCUS_01660 5375 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 5944 7335 gene locus_tag LOCUS_01670 5944 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 7319 8509 gene locus_tag LOCUS_01680 7319 8509 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929488.1 protein_id gnl|my_center|LOCUS_01680 8484 9155 gene locus_tag LOCUS_01690 8484 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 10079 9162 gene locus_tag LOCUS_01700 10079 9162 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394832.1 protein_id gnl|my_center|LOCUS_01700 10588 12276 gene locus_tag LOCUS_01710 10588 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 13887 12718 gene locus_tag LOCUS_01720 13887 12718 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_01720 15424 14261 gene locus_tag LOCUS_01730 15424 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084388.1 protein_id gnl|my_center|LOCUS_01730 15672 15596 gene locus_tag LOCUS_t00020 15672 15596 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16502 15822 gene locus_tag LOCUS_01740 16502 15822 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_01740 17811 16597 gene locus_tag LOCUS_01750 gene mnmA 17811 16597 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089733.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence008 278 69 gene locus_tag LOCUS_01760 278 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 677 357 gene locus_tag LOCUS_01770 677 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 1187 702 gene locus_tag LOCUS_01780 1187 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 1972 1184 gene locus_tag LOCUS_01790 1972 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 3242 2406 gene locus_tag LOCUS_01800 3242 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142031.1 protein_id gnl|my_center|LOCUS_01800 3778 3239 gene locus_tag LOCUS_01810 3778 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 6867 3775 gene locus_tag LOCUS_01820 6867 3775 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_01820 8669 6867 gene locus_tag LOCUS_01830 8669 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 9958 8669 gene locus_tag LOCUS_01840 9958 8669 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 protein_id gnl|my_center|LOCUS_01840 10386 10018 gene locus_tag LOCUS_01850 10386 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 10528 11190 gene locus_tag LOCUS_01860 10528 11190 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258297.1 protein_id gnl|my_center|LOCUS_01860 12089 11202 gene locus_tag LOCUS_01870 12089 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 12393 12133 gene locus_tag LOCUS_01880 12393 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 12632 13045 gene locus_tag LOCUS_01890 12632 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 13308 13102 gene locus_tag LOCUS_01900 13308 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 13801 13409 gene locus_tag LOCUS_01910 gene cueR 13801 13409 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939394.1 protein_id gnl|my_center|LOCUS_01910 13987 14628 gene locus_tag LOCUS_01920 13987 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 14679 16007 gene locus_tag LOCUS_01930 14679 16007 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence009 109 1164 gene locus_tag LOCUS_01940 109 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 1161 1400 gene locus_tag LOCUS_01950 1161 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 2757 1588 gene locus_tag LOCUS_01960 2757 1588 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060762.1 protein_id gnl|my_center|LOCUS_01960 3130 4107 gene locus_tag LOCUS_01970 3130 4107 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_01970 4197 5282 gene locus_tag LOCUS_01980 4197 5282 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021199.1 protein_id gnl|my_center|LOCUS_01980 5426 5608 gene locus_tag LOCUS_01990 5426 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 6632 5730 gene locus_tag LOCUS_02000 gene fsa 6632 5730 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667661.1 protein_id gnl|my_center|LOCUS_02000 7211 6681 gene locus_tag LOCUS_02010 gene gmhB 7211 6681 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_02010 7774 7208 gene locus_tag LOCUS_02020 7774 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02020 8721 7765 gene locus_tag LOCUS_02030 8721 7765 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_02030 9473 8769 gene locus_tag LOCUS_02040 9473 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 10414 9470 gene locus_tag LOCUS_02050 10414 9470 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_02050 11259 10411 gene locus_tag LOCUS_02060 11259 10411 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_02060 12252 11272 gene locus_tag LOCUS_02070 gene rfaE1 12252 11272 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_02070 12518 12267 gene locus_tag LOCUS_02080 12518 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 13183 12515 gene locus_tag LOCUS_02090 13183 12515 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496955.1 protein_id gnl|my_center|LOCUS_02090 13235 13717 gene locus_tag LOCUS_02100 13235 13717 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142043.1 protein_id gnl|my_center|LOCUS_02100 13722 14132 gene locus_tag LOCUS_02110 13722 14132 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762946.1 protein_id gnl|my_center|LOCUS_02110 14134 14697 gene locus_tag LOCUS_02120 14134 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 14829 15233 gene locus_tag LOCUS_02130 14829 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 15890 15234 gene locus_tag LOCUS_02140 15890 15234 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250893.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence010 1432 1229 gene locus_tag LOCUS_02150 1432 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 1698 1429 gene locus_tag LOCUS_02160 1698 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 2341 1805 gene locus_tag LOCUS_02170 2341 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 3285 2635 gene locus_tag LOCUS_02180 3285 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3518 3282 gene locus_tag LOCUS_02190 3518 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4208 3594 gene locus_tag LOCUS_02200 gene radC 4208 3594 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053959.1 protein_id gnl|my_center|LOCUS_02200 4523 4320 gene locus_tag LOCUS_02210 4523 4320 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_02210 4758 4516 gene locus_tag LOCUS_02220 4758 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 5048 4824 gene locus_tag LOCUS_02230 5048 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 5901 5683 gene locus_tag LOCUS_02240 5901 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_02240 6400 5999 gene locus_tag LOCUS_02250 6400 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7392 6841 gene locus_tag LOCUS_02260 7392 6841 CDS product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267039.1 protein_id gnl|my_center|LOCUS_02260 7471 7713 gene locus_tag LOCUS_02270 7471 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 8320 7856 gene locus_tag LOCUS_02280 8320 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 8595 8449 gene locus_tag LOCUS_02290 8595 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 8877 8608 gene locus_tag LOCUS_02300 8877 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9622 9413 gene locus_tag LOCUS_02310 9622 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 9909 9622 gene locus_tag LOCUS_02320 9909 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 10238 9906 gene locus_tag LOCUS_02330 10238 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 10596 10240 gene locus_tag LOCUS_02340 10596 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 11003 10608 gene locus_tag LOCUS_02350 11003 10608 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257456.1 protein_id gnl|my_center|LOCUS_02350 11469 11044 gene locus_tag LOCUS_02360 11469 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 12850 11861 gene locus_tag LOCUS_02370 12850 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 >Feature sequence011 150 16 gene locus_tag LOCUS_02380 150 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 664 1230 gene locus_tag LOCUS_02390 664 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1238 1930 gene locus_tag LOCUS_02400 1238 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1927 2184 gene locus_tag LOCUS_02410 1927 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2305 2730 gene locus_tag LOCUS_02420 2305 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3114 2797 gene locus_tag LOCUS_02430 3114 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3466 3101 gene locus_tag LOCUS_02440 3466 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3398 3607 gene locus_tag LOCUS_02450 3398 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3601 3924 gene locus_tag LOCUS_02460 3601 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4216 3869 gene locus_tag LOCUS_02470 4216 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 4319 5353 gene locus_tag LOCUS_02480 4319 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 8141 6228 gene locus_tag LOCUS_02490 8141 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 8957 8532 gene locus_tag LOCUS_02500 8957 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 9763 8957 gene locus_tag LOCUS_02510 9763 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 9973 9764 gene locus_tag LOCUS_02520 9973 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 10746 10153 gene locus_tag LOCUS_02530 10746 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 11162 10752 gene locus_tag LOCUS_02540 11162 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 12069 11209 gene locus_tag LOCUS_02550 12069 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 12643 12062 gene locus_tag LOCUS_02560 12643 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence012 1637 4561 gene locus_tag LOCUS_02570 1637 4561 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_02570 4953 4636 gene locus_tag LOCUS_02580 4953 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 5246 6307 gene locus_tag LOCUS_02590 5246 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 6399 6710 gene locus_tag LOCUS_02600 6399 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 6872 7996 gene locus_tag LOCUS_02610 6872 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 10002 8083 gene locus_tag LOCUS_02620 10002 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 10185 10112 gene locus_tag LOCUS_t00030 10185 10112 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12103 10301 gene locus_tag LOCUS_02630 12103 10301 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence013 1118 45 gene locus_tag LOCUS_02640 1118 45 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268129.1 protein_id gnl|my_center|LOCUS_02640 1390 2118 gene locus_tag LOCUS_02650 gene phnF 1390 2118 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309142.1 protein_id gnl|my_center|LOCUS_02650 2169 3116 gene locus_tag LOCUS_02660 2169 3116 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_02660 3183 3977 gene locus_tag LOCUS_02670 gene phnC 3183 3977 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_02670 3985 5007 gene locus_tag LOCUS_02680 3985 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5079 5558 gene locus_tag LOCUS_02690 5079 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 5551 6126 gene locus_tag LOCUS_02700 gene phnH 5551 6126 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535333.1 protein_id gnl|my_center|LOCUS_02700 6126 7250 gene locus_tag LOCUS_02710 6126 7250 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258836.1 protein_id gnl|my_center|LOCUS_02710 7247 8143 gene locus_tag LOCUS_02720 7247 8143 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267545.1 protein_id gnl|my_center|LOCUS_02720 8140 8970 gene locus_tag LOCUS_02730 8140 8970 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_02730 8981 9703 gene locus_tag LOCUS_02740 gene phnL 8981 9703 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 protein_id gnl|my_center|LOCUS_02740 9700 10854 gene locus_tag LOCUS_02750 9700 10854 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 protein_id gnl|my_center|LOCUS_02750 10866 11432 gene locus_tag LOCUS_02760 gene phnN 10866 11432 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194016.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence014 2131 1019 gene locus_tag LOCUS_02770 2131 1019 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931321.1 protein_id gnl|my_center|LOCUS_02770 3288 2158 gene locus_tag LOCUS_02780 3288 2158 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808452.1 protein_id gnl|my_center|LOCUS_02780 4186 3290 gene locus_tag LOCUS_02790 4186 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5492 4197 gene locus_tag LOCUS_02800 5492 4197 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064482.1 protein_id gnl|my_center|LOCUS_02800 7278 5578 gene locus_tag LOCUS_02810 7278 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 8066 7611 gene locus_tag LOCUS_02820 8066 7611 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769527.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence015 296 718 gene locus_tag LOCUS_02830 296 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 851 1009 gene locus_tag LOCUS_02840 851 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 1348 2040 gene locus_tag LOCUS_02850 1348 2040 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_02850 2204 2380 gene locus_tag LOCUS_02860 2204 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2377 3531 gene locus_tag LOCUS_02870 2377 3531 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 protein_id gnl|my_center|LOCUS_02870 3544 4776 gene locus_tag LOCUS_02880 3544 4776 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390303.1 protein_id gnl|my_center|LOCUS_02880 4792 5913 gene locus_tag LOCUS_02890 4792 5913 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901583.1 protein_id gnl|my_center|LOCUS_02890 5958 6923 gene locus_tag LOCUS_02900 5958 6923 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_02900 7234 8448 gene locus_tag LOCUS_02910 7234 8448 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_02910 8777 9085 gene locus_tag LOCUS_02920 8777 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 9285 9210 gene locus_tag LOCUS_t00040 9285 9210 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence016 52 2124 gene locus_tag LOCUS_02930 52 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2929 7077 gene locus_tag LOCUS_02940 2929 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 7232 7567 gene locus_tag LOCUS_02950 7232 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 7663 8145 gene locus_tag LOCUS_02960 7663 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 8535 8927 gene locus_tag LOCUS_02970 8535 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence017 838 2607 gene locus_tag LOCUS_02980 838 2607 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_02980 7952 2742 gene locus_tag LOCUS_02990 7952 2742 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966317.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence018 550 212 gene locus_tag LOCUS_03000 550 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 1944 547 gene locus_tag LOCUS_03010 1944 547 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224018.1 protein_id gnl|my_center|LOCUS_03010 2666 1950 gene locus_tag LOCUS_03020 2666 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2895 3203 gene locus_tag LOCUS_03030 2895 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 3200 4135 gene locus_tag LOCUS_03040 3200 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4268 5161 gene locus_tag LOCUS_03050 4268 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 5171 5407 gene locus_tag LOCUS_03060 5171 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 6089 5589 gene locus_tag LOCUS_03070 6089 5589 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_03070 6103 6750 gene locus_tag LOCUS_03080 gene nth 6103 6750 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_03080 7338 6772 gene locus_tag LOCUS_03090 7338 6772 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762644.1 protein_id gnl|my_center|LOCUS_03090 >Feature sequence019 642 1295 gene locus_tag LOCUS_03100 642 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 1398 1649 gene locus_tag LOCUS_03110 1398 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1741 3369 gene locus_tag LOCUS_03120 1741 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3486 3719 gene locus_tag LOCUS_03130 3486 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 3738 4013 gene locus_tag LOCUS_03140 3738 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4533 4898 gene locus_tag LOCUS_03150 4533 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5014 6249 gene locus_tag LOCUS_03160 5014 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 6798 7247 gene locus_tag LOCUS_03170 6798 7247 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_03170 7835 7338 gene locus_tag LOCUS_03180 7835 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 >Feature sequence020 913 539 gene locus_tag LOCUS_03190 913 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 984 2297 gene locus_tag LOCUS_03200 984 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 2381 2977 gene locus_tag LOCUS_03210 2381 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3750 2992 gene locus_tag LOCUS_03220 3750 2992 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_03220 4296 4045 gene locus_tag LOCUS_03230 4296 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4877 5497 gene locus_tag LOCUS_03240 4877 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 5983 5507 gene locus_tag LOCUS_03250 5983 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 6753 6115 gene locus_tag LOCUS_03260 6753 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6820 7728 gene locus_tag LOCUS_03270 6820 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence021 440 147 gene locus_tag LOCUS_03280 440 147 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213508.1 protein_id gnl|my_center|LOCUS_03280 766 494 gene locus_tag LOCUS_03290 766 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1200 793 gene locus_tag LOCUS_03300 1200 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 1778 2119 gene locus_tag LOCUS_03310 1778 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 2274 2846 gene locus_tag LOCUS_03320 2274 2846 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964079.1 protein_id gnl|my_center|LOCUS_03320 2843 2974 gene locus_tag LOCUS_03330 2843 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4183 3344 gene locus_tag LOCUS_03340 4183 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4291 4638 gene locus_tag LOCUS_03350 4291 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 4971 5426 gene locus_tag LOCUS_03360 4971 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5416 5973 gene locus_tag LOCUS_03370 5416 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 5973 6278 gene locus_tag LOCUS_03380 5973 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 6294 6506 gene locus_tag LOCUS_03390 6294 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 6503 6928 gene locus_tag LOCUS_03400 6503 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence022 226 1782 gene locus_tag LOCUS_03410 226 1782 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_03410 3167 2139 gene locus_tag LOCUS_03420 3167 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 4030 3203 gene locus_tag LOCUS_03430 4030 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 4709 4296 gene locus_tag LOCUS_03440 4709 4296 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968794.1 protein_id gnl|my_center|LOCUS_03440 6691 5240 gene locus_tag LOCUS_03450 6691 5240 CDS product SEFIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119720.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence023 454 2010 gene locus_tag LOCUS_03460 454 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 4296 2524 gene locus_tag LOCUS_03470 4296 2524 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365322.1 protein_id gnl|my_center|LOCUS_03470 4427 4648 gene locus_tag LOCUS_03480 4427 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 4687 6513 gene locus_tag LOCUS_03490 4687 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence024 67 939 gene locus_tag LOCUS_03500 67 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 932 1342 gene locus_tag LOCUS_03510 932 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 2733 3059 gene locus_tag LOCUS_03520 2733 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3605 3994 gene locus_tag LOCUS_03530 3605 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5005 4598 gene locus_tag LOCUS_03540 5005 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5196 5002 gene locus_tag LOCUS_03550 5196 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence025 455 778 gene locus_tag LOCUS_03560 455 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1454 831 gene locus_tag LOCUS_03570 1454 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1957 1451 gene locus_tag LOCUS_03580 1957 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2761 2417 gene locus_tag LOCUS_03590 2761 2417 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919247.1 protein_id gnl|my_center|LOCUS_03590 2853 3887 gene locus_tag LOCUS_03600 2853 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4389 4093 gene locus_tag LOCUS_03610 4389 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 5401 4553 gene locus_tag LOCUS_03620 5401 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 5479 5787 gene locus_tag LOCUS_03630 5479 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence026 718 3879 gene locus_tag LOCUS_03640 718 3879 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_03640 3903 4937 gene locus_tag LOCUS_03650 3903 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 5605 5216 gene locus_tag LOCUS_03660 5605 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence027 465 809 gene locus_tag LOCUS_03670 465 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1300 974 gene locus_tag LOCUS_03680 1300 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1749 5156 gene locus_tag LOCUS_03690 1749 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 5166 6128 gene locus_tag LOCUS_03700 5166 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence028 699 1535 gene locus_tag LOCUS_03710 699 1535 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 protein_id gnl|my_center|LOCUS_03710 1539 3113 gene locus_tag LOCUS_03720 1539 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4042 3110 gene locus_tag LOCUS_03730 4042 3110 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462872.1 protein_id gnl|my_center|LOCUS_03730 5401 4061 gene locus_tag LOCUS_03740 5401 4061 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_03740 5582 6076 gene locus_tag LOCUS_03750 5582 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence029 487 200 gene locus_tag LOCUS_03760 487 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 654 3194 gene locus_tag LOCUS_03770 654 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4130 3570 gene locus_tag LOCUS_03780 4130 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 4391 4146 gene locus_tag LOCUS_03790 4391 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 5446 4700 gene locus_tag LOCUS_03800 5446 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence030 659 883 gene locus_tag LOCUS_03810 659 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 880 3759 gene locus_tag LOCUS_03820 880 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5400 3766 gene locus_tag LOCUS_03830 5400 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence031 343 122 gene locus_tag LOCUS_03840 gene rpl18a 343 122 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250273.1 protein_id gnl|my_center|LOCUS_03840 1016 354 gene locus_tag LOCUS_03850 1016 354 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_03850 1283 1029 gene locus_tag LOCUS_03860 1283 1029 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_03860 1447 1292 gene locus_tag LOCUS_03870 1447 1292 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_03870 1790 1449 gene locus_tag LOCUS_03880 1790 1449 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 protein_id gnl|my_center|LOCUS_03880 2229 1783 gene locus_tag LOCUS_03890 2229 1783 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_03890 2717 2406 gene locus_tag LOCUS_03900 2717 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3414 2707 gene locus_tag LOCUS_03910 3414 2707 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 protein_id gnl|my_center|LOCUS_03910 3313 3966 gene locus_tag LOCUS_03920 3313 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 3977 4645 gene locus_tag LOCUS_03930 3977 4645 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941515.1 protein_id gnl|my_center|LOCUS_03930 5126 4689 gene locus_tag LOCUS_03940 5126 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5359 5111 gene locus_tag LOCUS_03950 5359 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence032 150 377 gene locus_tag LOCUS_03960 150 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 672 430 gene locus_tag LOCUS_03970 672 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1640 687 gene locus_tag LOCUS_03980 1640 687 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_03980 3097 1637 gene locus_tag LOCUS_03990 3097 1637 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_03990 3363 3145 gene locus_tag LOCUS_04000 3363 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4010 3381 gene locus_tag LOCUS_04010 gene parA 4010 3381 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666923.1 protein_id gnl|my_center|LOCUS_04010 4734 4102 gene locus_tag LOCUS_04020 gene mobC 4734 4102 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040061.1 protein_id gnl|my_center|LOCUS_04020 5057 5431 gene locus_tag LOCUS_04030 5057 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 >Feature sequence033 2783 606 gene locus_tag LOCUS_04040 gene katG 2783 606 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_04040 3339 2860 gene locus_tag LOCUS_04050 3339 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3902 3444 gene locus_tag LOCUS_04060 3902 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 4133 3924 gene locus_tag LOCUS_04070 4133 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 4608 4138 gene locus_tag LOCUS_04080 4608 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4999 4733 gene locus_tag LOCUS_04090 4999 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5273 5088 gene locus_tag LOCUS_04100 5273 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence034 1469 1017 gene locus_tag LOCUS_04110 1469 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2044 1535 gene locus_tag LOCUS_04120 2044 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2429 2208 gene locus_tag LOCUS_04130 2429 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 3075 2533 gene locus_tag LOCUS_04140 3075 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3915 3619 gene locus_tag LOCUS_04150 3915 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4922 4539 gene locus_tag LOCUS_04160 4922 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence035 209 442 gene locus_tag LOCUS_04170 209 442 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968496.1 protein_id gnl|my_center|LOCUS_04170 704 2212 gene locus_tag LOCUS_04180 704 2212 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_04180 2878 2381 gene locus_tag LOCUS_04190 2878 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3175 3720 gene locus_tag LOCUS_04200 3175 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4354 4665 gene locus_tag LOCUS_04210 4354 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence036 770 24 gene locus_tag LOCUS_04220 770 24 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223802.1 protein_id gnl|my_center|LOCUS_04220 1720 2079 gene locus_tag LOCUS_04230 1720 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 2183 2365 gene locus_tag LOCUS_04240 2183 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3182 2379 gene locus_tag LOCUS_04250 3182 2379 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414201.1 protein_id gnl|my_center|LOCUS_04250 4435 3179 gene locus_tag LOCUS_04260 4435 3179 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence037 431 123 gene locus_tag LOCUS_04270 431 123 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 protein_id gnl|my_center|LOCUS_04270 757 431 gene locus_tag LOCUS_04280 757 431 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 protein_id gnl|my_center|LOCUS_04280 861 1064 gene locus_tag LOCUS_04290 861 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2118 1183 gene locus_tag LOCUS_04300 2118 1183 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268128.1 protein_id gnl|my_center|LOCUS_04300 2387 3337 gene locus_tag LOCUS_04310 2387 3337 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268129.1 protein_id gnl|my_center|LOCUS_04310 3574 4098 gene locus_tag LOCUS_04320 3574 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4100 4693 gene locus_tag LOCUS_04330 4100 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5054 4758 gene locus_tag LOCUS_04340 5054 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5543 5205 gene locus_tag LOCUS_04350 5543 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence038 <1 712 gene locus_tag LOCUS_04360 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259194.1:2-dehydropantoate 2-reductase 1328 1579 gene locus_tag LOCUS_04370 1328 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1659 1838 gene locus_tag LOCUS_04380 1659 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 2099 3181 gene locus_tag LOCUS_04390 2099 3181 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321414.1 protein_id gnl|my_center|LOCUS_04390 3867 3205 gene locus_tag LOCUS_04400 3867 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3755 4171 gene locus_tag LOCUS_04410 3755 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 4889 4794 gene locus_tag LOCUS_t00050 4889 4794 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 1390 2001 gene locus_tag LOCUS_04420 1390 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 2046 2720 gene locus_tag LOCUS_04430 2046 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence040 <1 770 gene locus_tag LOCUS_04440 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206681.1:chromate efflux transporter 1063 1548 gene locus_tag LOCUS_04450 1063 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1815 1618 gene locus_tag LOCUS_04460 1815 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 1974 4481 gene locus_tag LOCUS_04470 1974 4481 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187006353.1 protein_id gnl|my_center|LOCUS_04470 4573 5199 gene locus_tag LOCUS_04480 4573 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence041 373 5250 gene locus_tag LOCUS_04490 373 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence042 2005 1661 gene locus_tag LOCUS_04500 2005 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2207 1977 gene locus_tag LOCUS_04510 2207 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3625 2315 gene locus_tag LOCUS_04520 3625 2315 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868644.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence043 1303 101 gene locus_tag LOCUS_04530 1303 101 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250764.1 protein_id gnl|my_center|LOCUS_04530 1588 1307 gene locus_tag LOCUS_04540 1588 1307 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876898.1 protein_id gnl|my_center|LOCUS_04540 1949 1563 gene locus_tag LOCUS_04550 1949 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 2206 1925 gene locus_tag LOCUS_04560 2206 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04560 2959 3822 gene locus_tag LOCUS_04570 2959 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 4785 3778 gene locus_tag LOCUS_04580 4785 3778 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061273.1 protein_id gnl|my_center|LOCUS_04580 >Feature sequence044 <1 825 gene locus_tag LOCUS_04590 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037390999.1:DMT family transporter 888 2171 gene locus_tag LOCUS_04600 888 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2178 5174 gene locus_tag LOCUS_04610 2178 5174 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153164114.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence045 1244 396 gene locus_tag LOCUS_04620 1244 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 1255 1458 gene locus_tag LOCUS_04630 1255 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 2466 1774 gene locus_tag LOCUS_04640 2466 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3079 2876 gene locus_tag LOCUS_04650 3079 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4109 3459 gene locus_tag LOCUS_04660 4109 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 4212 5163 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatccctttcaaatcagggcattcttgaatc >Feature sequence046 1934 591 gene locus_tag LOCUS_04670 1934 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4838 2370 gene locus_tag LOCUS_04680 4838 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence047 7 960 gene locus_tag LOCUS_04690 7 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 1345 983 gene locus_tag LOCUS_04700 1345 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 1644 1345 gene locus_tag LOCUS_04710 1644 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 1951 1646 gene locus_tag LOCUS_04720 1951 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2270 1953 gene locus_tag LOCUS_04730 2270 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2429 2629 gene locus_tag LOCUS_04740 2429 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2873 2571 gene locus_tag LOCUS_04750 2873 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3423 2905 gene locus_tag LOCUS_04760 3423 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4576 3626 gene locus_tag LOCUS_04770 4576 3626 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence048 508 266 gene locus_tag LOCUS_04780 508 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 970 587 gene locus_tag LOCUS_04790 970 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1382 948 gene locus_tag LOCUS_04800 1382 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 1451 2602 gene locus_tag LOCUS_04810 1451 2602 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_04810 2641 3369 gene locus_tag LOCUS_04820 2641 3369 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_04820 3411 4316 gene locus_tag LOCUS_04830 3411 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4317 4793 gene locus_tag LOCUS_04840 4317 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence049 535 1050 gene locus_tag LOCUS_04850 535 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1284 1892 gene locus_tag LOCUS_04860 1284 1892 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054659530.1 protein_id gnl|my_center|LOCUS_04860 2118 2678 gene locus_tag LOCUS_04870 2118 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 2729 3334 gene locus_tag LOCUS_04880 2729 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3602 3832 gene locus_tag LOCUS_04890 3602 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4002 4367 gene locus_tag LOCUS_04900 4002 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence050 936 166 gene locus_tag LOCUS_04910 936 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 1988 933 gene locus_tag LOCUS_04920 gene trpD 1988 933 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_04920 3513 1990 gene locus_tag LOCUS_04930 gene trpE 3513 1990 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870587.1 protein_id gnl|my_center|LOCUS_04930 3656 4042 gene locus_tag LOCUS_04940 3656 4042 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965103.1 protein_id gnl|my_center|LOCUS_04940 4039 4218 gene locus_tag LOCUS_04950 4039 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 <4865 4236 gene locus_tag LOCUS_04960 <4865 4236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021413.1:amino acid-binding protein >Feature sequence051 4 1132 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccacgcgcattcacgcgtggagac 1344 1177 gene locus_tag LOCUS_04970 1344 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 1641 1351 gene locus_tag LOCUS_04980 1641 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 3302 1641 gene locus_tag LOCUS_04990 gene cas1 3302 1641 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_04990 3564 4013 gene locus_tag LOCUS_05000 3564 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4121 4324 gene locus_tag LOCUS_05010 4121 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence052 <1 1017 gene locus_tag LOCUS_05020 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250274.1:glycosyltransferase family 4 protein 992 1720 gene locus_tag LOCUS_05030 992 1720 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_05030 1717 2709 gene locus_tag LOCUS_05040 1717 2709 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_05040 2797 3855 gene locus_tag LOCUS_05050 2797 3855 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583970.1 protein_id gnl|my_center|LOCUS_05050 <4827 3852 gene locus_tag LOCUS_05060 <4827 3852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583970.1:glycosyltransferase family 4 protein >Feature sequence053 1834 893 gene locus_tag LOCUS_05070 1834 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2456 1878 gene locus_tag LOCUS_05080 2456 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3471 2788 gene locus_tag LOCUS_05090 3471 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4086 3535 gene locus_tag LOCUS_05100 4086 3535 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_05100 4318 4118 gene locus_tag LOCUS_05110 4318 4118 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_05110 4715 4302 gene locus_tag LOCUS_05120 4715 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence054 <1 1515 gene locus_tag LOCUS_05130 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000384831.1:class I SAM-dependent DNA methyltransferase 1728 3377 gene locus_tag LOCUS_05140 1728 3377 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583749.1 protein_id gnl|my_center|LOCUS_05140 4232 3693 gene locus_tag LOCUS_05150 4232 3693 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence055 2092 1106 gene locus_tag LOCUS_05160 gene ilvC 2092 1106 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_05160 2632 2144 gene locus_tag LOCUS_05170 gene ilvN 2632 2144 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_05170 4320 2641 gene locus_tag LOCUS_05180 4320 2641 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence056 153 539 gene locus_tag LOCUS_05190 153 539 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_05190 553 1338 gene locus_tag LOCUS_05200 553 1338 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_05200 1389 1476 gene locus_tag LOCUS_t00060 1389 1476 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1614 1811 gene locus_tag LOCUS_05210 1614 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1798 2082 gene locus_tag LOCUS_05220 1798 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2327 3334 gene locus_tag LOCUS_05230 2327 3334 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_05230 3412 3999 gene locus_tag LOCUS_05240 3412 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05240 4003 4563 gene locus_tag LOCUS_05250 4003 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05250 >Feature sequence057 332 159 gene locus_tag LOCUS_05260 332 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 792 325 gene locus_tag LOCUS_05270 792 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1511 792 gene locus_tag LOCUS_05280 1511 792 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_05280 4459 1511 gene locus_tag LOCUS_05290 4459 1511 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480405.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence058 1652 444 gene locus_tag LOCUS_05300 1652 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 1894 1670 gene locus_tag LOCUS_05310 1894 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 3243 1906 gene locus_tag LOCUS_05320 3243 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3879 3559 gene locus_tag LOCUS_05330 3879 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4094 3834 gene locus_tag LOCUS_05340 4094 3834 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence059 517 179 gene locus_tag LOCUS_05350 517 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1070 585 gene locus_tag LOCUS_05360 1070 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 2469 2182 gene locus_tag LOCUS_05370 2469 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 3022 2771 gene locus_tag LOCUS_05380 3022 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05380 3381 3094 gene locus_tag LOCUS_05390 3381 3094 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 protein_id gnl|my_center|LOCUS_05390 3644 3378 gene locus_tag LOCUS_05400 3644 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence060 <1 797 gene locus_tag LOCUS_05410 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942084.1:M48 family metallopeptidase 2302 1745 gene locus_tag LOCUS_05420 2302 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 2621 2409 gene locus_tag LOCUS_05430 2621 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2943 2716 gene locus_tag LOCUS_05440 2943 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3491 2955 gene locus_tag LOCUS_05450 3491 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4085 3588 gene locus_tag LOCUS_05460 4085 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence061 1 1059 gene locus_tag LOCUS_05470 1 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 1116 1316 gene locus_tag LOCUS_05480 1116 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 1897 1421 gene locus_tag LOCUS_05490 gene cadR 1897 1421 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_05490 2066 2626 gene locus_tag LOCUS_05500 2066 2626 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_05500 2743 3114 gene locus_tag LOCUS_05510 2743 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3269 3619 gene locus_tag LOCUS_05520 3269 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence062 210 500 gene locus_tag LOCUS_05530 210 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1533 3302 gene locus_tag LOCUS_05540 1533 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3318 4001 gene locus_tag LOCUS_05550 3318 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence063 112 366 gene locus_tag LOCUS_05560 112 366 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_05560 363 785 gene locus_tag LOCUS_05570 363 785 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_05570 922 1287 gene locus_tag LOCUS_05580 922 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1390 2562 gene locus_tag LOCUS_05590 1390 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence064 1478 1146 gene locus_tag LOCUS_05600 1478 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 1365 4127 gene locus_tag LOCUS_05610 1365 4127 CDS product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence065 227 568 gene locus_tag LOCUS_05620 227 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 662 1027 gene locus_tag LOCUS_05630 662 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1090 1401 gene locus_tag LOCUS_05640 1090 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1670 1885 gene locus_tag LOCUS_05650 1670 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1953 2468 gene locus_tag LOCUS_05660 1953 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2930 3646 gene locus_tag LOCUS_05670 2930 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3947 4090 gene locus_tag LOCUS_05680 3947 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence066 142 897 gene locus_tag LOCUS_05690 142 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 894 1148 gene locus_tag LOCUS_05700 894 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 1145 2266 gene locus_tag LOCUS_05710 1145 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 2271 2528 gene locus_tag LOCUS_05720 2271 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2536 3189 gene locus_tag LOCUS_05730 2536 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3186 3782 gene locus_tag LOCUS_05740 3186 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3776 4009 gene locus_tag LOCUS_05750 3776 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence067 1339 845 gene locus_tag LOCUS_05760 1339 845 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930802.1 protein_id gnl|my_center|LOCUS_05760 1406 2530 gene locus_tag LOCUS_05770 1406 2530 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_05770 2601 3194 gene locus_tag LOCUS_05780 2601 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3191 3604 gene locus_tag LOCUS_05790 3191 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4119 3763 gene locus_tag LOCUS_05800 4119 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence068 488 928 gene locus_tag LOCUS_05810 488 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 1228 1659 gene locus_tag LOCUS_05820 1228 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040068.1 protein_id gnl|my_center|LOCUS_05820 1656 1910 gene locus_tag LOCUS_05830 1656 1910 CDS product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040067.1 protein_id gnl|my_center|LOCUS_05830 1921 3015 gene locus_tag LOCUS_05840 1921 3015 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040066.1 protein_id gnl|my_center|LOCUS_05840 3022 3324 gene locus_tag LOCUS_05850 3022 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040065.1 protein_id gnl|my_center|LOCUS_05850 3321 3479 gene locus_tag LOCUS_05860 3321 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040064.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence069 578 946 gene locus_tag LOCUS_05870 578 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 1077 1799 gene locus_tag LOCUS_05880 1077 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141459.1 protein_id gnl|my_center|LOCUS_05880 1967 1743 gene locus_tag LOCUS_05890 1967 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2688 2524 gene locus_tag LOCUS_05900 2688 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2997 3233 gene locus_tag LOCUS_05910 2997 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3420 3944 gene locus_tag LOCUS_05920 3420 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence070 263 553 gene locus_tag LOCUS_05930 263 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 680 1270 gene locus_tag LOCUS_05940 680 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1405 2019 gene locus_tag LOCUS_05950 1405 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2123 3034 gene locus_tag LOCUS_05960 2123 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3111 3701 gene locus_tag LOCUS_05970 3111 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence071 2721 1996 gene locus_tag LOCUS_05980 2721 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3963 2731 gene locus_tag LOCUS_05990 3963 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence072 428 27 gene locus_tag LOCUS_06000 428 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1102 710 gene locus_tag LOCUS_06010 1102 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1446 2600 gene locus_tag LOCUS_06020 1446 2600 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228989.1 protein_id gnl|my_center|LOCUS_06020 <3977 2778 gene locus_tag LOCUS_06030 <3977 2778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065226.1:replication factor C large subunit >Feature sequence073 <1 1483 gene locus_tag LOCUS_06040 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052292216.1:radical SAM protein 1497 1805 gene locus_tag LOCUS_06050 1497 1805 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868081.1 protein_id gnl|my_center|LOCUS_06050 1828 2433 gene locus_tag LOCUS_06060 1828 2433 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_06060 2886 2476 gene locus_tag LOCUS_06070 2886 2476 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902004.1 protein_id gnl|my_center|LOCUS_06070 3137 2883 gene locus_tag LOCUS_06080 3137 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence074 993 277 gene locus_tag LOCUS_06090 993 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1602 1141 gene locus_tag LOCUS_06100 1602 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2226 1681 gene locus_tag LOCUS_06110 2226 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2608 2255 gene locus_tag LOCUS_06120 2608 2255 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_06120 2931 2605 gene locus_tag LOCUS_06130 2931 2605 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_06130 3370 3092 gene locus_tag LOCUS_06140 3370 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3602 3327 gene locus_tag LOCUS_06150 3602 3327 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064047.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence075 2550 529 gene locus_tag LOCUS_06160 2550 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 3439 2630 gene locus_tag LOCUS_06170 3439 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence076 224 1255 gene locus_tag LOCUS_06180 224 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1261 2316 gene locus_tag LOCUS_06190 1261 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_06190 2430 3680 gene locus_tag LOCUS_06200 2430 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence077 81 884 gene locus_tag LOCUS_06210 81 884 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_06210 2405 1053 gene locus_tag LOCUS_06220 2405 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2628 2966 gene locus_tag LOCUS_06230 2628 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 <3832 2905 gene locus_tag LOCUS_06240 <3832 2905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876684.1:translation elongation factor EF-1 subunit alpha >Feature sequence078 943 425 gene locus_tag LOCUS_06250 943 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 1683 1120 gene locus_tag LOCUS_06260 1683 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06260 3035 1728 gene locus_tag LOCUS_06270 3035 1728 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence079 1203 682 gene locus_tag LOCUS_06280 1203 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 1462 1208 gene locus_tag LOCUS_06290 1462 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 1915 2883 gene locus_tag LOCUS_06300 1915 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3239 2892 gene locus_tag LOCUS_06310 3239 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3479 3404 gene locus_tag LOCUS_t00070 3479 3404 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence080 <1 583 gene locus_tag LOCUS_06320 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060905.1:5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH 1455 508 gene locus_tag LOCUS_06330 gene cofD 1455 508 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870769.1 protein_id gnl|my_center|LOCUS_06330 2200 1460 gene locus_tag LOCUS_06340 gene cofE 2200 1460 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_06340 2254 3228 gene locus_tag LOCUS_06350 gene mer 2254 3228 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_06350 3718 3230 gene locus_tag LOCUS_06360 3718 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence081 <1 1422 gene locus_tag LOCUS_06370 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083750460.1:CpaF family protein 1404 3374 gene locus_tag LOCUS_06380 1404 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence082 1062 1493 gene locus_tag LOCUS_06390 1062 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1598 1909 gene locus_tag LOCUS_06400 1598 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2325 2999 gene locus_tag LOCUS_06410 2325 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence083 158 1099 gene locus_tag LOCUS_06420 gene eif2g 158 1099 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_06420 1144 1533 gene locus_tag LOCUS_06430 1144 1533 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250895.1 protein_id gnl|my_center|LOCUS_06430 1541 3550 gene locus_tag LOCUS_06440 1541 3550 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence084 3079 839 gene locus_tag LOCUS_06450 3079 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence085 <1 905 gene locus_tag LOCUS_06460 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388138.1:gamma-glutamyltransferase 931 3198 gene locus_tag LOCUS_06470 931 3198 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 protein_id gnl|my_center|LOCUS_06470 3173 3442 gene locus_tag LOCUS_06480 3173 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence086 1013 582 gene locus_tag LOCUS_06490 1013 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1475 1020 gene locus_tag LOCUS_06500 1475 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 1474 1719 gene locus_tag LOCUS_06510 1474 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1721 1945 gene locus_tag LOCUS_06520 1721 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2908 1937 gene locus_tag LOCUS_06530 2908 1937 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867338.1 protein_id gnl|my_center|LOCUS_06530 <3511 2893 gene locus_tag LOCUS_06540 <3511 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436928.1:radical SAM protein >Feature sequence087 1541 366 gene locus_tag LOCUS_06550 1541 366 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_06550 <3497 1538 gene locus_tag LOCUS_06560 <3497 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546388.1:transketolase >Feature sequence088 517 918 gene locus_tag LOCUS_06570 517 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 2205 2029 gene locus_tag LOCUS_06580 2205 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2482 2958 gene locus_tag LOCUS_06590 2482 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence089 <1 661 gene locus_tag LOCUS_06600 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein 670 1053 gene locus_tag LOCUS_06610 670 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 1283 1059 gene locus_tag LOCUS_06620 1283 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1525 1295 gene locus_tag LOCUS_06630 1525 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1928 1539 gene locus_tag LOCUS_06640 1928 1539 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083575.1 protein_id gnl|my_center|LOCUS_06640 2260 1925 gene locus_tag LOCUS_06650 2260 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2542 2273 gene locus_tag LOCUS_06660 2542 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence090 1164 2447 gene locus_tag LOCUS_06670 1164 2447 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980656.1 protein_id gnl|my_center|LOCUS_06670 3364 2606 gene locus_tag LOCUS_06680 3364 2606 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249902.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence091 1218 655 gene locus_tag LOCUS_06690 1218 655 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024831595.1 protein_id gnl|my_center|LOCUS_06690 2332 1211 gene locus_tag LOCUS_06700 2332 1211 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272381.1 protein_id gnl|my_center|LOCUS_06700 2636 2301 gene locus_tag LOCUS_06710 2636 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3050 2637 gene locus_tag LOCUS_06720 3050 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence092 1135 104 gene locus_tag LOCUS_06730 1135 104 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108412.1 protein_id gnl|my_center|LOCUS_06730 2109 1132 gene locus_tag LOCUS_06740 2109 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 3328 2102 gene locus_tag LOCUS_06750 3328 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence093 649 578 gene locus_tag LOCUS_t00080 649 578 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2315 705 gene locus_tag LOCUS_06760 gene lysS 2315 705 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_06760 2682 2374 gene locus_tag LOCUS_06770 2682 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence094 1161 433 gene locus_tag LOCUS_06780 1161 433 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_06780 1998 1363 gene locus_tag LOCUS_06790 1998 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2410 2003 gene locus_tag LOCUS_06800 2410 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3153 2686 gene locus_tag LOCUS_06810 3153 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence095 209 1234 gene locus_tag LOCUS_06820 209 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1510 2772 gene locus_tag LOCUS_06830 1510 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence096 383 1537 gene locus_tag LOCUS_06840 gene cobD 383 1537 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_06840 1880 2821 gene locus_tag LOCUS_06850 gene cbiB 1880 2821 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence097 <1 757 gene locus_tag LOCUS_06860 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965993.1:branched-chain amino acid ABC transporter permease 754 1725 gene locus_tag LOCUS_06870 754 1725 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_06870 1706 2491 gene locus_tag LOCUS_06880 1706 2491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879470.1 protein_id gnl|my_center|LOCUS_06880 2481 3200 gene locus_tag LOCUS_06890 2481 3200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence098 737 372 gene locus_tag LOCUS_06900 737 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2052 1423 gene locus_tag LOCUS_06910 2052 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2874 2479 gene locus_tag LOCUS_06920 2874 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence099 859 86 gene locus_tag LOCUS_06930 gene truA 859 86 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_06930 932 1417 gene locus_tag LOCUS_06940 932 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1529 2245 gene locus_tag LOCUS_06950 1529 2245 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence100 <1 894 gene locus_tag LOCUS_06960 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529345.1:IS1595 family transposase 1095 1505 gene locus_tag LOCUS_06970 1095 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1547 1640 gene locus_tag LOCUS_t00090 1547 1640 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2216 2611 gene locus_tag LOCUS_06980 2216 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence101 <1 548 gene locus_tag LOCUS_06990 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868483.1:pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma 548 808 gene locus_tag LOCUS_07000 gene porD 548 808 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250932.1 protein_id gnl|my_center|LOCUS_07000 805 1989 gene locus_tag LOCUS_07010 gene porA 805 1989 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868478.1 protein_id gnl|my_center|LOCUS_07010 2064 2858 gene locus_tag LOCUS_07020 gene porB 2064 2858 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence102 171 350 gene locus_tag LOCUS_07030 171 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 583 1443 gene locus_tag LOCUS_07040 583 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1433 2083 gene locus_tag LOCUS_07050 1433 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3319 2171 gene locus_tag LOCUS_07060 3319 2171 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763625.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence103 358 50 gene locus_tag LOCUS_07070 358 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07070 776 414 gene locus_tag LOCUS_07080 776 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07080 2193 997 gene locus_tag LOCUS_07090 2193 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 <3271 2242 gene locus_tag LOCUS_07100 <3271 2242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391684.1:DUF763 domain-containing protein >Feature sequence104 238 447 gene locus_tag LOCUS_07110 238 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 460 1557 gene locus_tag LOCUS_07120 gene ftsZ 460 1557 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_07120 2213 1578 gene locus_tag LOCUS_07130 2213 1578 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_07130 <3269 2214 gene locus_tag LOCUS_07140 <3269 2214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080396.1:methionine--tRNA ligase >Feature sequence105 2783 1860 gene locus_tag LOCUS_07150 2783 1860 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence106 1003 44 gene locus_tag LOCUS_07160 1003 44 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530589.1 protein_id gnl|my_center|LOCUS_07160 1670 1134 gene locus_tag LOCUS_07170 1670 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2962 1682 gene locus_tag LOCUS_07180 2962 1682 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878920.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence107 172 1332 gene locus_tag LOCUS_07190 172 1332 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 protein_id gnl|my_center|LOCUS_07190 1396 2946 gene locus_tag LOCUS_07200 gene fdrA 1396 2946 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence108 1494 334 gene locus_tag LOCUS_07210 1494 334 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_07210 2576 1527 gene locus_tag LOCUS_07220 2576 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence109 144 3158 gene locus_tag LOCUS_07230 144 3158 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222049.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence110 44 688 gene locus_tag LOCUS_07240 44 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 1160 987 gene locus_tag LOCUS_07250 1160 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1744 1157 gene locus_tag LOCUS_07260 1744 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence111 324 1025 gene locus_tag LOCUS_07270 324 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 1900 1232 gene locus_tag LOCUS_07280 1900 1232 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 protein_id gnl|my_center|LOCUS_07280 <3201 1897 gene locus_tag LOCUS_07290 <3201 1897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391571.1:histidine kinase >Feature sequence112 754 1896 gene locus_tag LOCUS_07300 754 1896 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147062.1 protein_id gnl|my_center|LOCUS_07300 <3186 1999 gene locus_tag LOCUS_07310 <3186 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878082.1:M28 family metallopeptidase >Feature sequence113 830 312 gene locus_tag LOCUS_07320 830 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1242 991 gene locus_tag LOCUS_07330 1242 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3065 1239 gene locus_tag LOCUS_07340 3065 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence114 1091 309 gene locus_tag LOCUS_07350 1091 309 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_07350 1209 1508 gene locus_tag LOCUS_07360 1209 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1613 2509 gene locus_tag LOCUS_07370 1613 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3181 2528 gene locus_tag LOCUS_07380 3181 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence115 674 1657 gene locus_tag LOCUS_07390 674 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2129 2395 gene locus_tag LOCUS_07400 2129 2395 CDS product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036265.1 protein_id gnl|my_center|LOCUS_07400 2630 2436 gene locus_tag LOCUS_07410 2630 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence116 1321 293 gene locus_tag LOCUS_07420 1321 293 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_07420 2003 1326 gene locus_tag LOCUS_07430 2003 1326 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066212.1 protein_id gnl|my_center|LOCUS_07430 <3137 2035 gene locus_tag LOCUS_07440 <3137 2035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250738.1:tripartite tricarboxylate transporter permease >Feature sequence117 1637 432 gene locus_tag LOCUS_07450 1637 432 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_07450 2078 1650 gene locus_tag LOCUS_07460 gene argR 2078 1650 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_07460 3027 2095 gene locus_tag LOCUS_07470 gene argF 3027 2095 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence118 452 1714 gene locus_tag LOCUS_07480 452 1714 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103387.1 protein_id gnl|my_center|LOCUS_07480 1760 2965 gene locus_tag LOCUS_07490 1760 2965 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742961.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence119 424 20 gene locus_tag LOCUS_07500 424 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1299 718 gene locus_tag LOCUS_07510 1299 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2498 1296 gene locus_tag LOCUS_07520 2498 1296 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence120 171 410 gene locus_tag LOCUS_07530 171 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2423 480 gene locus_tag LOCUS_07540 2423 480 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 protein_id gnl|my_center|LOCUS_07540 2753 2436 gene locus_tag LOCUS_07550 2753 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence121 106 918 gene locus_tag LOCUS_07560 106 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1374 2723 gene locus_tag LOCUS_07570 gene ltrA 1374 2723 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence122 904 26 gene locus_tag LOCUS_07580 904 26 CDS product IS481-like element ISA0963-3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064386.1 protein_id gnl|my_center|LOCUS_07580 1223 1486 gene locus_tag LOCUS_07590 1223 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2459 1584 gene locus_tag LOCUS_07600 2459 1584 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320034.1 protein_id gnl|my_center|LOCUS_07600 2878 2456 gene locus_tag LOCUS_07610 2878 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence123 1052 228 gene locus_tag LOCUS_07620 gene hisF 1052 228 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_07620 1675 1055 gene locus_tag LOCUS_07630 gene hisH 1675 1055 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence124 752 1609 gene locus_tag LOCUS_07640 752 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1778 2257 gene locus_tag LOCUS_07650 1778 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence125 3 458 gene locus_tag LOCUS_07660 3 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 830 465 gene locus_tag LOCUS_07670 830 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2689 887 gene locus_tag LOCUS_07680 2689 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence126 55 1362 gene locus_tag LOCUS_07690 55 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1283 1756 gene locus_tag LOCUS_07700 1283 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence127 113 271 gene locus_tag LOCUS_07710 113 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 364 1494 gene locus_tag LOCUS_07720 364 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence128 1382 1245 gene locus_tag LOCUS_r00010 1382 1245 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2681 1806 gene locus_tag LOCUS_07730 2681 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence129 1250 1906 gene locus_tag LOCUS_07740 1250 1906 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence130 162 704 gene locus_tag LOCUS_07750 162 704 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_07750 722 958 gene locus_tag LOCUS_07760 722 958 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868268.1 protein_id gnl|my_center|LOCUS_07760 960 1946 gene locus_tag LOCUS_07770 960 1946 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250460.1 protein_id gnl|my_center|LOCUS_07770 2228 1947 gene locus_tag LOCUS_07780 2228 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2331 2419 gene locus_tag LOCUS_t00100 2331 2419 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2429 2905 gene locus_tag LOCUS_07790 2429 2905 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250457.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence131 316 2085 gene locus_tag LOCUS_07800 316 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 2419 2057 gene locus_tag LOCUS_07810 2419 2057 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence132 1388 255 gene locus_tag LOCUS_07820 1388 255 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_07820 1662 2027 gene locus_tag LOCUS_07830 1662 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence133 687 28 gene locus_tag LOCUS_07840 687 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1154 684 gene locus_tag LOCUS_07850 1154 684 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_07850 1448 1209 gene locus_tag LOCUS_07860 1448 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2450 1449 gene locus_tag LOCUS_07870 2450 1449 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146505.1 protein_id gnl|my_center|LOCUS_07870 2575 2697 gene locus_tag LOCUS_07880 2575 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence134 >Feature sequence135 862 1857 gene locus_tag LOCUS_07890 862 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1861 2244 gene locus_tag LOCUS_07900 1861 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2655 2455 gene locus_tag LOCUS_07910 2655 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence136 <1 963 gene locus_tag LOCUS_07920 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251108.1:carbamate kinase 1625 972 gene locus_tag LOCUS_07930 1625 972 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_07930 2374 1616 gene locus_tag LOCUS_07940 gene cobS 2374 1616 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496830.1 protein_id gnl|my_center|LOCUS_07940 <2905 2377 gene locus_tag LOCUS_07950 <2905 2377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065005.1:alpha-ribazole phosphatase CobZ >Feature sequence137 2497 272 gene locus_tag LOCUS_07960 2497 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence138 1146 439 gene locus_tag LOCUS_07970 1146 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 2260 1268 gene locus_tag LOCUS_07980 2260 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2782 2357 gene locus_tag LOCUS_07990 2782 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence139 828 2219 gene locus_tag LOCUS_08000 828 2219 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence140 887 811 gene locus_tag LOCUS_t00110 887 811 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1750 956 gene locus_tag LOCUS_08010 1750 956 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 protein_id gnl|my_center|LOCUS_08010 2606 1752 gene locus_tag LOCUS_08020 2606 1752 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060997.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence141 502 77 gene locus_tag LOCUS_08030 502 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 693 499 gene locus_tag LOCUS_08040 693 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 818 1078 gene locus_tag LOCUS_08050 818 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence142 <1 2685 gene locus_tag LOCUS_08060 <1 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250571.1:MCM2/3/5 family DNA replication licensing factor >Feature sequence143 311 742 gene locus_tag LOCUS_08070 311 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2230 746 gene locus_tag LOCUS_08080 2230 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2720 2274 gene locus_tag LOCUS_08090 2720 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence144 1961 327 gene locus_tag LOCUS_08100 1961 327 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_08100 2643 1948 gene locus_tag LOCUS_08110 2643 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence145 2710 467 gene locus_tag LOCUS_08120 2710 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence146 95 1201 gene locus_tag LOCUS_08130 95 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1303 1551 gene locus_tag LOCUS_08140 1303 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1548 1958 gene locus_tag LOCUS_08150 1548 1958 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902004.1 protein_id gnl|my_center|LOCUS_08150 1974 2522 gene locus_tag LOCUS_08160 1974 2522 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence147 2471 2136 gene locus_tag LOCUS_08170 2471 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2669 2487 gene locus_tag LOCUS_08180 2669 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence148 325 1851 gene locus_tag LOCUS_08190 gene istA 325 1851 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052821263.1 protein_id gnl|my_center|LOCUS_08190 1848 2654 gene locus_tag LOCUS_08200 gene istB 1848 2654 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971012.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence149 62 1363 gene locus_tag LOCUS_08210 62 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2788 1448 gene locus_tag LOCUS_08220 2788 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence150 907 203 gene locus_tag LOCUS_08230 907 203 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249896.1 protein_id gnl|my_center|LOCUS_08230 1460 912 gene locus_tag LOCUS_08240 1460 912 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 protein_id gnl|my_center|LOCUS_08240 1768 1457 gene locus_tag LOCUS_08250 1768 1457 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880624.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence151 87 749 gene locus_tag LOCUS_08260 87 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 746 1570 gene locus_tag LOCUS_08270 746 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022387.1 protein_id gnl|my_center|LOCUS_08270 1878 1705 gene locus_tag LOCUS_08280 1878 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence152 2402 528 gene locus_tag LOCUS_08290 2402 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence153 1913 2359 gene locus_tag LOCUS_08300 1913 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence154 <1 676 gene locus_tag LOCUS_08310 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876421.1:ribose-phosphate diphosphokinase 1937 669 gene locus_tag LOCUS_08320 1937 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence155 320 159 gene locus_tag LOCUS_08330 320 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 486 1175 gene locus_tag LOCUS_08340 486 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1380 2489 gene locus_tag LOCUS_08350 1380 2489 CDS product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947919.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence156 1256 1534 gene locus_tag LOCUS_08360 1256 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1537 2025 gene locus_tag LOCUS_08370 1537 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2260 2505 gene locus_tag LOCUS_08380 2260 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2444 2740 gene locus_tag LOCUS_08390 2444 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence157 <1 556 gene locus_tag LOCUS_08400 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545277.1:dihydropteroate synthase 591 1352 gene locus_tag LOCUS_08410 gene cofE 591 1352 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_08410 1425 1353 gene locus_tag LOCUS_t00120 1425 1353 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1898 1479 gene locus_tag LOCUS_08420 1898 1479 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146813.1 protein_id gnl|my_center|LOCUS_08420 2113 1862 gene locus_tag LOCUS_08430 2113 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2416 2180 gene locus_tag LOCUS_08440 2416 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence158 497 297 gene locus_tag LOCUS_08450 497 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1415 972 gene locus_tag LOCUS_08460 1415 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1600 1412 gene locus_tag LOCUS_08470 1600 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence159 870 562 gene locus_tag LOCUS_08480 870 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1451 984 gene locus_tag LOCUS_08490 1451 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1824 1597 gene locus_tag LOCUS_08500 1824 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08500 2496 2140 gene locus_tag LOCUS_08510 2496 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence160 1434 124 gene locus_tag LOCUS_08520 1434 124 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_08520 1955 1443 gene locus_tag LOCUS_08530 1955 1443 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence161 589 308 gene locus_tag LOCUS_08540 589 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1994 1875 gene locus_tag LOCUS_08550 1994 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence162 470 1660 gene locus_tag LOCUS_08560 470 1660 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429732.1 protein_id gnl|my_center|LOCUS_08560 2058 1765 gene locus_tag LOCUS_08570 2058 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2406 2167 gene locus_tag LOCUS_08580 2406 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence163 2225 1104 gene locus_tag LOCUS_08590 2225 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence164 39 998 gene locus_tag LOCUS_08600 39 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1377 2318 gene locus_tag LOCUS_08610 1377 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence165 440 610 gene locus_tag LOCUS_08620 440 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1045 650 gene locus_tag LOCUS_08630 1045 650 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_08630 1313 1038 gene locus_tag LOCUS_08640 1313 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1366 1494 gene locus_tag LOCUS_08650 1366 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 <2692 1513 gene locus_tag LOCUS_08660 <2692 1513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023091.1:ATP-binding protein >Feature sequence166 977 222 gene locus_tag LOCUS_08670 gene trmI 977 222 CDS product tRNA (adenine(57)-N(1)/adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867553.1 protein_id gnl|my_center|LOCUS_08670 1037 1918 gene locus_tag LOCUS_08680 1037 1918 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250544.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence167 311 99 gene locus_tag LOCUS_08690 311 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 623 345 gene locus_tag LOCUS_08700 623 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 846 616 gene locus_tag LOCUS_08710 846 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1761 1642 gene locus_tag LOCUS_08720 1761 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 <2684 1776 gene locus_tag LOCUS_08730 <2684 1776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171602985.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence168 23 253 gene locus_tag LOCUS_08740 23 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 261 905 gene locus_tag LOCUS_08750 261 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 918 1583 gene locus_tag LOCUS_08760 918 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1580 1705 gene locus_tag LOCUS_08770 1580 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1702 2025 gene locus_tag LOCUS_08780 1702 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence169 172 1311 gene locus_tag LOCUS_08790 gene asd 172 1311 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_08790 1929 1411 gene locus_tag LOCUS_08800 1929 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence170 237 1307 gene locus_tag LOCUS_08810 237 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1326 2417 gene locus_tag LOCUS_08820 gene amrS 1326 2417 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence171 1111 203 gene locus_tag LOCUS_08830 1111 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1702 1190 gene locus_tag LOCUS_08840 1702 1190 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_08840 2004 1699 gene locus_tag LOCUS_08850 2004 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 <2657 2154 gene locus_tag LOCUS_08860 <2657 2154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249461.1:redox-regulated ATPase YchF >Feature sequence172 883 125 gene locus_tag LOCUS_08870 gene istB 883 125 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_08870 2445 898 gene locus_tag LOCUS_08880 gene istA 2445 898 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence173 742 521 gene locus_tag LOCUS_08890 742 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1982 744 gene locus_tag LOCUS_08900 1982 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 <2650 1983 gene locus_tag LOCUS_08910 <2650 1983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249304.1:cell division ATPase MinD >Feature sequence174 594 4 gene locus_tag LOCUS_08920 594 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1425 739 gene locus_tag LOCUS_08930 1425 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2175 1528 gene locus_tag LOCUS_08940 2175 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence175 327 2543 gene locus_tag LOCUS_08950 327 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence176 87 440 gene locus_tag LOCUS_08960 87 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 501 740 gene locus_tag LOCUS_08970 501 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 715 2058 gene locus_tag LOCUS_08980 715 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence177 506 2017 gene locus_tag LOCUS_08990 506 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2097 2360 gene locus_tag LOCUS_09000 2097 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence178 506 850 gene locus_tag LOCUS_09010 506 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 853 2244 gene locus_tag LOCUS_09020 853 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2587 2270 gene locus_tag LOCUS_09030 2587 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence179 94 19 gene locus_tag LOCUS_t00130 94 19 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 385 307 gene locus_tag LOCUS_t00140 385 307 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1164 562 gene locus_tag LOCUS_09040 1164 562 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_09040 1897 1145 gene locus_tag LOCUS_09050 gene rph 1897 1145 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_09050 2290 1916 gene locus_tag LOCUS_09060 2290 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 2246 2530 gene locus_tag LOCUS_09070 2246 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence180 2536 377 gene locus_tag LOCUS_09080 2536 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence181 738 2393 gene locus_tag LOCUS_09090 738 2393 CDS product IS4-like element ISLpn5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947782.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence182 1200 103 gene locus_tag LOCUS_09100 1200 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204881.1 protein_id gnl|my_center|LOCUS_09100 2462 1200 gene locus_tag LOCUS_09110 2462 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204880.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence183 2486 1869 gene locus_tag LOCUS_09120 2486 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence184 1325 339 gene locus_tag LOCUS_09130 1325 339 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 protein_id gnl|my_center|LOCUS_09130 1432 2352 gene locus_tag LOCUS_09140 gene mvk 1432 2352 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence185 519 1820 gene locus_tag LOCUS_09150 519 1820 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_09150 2445 1840 gene locus_tag LOCUS_09160 gene tmk 2445 1840 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence186 2384 1185 gene locus_tag LOCUS_09170 2384 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence187 401 733 gene locus_tag LOCUS_09180 401 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1660 923 gene locus_tag LOCUS_09190 1660 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence188 702 1715 gene locus_tag LOCUS_09200 702 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 <2548 1709 gene locus_tag LOCUS_09210 <2548 1709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867667.1:ATP-dependent DNA ligase >Feature sequence189 1383 430 gene locus_tag LOCUS_09220 1383 430 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339822.1 protein_id gnl|my_center|LOCUS_09220 1820 1380 gene locus_tag LOCUS_09230 1820 1380 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876523.1 protein_id gnl|my_center|LOCUS_09230 2044 1862 gene locus_tag LOCUS_09240 2044 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence190 998 708 gene locus_tag LOCUS_09250 998 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1811 1008 gene locus_tag LOCUS_09260 1811 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1941 2279 gene locus_tag LOCUS_09270 1941 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence191 1764 847 gene locus_tag LOCUS_09280 1764 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence192 815 669 gene locus_tag LOCUS_09290 815 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1691 1485 gene locus_tag LOCUS_09300 1691 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2093 1833 gene locus_tag LOCUS_09310 2093 1833 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence193 240 1382 gene locus_tag LOCUS_09320 240 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence194 709 149 gene locus_tag LOCUS_09330 709 149 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_09330 1368 700 gene locus_tag LOCUS_09340 1368 700 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_09340 2339 1359 gene locus_tag LOCUS_09350 gene kae1 2339 1359 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868890.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence195 <1 664 gene locus_tag LOCUS_09360 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338051.1:NAD-dependent dihydropyrimidine dehydrogenase subunit PreA 586 2031 gene locus_tag LOCUS_09370 gene ssnA 586 2031 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047946.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence196 <1 704 gene locus_tag LOCUS_09380 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039182.1:branched-chain amino acid transaminase 766 1137 gene locus_tag LOCUS_09390 766 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1207 2175 gene locus_tag LOCUS_09400 1207 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence197 185 1063 gene locus_tag LOCUS_09410 185 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1050 2435 gene locus_tag LOCUS_09420 1050 2435 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence198 >Feature sequence199 1673 1104 gene locus_tag LOCUS_09430 1673 1104 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_09430 2253 1738 gene locus_tag LOCUS_09440 2253 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence200 751 44 gene locus_tag LOCUS_09450 gene istB 751 44 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_09450 2312 768 gene locus_tag LOCUS_09460 gene istA 2312 768 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence201 531 716 gene locus_tag LOCUS_09470 531 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 751 1068 gene locus_tag LOCUS_09480 751 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1767 1273 gene locus_tag LOCUS_09490 1767 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2486 2343 gene locus_tag LOCUS_09500 2486 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence202 1177 818 gene locus_tag LOCUS_09510 1177 818 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_09510 <2490 1292 gene locus_tag LOCUS_09520 <2490 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940712.1:molecular chaperone DnaJ >Feature sequence203 1138 854 gene locus_tag LOCUS_09530 1138 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1974 1531 gene locus_tag LOCUS_09540 1974 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2159 1971 gene locus_tag LOCUS_09550 2159 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence204 472 155 gene locus_tag LOCUS_09560 472 155 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_09560 791 450 gene locus_tag LOCUS_09570 791 450 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_09570 1731 979 gene locus_tag LOCUS_09580 1731 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1832 1960 gene locus_tag LOCUS_09590 1832 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence205 986 324 gene locus_tag LOCUS_09600 986 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1554 1000 gene locus_tag LOCUS_09610 1554 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1915 1547 gene locus_tag LOCUS_09620 1915 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2054 2127 gene locus_tag LOCUS_t00150 2054 2127 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence206 39 335 gene locus_tag LOCUS_09630 39 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 359 871 gene locus_tag LOCUS_09640 gene apt 359 871 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_09640 1650 1823 gene locus_tag LOCUS_09650 1650 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence207 <2465 1848 gene locus_tag LOCUS_09660 <2465 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228417.1:Xaa-Pro peptidase family protein >Feature sequence208 >Feature sequence209 608 2275 gene locus_tag LOCUS_09670 608 2275 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence210 737 387 gene locus_tag LOCUS_09680 737 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1273 734 gene locus_tag LOCUS_09690 1273 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1956 1270 gene locus_tag LOCUS_09700 1956 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence211 <1 1160 gene locus_tag LOCUS_09710 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393738.1:2-isopropylmalate synthase >Feature sequence212 1 1050 gene locus_tag LOCUS_09720 1 1050 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_09720 1068 1406 gene locus_tag LOCUS_09730 1068 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1690 1481 gene locus_tag LOCUS_09740 1690 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2363 1704 gene locus_tag LOCUS_09750 2363 1704 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence213 1940 261 gene locus_tag LOCUS_09760 1940 261 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879349.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence214 <1 561 gene locus_tag LOCUS_09770 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001309284.1:DUF2877 domain-containing protein 1350 562 gene locus_tag LOCUS_09780 gene gctB 1350 562 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_09780 2319 1354 gene locus_tag LOCUS_09790 2319 1354 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence215 84 434 gene locus_tag LOCUS_09800 84 434 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 protein_id gnl|my_center|LOCUS_09800 436 771 gene locus_tag LOCUS_09810 gene tnpB 436 771 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 protein_id gnl|my_center|LOCUS_09810 834 2390 gene locus_tag LOCUS_09820 834 2390 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence216 1905 1528 gene locus_tag LOCUS_09830 1905 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence217 20 460 gene locus_tag LOCUS_09840 20 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1339 575 gene locus_tag LOCUS_09850 1339 575 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_09850 2171 1344 gene locus_tag LOCUS_09860 2171 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence218 <1 609 gene locus_tag LOCUS_09870 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903201.1:N-(5'-phosphoribosyl)anthranilate isomerase 609 1799 gene locus_tag LOCUS_09880 gene trpB 609 1799 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496708.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence219 214 903 gene locus_tag LOCUS_09890 214 903 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546694.1 protein_id gnl|my_center|LOCUS_09890 952 2214 gene locus_tag LOCUS_09900 952 2214 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence220 318 530 gene locus_tag LOCUS_09910 318 530 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_09910 1181 1789 gene locus_tag LOCUS_09920 1181 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence221 957 2363 gene locus_tag LOCUS_09930 957 2363 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence222 93 1580 gene locus_tag LOCUS_09940 93 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence223 505 2103 gene locus_tag LOCUS_09950 505 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence224 88 666 gene locus_tag LOCUS_09960 88 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 738 1334 gene locus_tag LOCUS_09970 738 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2270 1386 gene locus_tag LOCUS_09980 2270 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence225 <1 544 gene locus_tag LOCUS_09990 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876682.1:30S ribosomal protein S7 608 1870 gene locus_tag LOCUS_10000 gene tuf 608 1870 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 protein_id gnl|my_center|LOCUS_10000 1910 2230 gene locus_tag LOCUS_10010 gene rpsJ 1910 2230 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_10010 2280 2368 gene locus_tag LOCUS_t00160 2280 2368 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence226 1421 63 gene locus_tag LOCUS_10020 1421 63 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_10020 1548 2180 gene locus_tag LOCUS_10030 1548 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence227 537 1664 gene locus_tag LOCUS_10040 537 1664 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_10040 2035 1688 gene locus_tag LOCUS_10050 2035 1688 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence228 1313 417 gene locus_tag LOCUS_10060 1313 417 CDS product LAGLIDADG family homing endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869812.1 protein_id gnl|my_center|LOCUS_10060 1897 1475 gene locus_tag LOCUS_10070 1897 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2313 1894 gene locus_tag LOCUS_10080 2313 1894 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251039.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence229 2045 1101 gene locus_tag LOCUS_10090 2045 1101 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence230 <1 523 gene locus_tag LOCUS_10100 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250576.1:sodium ion-translocating decarboxylase subunit beta 1455 715 gene locus_tag LOCUS_10110 1455 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1850 1719 gene locus_tag LOCUS_10120 1850 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence231 590 871 gene locus_tag LOCUS_10130 590 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence232 74 1114 gene locus_tag LOCUS_10140 gene rseP 74 1114 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_10140 1115 2197 gene locus_tag LOCUS_10150 gene ispG 1115 2197 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence233 1879 1187 gene locus_tag LOCUS_10160 1879 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence234 419 39 gene locus_tag LOCUS_10170 419 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 565 837 gene locus_tag LOCUS_10180 565 837 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_10180 868 1383 gene locus_tag LOCUS_10190 868 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1394 2008 gene locus_tag LOCUS_10200 1394 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence235 342 1607 gene locus_tag LOCUS_10210 gene eno 342 1607 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_10210 1598 2212 gene locus_tag LOCUS_10220 gene rpsB 1598 2212 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence236 705 247 gene locus_tag LOCUS_10230 705 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1334 774 gene locus_tag LOCUS_10240 1334 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence237 20 508 gene locus_tag LOCUS_10250 20 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 508 870 gene locus_tag LOCUS_10260 508 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 867 1634 gene locus_tag LOCUS_10270 867 1634 CDS product DUF2101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867928.1 protein_id gnl|my_center|LOCUS_10270 1849 1658 gene locus_tag LOCUS_10280 1849 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence238 233 481 gene locus_tag LOCUS_10290 233 481 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 protein_id gnl|my_center|LOCUS_10290 471 767 gene locus_tag LOCUS_10300 471 767 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 protein_id gnl|my_center|LOCUS_10300 900 1163 gene locus_tag LOCUS_10310 900 1163 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 protein_id gnl|my_center|LOCUS_10310 1150 1554 gene locus_tag LOCUS_10320 1150 1554 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_10320 1886 1641 gene locus_tag LOCUS_10330 1886 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1779 2222 gene locus_tag LOCUS_10340 1779 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence239 1213 659 gene locus_tag LOCUS_10350 1213 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1377 1195 gene locus_tag LOCUS_10360 1377 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1681 2247 gene locus_tag LOCUS_10370 1681 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence240 749 672 gene locus_tag LOCUS_t00170 749 672 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 801 1577 gene locus_tag LOCUS_10380 801 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1752 2201 gene locus_tag LOCUS_10390 1752 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence241 >Feature sequence242 143 1114 gene locus_tag LOCUS_10400 143 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1373 1756 gene locus_tag LOCUS_10410 1373 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence243 1663 620 gene locus_tag LOCUS_10420 1663 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2116 1673 gene locus_tag LOCUS_10430 2116 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence244 614 405 gene locus_tag LOCUS_10440 614 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 752 1621 gene locus_tag LOCUS_10450 752 1621 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_10450 1621 2178 gene locus_tag LOCUS_10460 1621 2178 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence245 211 14 gene locus_tag LOCUS_10470 211 14 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762842.1 protein_id gnl|my_center|LOCUS_10470 467 291 gene locus_tag LOCUS_10480 467 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2253 1246 gene locus_tag LOCUS_10490 2253 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence246 1170 331 gene locus_tag LOCUS_10500 1170 331 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876384.1 protein_id gnl|my_center|LOCUS_10500 1977 1438 gene locus_tag LOCUS_10510 1977 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence247 <1 993 gene locus_tag LOCUS_10520 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868419.1:ATP-binding protein 1832 1086 gene locus_tag LOCUS_10530 1832 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence248 412 870 gene locus_tag LOCUS_10540 412 870 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868849.1 protein_id gnl|my_center|LOCUS_10540 1065 1373 gene locus_tag LOCUS_10550 1065 1373 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496513.1 protein_id gnl|my_center|LOCUS_10550 1445 2197 gene locus_tag LOCUS_10560 gene psmA 1445 2197 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence249 196 1491 gene locus_tag LOCUS_10570 196 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence250 304 1107 gene locus_tag LOCUS_10580 304 1107 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_10580 <2227 1128 gene locus_tag LOCUS_10590 <2227 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023091.1:ATP-binding protein >Feature sequence251 1788 715 gene locus_tag LOCUS_10600 gene hisC 1788 715 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496679.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence252 134 1438 gene locus_tag LOCUS_10610 134 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1573 2010 gene locus_tag LOCUS_10620 1573 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence253 218 1489 gene locus_tag LOCUS_10630 218 1489 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence254 304 861 gene locus_tag LOCUS_10640 gene thpR 304 861 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_10640 <2205 893 gene locus_tag LOCUS_10650 <2205 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023473.1:CCA tRNA nucleotidyltransferase >Feature sequence255 <1 908 gene locus_tag LOCUS_10660 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870515.1:diadenylate cyclase 1780 914 gene locus_tag LOCUS_10670 1780 914 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774546.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence256 <1 1207 gene locus_tag LOCUS_10680 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA >Feature sequence257 459 67 gene locus_tag LOCUS_10690 459 67 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876928.1 protein_id gnl|my_center|LOCUS_10690 1061 459 gene locus_tag LOCUS_10700 1061 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1641 1045 gene locus_tag LOCUS_10710 1641 1045 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_10710 1972 1694 gene locus_tag LOCUS_10720 1972 1694 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876930.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence258 236 24 gene locus_tag LOCUS_10730 gene hpkA 236 24 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_10730 1553 270 gene locus_tag LOCUS_10740 1553 270 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence259 <1 792 gene locus_tag LOCUS_10750 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940799.1:hydrogenase small subunit >Feature sequence260 <1 555 gene locus_tag LOCUS_10760 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870830.1:aconitase X 552 935 gene locus_tag LOCUS_10770 552 935 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_10770 978 1937 gene locus_tag LOCUS_10780 978 1937 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence261 487 239 gene locus_tag LOCUS_10790 487 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 875 606 gene locus_tag LOCUS_10800 875 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1376 1113 gene locus_tag LOCUS_10810 1376 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence262 585 1988 gene locus_tag LOCUS_10820 gene ltrA 585 1988 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence263 <1 1794 gene locus_tag LOCUS_10830 <1 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878724.1:hydrophobe/amphiphile efflux-3 (HAE3) family transporter >Feature sequence264 110 391 gene locus_tag LOCUS_10840 110 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 468 968 gene locus_tag LOCUS_10850 468 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1043 1201 gene locus_tag LOCUS_10860 1043 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1405 1833 gene locus_tag LOCUS_10870 1405 1833 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926524.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence265 2082 730 gene locus_tag LOCUS_10880 2082 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence266 505 1275 gene locus_tag LOCUS_10890 505 1275 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_10890 1276 1644 gene locus_tag LOCUS_10900 1276 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence267 1415 171 gene locus_tag LOCUS_10910 1415 171 CDS product IS4-like element ISDha2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943229.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence268 716 462 gene locus_tag LOCUS_10920 716 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1224 736 gene locus_tag LOCUS_10930 1224 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_10930 2012 1221 gene locus_tag LOCUS_10940 gene lsrF 2012 1221 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219772.1 protein_id gnl|my_center|LOCUS_10940 2162 2025 gene locus_tag LOCUS_10950 2162 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence269 >Feature sequence270 328 480 gene locus_tag LOCUS_10960 328 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 473 778 gene locus_tag LOCUS_10970 473 778 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_10970 1149 1637 gene locus_tag LOCUS_10980 1149 1637 CDS product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 protein_id gnl|my_center|LOCUS_10980 1768 2154 gene locus_tag LOCUS_10990 1768 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence271 1283 564 gene locus_tag LOCUS_11000 1283 564 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728711.1 protein_id gnl|my_center|LOCUS_11000 <2155 1374 gene locus_tag LOCUS_11010 <2155 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027160700.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence272 <2150 490 gene locus_tag LOCUS_11020 <2150 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009195517.1:ABC transporter permease >Feature sequence273 1100 819 gene locus_tag LOCUS_11030 1100 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1371 1159 gene locus_tag LOCUS_11040 1371 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1679 1368 gene locus_tag LOCUS_11050 1679 1368 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence274 309 1034 gene locus_tag LOCUS_11060 309 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2121 1372 gene locus_tag LOCUS_11070 2121 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence275 <1 525 gene locus_tag LOCUS_11080 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546236.1:DUF763 domain-containing protein 856 1500 gene locus_tag LOCUS_11090 856 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1702 1839 gene locus_tag LOCUS_r00020 1702 1839 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1888 1963 gene locus_tag LOCUS_t00180 1888 1963 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence276 944 375 gene locus_tag LOCUS_11100 gene dcd 944 375 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_11100 1763 996 gene locus_tag LOCUS_11110 1763 996 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249752.1 protein_id gnl|my_center|LOCUS_11110 2057 1773 gene locus_tag LOCUS_11120 gene eif1A 2057 1773 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876635.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence277 >Feature sequence278 282 659 gene locus_tag LOCUS_11130 282 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 664 1290 gene locus_tag LOCUS_11140 664 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 <2126 1312 gene locus_tag LOCUS_11150 <2126 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023138.1:ATP-dependent DNA helicase >Feature sequence279 >Feature sequence280 <1 880 gene locus_tag LOCUS_11160 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002376739.1:cysteine desulfurase 881 1258 gene locus_tag LOCUS_11170 881 1258 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330765.1 protein_id gnl|my_center|LOCUS_11170 1259 1465 gene locus_tag LOCUS_11180 1259 1465 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583141.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence281 1793 57 gene locus_tag LOCUS_11190 1793 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence282 1889 483 gene locus_tag LOCUS_11200 1889 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence283 367 191 gene locus_tag LOCUS_11210 367 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2050 944 gene locus_tag LOCUS_11220 2050 944 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence284 1664 324 gene locus_tag LOCUS_11230 1664 324 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence285 810 965 gene locus_tag LOCUS_11240 810 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 985 1746 gene locus_tag LOCUS_11250 985 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence286 34 129 gene locus_tag LOCUS_t00190 34 129 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 964 1380 gene locus_tag LOCUS_11260 964 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1417 1508 gene locus_tag LOCUS_t00200 1417 1508 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1751 1521 gene locus_tag LOCUS_11270 1751 1521 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250282.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence287 498 1181 gene locus_tag LOCUS_11280 498 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1788 1525 gene locus_tag LOCUS_11290 1788 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2047 1769 gene locus_tag LOCUS_11300 2047 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence288 368 1369 gene locus_tag LOCUS_11310 368 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1559 1978 gene locus_tag LOCUS_11320 1559 1978 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764905.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence289 1771 914 gene locus_tag LOCUS_11330 gene accD 1771 914 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence290 467 973 gene locus_tag LOCUS_11340 467 973 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_11340 1128 1517 gene locus_tag LOCUS_11350 1128 1517 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_11350 1531 2061 gene locus_tag LOCUS_11360 1531 2061 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence291 <1 851 gene locus_tag LOCUS_11370 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421624.1:ACR3 family arsenite efflux transporter 1438 1154 gene locus_tag LOCUS_11380 1438 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1986 1441 gene locus_tag LOCUS_11390 1986 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence292 1039 716 gene locus_tag LOCUS_11400 1039 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1638 1123 gene locus_tag LOCUS_11410 1638 1123 CDS product AAA-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773822.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence293 364 146 gene locus_tag LOCUS_11420 364 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1100 627 gene locus_tag LOCUS_11430 1100 627 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398668.1 protein_id gnl|my_center|LOCUS_11430 1456 1181 gene locus_tag LOCUS_11440 1456 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence294 981 457 gene locus_tag LOCUS_11450 981 457 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_11450 <2061 1283 gene locus_tag LOCUS_11460 <2061 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977330.1:chorismate synthase >Feature sequence295 <1 1069 gene locus_tag LOCUS_11470 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870985.1:threonine synthase >Feature sequence296 1675 1208 gene locus_tag LOCUS_11480 gene rpiB 1675 1208 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence297 1034 654 gene locus_tag LOCUS_11490 gene rplX 1034 654 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 protein_id gnl|my_center|LOCUS_11490 1465 1040 gene locus_tag LOCUS_11500 1465 1040 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867453.1 protein_id gnl|my_center|LOCUS_11500 1793 1467 gene locus_tag LOCUS_11510 1793 1467 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869965.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence298 <1 732 gene locus_tag LOCUS_11520 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein 813 1127 gene locus_tag LOCUS_11530 813 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence299 >Feature sequence300 923 222 gene locus_tag LOCUS_11540 923 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1334 951 gene locus_tag LOCUS_11550 1334 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1421 1657 gene locus_tag LOCUS_11560 1421 1657 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_11560 1833 1997 gene locus_tag LOCUS_11570 1833 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence301 1893 280 gene locus_tag LOCUS_11580 gene ppcA 1893 280 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022649.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence302 <1 1048 gene locus_tag LOCUS_11590 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902167.1:RNA-guided endonuclease TnpB family protein 1579 1061 gene locus_tag LOCUS_11600 1579 1061 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868390.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence303 <2028 1140 gene locus_tag LOCUS_11610 <2028 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990858.1:SBBP repeat-containing protein >Feature sequence304 86 406 gene locus_tag LOCUS_11620 86 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 403 1929 gene locus_tag LOCUS_11630 403 1929 CDS product IS1182-like element ISMac20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755940.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence305 205 1005 gene locus_tag LOCUS_11640 205 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 992 1801 gene locus_tag LOCUS_11650 992 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1976 1776 gene locus_tag LOCUS_11660 1976 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence306 212 1660 gene locus_tag LOCUS_11670 212 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1997 1740 gene locus_tag LOCUS_11680 1997 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence307 931 695 gene locus_tag LOCUS_11690 931 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 1295 921 gene locus_tag LOCUS_11700 1295 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1558 1295 gene locus_tag LOCUS_11710 1558 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence308 96 1049 gene locus_tag LOCUS_11720 96 1049 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 protein_id gnl|my_center|LOCUS_11720 1051 1377 gene locus_tag LOCUS_11730 1051 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence309 583 92 gene locus_tag LOCUS_11740 583 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 957 613 gene locus_tag LOCUS_11750 957 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 898 1215 gene locus_tag LOCUS_11760 898 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11760 1824 1486 gene locus_tag LOCUS_11770 1824 1486 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence310 232 696 gene locus_tag LOCUS_11780 232 696 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868086.1 protein_id gnl|my_center|LOCUS_11780 1016 744 gene locus_tag LOCUS_11790 1016 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1480 1070 gene locus_tag LOCUS_11800 gene hisI 1480 1070 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence311 <2005 1059 gene locus_tag LOCUS_11810 <2005 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250266.1:phosphoadenosine phosphosulfate reductase family protein >Feature sequence312 <1 598 gene locus_tag LOCUS_11820 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein 613 993 gene locus_tag LOCUS_11830 613 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1021 1425 gene locus_tag LOCUS_11840 1021 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1437 1700 gene locus_tag LOCUS_11850 1437 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence313 <1 1221 gene locus_tag LOCUS_11860 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113167.1:tyrosine--tRNA ligase