>Feature sequence1 <1 620 gene locus_tag LOCUS_00010 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399999.1:phage terminase large subunit 737 994 gene locus_tag LOCUS_00020 737 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1989 1438 gene locus_tag LOCUS_00030 1989 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3115 2315 gene locus_tag LOCUS_00040 3115 2315 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_00040 4366 3128 gene locus_tag LOCUS_00050 4366 3128 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_00050 5934 4378 gene locus_tag LOCUS_00060 5934 4378 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807889.1 protein_id gnl|my_center|LOCUS_00060 6897 5947 gene locus_tag LOCUS_00070 6897 5947 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705115.1 protein_id gnl|my_center|LOCUS_00070 9368 6948 gene locus_tag LOCUS_00080 9368 6948 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_00080 10090 9443 gene locus_tag LOCUS_00090 10090 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12680 10809 gene locus_tag LOCUS_00100 12680 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14529 12682 gene locus_tag LOCUS_00110 14529 12682 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119442.1 protein_id gnl|my_center|LOCUS_00110 14838 16508 gene locus_tag LOCUS_00120 14838 16508 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265883.1 protein_id gnl|my_center|LOCUS_00120 16547 17812 gene locus_tag LOCUS_00130 gene aroA 16547 17812 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971031.1 protein_id gnl|my_center|LOCUS_00130 19179 18169 gene locus_tag LOCUS_00140 19179 18169 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921016.1 protein_id gnl|my_center|LOCUS_00140 19670 19248 gene locus_tag LOCUS_00150 19670 19248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20537 19689 gene locus_tag LOCUS_00160 20537 19689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21310 20534 gene locus_tag LOCUS_00170 21310 20534 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919975.1 protein_id gnl|my_center|LOCUS_00170 21500 22522 gene locus_tag LOCUS_00180 21500 22522 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265764.1 protein_id gnl|my_center|LOCUS_00180 23549 22515 gene locus_tag LOCUS_00190 23549 22515 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 protein_id gnl|my_center|LOCUS_00190 24445 23549 gene locus_tag LOCUS_00200 24445 23549 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110450429.1 protein_id gnl|my_center|LOCUS_00200 26178 24445 gene locus_tag LOCUS_00210 26178 24445 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_00210 28016 26355 gene locus_tag LOCUS_00220 28016 26355 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327740.1 protein_id gnl|my_center|LOCUS_00220 28117 28923 gene locus_tag LOCUS_00230 28117 28923 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 protein_id gnl|my_center|LOCUS_00230 28973 30664 gene locus_tag LOCUS_00240 28973 30664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30681 31610 gene locus_tag LOCUS_00250 30681 31610 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972116.1 protein_id gnl|my_center|LOCUS_00250 31666 31977 gene locus_tag LOCUS_00260 31666 31977 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_00260 31979 32272 gene locus_tag LOCUS_00270 gene nadS 31979 32272 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811547.1 protein_id gnl|my_center|LOCUS_00270 32718 32269 gene locus_tag LOCUS_00280 32718 32269 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311232.1 protein_id gnl|my_center|LOCUS_00280 33947 32718 gene locus_tag LOCUS_00290 33947 32718 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919203.1 protein_id gnl|my_center|LOCUS_00290 34884 33958 gene locus_tag LOCUS_00300 34884 33958 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920008.1 protein_id gnl|my_center|LOCUS_00300 35549 34881 gene locus_tag LOCUS_00310 35549 34881 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 protein_id gnl|my_center|LOCUS_00310 36877 35546 gene locus_tag LOCUS_00320 36877 35546 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_00320 38512 37106 gene locus_tag LOCUS_00330 gene murC 38512 37106 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089341.1 protein_id gnl|my_center|LOCUS_00330 39596 38505 gene locus_tag LOCUS_00340 gene murG 39596 38505 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920408.1 protein_id gnl|my_center|LOCUS_00340 40803 39667 gene locus_tag LOCUS_00350 gene ftsW 40803 39667 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920409.1 protein_id gnl|my_center|LOCUS_00350 42280 40841 gene locus_tag LOCUS_00360 gene murD 42280 40841 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920413.1 protein_id gnl|my_center|LOCUS_00360 43377 42292 gene locus_tag LOCUS_00370 gene mraY 43377 42292 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328954.1 protein_id gnl|my_center|LOCUS_00370 44800 43412 gene locus_tag LOCUS_00380 44800 43412 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920414.1 protein_id gnl|my_center|LOCUS_00380 46262 44793 gene locus_tag LOCUS_00390 46262 44793 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972057.1 protein_id gnl|my_center|LOCUS_00390 48097 46292 gene locus_tag LOCUS_00400 48097 46292 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396975.1 protein_id gnl|my_center|LOCUS_00400 48462 48094 gene locus_tag LOCUS_00410 48462 48094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49427 48549 gene locus_tag LOCUS_00420 gene rsmH 49427 48549 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966431.1 protein_id gnl|my_center|LOCUS_00420 50376 49504 gene locus_tag LOCUS_00430 gene ampR 50376 49504 CDS product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038155.1 protein_id gnl|my_center|LOCUS_00430 50474 51403 gene locus_tag LOCUS_00440 gene bla 50474 51403 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965202.1 protein_id gnl|my_center|LOCUS_00440 51414 52469 gene locus_tag LOCUS_00450 51414 52469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53206 52583 gene locus_tag LOCUS_00460 gene msrA 53206 52583 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_00460 53687 53208 gene locus_tag LOCUS_00470 53687 53208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55427 53736 gene locus_tag LOCUS_00480 55427 53736 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252802.1 protein_id gnl|my_center|LOCUS_00480 55657 57072 gene locus_tag LOCUS_00490 55657 57072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57511 57062 gene locus_tag LOCUS_00500 57511 57062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59406 58648 gene locus_tag LOCUS_00510 59406 58648 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906808.1 protein_id gnl|my_center|LOCUS_00510 59625 60332 gene locus_tag LOCUS_00520 59625 60332 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_00520 60333 60521 gene locus_tag LOCUS_00530 60333 60521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60561 61973 gene locus_tag LOCUS_00540 60561 61973 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513772.1 protein_id gnl|my_center|LOCUS_00540 62110 62586 gene locus_tag LOCUS_00550 gene rplM 62110 62586 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919253.1 protein_id gnl|my_center|LOCUS_00550 62586 63068 gene locus_tag LOCUS_00560 gene rpsI 62586 63068 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624294.1 protein_id gnl|my_center|LOCUS_00560 63286 64149 gene locus_tag LOCUS_00570 63286 64149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 64500 64246 gene locus_tag LOCUS_00580 64500 64246 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_00580 64768 64490 gene locus_tag LOCUS_00590 64768 64490 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_00590 65229 64810 gene locus_tag LOCUS_00600 65229 64810 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025999094.1 protein_id gnl|my_center|LOCUS_00600 65374 65961 gene locus_tag LOCUS_00610 65374 65961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66236 66162 gene locus_tag LOCUS_t00010 66236 66162 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 66472 68226 gene locus_tag LOCUS_00620 gene sppA 66472 68226 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918811.1 protein_id gnl|my_center|LOCUS_00620 71352 68488 gene locus_tag LOCUS_00630 71352 68488 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_00630 73717 71600 gene locus_tag LOCUS_00640 73717 71600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 74478 73714 gene locus_tag LOCUS_00650 74478 73714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00650 78156 75082 gene locus_tag LOCUS_00660 78156 75082 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265669.1 protein_id gnl|my_center|LOCUS_00660 78615 80681 gene locus_tag LOCUS_00670 78615 80681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 82366 80735 gene locus_tag LOCUS_00680 82366 80735 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_00680 82517 83068 gene locus_tag LOCUS_00690 82517 83068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 83974 83069 gene locus_tag LOCUS_00700 83974 83069 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_00700 84900 83971 gene locus_tag LOCUS_00710 gene oppB 84900 83971 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_00710 85825 85031 gene locus_tag LOCUS_00720 gene mtgA 85825 85031 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918214.1 protein_id gnl|my_center|LOCUS_00720 86862 85825 gene locus_tag LOCUS_00730 gene queG 86862 85825 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921465.1 protein_id gnl|my_center|LOCUS_00730 87540 86866 gene locus_tag LOCUS_00740 87540 86866 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970800.1 protein_id gnl|my_center|LOCUS_00740 88179 87565 gene locus_tag LOCUS_00750 88179 87565 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_00750 88343 88693 gene locus_tag LOCUS_00760 88343 88693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 88711 90354 gene locus_tag LOCUS_00770 gene secD 88711 90354 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919857.1 protein_id gnl|my_center|LOCUS_00770 90365 91393 gene locus_tag LOCUS_00780 gene secF 90365 91393 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640384.1 protein_id gnl|my_center|LOCUS_00780 91435 92031 gene locus_tag LOCUS_00790 91435 92031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 93770 92028 gene locus_tag LOCUS_00800 93770 92028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 94841 93795 gene locus_tag LOCUS_00810 gene argC 94841 93795 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390174.1 protein_id gnl|my_center|LOCUS_00810 95014 96840 gene locus_tag LOCUS_00820 95014 96840 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206337.1 protein_id gnl|my_center|LOCUS_00820 98045 96846 gene locus_tag LOCUS_00830 gene mnmA 98045 96846 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265643.1 protein_id gnl|my_center|LOCUS_00830 98169 98756 gene locus_tag LOCUS_00840 98169 98756 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_00840 98737 99021 gene locus_tag LOCUS_00850 98737 99021 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 protein_id gnl|my_center|LOCUS_00850 99030 99632 gene locus_tag LOCUS_00860 99030 99632 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974604.1 protein_id gnl|my_center|LOCUS_00860 100552 99629 gene locus_tag LOCUS_00870 100552 99629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 102688 100562 gene locus_tag LOCUS_00880 gene flgK 102688 100562 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918784.1 protein_id gnl|my_center|LOCUS_00880 103169 104446 gene locus_tag LOCUS_00890 103169 104446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 104455 105132 gene locus_tag LOCUS_00900 104455 105132 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388305.1 protein_id gnl|my_center|LOCUS_00900 105246 106658 gene locus_tag LOCUS_00910 gene flgE 105246 106658 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086481.1 protein_id gnl|my_center|LOCUS_00910 106805 107074 gene locus_tag LOCUS_00920 106805 107074 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527546.1 protein_id gnl|my_center|LOCUS_00920 107193 108824 gene locus_tag LOCUS_00930 gene fliF 107193 108824 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918789.1 protein_id gnl|my_center|LOCUS_00930 108824 109831 gene locus_tag LOCUS_00940 gene fliG 108824 109831 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918790.1 protein_id gnl|my_center|LOCUS_00940 109837 110475 gene locus_tag LOCUS_00950 109837 110475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 110488 110835 gene locus_tag LOCUS_00960 gene fliN 110488 110835 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918792.1 protein_id gnl|my_center|LOCUS_00960 110848 112245 gene locus_tag LOCUS_00970 gene flbD 110848 112245 CDS product sigma-54-dependent transcriptional regulator FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918793.1 protein_id gnl|my_center|LOCUS_00970 112260 114377 gene locus_tag LOCUS_00980 gene flhA 112260 114377 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918794.1 protein_id gnl|my_center|LOCUS_00980 114381 115511 gene locus_tag LOCUS_00990 114381 115511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 116264 115581 gene locus_tag LOCUS_01000 116264 115581 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163149.1 protein_id gnl|my_center|LOCUS_01000 118611 116332 gene locus_tag LOCUS_01010 gene piuA 118611 116332 CDS product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_01010 119178 118768 gene locus_tag LOCUS_01020 119178 118768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 120597 119269 gene locus_tag LOCUS_01030 gene fliI 120597 119269 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920876.1 protein_id gnl|my_center|LOCUS_01030 120847 121542 gene locus_tag LOCUS_01040 gene ctrA 120847 121542 CDS product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314973.1 protein_id gnl|my_center|LOCUS_01040 121680 122741 gene locus_tag LOCUS_01050 121680 122741 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972778.1 protein_id gnl|my_center|LOCUS_01050 123389 122808 gene locus_tag LOCUS_01060 123389 122808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 124476 123400 gene locus_tag LOCUS_01070 gene prfA 124476 123400 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265638.1 protein_id gnl|my_center|LOCUS_01070 124654 125133 gene locus_tag LOCUS_01080 124654 125133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 125482 125192 gene locus_tag LOCUS_01090 gene rpmB 125482 125192 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918547.1 protein_id gnl|my_center|LOCUS_01090 125947 125600 gene locus_tag LOCUS_01100 125947 125600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 126036 127037 gene locus_tag LOCUS_01110 126036 127037 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640144.1 protein_id gnl|my_center|LOCUS_01110 127226 127600 gene locus_tag LOCUS_01120 127226 127600 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_01120 129493 127925 gene locus_tag LOCUS_01130 129493 127925 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367409.1 protein_id gnl|my_center|LOCUS_01130 130745 129543 gene locus_tag LOCUS_01140 gene carA 130745 129543 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920674.1 protein_id gnl|my_center|LOCUS_01140 130889 132115 gene locus_tag LOCUS_01150 130889 132115 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930537.1 protein_id gnl|my_center|LOCUS_01150 132211 134235 gene locus_tag LOCUS_01160 132211 134235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 134336 134554 gene locus_tag LOCUS_01170 134336 134554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 134957 134544 gene locus_tag LOCUS_01180 134957 134544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 136930 134957 gene locus_tag LOCUS_01190 136930 134957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 137104 139812 gene locus_tag LOCUS_01200 137104 139812 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207266.1 protein_id gnl|my_center|LOCUS_01200 141635 139863 gene locus_tag LOCUS_01210 141635 139863 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815882.1 protein_id gnl|my_center|LOCUS_01210 142158 141649 gene locus_tag LOCUS_01220 142158 141649 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087107.1 protein_id gnl|my_center|LOCUS_01220 142459 143832 gene locus_tag LOCUS_01230 142459 143832 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090693.1 protein_id gnl|my_center|LOCUS_01230 144586 143834 gene locus_tag LOCUS_01240 144586 143834 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088363.1 protein_id gnl|my_center|LOCUS_01240 145425 144604 gene locus_tag LOCUS_01250 145425 144604 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967763.1 protein_id gnl|my_center|LOCUS_01250 146356 145427 gene locus_tag LOCUS_01260 146356 145427 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 protein_id gnl|my_center|LOCUS_01260 147795 146356 gene locus_tag LOCUS_01270 147795 146356 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_01270 148039 148797 gene locus_tag LOCUS_01280 148039 148797 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312730.1 protein_id gnl|my_center|LOCUS_01280 149136 148798 gene locus_tag LOCUS_01290 149136 148798 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090605.1 protein_id gnl|my_center|LOCUS_01290 149506 149231 gene locus_tag LOCUS_01300 149506 149231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 150150 149737 gene locus_tag LOCUS_01310 150150 149737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 150477 150154 gene locus_tag LOCUS_01320 150477 150154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 151293 150613 gene locus_tag LOCUS_01330 gene hisG 151293 150613 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530359.1 protein_id gnl|my_center|LOCUS_01330 152391 151294 gene locus_tag LOCUS_01340 152391 151294 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921341.1 protein_id gnl|my_center|LOCUS_01340 153881 152388 gene locus_tag LOCUS_01350 gene hisS 153881 152388 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921342.1 protein_id gnl|my_center|LOCUS_01350 154031 154831 gene locus_tag LOCUS_01360 154031 154831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 157119 155056 gene locus_tag LOCUS_01370 157119 155056 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_01370 157206 157658 gene locus_tag LOCUS_01380 157206 157658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 158502 157705 gene locus_tag LOCUS_01390 158502 157705 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_01390 161517 158695 gene locus_tag LOCUS_01400 161517 158695 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_01400 164436 161611 gene locus_tag LOCUS_01410 164436 161611 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_01410 166429 164585 gene locus_tag LOCUS_01420 166429 164585 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969054.1 protein_id gnl|my_center|LOCUS_01420 167588 166551 gene locus_tag LOCUS_01430 167588 166551 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_01430 167915 167595 gene locus_tag LOCUS_01440 gene grxD 167915 167595 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531377.1 protein_id gnl|my_center|LOCUS_01440 168086 169915 gene locus_tag LOCUS_01450 168086 169915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 171859 169937 gene locus_tag LOCUS_01460 171859 169937 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_01460 172860 171991 gene locus_tag LOCUS_01470 gene ccoP 172860 171991 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919280.1 protein_id gnl|my_center|LOCUS_01470 173056 172862 gene locus_tag LOCUS_01480 173056 172862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 173812 173069 gene locus_tag LOCUS_01490 gene ccoO 173812 173069 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919278.1 protein_id gnl|my_center|LOCUS_01490 175489 173825 gene locus_tag LOCUS_01500 gene ccoN 175489 173825 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919277.1 protein_id gnl|my_center|LOCUS_01500 176101 175805 gene locus_tag LOCUS_01510 176101 175805 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969337.1 protein_id gnl|my_center|LOCUS_01510 176264 176536 gene locus_tag LOCUS_01520 176264 176536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 176703 176906 gene locus_tag LOCUS_01530 gene rpmI 176703 176906 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918930.1 protein_id gnl|my_center|LOCUS_01530 176920 177279 gene locus_tag LOCUS_01540 gene rplT 176920 177279 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710091.1 protein_id gnl|my_center|LOCUS_01540 177394 178473 gene locus_tag LOCUS_01550 gene pheS 177394 178473 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918928.1 protein_id gnl|my_center|LOCUS_01550 178579 180957 gene locus_tag LOCUS_01560 gene pheT 178579 180957 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918927.1 protein_id gnl|my_center|LOCUS_01560 181872 180973 gene locus_tag LOCUS_01570 181872 180973 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640156.1 protein_id gnl|my_center|LOCUS_01570 183305 181869 gene locus_tag LOCUS_01580 183305 181869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 184793 183309 gene locus_tag LOCUS_01590 184793 183309 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 protein_id gnl|my_center|LOCUS_01590 187460 184941 gene locus_tag LOCUS_01600 187460 184941 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919020.1 protein_id gnl|my_center|LOCUS_01600 188931 187600 gene locus_tag LOCUS_01610 188931 187600 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_01610 190033 189014 gene locus_tag LOCUS_01620 190033 189014 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919021.1 protein_id gnl|my_center|LOCUS_01620 191016 190060 gene locus_tag LOCUS_01630 191016 190060 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384625.1 protein_id gnl|my_center|LOCUS_01630 191858 191016 gene locus_tag LOCUS_01640 gene kdsA 191858 191016 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724637.1 protein_id gnl|my_center|LOCUS_01640 192682 191930 gene locus_tag LOCUS_01650 gene yclP 192682 191930 CDS product petrobactin ABC transporter ATP-binding protein YclP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234487.1 protein_id gnl|my_center|LOCUS_01650 193662 192682 gene locus_tag LOCUS_01660 193662 192682 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_01660 194536 193652 gene locus_tag LOCUS_01670 194536 193652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 196358 194538 gene locus_tag LOCUS_01680 196358 194538 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_01680 197126 196797 gene locus_tag LOCUS_01690 197126 196797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 197599 197285 gene locus_tag LOCUS_01700 197599 197285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 199943 197619 gene locus_tag LOCUS_01710 199943 197619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 200395 200015 gene locus_tag LOCUS_01720 200395 200015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 216975 200386 gene locus_tag LOCUS_01730 216975 200386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 218717 216999 gene locus_tag LOCUS_01740 218717 216999 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098821.1 protein_id gnl|my_center|LOCUS_01740 219298 220644 gene locus_tag LOCUS_01750 gene glmM 219298 220644 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973270.1 protein_id gnl|my_center|LOCUS_01750 221149 220658 gene locus_tag LOCUS_01760 221149 220658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 221427 224654 gene locus_tag LOCUS_01770 gene carB 221427 224654 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920738.1 protein_id gnl|my_center|LOCUS_01770 224703 225176 gene locus_tag LOCUS_01780 gene greA 224703 225176 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920688.1 protein_id gnl|my_center|LOCUS_01780 225273 226238 gene locus_tag LOCUS_01790 225273 226238 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920689.1 protein_id gnl|my_center|LOCUS_01790 226223 227227 gene locus_tag LOCUS_01800 gene trxB 226223 227227 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265863.1 protein_id gnl|my_center|LOCUS_01800 227229 228122 gene locus_tag LOCUS_01810 227229 228122 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_01810 229724 228477 gene locus_tag LOCUS_01820 229724 228477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 230570 229746 gene locus_tag LOCUS_01830 230570 229746 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966655.1 protein_id gnl|my_center|LOCUS_01830 230588 231394 gene locus_tag LOCUS_01840 230588 231394 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973102.1 protein_id gnl|my_center|LOCUS_01840 231381 232232 gene locus_tag LOCUS_01850 231381 232232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 232229 233152 gene locus_tag LOCUS_01860 232229 233152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 234054 233149 gene locus_tag LOCUS_01870 234054 233149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 234187 234645 gene locus_tag LOCUS_01880 234187 234645 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920913.1 protein_id gnl|my_center|LOCUS_01880 234642 235511 gene locus_tag LOCUS_01890 234642 235511 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921014.1 protein_id gnl|my_center|LOCUS_01890 235521 235835 gene locus_tag LOCUS_01900 235521 235835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 235940 236497 gene locus_tag LOCUS_01910 235940 236497 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_01910 236930 236520 gene locus_tag LOCUS_01920 236930 236520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 239031 237370 gene locus_tag LOCUS_01930 gene ettA 239031 237370 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920009.1 protein_id gnl|my_center|LOCUS_01930 239257 239868 gene locus_tag LOCUS_01940 239257 239868 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921430.1 protein_id gnl|my_center|LOCUS_01940 239893 240750 gene locus_tag LOCUS_01950 239893 240750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 240762 241292 gene locus_tag LOCUS_01960 240762 241292 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923319.1 protein_id gnl|my_center|LOCUS_01960 241304 242071 gene locus_tag LOCUS_01970 gene lptB 241304 242071 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385411.1 protein_id gnl|my_center|LOCUS_01970 242276 243757 gene locus_tag LOCUS_01980 gene rpoN 242276 243757 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 protein_id gnl|my_center|LOCUS_01980 243917 244258 gene locus_tag LOCUS_01990 243917 244258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 244398 244865 gene locus_tag LOCUS_02000 gene ptsN 244398 244865 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 protein_id gnl|my_center|LOCUS_02000 246383 244884 gene locus_tag LOCUS_02010 246383 244884 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 protein_id gnl|my_center|LOCUS_02010 246524 248029 gene locus_tag LOCUS_02020 246524 248029 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919623.1 protein_id gnl|my_center|LOCUS_02020 248331 251351 gene locus_tag LOCUS_02030 248331 251351 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037353.1 protein_id gnl|my_center|LOCUS_02030 251899 251432 gene locus_tag LOCUS_02040 251899 251432 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947599.1 protein_id gnl|my_center|LOCUS_02040 253591 251939 gene locus_tag LOCUS_02050 253591 251939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 252005 252081 gene locus_tag LOCUS_t00020 252005 252081 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 253908 253588 gene locus_tag LOCUS_02060 253908 253588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 254492 254088 gene locus_tag LOCUS_02070 254492 254088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 256045 254489 gene locus_tag LOCUS_02080 256045 254489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 256844 256047 gene locus_tag LOCUS_02090 256844 256047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 257506 256931 gene locus_tag LOCUS_02100 257506 256931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 258477 257647 gene locus_tag LOCUS_02110 258477 257647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 258951 258673 gene locus_tag LOCUS_02120 258951 258673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 259269 259640 gene locus_tag LOCUS_02130 259269 259640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 261487 260309 gene locus_tag LOCUS_02140 261487 260309 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966754.1 protein_id gnl|my_center|LOCUS_02140 263408 261489 gene locus_tag LOCUS_02150 263408 261489 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 protein_id gnl|my_center|LOCUS_02150 264314 263409 gene locus_tag LOCUS_02160 264314 263409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 266977 264311 gene locus_tag LOCUS_02170 266977 264311 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244282.1 protein_id gnl|my_center|LOCUS_02170 267166 267011 gene locus_tag LOCUS_02180 267166 267011 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_02180 267337 267750 gene locus_tag LOCUS_02190 267337 267750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 267755 268726 gene locus_tag LOCUS_02200 267755 268726 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_02200 268964 269263 gene locus_tag LOCUS_02210 268964 269263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 269703 270008 gene locus_tag LOCUS_02220 269703 270008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 270451 270636 gene locus_tag LOCUS_02230 270451 270636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 270839 270672 gene locus_tag LOCUS_02240 270839 270672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 271206 271751 gene locus_tag LOCUS_02250 271206 271751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 272457 271813 gene locus_tag LOCUS_02260 272457 271813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 272852 273358 gene locus_tag LOCUS_02270 272852 273358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 273590 274183 gene locus_tag LOCUS_02280 273590 274183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 274176 275123 gene locus_tag LOCUS_02290 274176 275123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 276301 275168 gene locus_tag LOCUS_02300 276301 275168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 277212 276571 gene locus_tag LOCUS_02310 gene artP 277212 276571 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097360.1 protein_id gnl|my_center|LOCUS_02310 278713 277865 gene locus_tag LOCUS_02320 278713 277865 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751026.1 protein_id gnl|my_center|LOCUS_02320 280169 278880 gene locus_tag LOCUS_02330 280169 278880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 280543 280166 gene locus_tag LOCUS_02340 280543 280166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 280754 280536 gene locus_tag LOCUS_02350 280754 280536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 281219 282919 gene locus_tag LOCUS_02360 281219 282919 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090030.1 protein_id gnl|my_center|LOCUS_02360 283262 283600 gene locus_tag LOCUS_02370 283262 283600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 283725 284261 gene locus_tag LOCUS_02380 gene dut 283725 284261 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970813.1 protein_id gnl|my_center|LOCUS_02380 284265 284477 gene locus_tag LOCUS_02390 284265 284477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 286037 284478 gene locus_tag LOCUS_02400 286037 284478 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918029.1 protein_id gnl|my_center|LOCUS_02400 286613 286134 gene locus_tag LOCUS_02410 286613 286134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 287083 286667 gene locus_tag LOCUS_02420 287083 286667 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113677.1 protein_id gnl|my_center|LOCUS_02420 287388 288170 gene locus_tag LOCUS_02430 287388 288170 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189436615.1 protein_id gnl|my_center|LOCUS_02430 288801 288160 gene locus_tag LOCUS_02440 288801 288160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 289291 288794 gene locus_tag LOCUS_02450 289291 288794 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168301328.1 protein_id gnl|my_center|LOCUS_02450 289455 289730 gene locus_tag LOCUS_02460 289455 289730 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 protein_id gnl|my_center|LOCUS_02460 289870 290148 gene locus_tag LOCUS_02470 289870 290148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 290172 291005 gene locus_tag LOCUS_02480 290172 291005 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 protein_id gnl|my_center|LOCUS_02480 290992 291741 gene locus_tag LOCUS_02490 290992 291741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 291752 292159 gene locus_tag LOCUS_02500 291752 292159 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946402.1 protein_id gnl|my_center|LOCUS_02500 293127 292177 gene locus_tag LOCUS_02510 gene gshB 293127 292177 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383077.1 protein_id gnl|my_center|LOCUS_02510 293265 293651 gene locus_tag LOCUS_02520 293265 293651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 294286 293648 gene locus_tag LOCUS_02530 294286 293648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 295041 294289 gene locus_tag LOCUS_02540 295041 294289 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 protein_id gnl|my_center|LOCUS_02540 295164 296549 gene locus_tag LOCUS_02550 295164 296549 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920968.1 protein_id gnl|my_center|LOCUS_02550 297802 296546 gene locus_tag LOCUS_02560 297802 296546 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_02560 298009 298581 gene locus_tag LOCUS_02570 298009 298581 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528311.1 protein_id gnl|my_center|LOCUS_02570 299237 298578 gene locus_tag LOCUS_02580 299237 298578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968479.1 protein_id gnl|my_center|LOCUS_02580 300092 299238 gene locus_tag LOCUS_02590 300092 299238 CDS product acetyl-CoA carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921371.1 protein_id gnl|my_center|LOCUS_02590 300907 300092 gene locus_tag LOCUS_02600 gene trpA 300907 300092 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115801.1 protein_id gnl|my_center|LOCUS_02600 302126 300909 gene locus_tag LOCUS_02610 gene trpB 302126 300909 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265976.1 protein_id gnl|my_center|LOCUS_02610 302772 302128 gene locus_tag LOCUS_02620 302772 302128 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083568.1 protein_id gnl|my_center|LOCUS_02620 303185 302772 gene locus_tag LOCUS_02630 gene mscL 303185 302772 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921414.1 protein_id gnl|my_center|LOCUS_02630 303301 303891 gene locus_tag LOCUS_02640 303301 303891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 303946 304953 gene locus_tag LOCUS_02650 303946 304953 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920388.1 protein_id gnl|my_center|LOCUS_02650 305082 307352 gene locus_tag LOCUS_02660 305082 307352 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921378.1 protein_id gnl|my_center|LOCUS_02660 307441 307923 gene locus_tag LOCUS_02670 307441 307923 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617693.1 protein_id gnl|my_center|LOCUS_02670 307999 309606 gene locus_tag LOCUS_02680 307999 309606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 310070 309603 gene locus_tag LOCUS_02690 gene mmcB 310070 309603 CDS product DNA repair putative endonuclease MmcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 protein_id gnl|my_center|LOCUS_02690 310676 310092 gene locus_tag LOCUS_02700 310676 310092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 310870 311490 gene locus_tag LOCUS_02710 gene rpsD 310870 311490 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920368.1 protein_id gnl|my_center|LOCUS_02710 312497 311745 gene locus_tag LOCUS_02720 312497 311745 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923334.1 protein_id gnl|my_center|LOCUS_02720 312630 313262 gene locus_tag LOCUS_02730 gene maiA 312630 313262 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_02730 313259 313699 gene locus_tag LOCUS_02740 313259 313699 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640429.1 protein_id gnl|my_center|LOCUS_02740 313765 314538 gene locus_tag LOCUS_02750 313765 314538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 314639 315730 gene locus_tag LOCUS_02760 gene hppD 314639 315730 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 protein_id gnl|my_center|LOCUS_02760 315720 316250 gene locus_tag LOCUS_02770 315720 316250 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_02770 317028 316309 gene locus_tag LOCUS_02780 gene phbB 317028 316309 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086506.1 protein_id gnl|my_center|LOCUS_02780 317650 317201 gene locus_tag LOCUS_02790 317650 317201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 317857 318819 gene locus_tag LOCUS_02800 gene mdh 317857 318819 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921482.1 protein_id gnl|my_center|LOCUS_02800 321023 318912 gene locus_tag LOCUS_02810 321023 318912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065453.1 protein_id gnl|my_center|LOCUS_02810 321300 321734 gene locus_tag LOCUS_02820 321300 321734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 322316 321780 gene locus_tag LOCUS_02830 322316 321780 CDS product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265804.1 protein_id gnl|my_center|LOCUS_02830 322593 322847 gene locus_tag LOCUS_02840 322593 322847 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014761069.1 protein_id gnl|my_center|LOCUS_02840 323960 322860 gene locus_tag LOCUS_02850 323960 322860 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640051.1 protein_id gnl|my_center|LOCUS_02850 324340 324008 gene locus_tag LOCUS_02860 324340 324008 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_02860 324976 324476 gene locus_tag LOCUS_02870 324976 324476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 325962 324985 gene locus_tag LOCUS_02880 325962 324985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 326138 326557 gene locus_tag LOCUS_02890 326138 326557 CDS product truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651440.1 protein_id gnl|my_center|LOCUS_02890 327262 326561 gene locus_tag LOCUS_02900 327262 326561 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265698.1 protein_id gnl|my_center|LOCUS_02900 329091 327319 gene locus_tag LOCUS_02910 329091 327319 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_02910 329236 330270 gene locus_tag LOCUS_02920 gene trpS 329236 330270 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917953.1 protein_id gnl|my_center|LOCUS_02920 330664 330263 gene locus_tag LOCUS_02930 330664 330263 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087131.1 protein_id gnl|my_center|LOCUS_02930 331307 330666 gene locus_tag LOCUS_02940 331307 330666 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090406.1 protein_id gnl|my_center|LOCUS_02940 331405 332004 gene locus_tag LOCUS_02950 331405 332004 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089909.1 protein_id gnl|my_center|LOCUS_02950 333811 332021 gene locus_tag LOCUS_02960 gene recQ 333811 332021 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_02960 333928 334965 gene locus_tag LOCUS_02970 333928 334965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 334967 335437 gene locus_tag LOCUS_02980 334967 335437 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_02980 335508 336074 gene locus_tag LOCUS_02990 335508 336074 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639868.1 protein_id gnl|my_center|LOCUS_02990 337237 336071 gene locus_tag LOCUS_03000 337237 336071 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_03000 338663 337392 gene locus_tag LOCUS_03010 338663 337392 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_03010 340014 338767 gene locus_tag LOCUS_03020 340014 338767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 340214 340011 gene locus_tag LOCUS_03030 340214 340011 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 protein_id gnl|my_center|LOCUS_03030 340328 340657 gene locus_tag LOCUS_03040 340328 340657 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905560.1 protein_id gnl|my_center|LOCUS_03040 340658 341836 gene locus_tag LOCUS_03050 340658 341836 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967177.1 protein_id gnl|my_center|LOCUS_03050 341845 345054 gene locus_tag LOCUS_03060 341845 345054 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088515.1 protein_id gnl|my_center|LOCUS_03060 345148 346695 gene locus_tag LOCUS_03070 345148 346695 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918952.1 protein_id gnl|my_center|LOCUS_03070 347915 346725 gene locus_tag LOCUS_03080 gene metK 347915 346725 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088686.1 protein_id gnl|my_center|LOCUS_03080 349530 348028 gene locus_tag LOCUS_03090 349530 348028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 349686 350654 gene locus_tag LOCUS_03100 gene cysK 349686 350654 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_03100 351620 350655 gene locus_tag LOCUS_03110 351620 350655 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265914.1 protein_id gnl|my_center|LOCUS_03110 351769 352380 gene locus_tag LOCUS_03120 351769 352380 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_03120 352364 353074 gene locus_tag LOCUS_03130 352364 353074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 354329 353076 gene locus_tag LOCUS_03140 354329 353076 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918987.1 protein_id gnl|my_center|LOCUS_03140 355724 354372 gene locus_tag LOCUS_03150 355724 354372 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918987.1 protein_id gnl|my_center|LOCUS_03150 357249 355744 gene locus_tag LOCUS_03160 357249 355744 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_03160 358691 357183 gene locus_tag LOCUS_03170 358691 357183 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919623.1 protein_id gnl|my_center|LOCUS_03170 360726 358702 gene locus_tag LOCUS_03180 360726 358702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 363792 360934 gene locus_tag LOCUS_03190 363792 360934 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919622.1 protein_id gnl|my_center|LOCUS_03190 365070 364024 gene locus_tag LOCUS_03200 365070 364024 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919621.1 protein_id gnl|my_center|LOCUS_03200 365896 365213 gene locus_tag LOCUS_03210 365896 365213 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920508.1 protein_id gnl|my_center|LOCUS_03210 367115 366216 gene locus_tag LOCUS_03220 367115 366216 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640170.1 protein_id gnl|my_center|LOCUS_03220 367945 367115 gene locus_tag LOCUS_03230 367945 367115 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527709.1 protein_id gnl|my_center|LOCUS_03230 368098 368883 gene locus_tag LOCUS_03240 368098 368883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 368916 369704 gene locus_tag LOCUS_03250 368916 369704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 369798 370268 gene locus_tag LOCUS_03260 369798 370268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 370372 371775 gene locus_tag LOCUS_03270 gene lpdA 370372 371775 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265532.1 protein_id gnl|my_center|LOCUS_03270 372643 371891 gene locus_tag LOCUS_03280 gene truA 372643 371891 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528473.1 protein_id gnl|my_center|LOCUS_03280 373550 372636 gene locus_tag LOCUS_03290 gene fmt 373550 372636 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383426.1 protein_id gnl|my_center|LOCUS_03290 373631 374920 gene locus_tag LOCUS_03300 373631 374920 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_03300 374926 375504 gene locus_tag LOCUS_03310 gene nudK 374926 375504 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540486.1 protein_id gnl|my_center|LOCUS_03310 375713 375637 gene locus_tag LOCUS_t00030 375713 375637 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 375686 376612 gene locus_tag LOCUS_03320 375686 376612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 377179 376658 gene locus_tag LOCUS_03330 377179 376658 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265581.1 protein_id gnl|my_center|LOCUS_03330 377816 377475 gene locus_tag LOCUS_03340 377816 377475 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918540.1 protein_id gnl|my_center|LOCUS_03340 379218 377950 gene locus_tag LOCUS_03350 379218 377950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 379898 379434 gene locus_tag LOCUS_03360 379898 379434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 380690 380049 gene locus_tag LOCUS_03370 gene udk 380690 380049 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700143.1 protein_id gnl|my_center|LOCUS_03370 380732 381100 gene locus_tag LOCUS_03380 380732 381100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 383290 381236 gene locus_tag LOCUS_03390 383290 381236 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_03390 383466 384794 gene locus_tag LOCUS_03400 383466 384794 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 protein_id gnl|my_center|LOCUS_03400 384887 385018 gene locus_tag LOCUS_03410 384887 385018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 385656 385090 gene locus_tag LOCUS_03420 385656 385090 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923245.1 protein_id gnl|my_center|LOCUS_03420 386305 385766 gene locus_tag LOCUS_03430 386305 385766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 387136 386360 gene locus_tag LOCUS_03440 387136 386360 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061433.1 protein_id gnl|my_center|LOCUS_03440 387249 387578 gene locus_tag LOCUS_03450 387249 387578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 387559 387915 gene locus_tag LOCUS_03460 387559 387915 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_03460 388332 388724 gene locus_tag LOCUS_03470 388332 388724 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_03470 388727 389575 gene locus_tag LOCUS_03480 388727 389575 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_03480 390344 389619 gene locus_tag LOCUS_03490 390344 389619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 390568 391311 gene locus_tag LOCUS_03500 390568 391311 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920771.1 protein_id gnl|my_center|LOCUS_03500 391313 392167 gene locus_tag LOCUS_03510 391313 392167 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_03510 392299 394215 gene locus_tag LOCUS_03520 392299 394215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 394217 395029 gene locus_tag LOCUS_03530 gene phnE 394217 395029 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918252.1 protein_id gnl|my_center|LOCUS_03530 395148 396428 gene locus_tag LOCUS_03540 395148 396428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 396449 397501 gene locus_tag LOCUS_03550 396449 397501 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_03550 397683 398915 gene locus_tag LOCUS_03560 397683 398915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 398984 400030 gene locus_tag LOCUS_03570 398984 400030 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_03570 400919 400107 gene locus_tag LOCUS_03580 gene hflC 400919 400107 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_03580 402016 400919 gene locus_tag LOCUS_03590 gene hflK 402016 400919 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_03590 402637 402104 gene locus_tag LOCUS_03600 402637 402104 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243065.1 protein_id gnl|my_center|LOCUS_03600 402681 403841 gene locus_tag LOCUS_03610 402681 403841 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918779.1 protein_id gnl|my_center|LOCUS_03610 403861 404610 gene locus_tag LOCUS_03620 403861 404610 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923352.1 protein_id gnl|my_center|LOCUS_03620 404595 405110 gene locus_tag LOCUS_03630 404595 405110 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023240.1 protein_id gnl|my_center|LOCUS_03630 405513 405112 gene locus_tag LOCUS_03640 405513 405112 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_03640 405985 405506 gene locus_tag LOCUS_03650 405985 405506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 406098 407426 gene locus_tag LOCUS_03660 406098 407426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 408406 407423 gene locus_tag LOCUS_03670 408406 407423 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528226.1 protein_id gnl|my_center|LOCUS_03670 410226 408403 gene locus_tag LOCUS_03680 410226 408403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 411998 410223 gene locus_tag LOCUS_03690 411998 410223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 412635 412048 gene locus_tag LOCUS_03700 412635 412048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 415814 412689 gene locus_tag LOCUS_03710 gene putA 415814 412689 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918689.1 protein_id gnl|my_center|LOCUS_03710 415968 417059 gene locus_tag LOCUS_03720 415968 417059 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921174.1 protein_id gnl|my_center|LOCUS_03720 418354 417062 gene locus_tag LOCUS_03730 418354 417062 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920870.1 protein_id gnl|my_center|LOCUS_03730 418633 422331 gene locus_tag LOCUS_03740 418633 422331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 422739 422335 gene locus_tag LOCUS_03750 422739 422335 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537794.1 protein_id gnl|my_center|LOCUS_03750 423440 422736 gene locus_tag LOCUS_03760 423440 422736 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_03760 423748 423443 gene locus_tag LOCUS_03770 423748 423443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 426195 423862 gene locus_tag LOCUS_03780 426195 423862 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_03780 426328 427365 gene locus_tag LOCUS_03790 426328 427365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 427591 430173 gene locus_tag LOCUS_03800 gene acnB 427591 430173 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222205.1 protein_id gnl|my_center|LOCUS_03800 431774 430308 gene locus_tag LOCUS_03810 431774 430308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 431990 432730 gene locus_tag LOCUS_03820 431990 432730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 433893 432727 gene locus_tag LOCUS_03830 433893 432727 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 protein_id gnl|my_center|LOCUS_03830 435784 433961 gene locus_tag LOCUS_03840 gene glmS 435784 433961 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087378.1 protein_id gnl|my_center|LOCUS_03840 436391 435876 gene locus_tag LOCUS_03850 436391 435876 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640439.1 protein_id gnl|my_center|LOCUS_03850 436508 438178 gene locus_tag LOCUS_03860 436508 438178 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529948.1 protein_id gnl|my_center|LOCUS_03860 439191 438175 gene locus_tag LOCUS_03870 439191 438175 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265776.1 protein_id gnl|my_center|LOCUS_03870 439324 440106 gene locus_tag LOCUS_03880 gene ftsE 439324 440106 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265777.1 protein_id gnl|my_center|LOCUS_03880 440106 441041 gene locus_tag LOCUS_03890 440106 441041 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920078.1 protein_id gnl|my_center|LOCUS_03890 441041 441703 gene locus_tag LOCUS_03900 441041 441703 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066766.1 protein_id gnl|my_center|LOCUS_03900 441706 442434 gene locus_tag LOCUS_03910 441706 442434 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_03910 442415 443332 gene locus_tag LOCUS_03920 442415 443332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 443516 443827 gene locus_tag LOCUS_03930 443516 443827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 443840 444106 gene locus_tag LOCUS_03940 gene rpmA 443840 444106 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 protein_id gnl|my_center|LOCUS_03940 444352 445401 gene locus_tag LOCUS_03950 gene obgE 444352 445401 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918204.1 protein_id gnl|my_center|LOCUS_03950 445401 446516 gene locus_tag LOCUS_03960 gene proB 445401 446516 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918203.1 protein_id gnl|my_center|LOCUS_03960 446568 447320 gene locus_tag LOCUS_03970 446568 447320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 447361 448443 gene locus_tag LOCUS_03980 gene hisC 447361 448443 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529387.1 protein_id gnl|my_center|LOCUS_03980 448440 449345 gene locus_tag LOCUS_03990 448440 449345 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_03990 449847 449611 gene locus_tag LOCUS_04000 449847 449611 CDS product Rad51 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074138.1 protein_id gnl|my_center|LOCUS_04000 449933 450268 gene locus_tag LOCUS_04010 449933 450268 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 protein_id gnl|my_center|LOCUS_04010 450948 450265 gene locus_tag LOCUS_04020 450948 450265 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099642.1 protein_id gnl|my_center|LOCUS_04020 451043 452119 gene locus_tag LOCUS_04030 451043 452119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 452425 453018 gene locus_tag LOCUS_04040 452425 453018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 454879 453035 gene locus_tag LOCUS_04050 gene typA 454879 453035 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918627.1 protein_id gnl|my_center|LOCUS_04050 455056 457713 gene locus_tag LOCUS_04060 gene flaEY 455056 457713 CDS product regulatory protein FlaEY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919340.1 protein_id gnl|my_center|LOCUS_04060 458165 457728 gene locus_tag LOCUS_04070 458165 457728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 458687 458226 gene locus_tag LOCUS_04080 458687 458226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 459441 458797 gene locus_tag LOCUS_04090 459441 458797 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 protein_id gnl|my_center|LOCUS_04090 461774 459603 gene locus_tag LOCUS_04100 461774 459603 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 protein_id gnl|my_center|LOCUS_04100 462425 461778 gene locus_tag LOCUS_04110 462425 461778 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528838.1 protein_id gnl|my_center|LOCUS_04110 462546 463082 gene locus_tag LOCUS_04120 462546 463082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 463137 463889 gene locus_tag LOCUS_04130 463137 463889 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225729.1 protein_id gnl|my_center|LOCUS_04130 463889 464392 gene locus_tag LOCUS_04140 463889 464392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 464430 465113 gene locus_tag LOCUS_04150 464430 465113 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_04150 465166 465339 gene locus_tag LOCUS_04160 465166 465339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 465461 468310 gene locus_tag LOCUS_04170 gene polA 465461 468310 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265962.1 protein_id gnl|my_center|LOCUS_04170 469513 468392 gene locus_tag LOCUS_04180 469513 468392 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_04180 471290 469542 gene locus_tag LOCUS_04190 gene pabB 471290 469542 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217385.1 protein_id gnl|my_center|LOCUS_04190 471692 471297 gene locus_tag LOCUS_04200 471692 471297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 473078 471693 gene locus_tag LOCUS_04210 gene cysS 473078 471693 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918348.1 protein_id gnl|my_center|LOCUS_04210 473261 473875 gene locus_tag LOCUS_04220 gene folE 473261 473875 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918347.1 protein_id gnl|my_center|LOCUS_04220 474042 474776 gene locus_tag LOCUS_04230 474042 474776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 475245 475643 gene locus_tag LOCUS_04240 gene hisI 475245 475643 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918345.1 protein_id gnl|my_center|LOCUS_04240 475661 476296 gene locus_tag LOCUS_04250 gene ccmA 475661 476296 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921495.1 protein_id gnl|my_center|LOCUS_04250 476289 476960 gene locus_tag LOCUS_04260 gene ccmB 476289 476960 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310863.1 protein_id gnl|my_center|LOCUS_04260 477880 477023 gene locus_tag LOCUS_04270 477880 477023 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640244.1 protein_id gnl|my_center|LOCUS_04270 478928 478074 gene locus_tag LOCUS_04280 478928 478074 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640244.1 protein_id gnl|my_center|LOCUS_04280 479571 479179 gene locus_tag LOCUS_04290 479571 479179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 480502 479672 gene locus_tag LOCUS_04300 480502 479672 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918679.1 protein_id gnl|my_center|LOCUS_04300 481633 480803 gene locus_tag LOCUS_04310 481633 480803 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918677.1 protein_id gnl|my_center|LOCUS_04310 482334 481963 gene locus_tag LOCUS_04320 gene flaF 482334 481963 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 protein_id gnl|my_center|LOCUS_04320 482719 482282 gene locus_tag LOCUS_04330 gene flbT 482719 482282 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919334.1 protein_id gnl|my_center|LOCUS_04330 482923 483768 gene locus_tag LOCUS_04340 482923 483768 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_04340 484402 483770 gene locus_tag LOCUS_04350 484402 483770 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 protein_id gnl|my_center|LOCUS_04350 484490 485056 gene locus_tag LOCUS_04360 484490 485056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 485647 485102 gene locus_tag LOCUS_04370 gene gcrA 485647 485102 CDS product cell cycle sigma 70 cofactor GcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265783.1 protein_id gnl|my_center|LOCUS_04370 486046 487227 gene locus_tag LOCUS_04380 486046 487227 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968636.1 protein_id gnl|my_center|LOCUS_04380 487239 488156 gene locus_tag LOCUS_04390 gene argF 487239 488156 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920103.1 protein_id gnl|my_center|LOCUS_04390 488173 489096 gene locus_tag LOCUS_04400 488173 489096 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327203.1 protein_id gnl|my_center|LOCUS_04400 489164 490252 gene locus_tag LOCUS_04410 489164 490252 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640455.1 protein_id gnl|my_center|LOCUS_04410 490259 491200 gene locus_tag LOCUS_04420 490259 491200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640454.1 protein_id gnl|my_center|LOCUS_04420 491393 492670 gene locus_tag LOCUS_04430 491393 492670 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313410.1 protein_id gnl|my_center|LOCUS_04430 492724 494175 gene locus_tag LOCUS_04440 gene amn 492724 494175 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399822.1 protein_id gnl|my_center|LOCUS_04440 494347 495045 gene locus_tag LOCUS_04450 494347 495045 CDS product DUF4908 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639994.1 protein_id gnl|my_center|LOCUS_04450 495803 495042 gene locus_tag LOCUS_04460 gene gloB 495803 495042 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918407.1 protein_id gnl|my_center|LOCUS_04460 495844 496590 gene locus_tag LOCUS_04470 495844 496590 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394662.1 protein_id gnl|my_center|LOCUS_04470 496751 497095 gene locus_tag LOCUS_04480 496751 497095 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918409.1 protein_id gnl|my_center|LOCUS_04480 498245 497133 gene locus_tag LOCUS_04490 498245 497133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 498362 499108 gene locus_tag LOCUS_04500 498362 499108 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 protein_id gnl|my_center|LOCUS_04500 499196 499621 gene locus_tag LOCUS_04510 499196 499621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265559.1 protein_id gnl|my_center|LOCUS_04510 500775 499618 gene locus_tag LOCUS_04520 gene nagA 500775 499618 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918331.1 protein_id gnl|my_center|LOCUS_04520 501803 500772 gene locus_tag LOCUS_04530 501803 500772 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038509.1 protein_id gnl|my_center|LOCUS_04530 501950 502843 gene locus_tag LOCUS_04540 gene murQ 501950 502843 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_04540 502902 503081 gene locus_tag LOCUS_04550 502902 503081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 503130 503534 gene locus_tag LOCUS_04560 503130 503534 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_04560 504075 503539 gene locus_tag LOCUS_04570 504075 503539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 505150 504128 gene locus_tag LOCUS_04580 505150 504128 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528795.1 protein_id gnl|my_center|LOCUS_04580 505282 506187 gene locus_tag LOCUS_04590 gene pyrF 505282 506187 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_04590 506211 509279 gene locus_tag LOCUS_04600 gene addB 506211 509279 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921366.1 protein_id gnl|my_center|LOCUS_04600 509272 512757 gene locus_tag LOCUS_04610 gene addA 509272 512757 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923305.1 protein_id gnl|my_center|LOCUS_04610 512830 513150 gene locus_tag LOCUS_04620 gene trxA 512830 513150 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921368.1 protein_id gnl|my_center|LOCUS_04620 513165 513563 gene locus_tag LOCUS_04630 513165 513563 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_04630 513579 513857 gene locus_tag LOCUS_04640 513579 513857 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 protein_id gnl|my_center|LOCUS_04640 515630 514110 gene locus_tag LOCUS_04650 515630 514110 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920125.1 protein_id gnl|my_center|LOCUS_04650 516232 515735 gene locus_tag LOCUS_04660 516232 515735 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_04660 516496 516287 gene locus_tag LOCUS_04670 516496 516287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 518037 516520 gene locus_tag LOCUS_04680 518037 516520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 518256 518651 gene locus_tag LOCUS_04690 518256 518651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 518732 519391 gene locus_tag LOCUS_04700 518732 519391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 520949 519531 gene locus_tag LOCUS_04710 gene pyk 520949 519531 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919914.1 protein_id gnl|my_center|LOCUS_04710 521575 520946 gene locus_tag LOCUS_04720 521575 520946 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152804.1 protein_id gnl|my_center|LOCUS_04720 522552 521596 gene locus_tag LOCUS_04730 gene glk 522552 521596 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170347.1 protein_id gnl|my_center|LOCUS_04730 524388 522571 gene locus_tag LOCUS_04740 gene edd 524388 522571 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091478.1 protein_id gnl|my_center|LOCUS_04740 525157 524450 gene locus_tag LOCUS_04750 gene pgl 525157 524450 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527053.1 protein_id gnl|my_center|LOCUS_04750 526629 525154 gene locus_tag LOCUS_04760 gene zwf 526629 525154 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974509.1 protein_id gnl|my_center|LOCUS_04760 527012 528844 gene locus_tag LOCUS_04770 527012 528844 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640285.1 protein_id gnl|my_center|LOCUS_04770 528844 533484 gene locus_tag LOCUS_04780 528844 533484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 533471 533956 gene locus_tag LOCUS_04790 533471 533956 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 protein_id gnl|my_center|LOCUS_04790 534369 533953 gene locus_tag LOCUS_04800 534369 533953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 534497 535702 gene locus_tag LOCUS_04810 534497 535702 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921082.1 protein_id gnl|my_center|LOCUS_04810 535703 536329 gene locus_tag LOCUS_04820 gene thiE 535703 536329 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_04820 536326 537255 gene locus_tag LOCUS_04830 536326 537255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 537337 538134 gene locus_tag LOCUS_04840 537337 538134 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640711.1 protein_id gnl|my_center|LOCUS_04840 540653 538320 gene locus_tag LOCUS_04850 540653 538320 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919402.1 protein_id gnl|my_center|LOCUS_04850 540876 541265 gene locus_tag LOCUS_04860 540876 541265 CDS product VanZ superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265927.1 protein_id gnl|my_center|LOCUS_04860 541452 541249 gene locus_tag LOCUS_04870 541452 541249 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719290.1 protein_id gnl|my_center|LOCUS_04870 541637 541449 gene locus_tag LOCUS_04880 541637 541449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 542290 541649 gene locus_tag LOCUS_04890 gene rluA 542290 541649 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 protein_id gnl|my_center|LOCUS_04890 542882 542325 gene locus_tag LOCUS_04900 542882 542325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 543583 542966 gene locus_tag LOCUS_04910 543583 542966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 545579 544137 gene locus_tag LOCUS_04920 gene atpD 545579 544137 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921276.1 protein_id gnl|my_center|LOCUS_04920 546437 545625 gene locus_tag LOCUS_04930 546437 545625 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083273.1 protein_id gnl|my_center|LOCUS_04930 548121 546583 gene locus_tag LOCUS_04940 gene atpA 548121 546583 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921278.1 protein_id gnl|my_center|LOCUS_04940 548661 548125 gene locus_tag LOCUS_04950 548661 548125 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921279.1 protein_id gnl|my_center|LOCUS_04950 549690 548881 gene locus_tag LOCUS_04960 549690 548881 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067013.1 protein_id gnl|my_center|LOCUS_04960 550586 549783 gene locus_tag LOCUS_04970 550586 549783 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265975.1 protein_id gnl|my_center|LOCUS_04970 550842 551990 gene locus_tag LOCUS_04980 gene zapE 550842 551990 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_04980 552018 552428 gene locus_tag LOCUS_04990 552018 552428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 552429 553517 gene locus_tag LOCUS_05000 gene tsaD 552429 553517 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028001770.1 protein_id gnl|my_center|LOCUS_05000 554088 553519 gene locus_tag LOCUS_05010 554088 553519 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918615.1 protein_id gnl|my_center|LOCUS_05010 554854 554051 gene locus_tag LOCUS_05020 554854 554051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 555075 554872 gene locus_tag LOCUS_05030 555075 554872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 555183 556226 gene locus_tag LOCUS_05040 555183 556226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 556230 556952 gene locus_tag LOCUS_05050 556230 556952 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_05050 558618 556954 gene locus_tag LOCUS_05060 558618 556954 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920923.1 protein_id gnl|my_center|LOCUS_05060 559867 558764 gene locus_tag LOCUS_05070 559867 558764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 559990 560295 gene locus_tag LOCUS_05080 559990 560295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 561379 560354 gene locus_tag LOCUS_05090 561379 560354 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918416.1 protein_id gnl|my_center|LOCUS_05090 561729 561382 gene locus_tag LOCUS_05100 561729 561382 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918415.1 protein_id gnl|my_center|LOCUS_05100 563532 561958 gene locus_tag LOCUS_05110 563532 561958 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338336.1 protein_id gnl|my_center|LOCUS_05110 563708 564235 gene locus_tag LOCUS_05120 563708 564235 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918414.1 protein_id gnl|my_center|LOCUS_05120 564285 564896 gene locus_tag LOCUS_05130 564285 564896 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265622.1 protein_id gnl|my_center|LOCUS_05130 565702 564920 gene locus_tag LOCUS_05140 565702 564920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 566006 567124 gene locus_tag LOCUS_05150 566006 567124 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_05150 567121 567726 gene locus_tag LOCUS_05160 gene metW 567121 567726 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_05160 567726 568376 gene locus_tag LOCUS_05170 gene nth 567726 568376 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965134.1 protein_id gnl|my_center|LOCUS_05170 569075 568707 gene locus_tag LOCUS_05180 569075 568707 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968855.1 protein_id gnl|my_center|LOCUS_05180 570948 569146 gene locus_tag LOCUS_05190 gene lepA 570948 569146 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640125.1 protein_id gnl|my_center|LOCUS_05190 570915 571103 gene locus_tag LOCUS_05200 570915 571103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 571124 571717 gene locus_tag LOCUS_05210 571124 571717 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265661.1 protein_id gnl|my_center|LOCUS_05210 571765 572415 gene locus_tag LOCUS_05220 gene recR 571765 572415 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 protein_id gnl|my_center|LOCUS_05220 572765 572412 gene locus_tag LOCUS_05230 572765 572412 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328395.1 protein_id gnl|my_center|LOCUS_05230 573663 572758 gene locus_tag LOCUS_05240 gene rsmI 573663 572758 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918033.1 protein_id gnl|my_center|LOCUS_05240 573699 574949 gene locus_tag LOCUS_05250 573699 574949 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000235.1 protein_id gnl|my_center|LOCUS_05250 576076 574946 gene locus_tag LOCUS_05260 gene hemW 576076 574946 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 protein_id gnl|my_center|LOCUS_05260 576676 576077 gene locus_tag LOCUS_05270 gene rdgB 576676 576077 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639888.1 protein_id gnl|my_center|LOCUS_05270 576753 577274 gene locus_tag LOCUS_05280 576753 577274 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639889.1 protein_id gnl|my_center|LOCUS_05280 577286 577513 gene locus_tag LOCUS_05290 577286 577513 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_05290 578229 577510 gene locus_tag LOCUS_05300 gene rph 578229 577510 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918041.1 protein_id gnl|my_center|LOCUS_05300 578281 578889 gene locus_tag LOCUS_05310 578281 578889 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_05310 579798 578881 gene locus_tag LOCUS_05320 579798 578881 CDS product ATP-grasp domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265999.1 protein_id gnl|my_center|LOCUS_05320 579858 580850 gene locus_tag LOCUS_05330 579858 580850 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266000.1 protein_id gnl|my_center|LOCUS_05330 581828 580953 gene locus_tag LOCUS_05340 gene rarD 581828 580953 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532555.1 protein_id gnl|my_center|LOCUS_05340 582246 581848 gene locus_tag LOCUS_05350 582246 581848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 582281 583237 gene locus_tag LOCUS_05360 582281 583237 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970881.1 protein_id gnl|my_center|LOCUS_05360 583973 583215 gene locus_tag LOCUS_05370 583973 583215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 584035 584361 gene locus_tag LOCUS_05380 584035 584361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 585532 584339 gene locus_tag LOCUS_05390 585532 584339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 586847 585534 gene locus_tag LOCUS_05400 586847 585534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 586998 588389 gene locus_tag LOCUS_05410 gene fumC 586998 588389 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919970.1 protein_id gnl|my_center|LOCUS_05410 588711 589259 gene locus_tag LOCUS_05420 588711 589259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 590235 589345 gene locus_tag LOCUS_05430 590235 589345 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_05430 591098 590235 gene locus_tag LOCUS_05440 591098 590235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 593327 591288 gene locus_tag LOCUS_05450 593327 591288 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_05450 593474 594487 gene locus_tag LOCUS_05460 593474 594487 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920145.1 protein_id gnl|my_center|LOCUS_05460 596104 594488 gene locus_tag LOCUS_05470 596104 594488 CDS product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640457.1 protein_id gnl|my_center|LOCUS_05470 597858 596101 gene locus_tag LOCUS_05480 597858 596101 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265787.1 protein_id gnl|my_center|LOCUS_05480 598891 598187 gene locus_tag LOCUS_05490 598891 598187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 600433 598904 gene locus_tag LOCUS_05500 600433 598904 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920149.1 protein_id gnl|my_center|LOCUS_05500 603321 600529 gene locus_tag LOCUS_05510 603321 600529 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_05510 603867 605333 gene locus_tag LOCUS_05520 603867 605333 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_05520 605336 606700 gene locus_tag LOCUS_05530 605336 606700 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_05530 607526 606702 gene locus_tag LOCUS_05540 607526 606702 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393562.1 protein_id gnl|my_center|LOCUS_05540 608025 607564 gene locus_tag LOCUS_05550 608025 607564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 608930 608082 gene locus_tag LOCUS_05560 608930 608082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 609182 608994 gene locus_tag LOCUS_05570 609182 608994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 609385 609603 gene locus_tag LOCUS_05580 609385 609603 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_05580 610606 609623 gene locus_tag LOCUS_05590 610606 609623 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920832.1 protein_id gnl|my_center|LOCUS_05590 612463 610658 gene locus_tag LOCUS_05600 612463 610658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 612708 613295 gene locus_tag LOCUS_05610 612708 613295 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314627.1 protein_id gnl|my_center|LOCUS_05610 613441 613767 gene locus_tag LOCUS_05620 613441 613767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 614876 613764 gene locus_tag LOCUS_05630 gene ispG 614876 613764 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918736.1 protein_id gnl|my_center|LOCUS_05630 615884 614970 gene locus_tag LOCUS_05640 615884 614970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 618427 616169 gene locus_tag LOCUS_05650 gene ptsP 618427 616169 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 protein_id gnl|my_center|LOCUS_05650 618948 618529 gene locus_tag LOCUS_05660 gene nsrR 618948 618529 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_05660 619130 619519 gene locus_tag LOCUS_05670 619130 619519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 619585 620049 gene locus_tag LOCUS_05680 619585 620049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 621501 620086 gene locus_tag LOCUS_05690 621501 620086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 622957 621512 gene locus_tag LOCUS_05700 622957 621512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 624336 623092 gene locus_tag LOCUS_05710 624336 623092 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918728.1 protein_id gnl|my_center|LOCUS_05710 624525 625262 gene locus_tag LOCUS_05720 624525 625262 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970076.1 protein_id gnl|my_center|LOCUS_05720 626392 625355 gene locus_tag LOCUS_05730 gene fba 626392 625355 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809510.1 protein_id gnl|my_center|LOCUS_05730 628424 626418 gene locus_tag LOCUS_05740 gene tkt 628424 626418 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809443.1 protein_id gnl|my_center|LOCUS_05740 628595 628990 gene locus_tag LOCUS_05750 628595 628990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 629672 628983 gene locus_tag LOCUS_05760 gene rpe 629672 628983 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815384.1 protein_id gnl|my_center|LOCUS_05760 629767 630201 gene locus_tag LOCUS_05770 629767 630201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 630349 631566 gene locus_tag LOCUS_05780 gene cytX 630349 631566 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266480.1 protein_id gnl|my_center|LOCUS_05780 631578 632318 gene locus_tag LOCUS_05790 631578 632318 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921076.1 protein_id gnl|my_center|LOCUS_05790 632541 633098 gene locus_tag LOCUS_05800 632541 633098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 633109 633927 gene locus_tag LOCUS_05810 633109 633927 CDS product YmdB family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_05810 634715 633924 gene locus_tag LOCUS_05820 634715 633924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 636204 634705 gene locus_tag LOCUS_05830 636204 634705 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_05830 636819 636208 gene locus_tag LOCUS_05840 636819 636208 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978011.1 protein_id gnl|my_center|LOCUS_05840 636916 637860 gene locus_tag LOCUS_05850 gene bioH 636916 637860 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260983.1 protein_id gnl|my_center|LOCUS_05850 637893 640121 gene locus_tag LOCUS_05860 637893 640121 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_05860 640298 641635 gene locus_tag LOCUS_05870 640298 641635 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_05870 642721 641636 gene locus_tag LOCUS_05880 642721 641636 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919956.1 protein_id gnl|my_center|LOCUS_05880 644553 642724 gene locus_tag LOCUS_05890 gene feoB 644553 642724 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640041.1 protein_id gnl|my_center|LOCUS_05890 644783 644553 gene locus_tag LOCUS_05900 644783 644553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 645114 645908 gene locus_tag LOCUS_05910 645114 645908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 645972 646874 gene locus_tag LOCUS_05920 645972 646874 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164829992.1 protein_id gnl|my_center|LOCUS_05920 647480 646911 gene locus_tag LOCUS_05930 647480 646911 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038751.1 protein_id gnl|my_center|LOCUS_05930 648293 647502 gene locus_tag LOCUS_05940 648293 647502 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268548.1 protein_id gnl|my_center|LOCUS_05940 648375 649256 gene locus_tag LOCUS_05950 648375 649256 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967882.1 protein_id gnl|my_center|LOCUS_05950 649258 650127 gene locus_tag LOCUS_05960 gene tesB 649258 650127 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105107.1 protein_id gnl|my_center|LOCUS_05960 650260 652596 gene locus_tag LOCUS_05970 650260 652596 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640416.1 protein_id gnl|my_center|LOCUS_05970 652643 653728 gene locus_tag LOCUS_05980 652643 653728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 654650 653871 gene locus_tag LOCUS_05990 654650 653871 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_05990 655548 654664 gene locus_tag LOCUS_06000 gene rhtA 655548 654664 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268284.1 protein_id gnl|my_center|LOCUS_06000 655637 656224 gene locus_tag LOCUS_06010 655637 656224 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114630.1 protein_id gnl|my_center|LOCUS_06010 657638 656262 gene locus_tag LOCUS_06020 657638 656262 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 protein_id gnl|my_center|LOCUS_06020 657710 658243 gene locus_tag LOCUS_06030 657710 658243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 658278 658778 gene locus_tag LOCUS_06040 658278 658778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 658775 659347 gene locus_tag LOCUS_06050 658775 659347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 659766 659344 gene locus_tag LOCUS_06060 659766 659344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 659899 660645 gene locus_tag LOCUS_06070 659899 660645 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918613.1 protein_id gnl|my_center|LOCUS_06070 660645 661568 gene locus_tag LOCUS_06080 660645 661568 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918612.1 protein_id gnl|my_center|LOCUS_06080 661670 662764 gene locus_tag LOCUS_06090 661670 662764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 663912 662779 gene locus_tag LOCUS_06100 663912 662779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 664024 664446 gene locus_tag LOCUS_06110 664024 664446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 664514 665710 gene locus_tag LOCUS_06120 664514 665710 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_06120 666811 665744 gene locus_tag LOCUS_06130 gene leuB 666811 665744 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918082.1 protein_id gnl|my_center|LOCUS_06130 667951 666884 gene locus_tag LOCUS_06140 667951 666884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 668530 668315 gene locus_tag LOCUS_06150 668530 668315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 669534 668725 gene locus_tag LOCUS_06160 669534 668725 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265997.1 protein_id gnl|my_center|LOCUS_06160 669756 669998 gene locus_tag LOCUS_06170 669756 669998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 670080 670574 gene locus_tag LOCUS_06180 670080 670574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 670615 671205 gene locus_tag LOCUS_06190 670615 671205 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384535.1 protein_id gnl|my_center|LOCUS_06190 671241 672128 gene locus_tag LOCUS_06200 671241 672128 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_06200 673832 672534 gene locus_tag LOCUS_06210 gene hslU 673832 672534 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 protein_id gnl|my_center|LOCUS_06210 674392 673829 gene locus_tag LOCUS_06220 gene hslV 674392 673829 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923353.1 protein_id gnl|my_center|LOCUS_06220 675663 674446 gene locus_tag LOCUS_06230 675663 674446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 676865 675660 gene locus_tag LOCUS_06240 676865 675660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 678699 676936 gene locus_tag LOCUS_06250 678699 676936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 678950 679537 gene locus_tag LOCUS_06260 gene hisB 678950 679537 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921561.1 protein_id gnl|my_center|LOCUS_06260 679547 680173 gene locus_tag LOCUS_06270 gene hisH 679547 680173 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391343.1 protein_id gnl|my_center|LOCUS_06270 680166 680891 gene locus_tag LOCUS_06280 gene hisA 680166 680891 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330420.1 protein_id gnl|my_center|LOCUS_06280 680888 681664 gene locus_tag LOCUS_06290 gene hisF 680888 681664 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385072.1 protein_id gnl|my_center|LOCUS_06290 681665 681991 gene locus_tag LOCUS_06300 681665 681991 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337341.1 protein_id gnl|my_center|LOCUS_06300 681984 682529 gene locus_tag LOCUS_06310 681984 682529 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919934.1 protein_id gnl|my_center|LOCUS_06310 682526 683938 gene locus_tag LOCUS_06320 682526 683938 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_06320 684898 683939 gene locus_tag LOCUS_06330 684898 683939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 685027 686166 gene locus_tag LOCUS_06340 gene dapE 685027 686166 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918164.1 protein_id gnl|my_center|LOCUS_06340 686180 686986 gene locus_tag LOCUS_06350 gene dapB 686180 686986 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338720.1 protein_id gnl|my_center|LOCUS_06350 688047 686983 gene locus_tag LOCUS_06360 688047 686983 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639875.1 protein_id gnl|my_center|LOCUS_06360 688177 689700 gene locus_tag LOCUS_06370 688177 689700 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265498.1 protein_id gnl|my_center|LOCUS_06370 691122 689791 gene locus_tag LOCUS_06380 gene hemN 691122 689791 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390257.1 protein_id gnl|my_center|LOCUS_06380 693008 691200 gene locus_tag LOCUS_06390 693008 691200 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_06390 693328 693008 gene locus_tag LOCUS_06400 693328 693008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 693398 694261 gene locus_tag LOCUS_06410 693398 694261 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084260.1 protein_id gnl|my_center|LOCUS_06410 699207 694336 gene locus_tag LOCUS_06420 699207 694336 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917977.1 protein_id gnl|my_center|LOCUS_06420 699564 699388 gene locus_tag LOCUS_06430 699564 699388 CDS product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965258.1 protein_id gnl|my_center|LOCUS_06430 700172 699567 gene locus_tag LOCUS_06440 700172 699567 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_06440 700821 700159 gene locus_tag LOCUS_06450 700821 700159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 700955 701965 gene locus_tag LOCUS_06460 700955 701965 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_06460 702167 702439 gene locus_tag LOCUS_06470 gene hupB 702167 702439 CDS product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312721.1 protein_id gnl|my_center|LOCUS_06470 703790 702501 gene locus_tag LOCUS_06480 gene mtaB 703790 702501 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338605.1 protein_id gnl|my_center|LOCUS_06480 703873 704082 gene locus_tag LOCUS_06490 703873 704082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 704609 704079 gene locus_tag LOCUS_06500 gene rcdA 704609 704079 CDS product protease adaptor protein RcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 protein_id gnl|my_center|LOCUS_06500 704861 704673 gene locus_tag LOCUS_06510 704861 704673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 704988 705704 gene locus_tag LOCUS_06520 704988 705704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 705707 706669 gene locus_tag LOCUS_06530 705707 706669 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992236.1 protein_id gnl|my_center|LOCUS_06530 708638 706647 gene locus_tag LOCUS_06540 708638 706647 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 protein_id gnl|my_center|LOCUS_06540 710142 708703 gene locus_tag LOCUS_06550 710142 708703 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_06550 710314 711495 gene locus_tag LOCUS_06560 710314 711495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 711932 711492 gene locus_tag LOCUS_06570 711932 711492 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529104.1 protein_id gnl|my_center|LOCUS_06570 712099 712731 gene locus_tag LOCUS_06580 712099 712731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 714277 712874 gene locus_tag LOCUS_06590 714277 712874 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921135.1 protein_id gnl|my_center|LOCUS_06590 714618 714274 gene locus_tag LOCUS_06600 714618 714274 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921136.1 protein_id gnl|my_center|LOCUS_06600 715755 714619 gene locus_tag LOCUS_06610 715755 714619 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_06610 717567 716122 gene locus_tag LOCUS_06620 gene gabD 717567 716122 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_06620 718760 717564 gene locus_tag LOCUS_06630 718760 717564 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920965.1 protein_id gnl|my_center|LOCUS_06630 718977 719648 gene locus_tag LOCUS_06640 gene agkR 718977 719648 CDS product GntR family transcriptional regulator AgkR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721288.1 protein_id gnl|my_center|LOCUS_06640 720294 719653 gene locus_tag LOCUS_06650 720294 719653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 720347 720865 gene locus_tag LOCUS_06660 720347 720865 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 protein_id gnl|my_center|LOCUS_06660 721491 720862 gene locus_tag LOCUS_06670 721491 720862 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970578.1 protein_id gnl|my_center|LOCUS_06670 721529 722101 gene locus_tag LOCUS_06680 721529 722101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 722487 722098 gene locus_tag LOCUS_06690 722487 722098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 722966 723454 gene locus_tag LOCUS_06700 722966 723454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 723663 726290 gene locus_tag LOCUS_06710 gene leuS 723663 726290 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921576.1 protein_id gnl|my_center|LOCUS_06710 726297 726788 gene locus_tag LOCUS_06720 726297 726788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 726860 727840 gene locus_tag LOCUS_06730 gene holA 726860 727840 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921578.1 protein_id gnl|my_center|LOCUS_06730 728724 727837 gene locus_tag LOCUS_06740 728724 727837 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266006.1 protein_id gnl|my_center|LOCUS_06740 729527 728721 gene locus_tag LOCUS_06750 729527 728721 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_06750 730143 729517 gene locus_tag LOCUS_06760 gene rsmG 730143 729517 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391373.1 protein_id gnl|my_center|LOCUS_06760 732002 730143 gene locus_tag LOCUS_06770 gene mnmG 732002 730143 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266007.1 protein_id gnl|my_center|LOCUS_06770 733433 732102 gene locus_tag LOCUS_06780 gene mnmE 733433 732102 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923359.1 protein_id gnl|my_center|LOCUS_06780 733709 733434 gene locus_tag LOCUS_06790 733709 733434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 734148 733723 gene locus_tag LOCUS_06800 734148 733723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 735675 734206 gene locus_tag LOCUS_06810 gene rho 735675 734206 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266008.1 protein_id gnl|my_center|LOCUS_06810 737021 735771 gene locus_tag LOCUS_06820 737021 735771 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 protein_id gnl|my_center|LOCUS_06820 737150 739498 gene locus_tag LOCUS_06830 737150 739498 CDS product DNA translocase FtsK 4TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923345.1 protein_id gnl|my_center|LOCUS_06830 739505 740146 gene locus_tag LOCUS_06840 739505 740146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 741004 740417 gene locus_tag LOCUS_06850 741004 740417 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338814.1 protein_id gnl|my_center|LOCUS_06850 742348 741005 gene locus_tag LOCUS_06860 742348 741005 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947710.1 protein_id gnl|my_center|LOCUS_06860 742932 742345 gene locus_tag LOCUS_06870 742932 742345 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992367.1 protein_id gnl|my_center|LOCUS_06870 743208 743702 gene locus_tag LOCUS_06880 gene secB 743208 743702 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921569.1 protein_id gnl|my_center|LOCUS_06880 744408 743704 gene locus_tag LOCUS_06890 gene dnaQ 744408 743704 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538049.1 protein_id gnl|my_center|LOCUS_06890 745006 744401 gene locus_tag LOCUS_06900 gene coaE 745006 744401 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_06900 745856 744999 gene locus_tag LOCUS_06910 745856 744999 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085045.1 protein_id gnl|my_center|LOCUS_06910 746467 745853 gene locus_tag LOCUS_06920 746467 745853 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917893.1 protein_id gnl|my_center|LOCUS_06920 747287 746457 gene locus_tag LOCUS_06930 747287 746457 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_06930 747707 748738 gene locus_tag LOCUS_06940 gene hemE 747707 748738 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085186.1 protein_id gnl|my_center|LOCUS_06940 748743 749702 gene locus_tag LOCUS_06950 gene hemH 748743 749702 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921589.1 protein_id gnl|my_center|LOCUS_06950 749695 750150 gene locus_tag LOCUS_06960 gene hemJ 749695 750150 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_06960 751034 750147 gene locus_tag LOCUS_06970 gene folD 751034 750147 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384886.1 protein_id gnl|my_center|LOCUS_06970 751332 751042 gene locus_tag LOCUS_06980 751332 751042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 751636 751355 gene locus_tag LOCUS_06990 751636 751355 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265985.1 protein_id gnl|my_center|LOCUS_06990 751851 754616 gene locus_tag LOCUS_07000 751851 754616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 755788 754655 gene locus_tag LOCUS_07010 755788 754655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920970.1 protein_id gnl|my_center|LOCUS_07010 756643 755804 gene locus_tag LOCUS_07020 756643 755804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640674.1 protein_id gnl|my_center|LOCUS_07020 757549 756653 gene locus_tag LOCUS_07030 757549 756653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265910.1 protein_id gnl|my_center|LOCUS_07030 758736 757573 gene locus_tag LOCUS_07040 758736 757573 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920973.1 protein_id gnl|my_center|LOCUS_07040 760167 758773 gene locus_tag LOCUS_07050 760167 758773 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920974.1 protein_id gnl|my_center|LOCUS_07050 761553 760177 gene locus_tag LOCUS_07060 761553 760177 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389007.1 protein_id gnl|my_center|LOCUS_07060 762986 761553 gene locus_tag LOCUS_07070 762986 761553 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528228.1 protein_id gnl|my_center|LOCUS_07070 763893 763078 gene locus_tag LOCUS_07080 gene xth 763893 763078 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 protein_id gnl|my_center|LOCUS_07080 764958 763915 gene locus_tag LOCUS_07090 764958 763915 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388795.1 protein_id gnl|my_center|LOCUS_07090 765074 766336 gene locus_tag LOCUS_07100 765074 766336 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_07100 766330 767361 gene locus_tag LOCUS_07110 766330 767361 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919480.1 protein_id gnl|my_center|LOCUS_07110 767354 768811 gene locus_tag LOCUS_07120 gene astD 767354 768811 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919481.1 protein_id gnl|my_center|LOCUS_07120 768808 769710 gene locus_tag LOCUS_07130 768808 769710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 769785 770414 gene locus_tag LOCUS_07140 769785 770414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 770837 770442 gene locus_tag LOCUS_07150 770837 770442 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309922.1 protein_id gnl|my_center|LOCUS_07150 771897 770827 gene locus_tag LOCUS_07160 771897 770827 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921483.1 protein_id gnl|my_center|LOCUS_07160 772499 771906 gene locus_tag LOCUS_07170 772499 771906 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 protein_id gnl|my_center|LOCUS_07170 774061 772496 gene locus_tag LOCUS_07180 774061 772496 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_07180 774855 774061 gene locus_tag LOCUS_07190 774855 774061 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_07190 775541 774867 gene locus_tag LOCUS_07200 775541 774867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 775667 776539 gene locus_tag LOCUS_07210 gene galU 775667 776539 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529722.1 protein_id gnl|my_center|LOCUS_07210 776547 777527 gene locus_tag LOCUS_07220 776547 777527 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_07220 778974 777520 gene locus_tag LOCUS_07230 778974 777520 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972396.1 protein_id gnl|my_center|LOCUS_07230 779208 779870 gene locus_tag LOCUS_07240 779208 779870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 779874 781238 gene locus_tag LOCUS_07250 779874 781238 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921032.1 protein_id gnl|my_center|LOCUS_07250 781248 784526 gene locus_tag LOCUS_07260 781248 784526 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921033.1 protein_id gnl|my_center|LOCUS_07260 784622 785170 gene locus_tag LOCUS_07270 gene ppa 784622 785170 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310823.1 protein_id gnl|my_center|LOCUS_07270 785442 785215 gene locus_tag LOCUS_07280 785442 785215 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 protein_id gnl|my_center|LOCUS_07280 787019 785601 gene locus_tag LOCUS_07290 gene leuC 787019 785601 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918085.1 protein_id gnl|my_center|LOCUS_07290 787374 787964 gene locus_tag LOCUS_07300 787374 787964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 788057 788332 gene locus_tag LOCUS_07310 788057 788332 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 protein_id gnl|my_center|LOCUS_07310 788360 788743 gene locus_tag LOCUS_07320 788360 788743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 788745 789383 gene locus_tag LOCUS_07330 gene msrA 788745 789383 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_07330 789446 790552 gene locus_tag LOCUS_07340 789446 790552 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 protein_id gnl|my_center|LOCUS_07340 790549 792870 gene locus_tag LOCUS_07350 790549 792870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 793134 792871 gene locus_tag LOCUS_07360 793134 792871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 793343 794416 gene locus_tag LOCUS_07370 793343 794416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 795696 794485 gene locus_tag LOCUS_07380 795696 794485 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_07380 796136 795696 gene locus_tag LOCUS_07390 796136 795696 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085287.1 protein_id gnl|my_center|LOCUS_07390 796585 796136 gene locus_tag LOCUS_07400 796585 796136 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477208.1 protein_id gnl|my_center|LOCUS_07400 797072 796587 gene locus_tag LOCUS_07410 797072 796587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 798853 797075 gene locus_tag LOCUS_07420 798853 797075 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917969.1 protein_id gnl|my_center|LOCUS_07420 799264 798866 gene locus_tag LOCUS_07430 799264 798866 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 protein_id gnl|my_center|LOCUS_07430 799405 799803 gene locus_tag LOCUS_07440 799405 799803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 800008 803208 gene locus_tag LOCUS_07450 800008 803208 CDS product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640394.1 protein_id gnl|my_center|LOCUS_07450 803352 804242 gene locus_tag LOCUS_07460 803352 804242 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974359.1 protein_id gnl|my_center|LOCUS_07460 804239 805000 gene locus_tag LOCUS_07470 804239 805000 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533664.1 protein_id gnl|my_center|LOCUS_07470 806210 804990 gene locus_tag LOCUS_07480 806210 804990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 806358 806582 gene locus_tag LOCUS_07490 gene rpmE 806358 806582 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084323.1 protein_id gnl|my_center|LOCUS_07490 806703 807377 gene locus_tag LOCUS_07500 806703 807377 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115771.1 protein_id gnl|my_center|LOCUS_07500 807431 808687 gene locus_tag LOCUS_07510 807431 808687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 808684 810138 gene locus_tag LOCUS_07520 808684 810138 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917964.1 protein_id gnl|my_center|LOCUS_07520 810464 810390 gene locus_tag LOCUS_t00040 810464 810390 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 810575 810958 gene locus_tag LOCUS_07530 810575 810958 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919888.1 protein_id gnl|my_center|LOCUS_07530 810955 811458 gene locus_tag LOCUS_07540 810955 811458 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393929.1 protein_id gnl|my_center|LOCUS_07540 812028 811669 gene locus_tag LOCUS_07550 812028 811669 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 protein_id gnl|my_center|LOCUS_07550 812119 812946 gene locus_tag LOCUS_07560 812119 812946 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312898.1 protein_id gnl|my_center|LOCUS_07560 813315 814034 gene locus_tag LOCUS_07570 gene gpmA 813315 814034 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920122.1 protein_id gnl|my_center|LOCUS_07570 814034 814486 gene locus_tag LOCUS_07580 814034 814486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 817082 814464 gene locus_tag LOCUS_07590 817082 814464 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_07590 817228 817695 gene locus_tag LOCUS_07600 817228 817695 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898000.1 protein_id gnl|my_center|LOCUS_07600 817703 818305 gene locus_tag LOCUS_07610 817703 818305 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 protein_id gnl|my_center|LOCUS_07610 818305 819345 gene locus_tag LOCUS_07620 818305 819345 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923333.1 protein_id gnl|my_center|LOCUS_07620 819457 820464 gene locus_tag LOCUS_07630 gene gap 819457 820464 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 protein_id gnl|my_center|LOCUS_07630 820672 821319 gene locus_tag LOCUS_07640 820672 821319 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640673.1 protein_id gnl|my_center|LOCUS_07640 821353 822180 gene locus_tag LOCUS_07650 gene dapF 821353 822180 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921513.1 protein_id gnl|my_center|LOCUS_07650 822368 822709 gene locus_tag LOCUS_07660 gene arsC 822368 822709 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_07660 822726 823352 gene locus_tag LOCUS_07670 gene tsaB 822726 823352 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399637.1 protein_id gnl|my_center|LOCUS_07670 823345 823779 gene locus_tag LOCUS_07680 gene rimI 823345 823779 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700855.1 protein_id gnl|my_center|LOCUS_07680 823858 824283 gene locus_tag LOCUS_07690 823858 824283 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_07690 824305 825672 gene locus_tag LOCUS_07700 gene miaB 824305 825672 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639867.1 protein_id gnl|my_center|LOCUS_07700 825665 826150 gene locus_tag LOCUS_07710 825665 826150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 826151 827059 gene locus_tag LOCUS_07720 826151 827059 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 protein_id gnl|my_center|LOCUS_07720 827208 828602 gene locus_tag LOCUS_07730 gene lnt 827208 828602 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917942.1 protein_id gnl|my_center|LOCUS_07730 828667 829080 gene locus_tag LOCUS_07740 828667 829080 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527670.1 protein_id gnl|my_center|LOCUS_07740 829152 829778 gene locus_tag LOCUS_07750 gene trmB 829152 829778 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639863.1 protein_id gnl|my_center|LOCUS_07750 830613 829765 gene locus_tag LOCUS_07760 830613 829765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 831510 830638 gene locus_tag LOCUS_07770 831510 830638 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921486.1 protein_id gnl|my_center|LOCUS_07770 831585 832703 gene locus_tag LOCUS_07780 831585 832703 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_07780 833375 832698 gene locus_tag LOCUS_07790 833375 832698 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920500.1 protein_id gnl|my_center|LOCUS_07790 833820 833365 gene locus_tag LOCUS_07800 gene ybgC 833820 833365 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 protein_id gnl|my_center|LOCUS_07800 834835 833810 gene locus_tag LOCUS_07810 gene ruvB 834835 833810 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921069.1 protein_id gnl|my_center|LOCUS_07810 835479 834838 gene locus_tag LOCUS_07820 gene ruvA 835479 834838 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066857.1 protein_id gnl|my_center|LOCUS_07820 835985 835476 gene locus_tag LOCUS_07830 gene ruvC 835985 835476 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640705.1 protein_id gnl|my_center|LOCUS_07830 836037 836741 gene locus_tag LOCUS_07840 gene cobB 836037 836741 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 protein_id gnl|my_center|LOCUS_07840 837183 836734 gene locus_tag LOCUS_07850 837183 836734 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_07850 837998 837180 gene locus_tag LOCUS_07860 837998 837180 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529450.1 protein_id gnl|my_center|LOCUS_07860 838249 837995 gene locus_tag LOCUS_07870 gene grxC 838249 837995 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 protein_id gnl|my_center|LOCUS_07870 838340 838894 gene locus_tag LOCUS_07880 gene rsmD 838340 838894 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_07880 839246 838869 gene locus_tag LOCUS_07890 839246 838869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 839637 839260 gene locus_tag LOCUS_07900 839637 839260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 841530 839689 gene locus_tag LOCUS_07910 gene mutL 841530 839689 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139982.1 protein_id gnl|my_center|LOCUS_07910 842123 841542 gene locus_tag LOCUS_07920 842123 841542 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640037.1 protein_id gnl|my_center|LOCUS_07920 842717 842178 gene locus_tag LOCUS_07930 gene lspA 842717 842178 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918586.1 protein_id gnl|my_center|LOCUS_07930 842808 844487 gene locus_tag LOCUS_07940 842808 844487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917915.1 protein_id gnl|my_center|LOCUS_07940 846083 844518 gene locus_tag LOCUS_07950 gene murJ 846083 844518 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639869.1 protein_id gnl|my_center|LOCUS_07950 848935 846095 gene locus_tag LOCUS_07960 848935 846095 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917903.1 protein_id gnl|my_center|LOCUS_07960 849417 848956 gene locus_tag LOCUS_07970 gene infC 849417 848956 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918933.1 protein_id gnl|my_center|LOCUS_07970 850625 849633 gene locus_tag LOCUS_07980 850625 849633 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_07980 851770 850625 gene locus_tag LOCUS_07990 851770 850625 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_07990 851822 852583 gene locus_tag LOCUS_08000 851822 852583 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_08000 854654 852573 gene locus_tag LOCUS_08010 854654 852573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 856193 855108 gene locus_tag LOCUS_08020 gene ald 856193 855108 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946659.1 protein_id gnl|my_center|LOCUS_08020 856317 856784 gene locus_tag LOCUS_08030 856317 856784 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921402.1 protein_id gnl|my_center|LOCUS_08030 857811 856789 gene locus_tag LOCUS_08040 857811 856789 CDS product DUF4424 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206313.1 protein_id gnl|my_center|LOCUS_08040 858126 857923 gene locus_tag LOCUS_08050 858126 857923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 858348 858998 gene locus_tag LOCUS_08060 858348 858998 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_08060 859750 858995 gene locus_tag LOCUS_08070 859750 858995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 860872 859814 gene locus_tag LOCUS_08080 860872 859814 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336844.1 protein_id gnl|my_center|LOCUS_08080 861357 860872 gene locus_tag LOCUS_08090 gene purE 861357 860872 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077767952.1 protein_id gnl|my_center|LOCUS_08090 861518 862279 gene locus_tag LOCUS_08100 861518 862279 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_08100 862408 863301 gene locus_tag LOCUS_08110 gene rpoH 862408 863301 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920934.1 protein_id gnl|my_center|LOCUS_08110 863341 865503 gene locus_tag LOCUS_08120 863341 865503 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918235.1 protein_id gnl|my_center|LOCUS_08120 865526 866302 gene locus_tag LOCUS_08130 865526 866302 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973884.1 protein_id gnl|my_center|LOCUS_08130 866421 867710 gene locus_tag LOCUS_08140 866421 867710 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920939.1 protein_id gnl|my_center|LOCUS_08140 867816 868220 gene locus_tag LOCUS_08150 867816 868220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 868263 868478 gene locus_tag LOCUS_08160 868263 868478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 869891 868509 gene locus_tag LOCUS_08170 869891 868509 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_08170 870088 871134 gene locus_tag LOCUS_08180 870088 871134 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039199.1 protein_id gnl|my_center|LOCUS_08180 871237 872679 gene locus_tag LOCUS_08190 871237 872679 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 protein_id gnl|my_center|LOCUS_08190 872667 873977 gene locus_tag LOCUS_08200 872667 873977 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_08200 873967 874845 gene locus_tag LOCUS_08210 873967 874845 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_08210 874842 875663 gene locus_tag LOCUS_08220 874842 875663 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_08220 875666 878659 gene locus_tag LOCUS_08230 875666 878659 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275353.1 protein_id gnl|my_center|LOCUS_08230 878674 879729 gene locus_tag LOCUS_08240 gene ugpC 878674 879729 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974930.1 protein_id gnl|my_center|LOCUS_08240 879991 880593 gene locus_tag LOCUS_08250 gene leuD 879991 880593 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918084.1 protein_id gnl|my_center|LOCUS_08250 880607 881323 gene locus_tag LOCUS_08260 880607 881323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 881320 882060 gene locus_tag LOCUS_08270 881320 882060 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_08270 882057 883817 gene locus_tag LOCUS_08280 882057 883817 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_08280 883804 885456 gene locus_tag LOCUS_08290 883804 885456 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_08290 886282 885419 gene locus_tag LOCUS_08300 886282 885419 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919938.1 protein_id gnl|my_center|LOCUS_08300 887517 886282 gene locus_tag LOCUS_08310 887517 886282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 889454 887517 gene locus_tag LOCUS_08320 gene thrS 889454 887517 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918352.1 protein_id gnl|my_center|LOCUS_08320 889869 889447 gene locus_tag LOCUS_08330 889869 889447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 890412 889969 gene locus_tag LOCUS_08340 890412 889969 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531981.1 protein_id gnl|my_center|LOCUS_08340 890651 892507 gene locus_tag LOCUS_08350 890651 892507 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_08350 892522 894111 gene locus_tag LOCUS_08360 gene purH 892522 894111 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972592.1 protein_id gnl|my_center|LOCUS_08360 894202 894978 gene locus_tag LOCUS_08370 894202 894978 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917976.1 protein_id gnl|my_center|LOCUS_08370 895912 894965 gene locus_tag LOCUS_08380 895912 894965 CDS product DUF6065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969880.1 protein_id gnl|my_center|LOCUS_08380 896061 897572 gene locus_tag LOCUS_08390 896061 897572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 897606 898229 gene locus_tag LOCUS_08400 897606 898229 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919386.1 protein_id gnl|my_center|LOCUS_08400 900177 898387 gene locus_tag LOCUS_08410 gene sdhA 900177 898387 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265974.1 protein_id gnl|my_center|LOCUS_08410 900574 900179 gene locus_tag LOCUS_08420 gene sdhD 900574 900179 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923304.1 protein_id gnl|my_center|LOCUS_08420 900987 900577 gene locus_tag LOCUS_08430 gene sdhC 900987 900577 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921358.1 protein_id gnl|my_center|LOCUS_08430 901246 902094 gene locus_tag LOCUS_08440 901246 902094 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089860.1 protein_id gnl|my_center|LOCUS_08440 902186 902920 gene locus_tag LOCUS_08450 902186 902920 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639954.1 protein_id gnl|my_center|LOCUS_08450 903402 902917 gene locus_tag LOCUS_08460 903402 902917 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920071.1 protein_id gnl|my_center|LOCUS_08460 903574 904983 gene locus_tag LOCUS_08470 gene argH 903574 904983 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388156.1 protein_id gnl|my_center|LOCUS_08470 904976 905179 gene locus_tag LOCUS_08480 904976 905179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 905209 906471 gene locus_tag LOCUS_08490 gene lysA 905209 906471 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383406.1 protein_id gnl|my_center|LOCUS_08490 906892 908778 gene locus_tag LOCUS_08500 906892 908778 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923295.1 protein_id gnl|my_center|LOCUS_08500 909488 908781 gene locus_tag LOCUS_08510 909488 908781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 910207 909512 gene locus_tag LOCUS_08520 910207 909512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 911099 910293 gene locus_tag LOCUS_08530 911099 910293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 911291 912334 gene locus_tag LOCUS_08540 911291 912334 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918149.1 protein_id gnl|my_center|LOCUS_08540 913053 912331 gene locus_tag LOCUS_08550 913053 912331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 914053 913055 gene locus_tag LOCUS_08560 914053 913055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 915058 914054 gene locus_tag LOCUS_08570 915058 914054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 915793 915062 gene locus_tag LOCUS_08580 915793 915062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 916721 915810 gene locus_tag LOCUS_08590 916721 915810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 916884 919568 gene locus_tag LOCUS_08600 916884 919568 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041976239.1 protein_id gnl|my_center|LOCUS_08600 919669 920835 gene locus_tag LOCUS_08610 919669 920835 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091679.1 protein_id gnl|my_center|LOCUS_08610 920837 921304 gene locus_tag LOCUS_08620 920837 921304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 922118 921306 gene locus_tag LOCUS_08630 922118 921306 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310140.1 protein_id gnl|my_center|LOCUS_08630 922342 923757 gene locus_tag LOCUS_08640 922342 923757 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_08640 923769 928313 gene locus_tag LOCUS_08650 gene gltB 923769 928313 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921434.1 protein_id gnl|my_center|LOCUS_08650 928448 929209 gene locus_tag LOCUS_08660 928448 929209 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328249.1 protein_id gnl|my_center|LOCUS_08660 929257 930624 gene locus_tag LOCUS_08670 929257 930624 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_08670 931171 930779 gene locus_tag LOCUS_08680 931171 930779 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920112.1 protein_id gnl|my_center|LOCUS_08680 931387 932265 gene locus_tag LOCUS_08690 931387 932265 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918601.1 protein_id gnl|my_center|LOCUS_08690 932472 932302 gene locus_tag LOCUS_08700 932472 932302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 932659 933225 gene locus_tag LOCUS_08710 932659 933225 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923244.1 protein_id gnl|my_center|LOCUS_08710 933262 933489 gene locus_tag LOCUS_08720 933262 933489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 933977 933486 gene locus_tag LOCUS_08730 933977 933486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 934494 934015 gene locus_tag LOCUS_08740 934494 934015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 934715 935149 gene locus_tag LOCUS_08750 934715 935149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 935155 937083 gene locus_tag LOCUS_08760 935155 937083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 937829 937080 gene locus_tag LOCUS_08770 937829 937080 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265527.1 protein_id gnl|my_center|LOCUS_08770 938114 939316 gene locus_tag LOCUS_08780 gene sucC 938114 939316 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067154.1 protein_id gnl|my_center|LOCUS_08780 939318 940202 gene locus_tag LOCUS_08790 gene sucD 939318 940202 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918227.1 protein_id gnl|my_center|LOCUS_08790 940260 943208 gene locus_tag LOCUS_08800 940260 943208 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918228.1 protein_id gnl|my_center|LOCUS_08800 943225 944424 gene locus_tag LOCUS_08810 gene odhB 943225 944424 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918229.1 protein_id gnl|my_center|LOCUS_08810 944520 944972 gene locus_tag LOCUS_08820 944520 944972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 946783 944969 gene locus_tag LOCUS_08830 946783 944969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 947004 947798 gene locus_tag LOCUS_08840 947004 947798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 948266 947805 gene locus_tag LOCUS_08850 gene zur 948266 947805 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_08850 949371 948304 gene locus_tag LOCUS_08860 949371 948304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 949576 949652 gene locus_tag LOCUS_t00050 949576 949652 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 949843 951042 gene locus_tag LOCUS_08870 gene ubiM 949843 951042 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 protein_id gnl|my_center|LOCUS_08870 951082 951639 gene locus_tag LOCUS_08880 951082 951639 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919860.1 protein_id gnl|my_center|LOCUS_08880 951636 952241 gene locus_tag LOCUS_08890 951636 952241 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000242.1 protein_id gnl|my_center|LOCUS_08890 952238 952693 gene locus_tag LOCUS_08900 952238 952693 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 protein_id gnl|my_center|LOCUS_08900 952724 954952 gene locus_tag LOCUS_08910 952724 954952 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_08910 955441 954956 gene locus_tag LOCUS_08920 955441 954956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 956105 955692 gene locus_tag LOCUS_08930 956105 955692 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_08930 957075 956119 gene locus_tag LOCUS_08940 957075 956119 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391020.1 protein_id gnl|my_center|LOCUS_08940 959248 957077 gene locus_tag LOCUS_08950 959248 957077 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_08950 960350 959373 gene locus_tag LOCUS_08960 960350 959373 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921468.1 protein_id gnl|my_center|LOCUS_08960 960412 960594 gene locus_tag LOCUS_08970 960412 960594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 960715 960996 gene locus_tag LOCUS_08980 960715 960996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 961004 962794 gene locus_tag LOCUS_08990 gene yidC 961004 962794 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918653.1 protein_id gnl|my_center|LOCUS_08990 962794 963426 gene locus_tag LOCUS_09000 gene yihA 962794 963426 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090821.1 protein_id gnl|my_center|LOCUS_09000 964823 963423 gene locus_tag LOCUS_09010 964823 963423 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917991.1 protein_id gnl|my_center|LOCUS_09010 964905 965102 gene locus_tag LOCUS_09020 964905 965102 CDS product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338719.1 protein_id gnl|my_center|LOCUS_09020 965092 965772 gene locus_tag LOCUS_09030 965092 965772 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018207916.1 protein_id gnl|my_center|LOCUS_09030 965942 966808 gene locus_tag LOCUS_09040 965942 966808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 966916 967608 gene locus_tag LOCUS_09050 966916 967608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 968407 967601 gene locus_tag LOCUS_09060 968407 967601 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_09060 968536 970482 gene locus_tag LOCUS_09070 968536 970482 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639885.1 protein_id gnl|my_center|LOCUS_09070 970573 971202 gene locus_tag LOCUS_09080 970573 971202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 971311 972561 gene locus_tag LOCUS_09090 971311 972561 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918018.1 protein_id gnl|my_center|LOCUS_09090 973181 972591 gene locus_tag LOCUS_09100 973181 972591 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_09100 973352 973182 gene locus_tag LOCUS_09110 973352 973182 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917997.1 protein_id gnl|my_center|LOCUS_09110 974018 973356 gene locus_tag LOCUS_09120 974018 973356 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705602.1 protein_id gnl|my_center|LOCUS_09120 974881 974018 gene locus_tag LOCUS_09130 gene trxA 974881 974018 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 protein_id gnl|my_center|LOCUS_09130 975470 974925 gene locus_tag LOCUS_09140 975470 974925 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_09140 975601 975675 gene locus_tag LOCUS_t00060 975601 975675 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 976358 975783 gene locus_tag LOCUS_09150 976358 975783 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967222.1 protein_id gnl|my_center|LOCUS_09150 977715 976369 gene locus_tag LOCUS_09160 977715 976369 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_09160 977961 977740 gene locus_tag LOCUS_09170 977961 977740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 977849 978757 gene locus_tag LOCUS_09180 977849 978757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 979887 978811 gene locus_tag LOCUS_09190 979887 978811 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 protein_id gnl|my_center|LOCUS_09190 980867 979896 gene locus_tag LOCUS_09200 980867 979896 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920778.1 protein_id gnl|my_center|LOCUS_09200 982391 980880 gene locus_tag LOCUS_09210 982391 980880 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920779.1 protein_id gnl|my_center|LOCUS_09210 983781 982393 gene locus_tag LOCUS_09220 gene cpaE 983781 982393 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920780.1 protein_id gnl|my_center|LOCUS_09220 984452 983781 gene locus_tag LOCUS_09230 984452 983781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 986134 984470 gene locus_tag LOCUS_09240 986134 984470 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920782.1 protein_id gnl|my_center|LOCUS_09240 986991 986131 gene locus_tag LOCUS_09250 gene cpaB 986991 986131 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 protein_id gnl|my_center|LOCUS_09250 987643 987116 gene locus_tag LOCUS_09260 987643 987116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 988390 987695 gene locus_tag LOCUS_09270 988390 987695 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918902.1 protein_id gnl|my_center|LOCUS_09270 988627 988460 gene locus_tag LOCUS_09280 988627 988460 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173014.1 protein_id gnl|my_center|LOCUS_09280 989229 989062 gene locus_tag LOCUS_09290 989229 989062 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706435.1 protein_id gnl|my_center|LOCUS_09290 989530 989357 gene locus_tag LOCUS_09300 989530 989357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 989746 990180 gene locus_tag LOCUS_09310 989746 990180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 990266 990817 gene locus_tag LOCUS_09320 990266 990817 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920787.1 protein_id gnl|my_center|LOCUS_09320 990832 991473 gene locus_tag LOCUS_09330 990832 991473 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533689.1 protein_id gnl|my_center|LOCUS_09330 992999 991524 gene locus_tag LOCUS_09340 992999 991524 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919215.1 protein_id gnl|my_center|LOCUS_09340 994224 993280 gene locus_tag LOCUS_09350 994224 993280 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393732.1 protein_id gnl|my_center|LOCUS_09350 994919 994227 gene locus_tag LOCUS_09360 994919 994227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 995641 995042 gene locus_tag LOCUS_09370 995641 995042 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921260.1 protein_id gnl|my_center|LOCUS_09370 996910 995645 gene locus_tag LOCUS_09380 996910 995645 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388993.1 protein_id gnl|my_center|LOCUS_09380 997310 996996 gene locus_tag LOCUS_09390 997310 996996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 998029 997391 gene locus_tag LOCUS_09400 998029 997391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 998649 998086 gene locus_tag LOCUS_09410 998649 998086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 999246 998698 gene locus_tag LOCUS_09420 gene thpR 999246 998698 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972484.1 protein_id gnl|my_center|LOCUS_09420 1000592 999246 gene locus_tag LOCUS_09430 gene astB 1000592 999246 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919482.1 protein_id gnl|my_center|LOCUS_09430 1001840 1000791 gene locus_tag LOCUS_09440 1001840 1000791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1002827 1001934 gene locus_tag LOCUS_09450 1002827 1001934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_09450 1003194 1002820 gene locus_tag LOCUS_09460 1003194 1002820 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_09460 1003916 1003323 gene locus_tag LOCUS_09470 1003916 1003323 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919545.1 protein_id gnl|my_center|LOCUS_09470 1005025 1004087 gene locus_tag LOCUS_09480 1005025 1004087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1005486 1005178 gene locus_tag LOCUS_09490 1005486 1005178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1005891 1006565 gene locus_tag LOCUS_09500 1005891 1006565 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_09500 1007035 1006562 gene locus_tag LOCUS_09510 1007035 1006562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1007613 1006969 gene locus_tag LOCUS_09520 1007613 1006969 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920110.1 protein_id gnl|my_center|LOCUS_09520 1008359 1007727 gene locus_tag LOCUS_09530 1008359 1007727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1010350 1008428 gene locus_tag LOCUS_09540 1010350 1008428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1010753 1011217 gene locus_tag LOCUS_09550 1010753 1011217 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_09550 1013437 1011284 gene locus_tag LOCUS_09560 1013437 1011284 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 protein_id gnl|my_center|LOCUS_09560 1014400 1013540 gene locus_tag LOCUS_09570 1014400 1013540 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_09570 1015450 1014416 gene locus_tag LOCUS_09580 gene epmA 1015450 1014416 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_09580 1015547 1016122 gene locus_tag LOCUS_09590 gene efp 1015547 1016122 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067676.1 protein_id gnl|my_center|LOCUS_09590 1018124 1016319 gene locus_tag LOCUS_09600 gene thiC 1018124 1016319 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972409.1 protein_id gnl|my_center|LOCUS_09600 1019514 1018300 gene locus_tag LOCUS_09610 gene fabB 1019514 1018300 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921546.1 protein_id gnl|my_center|LOCUS_09610 1020053 1019529 gene locus_tag LOCUS_09620 gene fabA 1020053 1019529 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921547.1 protein_id gnl|my_center|LOCUS_09620 1020668 1020174 gene locus_tag LOCUS_09630 1020668 1020174 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527882.1 protein_id gnl|my_center|LOCUS_09630 1020857 1021843 gene locus_tag LOCUS_09640 1020857 1021843 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265998.1 protein_id gnl|my_center|LOCUS_09640 1022664 1023782 gene locus_tag LOCUS_09650 1022664 1023782 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_09650 1025828 1023819 gene locus_tag LOCUS_09660 1025828 1023819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1026279 1025833 gene locus_tag LOCUS_09670 1026279 1025833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1027193 1026276 gene locus_tag LOCUS_09680 1027193 1026276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1027853 1027293 gene locus_tag LOCUS_09690 1027853 1027293 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_09690 1028571 1028161 gene locus_tag LOCUS_09700 1028571 1028161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1029413 1028673 gene locus_tag LOCUS_09710 1029413 1028673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1029412 1029753 gene locus_tag LOCUS_09720 1029412 1029753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1029809 1030732 gene locus_tag LOCUS_09730 1029809 1030732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1031886 1030963 gene locus_tag LOCUS_09740 1031886 1030963 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920843.1 protein_id gnl|my_center|LOCUS_09740 1032836 1031925 gene locus_tag LOCUS_09750 1032836 1031925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1033465 1032956 gene locus_tag LOCUS_09760 1033465 1032956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1034335 1033508 gene locus_tag LOCUS_09770 1034335 1033508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1034583 1036232 gene locus_tag LOCUS_09780 1034583 1036232 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_09780 1036225 1037460 gene locus_tag LOCUS_09790 1036225 1037460 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_09790 1037460 1040447 gene locus_tag LOCUS_09800 1037460 1040447 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 protein_id gnl|my_center|LOCUS_09800 1040444 1041145 gene locus_tag LOCUS_09810 1040444 1041145 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_09810 1042221 1041571 gene locus_tag LOCUS_09820 1042221 1041571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1042432 1042223 gene locus_tag LOCUS_09830 1042432 1042223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1043091 1042486 gene locus_tag LOCUS_09840 1043091 1042486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1043843 1043256 gene locus_tag LOCUS_09850 1043843 1043256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1044143 1043952 gene locus_tag LOCUS_09860 1044143 1043952 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019830047.1 protein_id gnl|my_center|LOCUS_09860 1044967 1044272 gene locus_tag LOCUS_09870 1044967 1044272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1046186 1044993 gene locus_tag LOCUS_09880 1046186 1044993 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_09880 1046440 1046365 gene locus_tag LOCUS_t00070 1046440 1046365 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1046737 1046543 gene locus_tag LOCUS_09890 1046737 1046543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1047750 1046737 gene locus_tag LOCUS_09900 1047750 1046737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1048310 1047747 gene locus_tag LOCUS_09910 1048310 1047747 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640472.1 protein_id gnl|my_center|LOCUS_09910 1048544 1048326 gene locus_tag LOCUS_09920 gene infA 1048544 1048326 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_09920 1048805 1049578 gene locus_tag LOCUS_09930 1048805 1049578 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537440.1 protein_id gnl|my_center|LOCUS_09930 1049812 1050159 gene locus_tag LOCUS_09940 1049812 1050159 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_09940 1050197 1051333 gene locus_tag LOCUS_09950 gene rlmN 1050197 1051333 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918023.1 protein_id gnl|my_center|LOCUS_09950 1051602 1051447 gene locus_tag LOCUS_09960 1051602 1051447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1051848 1051678 gene locus_tag LOCUS_09970 1051848 1051678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1052453 1051908 gene locus_tag LOCUS_09980 gene rimM 1052453 1051908 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721394.1 protein_id gnl|my_center|LOCUS_09980 1052867 1052457 gene locus_tag LOCUS_09990 1052867 1052457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1054430 1052907 gene locus_tag LOCUS_10000 gene ffh 1054430 1052907 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921480.1 protein_id gnl|my_center|LOCUS_10000 1054685 1055185 gene locus_tag LOCUS_10010 1054685 1055185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1055296 1056261 gene locus_tag LOCUS_10020 1055296 1056261 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_10020 1057384 1056272 gene locus_tag LOCUS_10030 1057384 1056272 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_10030 1057798 1057523 gene locus_tag LOCUS_10040 1057798 1057523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1058025 1059407 gene locus_tag LOCUS_10050 1058025 1059407 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_10050 1059757 1059404 gene locus_tag LOCUS_10060 1059757 1059404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1060904 1059759 gene locus_tag LOCUS_10070 1060904 1059759 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096575.1 protein_id gnl|my_center|LOCUS_10070 1061581 1060871 gene locus_tag LOCUS_10080 1061581 1060871 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919712.1 protein_id gnl|my_center|LOCUS_10080 1062510 1061725 gene locus_tag LOCUS_10090 1062510 1061725 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921355.1 protein_id gnl|my_center|LOCUS_10090 1062723 1063301 gene locus_tag LOCUS_10100 1062723 1063301 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_10100 1063298 1063699 gene locus_tag LOCUS_10110 1063298 1063699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1064349 1063786 gene locus_tag LOCUS_10120 1064349 1063786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1064627 1064346 gene locus_tag LOCUS_10130 1064627 1064346 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_10130 1064986 1064627 gene locus_tag LOCUS_10140 1064986 1064627 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence2 49 125 gene locus_tag LOCUS_t00080 49 125 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 255 1562 gene locus_tag LOCUS_10150 255 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2223 2597 gene locus_tag LOCUS_10160 2223 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2964 3863 gene locus_tag LOCUS_10170 2964 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4465 3896 gene locus_tag LOCUS_10180 4465 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4918 5841 gene locus_tag LOCUS_10190 4918 5841 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394832.1 protein_id gnl|my_center|LOCUS_10190 5885 6199 gene locus_tag LOCUS_10200 5885 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 6475 6224 gene locus_tag LOCUS_10210 6475 6224 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266521.1 protein_id gnl|my_center|LOCUS_10210 6557 6928 gene locus_tag LOCUS_10220 6557 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 7135 6908 gene locus_tag LOCUS_10230 7135 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7389 7691 gene locus_tag LOCUS_10240 7389 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 8654 7812 gene locus_tag LOCUS_10250 8654 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 9491 8709 gene locus_tag LOCUS_10260 9491 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 10435 10626 gene locus_tag LOCUS_10270 10435 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 10690 11187 gene locus_tag LOCUS_10280 10690 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 11455 14673 gene locus_tag LOCUS_10290 gene cas9 11455 14673 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_10290 14769 15680 gene locus_tag LOCUS_10300 gene cas1 14769 15680 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_10300 15697 16026 gene locus_tag LOCUS_10310 gene cas2 15697 16026 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_10310 16084 19420 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agcctaccataggaagatcggtagggaaaccacggc 19559 20152 gene locus_tag LOCUS_10320 19559 20152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 21366 20143 gene locus_tag LOCUS_10330 21366 20143 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019197495.1 protein_id gnl|my_center|LOCUS_10330 21678 21367 gene locus_tag LOCUS_10340 21678 21367 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533370.1 protein_id gnl|my_center|LOCUS_10340 22010 22633 gene locus_tag LOCUS_10350 22010 22633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 23799 22630 gene locus_tag LOCUS_10360 23799 22630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 24113 23814 gene locus_tag LOCUS_10370 24113 23814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 24603 24764 gene locus_tag LOCUS_10380 24603 24764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 24761 26485 gene locus_tag LOCUS_10390 24761 26485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 26550 26858 gene locus_tag LOCUS_10400 26550 26858 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857612.1 protein_id gnl|my_center|LOCUS_10400 26858 27400 gene locus_tag LOCUS_10410 26858 27400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857613.1 protein_id gnl|my_center|LOCUS_10410 27595 27437 gene locus_tag LOCUS_10420 27595 27437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 27743 29683 gene locus_tag LOCUS_10430 27743 29683 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_10430 29686 30276 gene locus_tag LOCUS_10440 29686 30276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 30376 34665 gene locus_tag LOCUS_10450 30376 34665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206868.1 protein_id gnl|my_center|LOCUS_10450 34830 35105 gene locus_tag LOCUS_10460 34830 35105 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855694.1 protein_id gnl|my_center|LOCUS_10460 35105 35632 gene locus_tag LOCUS_10470 35105 35632 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_10470 36963 35656 gene locus_tag LOCUS_10480 gene trbI 36963 35656 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970264.1 protein_id gnl|my_center|LOCUS_10480 37390 36953 gene locus_tag LOCUS_10490 37390 36953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 38443 37394 gene locus_tag LOCUS_10500 38443 37394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 39157 38453 gene locus_tag LOCUS_10510 39157 38453 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_10510 40500 39175 gene locus_tag LOCUS_10520 gene trbL 40500 39175 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815842.1 protein_id gnl|my_center|LOCUS_10520 41222 40500 gene locus_tag LOCUS_10530 41222 40500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 43708 41219 gene locus_tag LOCUS_10540 43708 41219 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028755117.1 protein_id gnl|my_center|LOCUS_10540 44030 43749 gene locus_tag LOCUS_10550 44030 43749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 44371 44033 gene locus_tag LOCUS_10560 44371 44033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 45361 44399 gene locus_tag LOCUS_10570 gene trbB 45361 44399 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 protein_id gnl|my_center|LOCUS_10570 45818 46489 gene locus_tag LOCUS_10580 45818 46489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 46476 47480 gene locus_tag LOCUS_10590 46476 47480 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391060.1 protein_id gnl|my_center|LOCUS_10590 47482 48372 gene locus_tag LOCUS_10600 47482 48372 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080579555.1 protein_id gnl|my_center|LOCUS_10600 49382 48393 gene locus_tag LOCUS_10610 gene thiO 49382 48393 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976312.1 protein_id gnl|my_center|LOCUS_10610 51018 51551 gene locus_tag LOCUS_10620 51018 51551 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 protein_id gnl|my_center|LOCUS_10620 51580 52731 gene locus_tag LOCUS_10630 51580 52731 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172347.1 protein_id gnl|my_center|LOCUS_10630 53118 52750 gene locus_tag LOCUS_10640 53118 52750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 53153 53329 gene locus_tag LOCUS_10650 53153 53329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 54166 53516 gene locus_tag LOCUS_10660 gene ytfE 54166 53516 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 protein_id gnl|my_center|LOCUS_10660 54485 54168 gene locus_tag LOCUS_10670 54485 54168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 55050 54487 gene locus_tag LOCUS_10680 55050 54487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 55484 55047 gene locus_tag LOCUS_10690 55484 55047 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_10690 55758 55486 gene locus_tag LOCUS_10700 55758 55486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 56970 55768 gene locus_tag LOCUS_10710 56970 55768 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037163.1 protein_id gnl|my_center|LOCUS_10710 57950 56967 gene locus_tag LOCUS_10720 gene moaCB 57950 56967 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_10720 58812 57952 gene locus_tag LOCUS_10730 gene moaA 58812 57952 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192029632.1 protein_id gnl|my_center|LOCUS_10730 60578 59094 gene locus_tag LOCUS_10740 60578 59094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 61062 62369 gene locus_tag LOCUS_10750 61062 62369 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_10750 62394 64001 gene locus_tag LOCUS_10760 62394 64001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 64032 67811 gene locus_tag LOCUS_10770 64032 67811 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205550.1 protein_id gnl|my_center|LOCUS_10770 67822 69351 gene locus_tag LOCUS_10780 gene narH 67822 69351 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_10780 69341 70072 gene locus_tag LOCUS_10790 gene narJ 69341 70072 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 protein_id gnl|my_center|LOCUS_10790 70069 70758 gene locus_tag LOCUS_10800 gene narI 70069 70758 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160115.1 protein_id gnl|my_center|LOCUS_10800 70761 71231 gene locus_tag LOCUS_10810 70761 71231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 71925 71308 gene locus_tag LOCUS_10820 71925 71308 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_10820 73248 72016 gene locus_tag LOCUS_10830 73248 72016 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_10830 73905 74585 gene locus_tag LOCUS_10840 73905 74585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 74683 76614 gene locus_tag LOCUS_10850 74683 76614 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_10850 76731 77321 gene locus_tag LOCUS_10860 76731 77321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 77669 77334 gene locus_tag LOCUS_10870 77669 77334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 78709 83955 gene locus_tag LOCUS_10880 78709 83955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10880 84028 88365 gene locus_tag LOCUS_10890 84028 88365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 89010 88579 gene locus_tag LOCUS_10900 89010 88579 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_10900 89284 89012 gene locus_tag LOCUS_10910 89284 89012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 90496 89288 gene locus_tag LOCUS_10920 gene moeA 90496 89288 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693918.1 protein_id gnl|my_center|LOCUS_10920 91476 90493 gene locus_tag LOCUS_10930 gene moaCB 91476 90493 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932998.1 protein_id gnl|my_center|LOCUS_10930 91639 92439 gene locus_tag LOCUS_10940 gene modA 91639 92439 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090881.1 protein_id gnl|my_center|LOCUS_10940 92436 93122 gene locus_tag LOCUS_10950 gene modB 92436 93122 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628423.1 protein_id gnl|my_center|LOCUS_10950 93115 93750 gene locus_tag LOCUS_10960 93115 93750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 95763 93757 gene locus_tag LOCUS_10970 95763 93757 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555312.1 protein_id gnl|my_center|LOCUS_10970 96817 95837 gene locus_tag LOCUS_10980 96817 95837 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 protein_id gnl|my_center|LOCUS_10980 98083 96866 gene locus_tag LOCUS_10990 98083 96866 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 protein_id gnl|my_center|LOCUS_10990 100519 98246 gene locus_tag LOCUS_11000 100519 98246 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 protein_id gnl|my_center|LOCUS_11000 103516 100550 gene locus_tag LOCUS_11010 103516 100550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 103779 105290 gene locus_tag LOCUS_11020 103779 105290 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928742.1 protein_id gnl|my_center|LOCUS_11020 105301 106305 gene locus_tag LOCUS_11030 105301 106305 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970412.1 protein_id gnl|my_center|LOCUS_11030 106305 107726 gene locus_tag LOCUS_11040 106305 107726 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932603.1 protein_id gnl|my_center|LOCUS_11040 107751 108620 gene locus_tag LOCUS_11050 107751 108620 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096546.1 protein_id gnl|my_center|LOCUS_11050 108623 109645 gene locus_tag LOCUS_11060 108623 109645 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 protein_id gnl|my_center|LOCUS_11060 110360 109647 gene locus_tag LOCUS_11070 110360 109647 CDS product DUF3142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707337.1 protein_id gnl|my_center|LOCUS_11070 112498 110363 gene locus_tag LOCUS_11080 112498 110363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114102.1 protein_id gnl|my_center|LOCUS_11080 113112 113591 gene locus_tag LOCUS_11090 113112 113591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 113563 114912 gene locus_tag LOCUS_11100 113563 114912 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918178.1 protein_id gnl|my_center|LOCUS_11100 115108 116427 gene locus_tag LOCUS_11110 gene pstC 115108 116427 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_11110 116420 118159 gene locus_tag LOCUS_11120 116420 118159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 118161 119021 gene locus_tag LOCUS_11130 gene pstB 118161 119021 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918181.1 protein_id gnl|my_center|LOCUS_11130 119023 119736 gene locus_tag LOCUS_11140 gene phoU 119023 119736 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918182.1 protein_id gnl|my_center|LOCUS_11140 119756 120445 gene locus_tag LOCUS_11150 gene phoB 119756 120445 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_11150 121146 120442 gene locus_tag LOCUS_11160 121146 120442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 121838 121152 gene locus_tag LOCUS_11170 121838 121152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 122558 121839 gene locus_tag LOCUS_11180 122558 121839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 122975 122658 gene locus_tag LOCUS_11190 122975 122658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 125742 123145 gene locus_tag LOCUS_11200 gene clpB 125742 123145 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918763.1 protein_id gnl|my_center|LOCUS_11200 125935 126210 gene locus_tag LOCUS_11210 125935 126210 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530040.1 protein_id gnl|my_center|LOCUS_11210 126200 126499 gene locus_tag LOCUS_11220 126200 126499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 127878 126496 gene locus_tag LOCUS_11230 127878 126496 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 protein_id gnl|my_center|LOCUS_11230 128173 128868 gene locus_tag LOCUS_11240 128173 128868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 128869 129222 gene locus_tag LOCUS_11250 128869 129222 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921255.1 protein_id gnl|my_center|LOCUS_11250 130300 129236 gene locus_tag LOCUS_11260 130300 129236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 131626 130436 gene locus_tag LOCUS_11270 gene nhaA 131626 130436 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281946.1 protein_id gnl|my_center|LOCUS_11270 132658 131723 gene locus_tag LOCUS_11280 132658 131723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 133749 132787 gene locus_tag LOCUS_11290 133749 132787 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_11290 135674 133842 gene locus_tag LOCUS_11300 gene cobT 135674 133842 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_11300 136750 135764 gene locus_tag LOCUS_11310 gene cobS 136750 135764 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920857.1 protein_id gnl|my_center|LOCUS_11310 137460 137035 gene locus_tag LOCUS_11320 137460 137035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 137765 138892 gene locus_tag LOCUS_11330 137765 138892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 139294 138905 gene locus_tag LOCUS_11340 139294 138905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 139987 139361 gene locus_tag LOCUS_11350 139987 139361 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_11350 140040 140360 gene locus_tag LOCUS_11360 140040 140360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 140994 140353 gene locus_tag LOCUS_11370 140994 140353 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 protein_id gnl|my_center|LOCUS_11370 141946 141110 gene locus_tag LOCUS_11380 141946 141110 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_11380 143079 141946 gene locus_tag LOCUS_11390 143079 141946 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084984.1 protein_id gnl|my_center|LOCUS_11390 143445 143080 gene locus_tag LOCUS_11400 143445 143080 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028143851.1 protein_id gnl|my_center|LOCUS_11400 143960 143466 gene locus_tag LOCUS_11410 143960 143466 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083224.1 protein_id gnl|my_center|LOCUS_11410 146665 143957 gene locus_tag LOCUS_11420 146665 143957 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084982.1 protein_id gnl|my_center|LOCUS_11420 147542 146901 gene locus_tag LOCUS_11430 147542 146901 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 protein_id gnl|my_center|LOCUS_11430 148067 147639 gene locus_tag LOCUS_11440 148067 147639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 148325 148113 gene locus_tag LOCUS_11450 148325 148113 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_11450 149716 148415 gene locus_tag LOCUS_11460 149716 148415 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_11460 151073 149676 gene locus_tag LOCUS_11470 gene thrC 151073 149676 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921228.1 protein_id gnl|my_center|LOCUS_11470 151771 151070 gene locus_tag LOCUS_11480 151771 151070 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012188.1 protein_id gnl|my_center|LOCUS_11480 152079 151768 gene locus_tag LOCUS_11490 152079 151768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 153435 152395 gene locus_tag LOCUS_11500 153435 152395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 154037 153474 gene locus_tag LOCUS_11510 154037 153474 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392602.1 protein_id gnl|my_center|LOCUS_11510 155154 154174 gene locus_tag LOCUS_11520 gene cyoE 155154 154174 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923267.1 protein_id gnl|my_center|LOCUS_11520 156828 155179 gene locus_tag LOCUS_11530 gene ctaD 156828 155179 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921235.1 protein_id gnl|my_center|LOCUS_11530 157651 156839 gene locus_tag LOCUS_11540 gene coxB 157651 156839 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921236.1 protein_id gnl|my_center|LOCUS_11540 157881 159311 gene locus_tag LOCUS_11550 gene tldD 157881 159311 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265953.1 protein_id gnl|my_center|LOCUS_11550 160198 159308 gene locus_tag LOCUS_11560 160198 159308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 160439 160200 gene locus_tag LOCUS_11570 160439 160200 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918376.1 protein_id gnl|my_center|LOCUS_11570 160734 160417 gene locus_tag LOCUS_11580 160734 160417 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918377.1 protein_id gnl|my_center|LOCUS_11580 160831 161481 gene locus_tag LOCUS_11590 160831 161481 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173723.1 protein_id gnl|my_center|LOCUS_11590 161559 161984 gene locus_tag LOCUS_11600 161559 161984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 162053 162874 gene locus_tag LOCUS_11610 162053 162874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 164152 162875 gene locus_tag LOCUS_11620 164152 162875 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640633.1 protein_id gnl|my_center|LOCUS_11620 165269 164154 gene locus_tag LOCUS_11630 gene aroB 165269 164154 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920845.1 protein_id gnl|my_center|LOCUS_11630 165867 165262 gene locus_tag LOCUS_11640 165867 165262 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920844.1 protein_id gnl|my_center|LOCUS_11640 166152 166027 gene locus_tag LOCUS_11650 166152 166027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 166139 167758 gene locus_tag LOCUS_11660 166139 167758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 167751 168695 gene locus_tag LOCUS_11670 167751 168695 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391485.1 protein_id gnl|my_center|LOCUS_11670 168743 169792 gene locus_tag LOCUS_11680 168743 169792 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265893.1 protein_id gnl|my_center|LOCUS_11680 169795 170400 gene locus_tag LOCUS_11690 169795 170400 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_11690 171169 170393 gene locus_tag LOCUS_11700 171169 170393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 171657 171169 gene locus_tag LOCUS_11710 171657 171169 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921269.1 protein_id gnl|my_center|LOCUS_11710 173007 171730 gene locus_tag LOCUS_11720 173007 171730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 174576 173083 gene locus_tag LOCUS_11730 174576 173083 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921264.1 protein_id gnl|my_center|LOCUS_11730 175802 174597 gene locus_tag LOCUS_11740 175802 174597 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067223.1 protein_id gnl|my_center|LOCUS_11740 176280 175804 gene locus_tag LOCUS_11750 gene rlmH 176280 175804 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338553.1 protein_id gnl|my_center|LOCUS_11750 176561 176283 gene locus_tag LOCUS_11760 176561 176283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 176808 177890 gene locus_tag LOCUS_11770 gene hrcA 176808 177890 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639892.1 protein_id gnl|my_center|LOCUS_11770 177951 178511 gene locus_tag LOCUS_11780 177951 178511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 179477 178692 gene locus_tag LOCUS_11790 179477 178692 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966663.1 protein_id gnl|my_center|LOCUS_11790 180646 179501 gene locus_tag LOCUS_11800 180646 179501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704179.1 protein_id gnl|my_center|LOCUS_11800 181413 180691 gene locus_tag LOCUS_11810 181413 180691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 182519 181668 gene locus_tag LOCUS_11820 gene prmC 182519 181668 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640077.1 protein_id gnl|my_center|LOCUS_11820 182792 182559 gene locus_tag LOCUS_11830 182792 182559 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921114.1 protein_id gnl|my_center|LOCUS_11830 183298 182792 gene locus_tag LOCUS_11840 183298 182792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 183834 183334 gene locus_tag LOCUS_11850 183834 183334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 184739 183912 gene locus_tag LOCUS_11860 184739 183912 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265531.1 protein_id gnl|my_center|LOCUS_11860 186696 184825 gene locus_tag LOCUS_11870 186696 184825 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919568.1 protein_id gnl|my_center|LOCUS_11870 186818 187906 gene locus_tag LOCUS_11880 186818 187906 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 protein_id gnl|my_center|LOCUS_11880 189493 188078 gene locus_tag LOCUS_11890 189493 188078 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958052.1 protein_id gnl|my_center|LOCUS_11890 190085 189525 gene locus_tag LOCUS_11900 190085 189525 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383411.1 protein_id gnl|my_center|LOCUS_11900 190166 190648 gene locus_tag LOCUS_11910 190166 190648 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_11910 190658 191050 gene locus_tag LOCUS_11920 190658 191050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 191097 191849 gene locus_tag LOCUS_11930 191097 191849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173716.1 protein_id gnl|my_center|LOCUS_11930 191849 193429 gene locus_tag LOCUS_11940 191849 193429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 193465 195339 gene locus_tag LOCUS_11950 gene dnaG 193465 195339 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338201.1 protein_id gnl|my_center|LOCUS_11950 195534 197516 gene locus_tag LOCUS_11960 gene rpoD 195534 197516 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920883.1 protein_id gnl|my_center|LOCUS_11960 197585 199348 gene locus_tag LOCUS_11970 197585 199348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 201069 199345 gene locus_tag LOCUS_11980 201069 199345 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921248.1 protein_id gnl|my_center|LOCUS_11980 201823 201128 gene locus_tag LOCUS_11990 201823 201128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 202754 201825 gene locus_tag LOCUS_12000 gene hemC 202754 201825 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917961.1 protein_id gnl|my_center|LOCUS_12000 202895 203389 gene locus_tag LOCUS_12010 202895 203389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 204009 203392 gene locus_tag LOCUS_12020 204009 203392 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_12020 204129 206396 gene locus_tag LOCUS_12030 204129 206396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 206403 207071 gene locus_tag LOCUS_12040 206403 207071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 207113 207811 gene locus_tag LOCUS_12050 207113 207811 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945965.1 protein_id gnl|my_center|LOCUS_12050 208905 207808 gene locus_tag LOCUS_12060 208905 207808 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267245.1 protein_id gnl|my_center|LOCUS_12060 209494 208898 gene locus_tag LOCUS_12070 209494 208898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 209882 209487 gene locus_tag LOCUS_12080 209882 209487 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119375951.1 protein_id gnl|my_center|LOCUS_12080 209991 210374 gene locus_tag LOCUS_12090 209991 210374 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_12090 211699 210371 gene locus_tag LOCUS_12100 211699 210371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 212436 211774 gene locus_tag LOCUS_12110 212436 211774 CDS product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090200.1 protein_id gnl|my_center|LOCUS_12110 212576 213043 gene locus_tag LOCUS_12120 212576 213043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 213043 213903 gene locus_tag LOCUS_12130 213043 213903 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693720.1 protein_id gnl|my_center|LOCUS_12130 214133 214789 gene locus_tag LOCUS_12140 214133 214789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 215701 214979 gene locus_tag LOCUS_12150 215701 214979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 216651 215710 gene locus_tag LOCUS_12160 gene ispH 216651 215710 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921190.1 protein_id gnl|my_center|LOCUS_12160 216745 217494 gene locus_tag LOCUS_12170 216745 217494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 217513 219306 gene locus_tag LOCUS_12180 gene argS 217513 219306 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921188.1 protein_id gnl|my_center|LOCUS_12180 219521 219315 gene locus_tag LOCUS_12190 219521 219315 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_12190 219943 219518 gene locus_tag LOCUS_12200 219943 219518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 220188 221477 gene locus_tag LOCUS_12210 gene serS 220188 221477 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971811.1 protein_id gnl|my_center|LOCUS_12210 222912 221518 gene locus_tag LOCUS_12220 222912 221518 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706871.1 protein_id gnl|my_center|LOCUS_12220 224277 222970 gene locus_tag LOCUS_12230 224277 222970 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037403150.1 protein_id gnl|my_center|LOCUS_12230 224841 224350 gene locus_tag LOCUS_12240 224841 224350 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229400.1 protein_id gnl|my_center|LOCUS_12240 224912 225376 gene locus_tag LOCUS_12250 224912 225376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 226791 225373 gene locus_tag LOCUS_12260 gene ubiB 226791 225373 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921536.1 protein_id gnl|my_center|LOCUS_12260 227571 226795 gene locus_tag LOCUS_12270 227571 226795 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921535.1 protein_id gnl|my_center|LOCUS_12270 228928 227621 gene locus_tag LOCUS_12280 gene dinB 228928 227621 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_12280 229155 229817 gene locus_tag LOCUS_12290 229155 229817 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919285.1 protein_id gnl|my_center|LOCUS_12290 230958 229903 gene locus_tag LOCUS_12300 230958 229903 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016994.1 protein_id gnl|my_center|LOCUS_12300 231107 231982 gene locus_tag LOCUS_12310 gene mutM 231107 231982 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923346.1 protein_id gnl|my_center|LOCUS_12310 231984 232472 gene locus_tag LOCUS_12320 231984 232472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 232728 232486 gene locus_tag LOCUS_12330 232728 232486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 232846 233367 gene locus_tag LOCUS_12340 gene def 232846 233367 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918161.1 protein_id gnl|my_center|LOCUS_12340 233449 233715 gene locus_tag LOCUS_12350 233449 233715 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764692.1 protein_id gnl|my_center|LOCUS_12350 233722 234492 gene locus_tag LOCUS_12360 gene rcnA 233722 234492 CDS product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134620.1 protein_id gnl|my_center|LOCUS_12360 235770 234529 gene locus_tag LOCUS_12370 235770 234529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 236405 236028 gene locus_tag LOCUS_12380 236405 236028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 236642 236445 gene locus_tag LOCUS_12390 236642 236445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 237577 236642 gene locus_tag LOCUS_12400 237577 236642 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383387.1 protein_id gnl|my_center|LOCUS_12400 237687 238079 gene locus_tag LOCUS_12410 237687 238079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 238086 238640 gene locus_tag LOCUS_12420 238086 238640 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919519.1 protein_id gnl|my_center|LOCUS_12420 238642 239001 gene locus_tag LOCUS_12430 238642 239001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 239598 239002 gene locus_tag LOCUS_12440 239598 239002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 240157 239606 gene locus_tag LOCUS_12450 240157 239606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 240842 240177 gene locus_tag LOCUS_12460 240842 240177 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921221.1 protein_id gnl|my_center|LOCUS_12460 241624 240974 gene locus_tag LOCUS_12470 241624 240974 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 protein_id gnl|my_center|LOCUS_12470 241841 243610 gene locus_tag LOCUS_12480 241841 243610 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974690.1 protein_id gnl|my_center|LOCUS_12480 243703 244941 gene locus_tag LOCUS_12490 243703 244941 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 protein_id gnl|my_center|LOCUS_12490 245284 245763 gene locus_tag LOCUS_12500 245284 245763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 245879 246274 gene locus_tag LOCUS_12510 245879 246274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 246729 246295 gene locus_tag LOCUS_12520 246729 246295 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 protein_id gnl|my_center|LOCUS_12520 246910 248187 gene locus_tag LOCUS_12530 246910 248187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 248900 248184 gene locus_tag LOCUS_12540 248900 248184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 249069 249419 gene locus_tag LOCUS_12550 249069 249419 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_12550 249484 249870 gene locus_tag LOCUS_12560 249484 249870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 250064 251668 gene locus_tag LOCUS_12570 250064 251668 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918954.1 protein_id gnl|my_center|LOCUS_12570 252997 251921 gene locus_tag LOCUS_12580 252997 251921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 254248 253154 gene locus_tag LOCUS_12590 254248 253154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 256134 254293 gene locus_tag LOCUS_12600 256134 254293 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920483.1 protein_id gnl|my_center|LOCUS_12600 258149 256134 gene locus_tag LOCUS_12610 gene pbpC 258149 256134 CDS product multimodular transpeptidase-transglycosylase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921109.1 protein_id gnl|my_center|LOCUS_12610 258342 258617 gene locus_tag LOCUS_12620 258342 258617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 258628 259695 gene locus_tag LOCUS_12630 258628 259695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 259763 260893 gene locus_tag LOCUS_12640 259763 260893 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920629.1 protein_id gnl|my_center|LOCUS_12640 260893 261144 gene locus_tag LOCUS_12650 260893 261144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 261141 261572 gene locus_tag LOCUS_12660 261141 261572 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920627.1 protein_id gnl|my_center|LOCUS_12660 261587 262813 gene locus_tag LOCUS_12670 261587 262813 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 protein_id gnl|my_center|LOCUS_12670 262823 263359 gene locus_tag LOCUS_12680 262823 263359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 263356 263751 gene locus_tag LOCUS_12690 263356 263751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 263911 264327 gene locus_tag LOCUS_12700 263911 264327 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 protein_id gnl|my_center|LOCUS_12700 264324 264626 gene locus_tag LOCUS_12710 264324 264626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 264626 264790 gene locus_tag LOCUS_12720 264626 264790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 264791 265306 gene locus_tag LOCUS_12730 264791 265306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920620.1 protein_id gnl|my_center|LOCUS_12730 265303 265935 gene locus_tag LOCUS_12740 265303 265935 CDS product TIGR02217 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971292.1 protein_id gnl|my_center|LOCUS_12740 265932 266777 gene locus_tag LOCUS_12750 265932 266777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 266764 267123 gene locus_tag LOCUS_12760 266764 267123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 267123 270788 gene locus_tag LOCUS_12770 267123 270788 CDS product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337519.1 protein_id gnl|my_center|LOCUS_12770 271143 270778 gene locus_tag LOCUS_12780 271143 270778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 272430 271279 gene locus_tag LOCUS_12790 272430 271279 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969160.1 protein_id gnl|my_center|LOCUS_12790 272506 273018 gene locus_tag LOCUS_12800 272506 273018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 273021 274385 gene locus_tag LOCUS_12810 273021 274385 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920320.1 protein_id gnl|my_center|LOCUS_12810 275064 274531 gene locus_tag LOCUS_12820 275064 274531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 275213 275569 gene locus_tag LOCUS_12830 275213 275569 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_12830 276360 275614 gene locus_tag LOCUS_12840 276360 275614 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 protein_id gnl|my_center|LOCUS_12840 276933 277460 gene locus_tag LOCUS_12850 276933 277460 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_12850 277593 279188 gene locus_tag LOCUS_12860 277593 279188 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_12860 279758 279216 gene locus_tag LOCUS_12870 279758 279216 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265825.1 protein_id gnl|my_center|LOCUS_12870 280132 281058 gene locus_tag LOCUS_12880 280132 281058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 282512 281124 gene locus_tag LOCUS_12890 282512 281124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 284908 282770 gene locus_tag LOCUS_12900 gene scpA 284908 282770 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920232.1 protein_id gnl|my_center|LOCUS_12900 286120 284909 gene locus_tag LOCUS_12910 286120 284909 CDS product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920231.1 protein_id gnl|my_center|LOCUS_12910 288390 286201 gene locus_tag LOCUS_12920 288390 286201 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083208.1 protein_id gnl|my_center|LOCUS_12920 289584 288442 gene locus_tag LOCUS_12930 gene pelA 289584 288442 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_12930 290589 289636 gene locus_tag LOCUS_12940 290589 289636 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163229416.1 protein_id gnl|my_center|LOCUS_12940 291576 290638 gene locus_tag LOCUS_12950 gene hfsG 291576 290638 CDS product polysaccharide biosynthesis protein HfsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920285.1 protein_id gnl|my_center|LOCUS_12950 292592 292005 gene locus_tag LOCUS_12960 292592 292005 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085211.1 protein_id gnl|my_center|LOCUS_12960 292688 293707 gene locus_tag LOCUS_12970 292688 293707 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639871.1 protein_id gnl|my_center|LOCUS_12970 293858 295372 gene locus_tag LOCUS_12980 gene ccoG 293858 295372 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_12980 295381 295869 gene locus_tag LOCUS_12990 295381 295869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 295872 298085 gene locus_tag LOCUS_13000 295872 298085 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919283.1 protein_id gnl|my_center|LOCUS_13000 298095 298250 gene locus_tag LOCUS_13010 298095 298250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 299012 298251 gene locus_tag LOCUS_13020 299012 298251 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172853.1 protein_id gnl|my_center|LOCUS_13020 299938 299156 gene locus_tag LOCUS_13030 299938 299156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 300131 301285 gene locus_tag LOCUS_13040 300131 301285 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444889.1 protein_id gnl|my_center|LOCUS_13040 301285 301824 gene locus_tag LOCUS_13050 301285 301824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 301897 302904 gene locus_tag LOCUS_13060 301897 302904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 302901 303260 gene locus_tag LOCUS_13070 302901 303260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 303378 304862 gene locus_tag LOCUS_13080 303378 304862 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 protein_id gnl|my_center|LOCUS_13080 305594 304890 gene locus_tag LOCUS_13090 305594 304890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 305754 306413 gene locus_tag LOCUS_13100 305754 306413 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398720.1 protein_id gnl|my_center|LOCUS_13100 306819 306391 gene locus_tag LOCUS_13110 306819 306391 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966405.1 protein_id gnl|my_center|LOCUS_13110 307286 306816 gene locus_tag LOCUS_13120 307286 306816 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092949.1 protein_id gnl|my_center|LOCUS_13120 307702 307322 gene locus_tag LOCUS_13130 307702 307322 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205987.1 protein_id gnl|my_center|LOCUS_13130 307800 308417 gene locus_tag LOCUS_13140 307800 308417 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073335.1 protein_id gnl|my_center|LOCUS_13140 308748 308419 gene locus_tag LOCUS_13150 308748 308419 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 protein_id gnl|my_center|LOCUS_13150 308862 309677 gene locus_tag LOCUS_13160 308862 309677 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_13160 309714 310244 gene locus_tag LOCUS_13170 309714 310244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 311433 310252 gene locus_tag LOCUS_13180 311433 310252 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921438.1 protein_id gnl|my_center|LOCUS_13180 311628 313112 gene locus_tag LOCUS_13190 311628 313112 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463733.1 protein_id gnl|my_center|LOCUS_13190 313249 313659 gene locus_tag LOCUS_13200 313249 313659 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_13200 313744 314535 gene locus_tag LOCUS_13210 gene hisN 313744 314535 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 protein_id gnl|my_center|LOCUS_13210 314688 316865 gene locus_tag LOCUS_13220 314688 316865 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918141.1 protein_id gnl|my_center|LOCUS_13220 317046 318995 gene locus_tag LOCUS_13230 317046 318995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 320272 319016 gene locus_tag LOCUS_13240 320272 319016 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265522.1 protein_id gnl|my_center|LOCUS_13240 321051 320374 gene locus_tag LOCUS_13250 321051 320374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 321096 322454 gene locus_tag LOCUS_13260 321096 322454 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 protein_id gnl|my_center|LOCUS_13260 322467 323336 gene locus_tag LOCUS_13270 322467 323336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 323346 324221 gene locus_tag LOCUS_13280 323346 324221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 324306 324866 gene locus_tag LOCUS_13290 gene spdR 324306 324866 CDS product stationary phase response regulator transcription factor SpdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918136.1 protein_id gnl|my_center|LOCUS_13290 324949 325833 gene locus_tag LOCUS_13300 324949 325833 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_13300 326769 325867 gene locus_tag LOCUS_13310 326769 325867 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369250.1 protein_id gnl|my_center|LOCUS_13310 326856 327611 gene locus_tag LOCUS_13320 326856 327611 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_13320 330121 327722 gene locus_tag LOCUS_13330 gene gyrB 330121 327722 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265504.1 protein_id gnl|my_center|LOCUS_13330 331332 330121 gene locus_tag LOCUS_13340 gene recF 331332 330121 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651375.1 protein_id gnl|my_center|LOCUS_13340 332487 331372 gene locus_tag LOCUS_13350 gene dnaN 332487 331372 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918045.1 protein_id gnl|my_center|LOCUS_13350 332846 333109 gene locus_tag LOCUS_13360 gene rpsT 332846 333109 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533694.1 protein_id gnl|my_center|LOCUS_13360 333881 335410 gene locus_tag LOCUS_13370 gene dnaA 333881 335410 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_13370 336426 335407 gene locus_tag LOCUS_13380 336426 335407 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_13380 337037 336426 gene locus_tag LOCUS_13390 337037 336426 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_13390 337550 337047 gene locus_tag LOCUS_13400 337550 337047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 338560 337619 gene locus_tag LOCUS_13410 338560 337619 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 protein_id gnl|my_center|LOCUS_13410 339236 338601 gene locus_tag LOCUS_13420 339236 338601 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919863.1 protein_id gnl|my_center|LOCUS_13420 340015 339236 gene locus_tag LOCUS_13430 gene surE 340015 339236 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919864.1 protein_id gnl|my_center|LOCUS_13430 340497 340084 gene locus_tag LOCUS_13440 340497 340084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 340635 341213 gene locus_tag LOCUS_13450 340635 341213 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_13450 341800 341297 gene locus_tag LOCUS_13460 341800 341297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 342103 342963 gene locus_tag LOCUS_13470 342103 342963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 342995 343933 gene locus_tag LOCUS_13480 342995 343933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 343954 344721 gene locus_tag LOCUS_13490 343954 344721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 344791 345753 gene locus_tag LOCUS_13500 344791 345753 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532804.1 protein_id gnl|my_center|LOCUS_13500 345765 346490 gene locus_tag LOCUS_13510 345765 346490 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965071.1 protein_id gnl|my_center|LOCUS_13510 346666 347007 gene locus_tag LOCUS_13520 346666 347007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 347007 347672 gene locus_tag LOCUS_13530 347007 347672 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532639.1 protein_id gnl|my_center|LOCUS_13530 347686 349059 gene locus_tag LOCUS_13540 347686 349059 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_13540 349156 350520 gene locus_tag LOCUS_13550 349156 350520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 350640 351800 gene locus_tag LOCUS_13560 350640 351800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 351800 352258 gene locus_tag LOCUS_13570 gene ccmE 351800 352258 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085910.1 protein_id gnl|my_center|LOCUS_13570 352258 354225 gene locus_tag LOCUS_13580 352258 354225 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920601.1 protein_id gnl|my_center|LOCUS_13580 354228 354662 gene locus_tag LOCUS_13590 354228 354662 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920600.1 protein_id gnl|my_center|LOCUS_13590 354962 354666 gene locus_tag LOCUS_13600 354962 354666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 355195 356703 gene locus_tag LOCUS_13610 355195 356703 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175379.1 protein_id gnl|my_center|LOCUS_13610 356713 357384 gene locus_tag LOCUS_13620 356713 357384 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812818.1 protein_id gnl|my_center|LOCUS_13620 357389 358873 gene locus_tag LOCUS_13630 gene uczS 357389 358873 CDS product two-component system sensor histidine kinase UczS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920596.1 protein_id gnl|my_center|LOCUS_13630 358884 361682 gene locus_tag LOCUS_13640 358884 361682 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265846.1 protein_id gnl|my_center|LOCUS_13640 361825 362532 gene locus_tag LOCUS_13650 361825 362532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 362536 363132 gene locus_tag LOCUS_13660 362536 363132 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486300.1 protein_id gnl|my_center|LOCUS_13660 363140 363532 gene locus_tag LOCUS_13670 363140 363532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 363807 363640 gene locus_tag LOCUS_13680 gene rpmG 363807 363640 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920317.1 protein_id gnl|my_center|LOCUS_13680 365045 363876 gene locus_tag LOCUS_13690 365045 363876 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034854038.1 protein_id gnl|my_center|LOCUS_13690 365130 366263 gene locus_tag LOCUS_13700 365130 366263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 367215 366268 gene locus_tag LOCUS_13710 367215 366268 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 protein_id gnl|my_center|LOCUS_13710 367572 367279 gene locus_tag LOCUS_13720 367572 367279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 368275 367685 gene locus_tag LOCUS_13730 368275 367685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 368357 369040 gene locus_tag LOCUS_13740 368357 369040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 369059 369424 gene locus_tag LOCUS_13750 369059 369424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 369712 369960 gene locus_tag LOCUS_13760 369712 369960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 370000 371001 gene locus_tag LOCUS_13770 370000 371001 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537496.1 protein_id gnl|my_center|LOCUS_13770 371756 370998 gene locus_tag LOCUS_13780 371756 370998 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640491.1 protein_id gnl|my_center|LOCUS_13780 371914 373389 gene locus_tag LOCUS_13790 371914 373389 CDS product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109099387.1 protein_id gnl|my_center|LOCUS_13790 373454 374113 gene locus_tag LOCUS_13800 373454 374113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920288.1 protein_id gnl|my_center|LOCUS_13800 374198 375331 gene locus_tag LOCUS_13810 374198 375331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 376284 375328 gene locus_tag LOCUS_13820 gene hfsG 376284 375328 CDS product polysaccharide biosynthesis protein HfsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920285.1 protein_id gnl|my_center|LOCUS_13820 377723 376284 gene locus_tag LOCUS_13830 gene hfsF 377723 376284 CDS product polysaccharide biosynthesis protein HsfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920284.1 protein_id gnl|my_center|LOCUS_13830 379213 377723 gene locus_tag LOCUS_13840 gene hfsE 379213 377723 CDS product polysaccharide biosynthesis protein HfsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265803.1 protein_id gnl|my_center|LOCUS_13840 379379 379469 gene locus_tag LOCUS_t00090 379379 379469 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 379820 379470 gene locus_tag LOCUS_13850 379820 379470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 380096 381661 gene locus_tag LOCUS_13860 380096 381661 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_13860 381757 383664 gene locus_tag LOCUS_13870 381757 383664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 383793 385640 gene locus_tag LOCUS_13880 383793 385640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 385750 386526 gene locus_tag LOCUS_13890 385750 386526 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262409.1 protein_id gnl|my_center|LOCUS_13890 386586 386738 gene locus_tag LOCUS_13900 386586 386738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 386828 388132 gene locus_tag LOCUS_13910 386828 388132 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640497.1 protein_id gnl|my_center|LOCUS_13910 388238 389425 gene locus_tag LOCUS_13920 388238 389425 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975703.1 protein_id gnl|my_center|LOCUS_13920 389664 391550 gene locus_tag LOCUS_13930 389664 391550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 392017 391577 gene locus_tag LOCUS_13940 392017 391577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 393128 392019 gene locus_tag LOCUS_13950 393128 392019 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_13950 393609 393139 gene locus_tag LOCUS_13960 393609 393139 CDS product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 protein_id gnl|my_center|LOCUS_13960 393697 395610 gene locus_tag LOCUS_13970 393697 395610 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_13970 396125 396523 gene locus_tag LOCUS_13980 396125 396523 CDS product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973558.1 protein_id gnl|my_center|LOCUS_13980 396875 396570 gene locus_tag LOCUS_13990 396875 396570 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933271.1 protein_id gnl|my_center|LOCUS_13990 397062 397355 gene locus_tag LOCUS_14000 397062 397355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 397355 399013 gene locus_tag LOCUS_14010 397355 399013 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244652.1 protein_id gnl|my_center|LOCUS_14010 399000 399398 gene locus_tag LOCUS_14020 399000 399398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 399388 400113 gene locus_tag LOCUS_14030 399388 400113 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974761.1 protein_id gnl|my_center|LOCUS_14030 400118 401020 gene locus_tag LOCUS_14040 gene cysD 400118 401020 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 protein_id gnl|my_center|LOCUS_14040 401080 402720 gene locus_tag LOCUS_14050 401080 402720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 402717 404111 gene locus_tag LOCUS_14060 gene cysG 402717 404111 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256894.1 protein_id gnl|my_center|LOCUS_14060 404112 404600 gene locus_tag LOCUS_14070 404112 404600 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090847.1 protein_id gnl|my_center|LOCUS_14070 404757 405182 gene locus_tag LOCUS_14080 404757 405182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 405734 405264 gene locus_tag LOCUS_14090 405734 405264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 406105 406887 gene locus_tag LOCUS_14100 406105 406887 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_14100 407654 406872 gene locus_tag LOCUS_14110 407654 406872 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946646.1 protein_id gnl|my_center|LOCUS_14110 408886 407654 gene locus_tag LOCUS_14120 gene coaBC 408886 407654 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_14120 409643 408873 gene locus_tag LOCUS_14130 gene panC 409643 408873 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771941.1 protein_id gnl|my_center|LOCUS_14130 410452 409640 gene locus_tag LOCUS_14140 gene panB 410452 409640 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957565.1 protein_id gnl|my_center|LOCUS_14140 410815 410949 gene locus_tag LOCUS_14150 410815 410949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 411710 410934 gene locus_tag LOCUS_14160 gene ydfG 411710 410934 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636564.1 protein_id gnl|my_center|LOCUS_14160 412357 411743 gene locus_tag LOCUS_14170 412357 411743 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926466.1 protein_id gnl|my_center|LOCUS_14170 412420 412761 gene locus_tag LOCUS_14180 412420 412761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 412761 413462 gene locus_tag LOCUS_14190 412761 413462 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_14190 414621 413497 gene locus_tag LOCUS_14200 414621 413497 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967274.1 protein_id gnl|my_center|LOCUS_14200 416002 414632 gene locus_tag LOCUS_14210 416002 414632 CDS product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 protein_id gnl|my_center|LOCUS_14210 416384 416070 gene locus_tag LOCUS_14220 416384 416070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 416350 416535 gene locus_tag LOCUS_14230 416350 416535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 416558 418795 gene locus_tag LOCUS_14240 416558 418795 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918700.1 protein_id gnl|my_center|LOCUS_14240 419572 418796 gene locus_tag LOCUS_14250 419572 418796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 421478 419667 gene locus_tag LOCUS_14260 421478 419667 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082989.1 protein_id gnl|my_center|LOCUS_14260 421641 422885 gene locus_tag LOCUS_14270 421641 422885 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918152.1 protein_id gnl|my_center|LOCUS_14270 422906 424534 gene locus_tag LOCUS_14280 422906 424534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 424524 424988 gene locus_tag LOCUS_14290 424524 424988 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 protein_id gnl|my_center|LOCUS_14290 424998 425495 gene locus_tag LOCUS_14300 424998 425495 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337239.1 protein_id gnl|my_center|LOCUS_14300 427350 425899 gene locus_tag LOCUS_14310 427350 425899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 428908 427481 gene locus_tag LOCUS_14320 gene rmuC 428908 427481 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_14320 430031 428970 gene locus_tag LOCUS_14330 430031 428970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 431041 430031 gene locus_tag LOCUS_14340 431041 430031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 431685 431197 gene locus_tag LOCUS_14350 431685 431197 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265921.1 protein_id gnl|my_center|LOCUS_14350 431962 435387 gene locus_tag LOCUS_14360 431962 435387 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640689.1 protein_id gnl|my_center|LOCUS_14360 436597 435380 gene locus_tag LOCUS_14370 436597 435380 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920120.1 protein_id gnl|my_center|LOCUS_14370 436788 436864 gene locus_tag LOCUS_t00100 436788 436864 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 437184 438383 gene locus_tag LOCUS_14380 437184 438383 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920120.1 protein_id gnl|my_center|LOCUS_14380 438503 439723 gene locus_tag LOCUS_14390 438503 439723 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920120.1 protein_id gnl|my_center|LOCUS_14390 440029 442659 gene locus_tag LOCUS_14400 440029 442659 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_14400 442743 443450 gene locus_tag LOCUS_14410 gene queC 442743 443450 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929689.1 protein_id gnl|my_center|LOCUS_14410 443447 444079 gene locus_tag LOCUS_14420 gene queE 443447 444079 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085270.1 protein_id gnl|my_center|LOCUS_14420 444076 444444 gene locus_tag LOCUS_14430 444076 444444 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920994.1 protein_id gnl|my_center|LOCUS_14430 444574 445686 gene locus_tag LOCUS_14440 444574 445686 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918237.1 protein_id gnl|my_center|LOCUS_14440 446551 445703 gene locus_tag LOCUS_14450 446551 445703 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640515.1 protein_id gnl|my_center|LOCUS_14450 446911 449394 gene locus_tag LOCUS_14460 446911 449394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 449580 450794 gene locus_tag LOCUS_14470 449580 450794 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920379.1 protein_id gnl|my_center|LOCUS_14470 450939 451454 gene locus_tag LOCUS_14480 450939 451454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 451464 452099 gene locus_tag LOCUS_14490 451464 452099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 452213 452896 gene locus_tag LOCUS_14500 452213 452896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 453020 454120 gene locus_tag LOCUS_14510 453020 454120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 454198 454812 gene locus_tag LOCUS_14520 454198 454812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 454864 455259 gene locus_tag LOCUS_14530 454864 455259 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968794.1 protein_id gnl|my_center|LOCUS_14530 455270 456364 gene locus_tag LOCUS_14540 455270 456364 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920312.1 protein_id gnl|my_center|LOCUS_14540 458041 456368 gene locus_tag LOCUS_14550 458041 456368 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265906.1 protein_id gnl|my_center|LOCUS_14550 458247 458738 gene locus_tag LOCUS_14560 458247 458738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 461546 458910 gene locus_tag LOCUS_14570 gene alaS 461546 458910 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920386.1 protein_id gnl|my_center|LOCUS_14570 462815 461742 gene locus_tag LOCUS_14580 gene recA 462815 461742 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314063.1 protein_id gnl|my_center|LOCUS_14580 463900 463037 gene locus_tag LOCUS_14590 463900 463037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 464496 464113 gene locus_tag LOCUS_14600 464496 464113 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220683.1 protein_id gnl|my_center|LOCUS_14600 466863 464929 gene locus_tag LOCUS_14610 gene cckA 466863 464929 CDS product cell cycle histidine kinase CckA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918962.1 protein_id gnl|my_center|LOCUS_14610 467954 466866 gene locus_tag LOCUS_14620 gene flhB 467954 466866 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918961.1 protein_id gnl|my_center|LOCUS_14620 468712 467963 gene locus_tag LOCUS_14630 gene fliR 468712 467963 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918960.1 protein_id gnl|my_center|LOCUS_14630 468987 468712 gene locus_tag LOCUS_14640 gene fliQ 468987 468712 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640137.1 protein_id gnl|my_center|LOCUS_14640 469181 471214 gene locus_tag LOCUS_14650 469181 471214 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265858.1 protein_id gnl|my_center|LOCUS_14650 473193 471352 gene locus_tag LOCUS_14660 473193 471352 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 protein_id gnl|my_center|LOCUS_14660 473316 474395 gene locus_tag LOCUS_14670 473316 474395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920937.1 protein_id gnl|my_center|LOCUS_14670 475243 474392 gene locus_tag LOCUS_14680 475243 474392 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919400.1 protein_id gnl|my_center|LOCUS_14680 475320 476042 gene locus_tag LOCUS_14690 475320 476042 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530342.1 protein_id gnl|my_center|LOCUS_14690 476130 477488 gene locus_tag LOCUS_14700 476130 477488 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921243.1 protein_id gnl|my_center|LOCUS_14700 477597 478478 gene locus_tag LOCUS_14710 477597 478478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 478636 480516 gene locus_tag LOCUS_14720 478636 480516 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 protein_id gnl|my_center|LOCUS_14720 480519 480971 gene locus_tag LOCUS_14730 480519 480971 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 protein_id gnl|my_center|LOCUS_14730 483064 480977 gene locus_tag LOCUS_14740 483064 480977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 483196 484524 gene locus_tag LOCUS_14750 483196 484524 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525026.1 protein_id gnl|my_center|LOCUS_14750 484588 486252 gene locus_tag LOCUS_14760 484588 486252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 486256 486669 gene locus_tag LOCUS_14770 486256 486669 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388492.1 protein_id gnl|my_center|LOCUS_14770 486687 487544 gene locus_tag LOCUS_14780 486687 487544 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 protein_id gnl|my_center|LOCUS_14780 487623 487937 gene locus_tag LOCUS_14790 487623 487937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 488797 487940 gene locus_tag LOCUS_14800 gene serB 488797 487940 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640406.1 protein_id gnl|my_center|LOCUS_14800 488867 489760 gene locus_tag LOCUS_14810 gene miaA 488867 489760 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_14810 490956 489757 gene locus_tag LOCUS_14820 490956 489757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 491319 493106 gene locus_tag LOCUS_14830 491319 493106 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976138.1 protein_id gnl|my_center|LOCUS_14830 493228 493851 gene locus_tag LOCUS_14840 493228 493851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 493848 494435 gene locus_tag LOCUS_14850 493848 494435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 494463 495005 gene locus_tag LOCUS_14860 gene ilvN 494463 495005 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507555.1 protein_id gnl|my_center|LOCUS_14860 495007 495666 gene locus_tag LOCUS_14870 495007 495666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 495666 496415 gene locus_tag LOCUS_14880 495666 496415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 496578 497597 gene locus_tag LOCUS_14890 gene ilvC 496578 497597 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919981.1 protein_id gnl|my_center|LOCUS_14890 497785 498453 gene locus_tag LOCUS_14900 497785 498453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 498588 499088 gene locus_tag LOCUS_14910 498588 499088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 499153 501003 gene locus_tag LOCUS_14920 gene ilvD 499153 501003 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920880.1 protein_id gnl|my_center|LOCUS_14920 501064 502530 gene locus_tag LOCUS_14930 501064 502530 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502938.1 protein_id gnl|my_center|LOCUS_14930 502594 503301 gene locus_tag LOCUS_14940 502594 503301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 504430 503333 gene locus_tag LOCUS_14950 504430 503333 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_14950 504528 505262 gene locus_tag LOCUS_14960 504528 505262 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919412.1 protein_id gnl|my_center|LOCUS_14960 505468 507009 gene locus_tag LOCUS_14970 505468 507009 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_14970 507104 507940 gene locus_tag LOCUS_14980 507104 507940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920841.1 protein_id gnl|my_center|LOCUS_14980 508665 507937 gene locus_tag LOCUS_14990 508665 507937 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_14990 508773 509687 gene locus_tag LOCUS_15000 508773 509687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 510465 509671 gene locus_tag LOCUS_15010 510465 509671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 511276 510557 gene locus_tag LOCUS_15020 511276 510557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 511344 512573 gene locus_tag LOCUS_15030 511344 512573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 513958 512570 gene locus_tag LOCUS_15040 513958 512570 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971098.1 protein_id gnl|my_center|LOCUS_15040 514582 513959 gene locus_tag LOCUS_15050 514582 513959 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971840.1 protein_id gnl|my_center|LOCUS_15050 514808 515668 gene locus_tag LOCUS_15060 gene cysE 514808 515668 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640548.1 protein_id gnl|my_center|LOCUS_15060 516121 517152 gene locus_tag LOCUS_15070 516121 517152 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921314.1 protein_id gnl|my_center|LOCUS_15070 519875 517227 gene locus_tag LOCUS_15080 519875 517227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038875.1 protein_id gnl|my_center|LOCUS_15080 520079 519960 gene locus_tag LOCUS_15090 520079 519960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 520117 521481 gene locus_tag LOCUS_15100 gene xseA 520117 521481 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090239.1 protein_id gnl|my_center|LOCUS_15100 521637 522536 gene locus_tag LOCUS_15110 521637 522536 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640449.1 protein_id gnl|my_center|LOCUS_15110 522574 523464 gene locus_tag LOCUS_15120 522574 523464 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640449.1 protein_id gnl|my_center|LOCUS_15120 523569 524165 gene locus_tag LOCUS_15130 523569 524165 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921284.1 protein_id gnl|my_center|LOCUS_15130 524167 524991 gene locus_tag LOCUS_15140 524167 524991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 525007 525690 gene locus_tag LOCUS_15150 525007 525690 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528995.1 protein_id gnl|my_center|LOCUS_15150 526199 525915 gene locus_tag LOCUS_15160 526199 525915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 527157 526318 gene locus_tag LOCUS_15170 gene gluQRS 527157 526318 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640436.1 protein_id gnl|my_center|LOCUS_15170 527230 527835 gene locus_tag LOCUS_15180 527230 527835 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 protein_id gnl|my_center|LOCUS_15180 527955 528473 gene locus_tag LOCUS_15190 527955 528473 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_15190 528568 529557 gene locus_tag LOCUS_15200 528568 529557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 530727 529552 gene locus_tag LOCUS_15210 530727 529552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265542.1 protein_id gnl|my_center|LOCUS_15210 530940 531464 gene locus_tag LOCUS_15220 530940 531464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 533451 531418 gene locus_tag LOCUS_15230 533451 531418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400792.1 protein_id gnl|my_center|LOCUS_15230 535871 533451 gene locus_tag LOCUS_15240 535871 533451 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969884.1 protein_id gnl|my_center|LOCUS_15240 535870 536037 gene locus_tag LOCUS_15250 535870 536037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 536965 536105 gene locus_tag LOCUS_15260 536965 536105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 537989 536967 gene locus_tag LOCUS_15270 537989 536967 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969882.1 protein_id gnl|my_center|LOCUS_15270 538070 538636 gene locus_tag LOCUS_15280 538070 538636 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_15280 538636 539253 gene locus_tag LOCUS_15290 538636 539253 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329137.1 protein_id gnl|my_center|LOCUS_15290 539240 540433 gene locus_tag LOCUS_15300 539240 540433 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976399.1 protein_id gnl|my_center|LOCUS_15300 541000 540422 gene locus_tag LOCUS_15310 541000 540422 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072768.1 protein_id gnl|my_center|LOCUS_15310 541107 541754 gene locus_tag LOCUS_15320 541107 541754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 544106 541755 gene locus_tag LOCUS_15330 gene ligA 544106 541755 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919396.1 protein_id gnl|my_center|LOCUS_15330 545806 544106 gene locus_tag LOCUS_15340 gene recN 545806 544106 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919849.1 protein_id gnl|my_center|LOCUS_15340 546756 545866 gene locus_tag LOCUS_15350 546756 545866 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640381.1 protein_id gnl|my_center|LOCUS_15350 547938 547024 gene locus_tag LOCUS_15360 gene lpxC 547938 547024 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640382.1 protein_id gnl|my_center|LOCUS_15360 549808 548291 gene locus_tag LOCUS_15370 gene ftsZ 549808 548291 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920397.1 protein_id gnl|my_center|LOCUS_15370 550048 549854 gene locus_tag LOCUS_15380 550048 549854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 550126 550917 gene locus_tag LOCUS_15390 gene murI 550126 550917 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480859.1 protein_id gnl|my_center|LOCUS_15390 550928 551701 gene locus_tag LOCUS_15400 550928 551701 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 protein_id gnl|my_center|LOCUS_15400 552514 551702 gene locus_tag LOCUS_15410 552514 551702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 552981 552514 gene locus_tag LOCUS_15420 552981 552514 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385570.1 protein_id gnl|my_center|LOCUS_15420 553082 553930 gene locus_tag LOCUS_15430 553082 553930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 554774 553920 gene locus_tag LOCUS_15440 554774 553920 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 protein_id gnl|my_center|LOCUS_15440 555725 554850 gene locus_tag LOCUS_15450 555725 554850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 556768 555959 gene locus_tag LOCUS_15460 556768 555959 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918362.1 protein_id gnl|my_center|LOCUS_15460 558025 556781 gene locus_tag LOCUS_15470 558025 556781 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918361.1 protein_id gnl|my_center|LOCUS_15470 558608 558030 gene locus_tag LOCUS_15480 gene petA 558608 558030 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639988.1 protein_id gnl|my_center|LOCUS_15480 559324 559031 gene locus_tag LOCUS_15490 559324 559031 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_15490 560019 559324 gene locus_tag LOCUS_15500 560019 559324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 560171 561112 gene locus_tag LOCUS_15510 gene hemF 560171 561112 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 protein_id gnl|my_center|LOCUS_15510 561856 561269 gene locus_tag LOCUS_15520 561856 561269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 563128 561857 gene locus_tag LOCUS_15530 563128 561857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 563934 563206 gene locus_tag LOCUS_15540 563934 563206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 565236 564019 gene locus_tag LOCUS_15550 565236 564019 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_15550 565365 566714 gene locus_tag LOCUS_15560 565365 566714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 566797 567909 gene locus_tag LOCUS_15570 gene ppk2 566797 567909 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819675.1 protein_id gnl|my_center|LOCUS_15570 570351 568090 gene locus_tag LOCUS_15580 570351 568090 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038895.1 protein_id gnl|my_center|LOCUS_15580 570489 570644 gene locus_tag LOCUS_15590 570489 570644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 570748 571668 gene locus_tag LOCUS_15600 570748 571668 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 protein_id gnl|my_center|LOCUS_15600 571685 572644 gene locus_tag LOCUS_15610 571685 572644 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925938.1 protein_id gnl|my_center|LOCUS_15610 572644 574035 gene locus_tag LOCUS_15620 572644 574035 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_15620 574152 574568 gene locus_tag LOCUS_15630 574152 574568 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946442.1 protein_id gnl|my_center|LOCUS_15630 574568 574975 gene locus_tag LOCUS_15640 574568 574975 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818372.1 protein_id gnl|my_center|LOCUS_15640 576161 574965 gene locus_tag LOCUS_15650 576161 574965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 576954 576238 gene locus_tag LOCUS_15660 gene qscR 576954 576238 CDS product quorum-sensing transcriptional repressor QscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118960.1 protein_id gnl|my_center|LOCUS_15660 577191 577733 gene locus_tag LOCUS_15670 577191 577733 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617693.1 protein_id gnl|my_center|LOCUS_15670 577781 578296 gene locus_tag LOCUS_15680 577781 578296 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617693.1 protein_id gnl|my_center|LOCUS_15680 578353 578865 gene locus_tag LOCUS_15690 578353 578865 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617693.1 protein_id gnl|my_center|LOCUS_15690 578887 579402 gene locus_tag LOCUS_15700 578887 579402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 580166 579399 gene locus_tag LOCUS_15710 580166 579399 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240575.1 protein_id gnl|my_center|LOCUS_15710 581562 580153 gene locus_tag LOCUS_15720 581562 580153 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 protein_id gnl|my_center|LOCUS_15720 582509 581574 gene locus_tag LOCUS_15730 582509 581574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 582640 583647 gene locus_tag LOCUS_15740 gene dusA 582640 583647 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919183.1 protein_id gnl|my_center|LOCUS_15740 584063 583827 gene locus_tag LOCUS_15750 584063 583827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 584084 584479 gene locus_tag LOCUS_15760 584084 584479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 585488 584520 gene locus_tag LOCUS_15770 585488 584520 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_15770 586705 585488 gene locus_tag LOCUS_15780 gene kbl 586705 585488 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213845.1 protein_id gnl|my_center|LOCUS_15780 586806 587387 gene locus_tag LOCUS_15790 586806 587387 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_15790 588060 587395 gene locus_tag LOCUS_15800 588060 587395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 588737 588099 gene locus_tag LOCUS_15810 588737 588099 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970569.1 protein_id gnl|my_center|LOCUS_15810 589546 588743 gene locus_tag LOCUS_15820 589546 588743 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918273.1 protein_id gnl|my_center|LOCUS_15820 589926 589543 gene locus_tag LOCUS_15830 589926 589543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 590720 589926 gene locus_tag LOCUS_15840 590720 589926 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_15840 590883 592169 gene locus_tag LOCUS_15850 590883 592169 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919950.1 protein_id gnl|my_center|LOCUS_15850 592802 592152 gene locus_tag LOCUS_15860 592802 592152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15860 593312 592878 gene locus_tag LOCUS_15870 593312 592878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15870 594217 593300 gene locus_tag LOCUS_15880 gene rlmB 594217 593300 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919119.1 protein_id gnl|my_center|LOCUS_15880 594291 594376 gene locus_tag LOCUS_t00110 594291 594376 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 594403 594476 gene locus_tag LOCUS_t00120 594403 594476 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 595427 594591 gene locus_tag LOCUS_15890 595427 594591 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_15890 597867 595495 gene locus_tag LOCUS_15900 597867 595495 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_15900 598010 598732 gene locus_tag LOCUS_15910 598010 598732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence3 152 367 gene locus_tag LOCUS_15920 152 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 821 369 gene locus_tag LOCUS_15930 821 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2022 814 gene locus_tag LOCUS_15940 2022 814 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_15940 2999 2265 gene locus_tag LOCUS_15950 2999 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3049 3450 gene locus_tag LOCUS_15960 3049 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3451 3891 gene locus_tag LOCUS_15970 3451 3891 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_15970 3894 5564 gene locus_tag LOCUS_15980 3894 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 6239 6163 gene locus_tag LOCUS_t00130 6239 6163 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6406 7134 gene locus_tag LOCUS_15990 6406 7134 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 protein_id gnl|my_center|LOCUS_15990 7221 8639 gene locus_tag LOCUS_16000 7221 8639 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919161.1 protein_id gnl|my_center|LOCUS_16000 8636 9937 gene locus_tag LOCUS_16010 8636 9937 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919162.1 protein_id gnl|my_center|LOCUS_16010 9934 10713 gene locus_tag LOCUS_16020 9934 10713 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211147.1 protein_id gnl|my_center|LOCUS_16020 10784 11329 gene locus_tag LOCUS_16030 10784 11329 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330816.1 protein_id gnl|my_center|LOCUS_16030 11390 13462 gene locus_tag LOCUS_16040 gene recG 11390 13462 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_16040 14399 13449 gene locus_tag LOCUS_16050 gene ubiA 14399 13449 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923273.1 protein_id gnl|my_center|LOCUS_16050 14579 15409 gene locus_tag LOCUS_16060 14579 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 15974 15525 gene locus_tag LOCUS_16070 15974 15525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 16303 15974 gene locus_tag LOCUS_16080 16303 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 17427 16303 gene locus_tag LOCUS_16090 17427 16303 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173283.1 protein_id gnl|my_center|LOCUS_16090 17625 18044 gene locus_tag LOCUS_16100 gene fliX 17625 18044 CDS product flagellar assembly regulator FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920437.1 protein_id gnl|my_center|LOCUS_16100 18290 18760 gene locus_tag LOCUS_16110 gene dksA 18290 18760 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920436.1 protein_id gnl|my_center|LOCUS_16110 18885 19400 gene locus_tag LOCUS_16120 18885 19400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 20303 19539 gene locus_tag LOCUS_16130 gene flgH 20303 19539 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919927.1 protein_id gnl|my_center|LOCUS_16130 21084 20311 gene locus_tag LOCUS_16140 21084 20311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 21881 21093 gene locus_tag LOCUS_16150 gene flgG 21881 21093 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919925.1 protein_id gnl|my_center|LOCUS_16150 22638 21892 gene locus_tag LOCUS_16160 gene flgF 22638 21892 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919924.1 protein_id gnl|my_center|LOCUS_16160 22884 23567 gene locus_tag LOCUS_16170 22884 23567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 23567 24688 gene locus_tag LOCUS_16180 gene fliM 23567 24688 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640397.1 protein_id gnl|my_center|LOCUS_16180 24685 25146 gene locus_tag LOCUS_16190 24685 25146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 25166 26044 gene locus_tag LOCUS_16200 25166 26044 CDS product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919922.1 protein_id gnl|my_center|LOCUS_16200 26057 29788 gene locus_tag LOCUS_16210 26057 29788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 30583 29789 gene locus_tag LOCUS_16220 gene fliP 30583 29789 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918835.1 protein_id gnl|my_center|LOCUS_16220 31200 30910 gene locus_tag LOCUS_16230 31200 30910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 31307 31753 gene locus_tag LOCUS_16240 gene flgB 31307 31753 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640104.1 protein_id gnl|my_center|LOCUS_16240 31757 32170 gene locus_tag LOCUS_16250 gene flgC 31757 32170 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918838.1 protein_id gnl|my_center|LOCUS_16250 32197 32502 gene locus_tag LOCUS_16260 gene fliE 32197 32502 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918839.1 protein_id gnl|my_center|LOCUS_16260 32627 32878 gene locus_tag LOCUS_16270 32627 32878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 33550 33038 gene locus_tag LOCUS_16280 33550 33038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 34911 33547 gene locus_tag LOCUS_16290 34911 33547 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_16290 36299 35016 gene locus_tag LOCUS_16300 gene ccrA 36299 35016 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920921.1 protein_id gnl|my_center|LOCUS_16300 36591 38570 gene locus_tag LOCUS_16310 36591 38570 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920917.1 protein_id gnl|my_center|LOCUS_16310 38771 39664 gene locus_tag LOCUS_16320 38771 39664 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920700.1 protein_id gnl|my_center|LOCUS_16320 40566 39661 gene locus_tag LOCUS_16330 40566 39661 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_16330 41552 40566 gene locus_tag LOCUS_16340 gene lpxK 41552 40566 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918190.1 protein_id gnl|my_center|LOCUS_16340 42835 41552 gene locus_tag LOCUS_16350 42835 41552 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_16350 43574 42828 gene locus_tag LOCUS_16360 43574 42828 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_16360 43647 44348 gene locus_tag LOCUS_16370 43647 44348 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_16370 46118 44349 gene locus_tag LOCUS_16380 gene msbA 46118 44349 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_16380 46364 46122 gene locus_tag LOCUS_16390 46364 46122 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639934.1 protein_id gnl|my_center|LOCUS_16390 47217 46435 gene locus_tag LOCUS_16400 47217 46435 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918197.1 protein_id gnl|my_center|LOCUS_16400 48587 47217 gene locus_tag LOCUS_16410 48587 47217 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918198.1 protein_id gnl|my_center|LOCUS_16410 49041 48649 gene locus_tag LOCUS_16420 49041 48649 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_16420 49199 49363 gene locus_tag LOCUS_16430 49199 49363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 49400 50005 gene locus_tag LOCUS_16440 49400 50005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 50834 50022 gene locus_tag LOCUS_16450 50834 50022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 52422 50893 gene locus_tag LOCUS_16460 52422 50893 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918202.1 protein_id gnl|my_center|LOCUS_16460 52633 53007 gene locus_tag LOCUS_16470 52633 53007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 53333 53004 gene locus_tag LOCUS_16480 53333 53004 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921253.1 protein_id gnl|my_center|LOCUS_16480 55106 53334 gene locus_tag LOCUS_16490 55106 53334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 55654 55103 gene locus_tag LOCUS_16500 55654 55103 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086823.1 protein_id gnl|my_center|LOCUS_16500 56319 55654 gene locus_tag LOCUS_16510 56319 55654 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275419.1 protein_id gnl|my_center|LOCUS_16510 56446 56658 gene locus_tag LOCUS_16520 56446 56658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 56661 56930 gene locus_tag LOCUS_16530 56661 56930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 57628 56927 gene locus_tag LOCUS_16540 57628 56927 CDS product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 protein_id gnl|my_center|LOCUS_16540 58509 57640 gene locus_tag LOCUS_16550 58509 57640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 59672 58674 gene locus_tag LOCUS_16560 59672 58674 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401737.1 protein_id gnl|my_center|LOCUS_16560 60071 59682 gene locus_tag LOCUS_16570 gene crcB 60071 59682 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975197.1 protein_id gnl|my_center|LOCUS_16570 60818 60132 gene locus_tag LOCUS_16580 gene aqpZ 60818 60132 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207869.1 protein_id gnl|my_center|LOCUS_16580 61656 60925 gene locus_tag LOCUS_16590 61656 60925 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919163.1 protein_id gnl|my_center|LOCUS_16590 62510 61656 gene locus_tag LOCUS_16600 gene nadC 62510 61656 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_16600 63982 62507 gene locus_tag LOCUS_16610 63982 62507 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920751.1 protein_id gnl|my_center|LOCUS_16610 65103 63982 gene locus_tag LOCUS_16620 gene nadA 65103 63982 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265876.1 protein_id gnl|my_center|LOCUS_16620 65771 65166 gene locus_tag LOCUS_16630 65771 65166 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 protein_id gnl|my_center|LOCUS_16630 65889 66716 gene locus_tag LOCUS_16640 65889 66716 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265717.1 protein_id gnl|my_center|LOCUS_16640 66756 67124 gene locus_tag LOCUS_16650 66756 67124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 67673 67161 gene locus_tag LOCUS_16660 67673 67161 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036326.1 protein_id gnl|my_center|LOCUS_16660 68179 67685 gene locus_tag LOCUS_16670 68179 67685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 68712 68242 gene locus_tag LOCUS_16680 gene queF 68712 68242 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972191.1 protein_id gnl|my_center|LOCUS_16680 68934 70475 gene locus_tag LOCUS_16690 68934 70475 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_16690 70568 71341 gene locus_tag LOCUS_16700 70568 71341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 71335 71886 gene locus_tag LOCUS_16710 71335 71886 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096602.1 protein_id gnl|my_center|LOCUS_16710 73683 72193 gene locus_tag LOCUS_16720 73683 72193 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640209.1 protein_id gnl|my_center|LOCUS_16720 75184 73751 gene locus_tag LOCUS_16730 75184 73751 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084348.1 protein_id gnl|my_center|LOCUS_16730 76034 75393 gene locus_tag LOCUS_16740 76034 75393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 76744 76067 gene locus_tag LOCUS_16750 76744 76067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 77471 76878 gene locus_tag LOCUS_16760 77471 76878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 78150 77674 gene locus_tag LOCUS_16770 78150 77674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 78463 79509 gene locus_tag LOCUS_16780 78463 79509 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398801.1 protein_id gnl|my_center|LOCUS_16780 80665 79499 gene locus_tag LOCUS_16790 gene metC 80665 79499 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919300.1 protein_id gnl|my_center|LOCUS_16790 81524 80652 gene locus_tag LOCUS_16800 gene sseA 81524 80652 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 protein_id gnl|my_center|LOCUS_16800 82285 81584 gene locus_tag LOCUS_16810 82285 81584 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_16810 83029 82295 gene locus_tag LOCUS_16820 83029 82295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 83150 83818 gene locus_tag LOCUS_16830 gene pdxH 83150 83818 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_16830 83933 85555 gene locus_tag LOCUS_16840 83933 85555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 85562 86110 gene locus_tag LOCUS_16850 85562 86110 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_16850 87004 86111 gene locus_tag LOCUS_16860 87004 86111 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_16860 87110 88084 gene locus_tag LOCUS_16870 87110 88084 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_16870 89329 88232 gene locus_tag LOCUS_16880 gene ychF 89329 88232 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918367.1 protein_id gnl|my_center|LOCUS_16880 89476 90570 gene locus_tag LOCUS_16890 89476 90570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 91784 90657 gene locus_tag LOCUS_16900 91784 90657 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222139.1 protein_id gnl|my_center|LOCUS_16900 92143 91784 gene locus_tag LOCUS_16910 92143 91784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 92418 93335 gene locus_tag LOCUS_16920 92418 93335 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920400.1 protein_id gnl|my_center|LOCUS_16920 93332 94273 gene locus_tag LOCUS_16930 93332 94273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 94295 95587 gene locus_tag LOCUS_16940 gene ftsA 94295 95587 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640521.1 protein_id gnl|my_center|LOCUS_16940 96772 95624 gene locus_tag LOCUS_16950 96772 95624 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085154.1 protein_id gnl|my_center|LOCUS_16950 97409 96885 gene locus_tag LOCUS_16960 97409 96885 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707377.1 protein_id gnl|my_center|LOCUS_16960 98736 97420 gene locus_tag LOCUS_16970 98736 97420 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704508.1 protein_id gnl|my_center|LOCUS_16970 101050 98747 gene locus_tag LOCUS_16980 101050 98747 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550100.1 protein_id gnl|my_center|LOCUS_16980 101452 101123 gene locus_tag LOCUS_16990 101452 101123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 102083 102283 gene locus_tag LOCUS_17000 102083 102283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 102980 102294 gene locus_tag LOCUS_17010 102980 102294 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920164.1 protein_id gnl|my_center|LOCUS_17010 103133 104491 gene locus_tag LOCUS_17020 gene glmU 103133 104491 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920163.1 protein_id gnl|my_center|LOCUS_17020 104488 105195 gene locus_tag LOCUS_17030 gene rpiA 104488 105195 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 protein_id gnl|my_center|LOCUS_17030 105350 106720 gene locus_tag LOCUS_17040 gene gor 105350 106720 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920161.1 protein_id gnl|my_center|LOCUS_17040 106950 108065 gene locus_tag LOCUS_17050 106950 108065 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456661.1 protein_id gnl|my_center|LOCUS_17050 109231 108143 gene locus_tag LOCUS_17060 109231 108143 CDS product DUF4236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097975.1 protein_id gnl|my_center|LOCUS_17060 109364 109606 gene locus_tag LOCUS_17070 109364 109606 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920709.1 protein_id gnl|my_center|LOCUS_17070 109904 110740 gene locus_tag LOCUS_17080 gene fghA 109904 110740 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088926.1 protein_id gnl|my_center|LOCUS_17080 110785 111450 gene locus_tag LOCUS_17090 110785 111450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 112432 111452 gene locus_tag LOCUS_17100 112432 111452 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_17100 113114 112500 gene locus_tag LOCUS_17110 113114 112500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 113188 113472 gene locus_tag LOCUS_17120 113188 113472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 113554 113745 gene locus_tag LOCUS_17130 113554 113745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 113896 115041 gene locus_tag LOCUS_17140 gene spbR 113896 115041 CDS product pole-localized protein SpbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920182.1 protein_id gnl|my_center|LOCUS_17140 115582 115091 gene locus_tag LOCUS_17150 115582 115091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265683.1 protein_id gnl|my_center|LOCUS_17150 116442 115663 gene locus_tag LOCUS_17160 116442 115663 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625959.1 protein_id gnl|my_center|LOCUS_17160 117528 116512 gene locus_tag LOCUS_17170 117528 116512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 117636 118325 gene locus_tag LOCUS_17180 117636 118325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 121222 118346 gene locus_tag LOCUS_17190 gene uvrA 121222 118346 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920446.1 protein_id gnl|my_center|LOCUS_17190 121481 121900 gene locus_tag LOCUS_17200 121481 121900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 122029 122394 gene locus_tag LOCUS_17210 122029 122394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 122406 122885 gene locus_tag LOCUS_17220 122406 122885 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240374.1 protein_id gnl|my_center|LOCUS_17220 122916 123311 gene locus_tag LOCUS_17230 122916 123311 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_17230 123885 123313 gene locus_tag LOCUS_17240 123885 123313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 123972 124634 gene locus_tag LOCUS_17250 123972 124634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 124762 127566 gene locus_tag LOCUS_17260 gene gyrA 124762 127566 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436050.1 protein_id gnl|my_center|LOCUS_17260 127669 128178 gene locus_tag LOCUS_17270 gene coaD 127669 128178 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919455.1 protein_id gnl|my_center|LOCUS_17270 128168 129130 gene locus_tag LOCUS_17280 128168 129130 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640278.1 protein_id gnl|my_center|LOCUS_17280 129231 129842 gene locus_tag LOCUS_17290 129231 129842 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208083.1 protein_id gnl|my_center|LOCUS_17290 129916 130368 gene locus_tag LOCUS_17300 129916 130368 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919458.1 protein_id gnl|my_center|LOCUS_17300 130374 131438 gene locus_tag LOCUS_17310 gene queA 130374 131438 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971794.1 protein_id gnl|my_center|LOCUS_17310 131428 132540 gene locus_tag LOCUS_17320 gene tgt 131428 132540 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919462.1 protein_id gnl|my_center|LOCUS_17320 133058 132537 gene locus_tag LOCUS_17330 133058 132537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 133338 133412 gene locus_tag LOCUS_t00140 133338 133412 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 133786 135000 gene locus_tag LOCUS_17340 133786 135000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 135880 135074 gene locus_tag LOCUS_17350 gene phhA 135880 135074 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_17350 136280 135948 gene locus_tag LOCUS_17360 gene hspQ 136280 135948 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 protein_id gnl|my_center|LOCUS_17360 136400 137107 gene locus_tag LOCUS_17370 136400 137107 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640290.1 protein_id gnl|my_center|LOCUS_17370 137170 138657 gene locus_tag LOCUS_17380 gene guaB 137170 138657 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919491.1 protein_id gnl|my_center|LOCUS_17380 138659 139963 gene locus_tag LOCUS_17390 138659 139963 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086762.1 protein_id gnl|my_center|LOCUS_17390 139964 141523 gene locus_tag LOCUS_17400 gene guaA 139964 141523 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310127.1 protein_id gnl|my_center|LOCUS_17400 141527 141736 gene locus_tag LOCUS_17410 141527 141736 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129656.1 protein_id gnl|my_center|LOCUS_17410 142325 141720 gene locus_tag LOCUS_17420 142325 141720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966478.1 protein_id gnl|my_center|LOCUS_17420 142428 143057 gene locus_tag LOCUS_17430 142428 143057 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089232.1 protein_id gnl|my_center|LOCUS_17430 144014 143043 gene locus_tag LOCUS_17440 144014 143043 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266539.1 protein_id gnl|my_center|LOCUS_17440 145860 144028 gene locus_tag LOCUS_17450 145860 144028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 146171 146590 gene locus_tag LOCUS_17460 gene phaP 146171 146590 CDS product TIGR01841 family phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640421.1 protein_id gnl|my_center|LOCUS_17460 146761 147120 gene locus_tag LOCUS_17470 gene clpS 146761 147120 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 protein_id gnl|my_center|LOCUS_17470 147168 149498 gene locus_tag LOCUS_17480 gene clpA 147168 149498 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087911.1 protein_id gnl|my_center|LOCUS_17480 149965 149525 gene locus_tag LOCUS_17490 149965 149525 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920328.1 protein_id gnl|my_center|LOCUS_17490 150425 149967 gene locus_tag LOCUS_17500 150425 149967 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_17500 150891 150427 gene locus_tag LOCUS_17510 150891 150427 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_17510 151027 151491 gene locus_tag LOCUS_17520 151027 151491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 152463 151672 gene locus_tag LOCUS_17530 gene trpC 152463 151672 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531739.1 protein_id gnl|my_center|LOCUS_17530 153491 152463 gene locus_tag LOCUS_17540 gene trpD 153491 152463 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531738.1 protein_id gnl|my_center|LOCUS_17540 154074 153478 gene locus_tag LOCUS_17550 154074 153478 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_17550 155636 154074 gene locus_tag LOCUS_17560 gene trpE 155636 154074 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643621.1 protein_id gnl|my_center|LOCUS_17560 157552 155648 gene locus_tag LOCUS_17570 157552 155648 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919760.1 protein_id gnl|my_center|LOCUS_17570 157684 158442 gene locus_tag LOCUS_17580 gene tpiA 157684 158442 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389642.1 protein_id gnl|my_center|LOCUS_17580 158540 159643 gene locus_tag LOCUS_17590 158540 159643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 159738 160199 gene locus_tag LOCUS_17600 159738 160199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 160241 161875 gene locus_tag LOCUS_17610 160241 161875 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919588.1 protein_id gnl|my_center|LOCUS_17610 161959 162141 gene locus_tag LOCUS_17620 gene rpmF 161959 162141 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919589.1 protein_id gnl|my_center|LOCUS_17620 162359 162883 gene locus_tag LOCUS_17630 162359 162883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 163662 163033 gene locus_tag LOCUS_17640 163662 163033 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919423.1 protein_id gnl|my_center|LOCUS_17640 163709 164248 gene locus_tag LOCUS_17650 gene folK 163709 164248 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189575617.1 protein_id gnl|my_center|LOCUS_17650 164307 164660 gene locus_tag LOCUS_17660 gene rpoZ 164307 164660 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919426.1 protein_id gnl|my_center|LOCUS_17660 164872 167058 gene locus_tag LOCUS_17670 164872 167058 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919427.1 protein_id gnl|my_center|LOCUS_17670 167082 167675 gene locus_tag LOCUS_17680 gene pyrE 167082 167675 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532589.1 protein_id gnl|my_center|LOCUS_17680 167677 168429 gene locus_tag LOCUS_17690 167677 168429 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383418.1 protein_id gnl|my_center|LOCUS_17690 168426 168827 gene locus_tag LOCUS_17700 gene acpS 168426 168827 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971345.1 protein_id gnl|my_center|LOCUS_17700 168845 169645 gene locus_tag LOCUS_17710 gene lepB 168845 169645 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919433.1 protein_id gnl|my_center|LOCUS_17710 169647 170372 gene locus_tag LOCUS_17720 gene rnc 169647 170372 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919434.1 protein_id gnl|my_center|LOCUS_17720 170362 171309 gene locus_tag LOCUS_17730 gene era 170362 171309 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640271.1 protein_id gnl|my_center|LOCUS_17730 171325 172059 gene locus_tag LOCUS_17740 gene recO 171325 172059 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640273.1 protein_id gnl|my_center|LOCUS_17740 173108 172062 gene locus_tag LOCUS_17750 173108 172062 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919716.1 protein_id gnl|my_center|LOCUS_17750 173214 174617 gene locus_tag LOCUS_17760 173214 174617 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 protein_id gnl|my_center|LOCUS_17760 176205 174604 gene locus_tag LOCUS_17770 176205 174604 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314108.1 protein_id gnl|my_center|LOCUS_17770 178545 176512 gene locus_tag LOCUS_17780 gene parE 178545 176512 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400485.1 protein_id gnl|my_center|LOCUS_17780 178687 179136 gene locus_tag LOCUS_17790 178687 179136 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_17790 179274 181508 gene locus_tag LOCUS_17800 gene parC 179274 181508 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919440.1 protein_id gnl|my_center|LOCUS_17800 182751 181567 gene locus_tag LOCUS_17810 182751 181567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 183661 182873 gene locus_tag LOCUS_17820 183661 182873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 184550 183774 gene locus_tag LOCUS_17830 184550 183774 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971439.1 protein_id gnl|my_center|LOCUS_17830 185446 184586 gene locus_tag LOCUS_17840 185446 184586 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_17840 186041 185520 gene locus_tag LOCUS_17850 186041 185520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 187051 186038 gene locus_tag LOCUS_17860 gene hemB 187051 186038 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 protein_id gnl|my_center|LOCUS_17860 188349 187075 gene locus_tag LOCUS_17870 188349 187075 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_17870 188470 189588 gene locus_tag LOCUS_17880 188470 189588 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_17880 189877 190437 gene locus_tag LOCUS_17890 189877 190437 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_17890 190666 191886 gene locus_tag LOCUS_17900 gene hemA 190666 191886 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919232.1 protein_id gnl|my_center|LOCUS_17900 192552 192136 gene locus_tag LOCUS_17910 192552 192136 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265704.1 protein_id gnl|my_center|LOCUS_17910 193015 194298 gene locus_tag LOCUS_17920 193015 194298 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478453.1 protein_id gnl|my_center|LOCUS_17920 194311 194781 gene locus_tag LOCUS_17930 gene nrdR 194311 194781 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 protein_id gnl|my_center|LOCUS_17930 194788 195441 gene locus_tag LOCUS_17940 194788 195441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 195443 196051 gene locus_tag LOCUS_17950 195443 196051 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_17950 196062 196529 gene locus_tag LOCUS_17960 gene ribH 196062 196529 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975017.1 protein_id gnl|my_center|LOCUS_17960 196541 197026 gene locus_tag LOCUS_17970 gene nusB 196541 197026 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971444.1 protein_id gnl|my_center|LOCUS_17970 197027 197998 gene locus_tag LOCUS_17980 gene thiL 197027 197998 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087788.1 protein_id gnl|my_center|LOCUS_17980 198058 198489 gene locus_tag LOCUS_17990 198058 198489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 198655 200814 gene locus_tag LOCUS_18000 198655 200814 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919240.1 protein_id gnl|my_center|LOCUS_18000 200946 202097 gene locus_tag LOCUS_18010 200946 202097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 202207 203253 gene locus_tag LOCUS_18020 202207 203253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 203756 203298 gene locus_tag LOCUS_18030 203756 203298 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640219.1 protein_id gnl|my_center|LOCUS_18030 203886 204383 gene locus_tag LOCUS_18040 203886 204383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 204490 205557 gene locus_tag LOCUS_18050 gene plsX 204490 205557 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919245.1 protein_id gnl|my_center|LOCUS_18050 205575 206537 gene locus_tag LOCUS_18060 205575 206537 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327909.1 protein_id gnl|my_center|LOCUS_18060 206790 207080 gene locus_tag LOCUS_18070 gene ihfA 206790 207080 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719760.1 protein_id gnl|my_center|LOCUS_18070 207081 207524 gene locus_tag LOCUS_18080 207081 207524 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919248.1 protein_id gnl|my_center|LOCUS_18080 207526 208062 gene locus_tag LOCUS_18090 207526 208062 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_18090 208399 208139 gene locus_tag LOCUS_18100 208399 208139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 208553 209545 gene locus_tag LOCUS_18110 208553 209545 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975052.1 protein_id gnl|my_center|LOCUS_18110 209615 210898 gene locus_tag LOCUS_18120 gene eno 209615 210898 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919592.1 protein_id gnl|my_center|LOCUS_18120 210997 211293 gene locus_tag LOCUS_18130 210997 211293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 211464 212486 gene locus_tag LOCUS_18140 gene pdhA 211464 212486 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919594.1 protein_id gnl|my_center|LOCUS_18140 212511 213428 gene locus_tag LOCUS_18150 212511 213428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 213444 214784 gene locus_tag LOCUS_18160 213444 214784 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919595.1 protein_id gnl|my_center|LOCUS_18160 214796 216055 gene locus_tag LOCUS_18170 214796 216055 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919597.1 protein_id gnl|my_center|LOCUS_18170 216182 216595 gene locus_tag LOCUS_18180 216182 216595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 216690 216869 gene locus_tag LOCUS_18190 216690 216869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 216943 217581 gene locus_tag LOCUS_18200 216943 217581 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975402.1 protein_id gnl|my_center|LOCUS_18200 217593 219002 gene locus_tag LOCUS_18210 gene lpdA 217593 219002 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383235.1 protein_id gnl|my_center|LOCUS_18210 219172 220206 gene locus_tag LOCUS_18220 219172 220206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 220224 221597 gene locus_tag LOCUS_18230 220224 221597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 221607 223133 gene locus_tag LOCUS_18240 gene der 221607 223133 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919527.1 protein_id gnl|my_center|LOCUS_18240 223893 223156 gene locus_tag LOCUS_18250 223893 223156 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919529.1 protein_id gnl|my_center|LOCUS_18250 225384 223894 gene locus_tag LOCUS_18260 gene purF 225384 223894 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919531.1 protein_id gnl|my_center|LOCUS_18260 226081 225374 gene locus_tag LOCUS_18270 226081 225374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 227488 226097 gene locus_tag LOCUS_18280 gene radA 227488 226097 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919533.1 protein_id gnl|my_center|LOCUS_18280 228561 227503 gene locus_tag LOCUS_18290 gene alr 228561 227503 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332653.1 protein_id gnl|my_center|LOCUS_18290 230043 228574 gene locus_tag LOCUS_18300 230043 228574 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919538.1 protein_id gnl|my_center|LOCUS_18300 230576 230124 gene locus_tag LOCUS_18310 230576 230124 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704690.1 protein_id gnl|my_center|LOCUS_18310 231259 230684 gene locus_tag LOCUS_18320 gene rplI 231259 230684 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532521.1 protein_id gnl|my_center|LOCUS_18320 231527 231270 gene locus_tag LOCUS_18330 gene rpsR 231527 231270 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203718.1 protein_id gnl|my_center|LOCUS_18330 231935 231531 gene locus_tag LOCUS_18340 gene rpsF 231935 231531 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919541.1 protein_id gnl|my_center|LOCUS_18340 233615 232134 gene locus_tag LOCUS_18350 233615 232134 CDS product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855193.1 protein_id gnl|my_center|LOCUS_18350 233794 234150 gene locus_tag LOCUS_18360 233794 234150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 234515 234201 gene locus_tag LOCUS_18370 234515 234201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 234833 234609 gene locus_tag LOCUS_18380 234833 234609 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002246537.1 protein_id gnl|my_center|LOCUS_18380 235019 236368 gene locus_tag LOCUS_18390 gene yegQ 235019 236368 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_18390 236415 237569 gene locus_tag LOCUS_18400 236415 237569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 237602 237955 gene locus_tag LOCUS_18410 237602 237955 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182869854.1 protein_id gnl|my_center|LOCUS_18410 237963 238802 gene locus_tag LOCUS_18420 237963 238802 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_18420 238921 240711 gene locus_tag LOCUS_18430 238921 240711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 240754 241692 gene locus_tag LOCUS_18440 gene fabD 240754 241692 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919546.1 protein_id gnl|my_center|LOCUS_18440 241719 242453 gene locus_tag LOCUS_18450 gene fabG 241719 242453 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_18450 242639 242878 gene locus_tag LOCUS_18460 242639 242878 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383938.1 protein_id gnl|my_center|LOCUS_18460 242896 244176 gene locus_tag LOCUS_18470 gene fabF 242896 244176 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919549.1 protein_id gnl|my_center|LOCUS_18470 244184 245254 gene locus_tag LOCUS_18480 gene mltG 244184 245254 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 protein_id gnl|my_center|LOCUS_18480 245254 245904 gene locus_tag LOCUS_18490 gene gmk 245254 245904 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971396.1 protein_id gnl|my_center|LOCUS_18490 246728 245901 gene locus_tag LOCUS_18500 gene rsmA 246728 245901 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265733.1 protein_id gnl|my_center|LOCUS_18500 247734 246721 gene locus_tag LOCUS_18510 gene pdxA 247734 246721 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919557.1 protein_id gnl|my_center|LOCUS_18510 249031 247736 gene locus_tag LOCUS_18520 249031 247736 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640302.1 protein_id gnl|my_center|LOCUS_18520 251403 249151 gene locus_tag LOCUS_18530 gene lptD 251403 249151 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_18530 252557 251445 gene locus_tag LOCUS_18540 gene lptG 252557 251445 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919560.1 protein_id gnl|my_center|LOCUS_18540 253689 252547 gene locus_tag LOCUS_18550 253689 252547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 253832 255319 gene locus_tag LOCUS_18560 253832 255319 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171097.1 protein_id gnl|my_center|LOCUS_18560 255319 255768 gene locus_tag LOCUS_18570 255319 255768 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919563.1 protein_id gnl|my_center|LOCUS_18570 255765 256058 gene locus_tag LOCUS_18580 255765 256058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 256116 256538 gene locus_tag LOCUS_18590 gene ndk 256116 256538 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086893.1 protein_id gnl|my_center|LOCUS_18590 256632 256838 gene locus_tag LOCUS_18600 256632 256838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 257358 256843 gene locus_tag LOCUS_18610 257358 256843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 258000 257368 gene locus_tag LOCUS_18620 gene purN 258000 257368 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172390.1 protein_id gnl|my_center|LOCUS_18620 259037 258000 gene locus_tag LOCUS_18630 gene purM 259037 258000 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919572.1 protein_id gnl|my_center|LOCUS_18630 259113 259748 gene locus_tag LOCUS_18640 259113 259748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 259726 261906 gene locus_tag LOCUS_18650 259726 261906 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265738.1 protein_id gnl|my_center|LOCUS_18650 261903 263399 gene locus_tag LOCUS_18660 261903 263399 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919577.1 protein_id gnl|my_center|LOCUS_18660 263467 263727 gene locus_tag LOCUS_18670 263467 263727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 264904 263729 gene locus_tag LOCUS_18680 gene rnd 264904 263729 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_18680 265063 266844 gene locus_tag LOCUS_18690 gene aspS 265063 266844 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_18690 267617 266907 gene locus_tag LOCUS_18700 267617 266907 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640359.1 protein_id gnl|my_center|LOCUS_18700 268232 267738 gene locus_tag LOCUS_18710 268232 267738 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919756.1 protein_id gnl|my_center|LOCUS_18710 270870 268345 gene locus_tag LOCUS_18720 270870 268345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 271100 271486 gene locus_tag LOCUS_18730 271100 271486 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640357.1 protein_id gnl|my_center|LOCUS_18730 271487 272356 gene locus_tag LOCUS_18740 271487 272356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 272984 272310 gene locus_tag LOCUS_18750 gene aat 272984 272310 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919751.1 protein_id gnl|my_center|LOCUS_18750 274354 273005 gene locus_tag LOCUS_18760 gene accC 274354 273005 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 protein_id gnl|my_center|LOCUS_18760 274844 274368 gene locus_tag LOCUS_18770 gene accB 274844 274368 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383006.1 protein_id gnl|my_center|LOCUS_18770 275382 274939 gene locus_tag LOCUS_18780 gene aroQ 275382 274939 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919748.1 protein_id gnl|my_center|LOCUS_18780 275444 275665 gene locus_tag LOCUS_18790 gene thiS 275444 275665 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015109.1 protein_id gnl|my_center|LOCUS_18790 275674 276447 gene locus_tag LOCUS_18800 275674 276447 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919746.1 protein_id gnl|my_center|LOCUS_18800 277230 276448 gene locus_tag LOCUS_18810 277230 276448 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_18810 278646 277294 gene locus_tag LOCUS_18820 278646 277294 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640355.1 protein_id gnl|my_center|LOCUS_18820 279263 278730 gene locus_tag LOCUS_18830 279263 278730 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041577.1 protein_id gnl|my_center|LOCUS_18830 281583 279253 gene locus_tag LOCUS_18840 281583 279253 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919743.1 protein_id gnl|my_center|LOCUS_18840 281800 281498 gene locus_tag LOCUS_18850 281800 281498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 282065 283303 gene locus_tag LOCUS_18860 282065 283303 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919742.1 protein_id gnl|my_center|LOCUS_18860 283406 285769 gene locus_tag LOCUS_18870 283406 285769 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_18870 285794 286906 gene locus_tag LOCUS_18880 gene prfB 285794 286906 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919740.1 protein_id gnl|my_center|LOCUS_18880 287393 286941 gene locus_tag LOCUS_18890 287393 286941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 287940 287482 gene locus_tag LOCUS_18900 287940 287482 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532169.1 protein_id gnl|my_center|LOCUS_18900 289221 287950 gene locus_tag LOCUS_18910 gene tyrS 289221 287950 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_18910 289303 290421 gene locus_tag LOCUS_18920 289303 290421 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532935.1 protein_id gnl|my_center|LOCUS_18920 290519 291766 gene locus_tag LOCUS_18930 290519 291766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 292516 291767 gene locus_tag LOCUS_18940 292516 291767 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_18940 293245 292574 gene locus_tag LOCUS_18950 293245 292574 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615265.1 protein_id gnl|my_center|LOCUS_18950 293381 293830 gene locus_tag LOCUS_18960 293381 293830 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_18960 293830 294963 gene locus_tag LOCUS_18970 293830 294963 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 protein_id gnl|my_center|LOCUS_18970 294963 296450 gene locus_tag LOCUS_18980 gene sufB 294963 296450 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919730.1 protein_id gnl|my_center|LOCUS_18980 296450 297196 gene locus_tag LOCUS_18990 gene sufC 296450 297196 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_18990 297196 298332 gene locus_tag LOCUS_19000 gene sufD 297196 298332 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975621.1 protein_id gnl|my_center|LOCUS_19000 298329 299543 gene locus_tag LOCUS_19010 298329 299543 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919726.1 protein_id gnl|my_center|LOCUS_19010 299543 299887 gene locus_tag LOCUS_19020 299543 299887 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 protein_id gnl|my_center|LOCUS_19020 299897 300259 gene locus_tag LOCUS_19030 299897 300259 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_19030 300766 300332 gene locus_tag LOCUS_19040 300766 300332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 301856 300825 gene locus_tag LOCUS_19050 301856 300825 CDS product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113880.1 protein_id gnl|my_center|LOCUS_19050 302503 301913 gene locus_tag LOCUS_19060 302503 301913 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015611.1 protein_id gnl|my_center|LOCUS_19060 303471 302557 gene locus_tag LOCUS_19070 303471 302557 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971919.1 protein_id gnl|my_center|LOCUS_19070 305306 303897 gene locus_tag LOCUS_19080 gene glnA 305306 303897 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919835.1 protein_id gnl|my_center|LOCUS_19080 305690 305352 gene locus_tag LOCUS_19090 305690 305352 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919834.1 protein_id gnl|my_center|LOCUS_19090 306090 306827 gene locus_tag LOCUS_19100 306090 306827 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 protein_id gnl|my_center|LOCUS_19100 306827 307471 gene locus_tag LOCUS_19110 306827 307471 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_19110 307714 310641 gene locus_tag LOCUS_19120 307714 310641 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_19120 310881 313856 gene locus_tag LOCUS_19130 310881 313856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 313987 314685 gene locus_tag LOCUS_19140 313987 314685 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918095.1 protein_id gnl|my_center|LOCUS_19140 316863 314713 gene locus_tag LOCUS_19150 316863 314713 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067382.1 protein_id gnl|my_center|LOCUS_19150 317005 317778 gene locus_tag LOCUS_19160 317005 317778 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918740.1 protein_id gnl|my_center|LOCUS_19160 317827 319140 gene locus_tag LOCUS_19170 gene ribB 317827 319140 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971123.1 protein_id gnl|my_center|LOCUS_19170 320696 319137 gene locus_tag LOCUS_19180 320696 319137 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919601.1 protein_id gnl|my_center|LOCUS_19180 320899 321864 gene locus_tag LOCUS_19190 gene lipA 320899 321864 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919603.1 protein_id gnl|my_center|LOCUS_19190 321857 322342 gene locus_tag LOCUS_19200 321857 322342 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919604.1 protein_id gnl|my_center|LOCUS_19200 322816 322325 gene locus_tag LOCUS_19210 322816 322325 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531490.1 protein_id gnl|my_center|LOCUS_19210 323995 322820 gene locus_tag LOCUS_19220 323995 322820 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384089.1 protein_id gnl|my_center|LOCUS_19220 324176 325255 gene locus_tag LOCUS_19230 324176 325255 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640317.1 protein_id gnl|my_center|LOCUS_19230 325255 326688 gene locus_tag LOCUS_19240 325255 326688 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919609.1 protein_id gnl|my_center|LOCUS_19240 326749 328998 gene locus_tag LOCUS_19250 326749 328998 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640318.1 protein_id gnl|my_center|LOCUS_19250 329002 330390 gene locus_tag LOCUS_19260 gene ntrX 329002 330390 CDS product nitrogen assimilation response regulator NtrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919611.1 protein_id gnl|my_center|LOCUS_19260 330390 331229 gene locus_tag LOCUS_19270 330390 331229 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919612.1 protein_id gnl|my_center|LOCUS_19270 331389 331640 gene locus_tag LOCUS_19280 gene hfq 331389 331640 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919613.1 protein_id gnl|my_center|LOCUS_19280 331643 332995 gene locus_tag LOCUS_19290 gene hflX 331643 332995 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640319.1 protein_id gnl|my_center|LOCUS_19290 333772 332960 gene locus_tag LOCUS_19300 gene mazG 333772 332960 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_19300 335120 333777 gene locus_tag LOCUS_19310 335120 333777 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920866.1 protein_id gnl|my_center|LOCUS_19310 336113 335196 gene locus_tag LOCUS_19320 336113 335196 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208636288.1 protein_id gnl|my_center|LOCUS_19320 336313 337575 gene locus_tag LOCUS_19330 336313 337575 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259113.1 protein_id gnl|my_center|LOCUS_19330 338376 337576 gene locus_tag LOCUS_19340 338376 337576 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919687.1 protein_id gnl|my_center|LOCUS_19340 339149 338373 gene locus_tag LOCUS_19350 339149 338373 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919688.1 protein_id gnl|my_center|LOCUS_19350 340186 339146 gene locus_tag LOCUS_19360 340186 339146 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385183.1 protein_id gnl|my_center|LOCUS_19360 340820 340179 gene locus_tag LOCUS_19370 gene tmk 340820 340179 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_19370 341878 340874 gene locus_tag LOCUS_19380 341878 340874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 342093 341941 gene locus_tag LOCUS_19390 342093 341941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 342138 343091 gene locus_tag LOCUS_19400 342138 343091 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329123.1 protein_id gnl|my_center|LOCUS_19400 343315 344817 gene locus_tag LOCUS_19410 343315 344817 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329122.1 protein_id gnl|my_center|LOCUS_19410 344958 345620 gene locus_tag LOCUS_19420 344958 345620 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920508.1 protein_id gnl|my_center|LOCUS_19420 345708 346103 gene locus_tag LOCUS_19430 345708 346103 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532871.1 protein_id gnl|my_center|LOCUS_19430 351370 346154 gene locus_tag LOCUS_19440 351370 346154 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211921382.1 protein_id gnl|my_center|LOCUS_19440 352554 351706 gene locus_tag LOCUS_19450 352554 351706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19450 352787 353140 gene locus_tag LOCUS_19460 352787 353140 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053149.1 protein_id gnl|my_center|LOCUS_19460 353316 353225 gene locus_tag LOCUS_t00150 353316 353225 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 355135 353468 gene locus_tag LOCUS_19470 355135 353468 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526206.1 protein_id gnl|my_center|LOCUS_19470 356503 355157 gene locus_tag LOCUS_19480 356503 355157 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 protein_id gnl|my_center|LOCUS_19480 356856 357491 gene locus_tag LOCUS_19490 356856 357491 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378642.1 protein_id gnl|my_center|LOCUS_19490 360893 357474 gene locus_tag LOCUS_19500 360893 357474 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 protein_id gnl|my_center|LOCUS_19500 361033 362904 gene locus_tag LOCUS_19510 361033 362904 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 protein_id gnl|my_center|LOCUS_19510 364338 363451 gene locus_tag LOCUS_19520 364338 363451 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_19520 365222 364338 gene locus_tag LOCUS_19530 365222 364338 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 protein_id gnl|my_center|LOCUS_19530 365961 365263 gene locus_tag LOCUS_19540 365961 365263 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_19540 366062 366349 gene locus_tag LOCUS_19550 366062 366349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 366409 366711 gene locus_tag LOCUS_19560 366409 366711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 369356 366708 gene locus_tag LOCUS_19570 369356 366708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19570 370427 369360 gene locus_tag LOCUS_19580 370427 369360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19580 371287 370427 gene locus_tag LOCUS_19590 gene metF 371287 370427 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920001.1 protein_id gnl|my_center|LOCUS_19590 372288 371284 gene locus_tag LOCUS_19600 372288 371284 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 protein_id gnl|my_center|LOCUS_19600 372402 372839 gene locus_tag LOCUS_19610 gene rnhA 372402 372839 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241132.1 protein_id gnl|my_center|LOCUS_19610 372839 373366 gene locus_tag LOCUS_19620 372839 373366 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208164.1 protein_id gnl|my_center|LOCUS_19620 373888 373361 gene locus_tag LOCUS_19630 373888 373361 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266323.1 protein_id gnl|my_center|LOCUS_19630 376735 374009 gene locus_tag LOCUS_19640 376735 374009 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919197.1 protein_id gnl|my_center|LOCUS_19640 377507 376857 gene locus_tag LOCUS_19650 gene popZ 377507 376857 CDS product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 protein_id gnl|my_center|LOCUS_19650 378264 377647 gene locus_tag LOCUS_19660 378264 377647 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919194.1 protein_id gnl|my_center|LOCUS_19660 378519 378592 gene locus_tag LOCUS_t00160 378519 378592 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 378874 378949 gene locus_tag LOCUS_t00170 378874 378949 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 379114 379671 gene locus_tag LOCUS_19670 379114 379671 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640203.1 protein_id gnl|my_center|LOCUS_19670 381043 379712 gene locus_tag LOCUS_19680 gene gltX 381043 379712 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338496.1 protein_id gnl|my_center|LOCUS_19680 381234 381896 gene locus_tag LOCUS_19690 gene lexA 381234 381896 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528303.1 protein_id gnl|my_center|LOCUS_19690 383753 381903 gene locus_tag LOCUS_19700 383753 381903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19700 383704 383883 gene locus_tag LOCUS_19710 383704 383883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 384103 385509 gene locus_tag LOCUS_19720 gene gltX 384103 385509 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919771.1 protein_id gnl|my_center|LOCUS_19720 385567 386871 gene locus_tag LOCUS_19730 gene gltA 385567 386871 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919772.1 protein_id gnl|my_center|LOCUS_19730 388060 386918 gene locus_tag LOCUS_19740 gene lpxB 388060 386918 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919775.1 protein_id gnl|my_center|LOCUS_19740 388910 388050 gene locus_tag LOCUS_19750 388910 388050 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_19750 389700 388912 gene locus_tag LOCUS_19760 gene lpxA 389700 388912 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919777.1 protein_id gnl|my_center|LOCUS_19760 390162 389710 gene locus_tag LOCUS_19770 gene fabZ 390162 389710 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919778.1 protein_id gnl|my_center|LOCUS_19770 391176 390178 gene locus_tag LOCUS_19780 gene lpxD 391176 390178 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919779.1 protein_id gnl|my_center|LOCUS_19780 391940 391194 gene locus_tag LOCUS_19790 391940 391194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 394418 391977 gene locus_tag LOCUS_19800 gene bamA 394418 391977 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640362.1 protein_id gnl|my_center|LOCUS_19800 395761 394565 gene locus_tag LOCUS_19810 gene rseP 395761 394565 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087622.1 protein_id gnl|my_center|LOCUS_19810 396966 395779 gene locus_tag LOCUS_19820 gene dxr 396966 395779 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919783.1 protein_id gnl|my_center|LOCUS_19820 397844 396963 gene locus_tag LOCUS_19830 397844 396963 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971574.1 protein_id gnl|my_center|LOCUS_19830 398590 397844 gene locus_tag LOCUS_19840 398590 397844 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087625.1 protein_id gnl|my_center|LOCUS_19840 399149 398592 gene locus_tag LOCUS_19850 gene frr 399149 398592 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919786.1 protein_id gnl|my_center|LOCUS_19850 400004 399162 gene locus_tag LOCUS_19860 gene pyrH 400004 399162 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919787.1 protein_id gnl|my_center|LOCUS_19860 400973 400056 gene locus_tag LOCUS_19870 gene tsf 400973 400056 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919788.1 protein_id gnl|my_center|LOCUS_19870 401839 401042 gene locus_tag LOCUS_19880 gene rpsB 401839 401042 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919789.1 protein_id gnl|my_center|LOCUS_19880 405459 402040 gene locus_tag LOCUS_19890 gene dnaE 405459 402040 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919792.1 protein_id gnl|my_center|LOCUS_19890 406503 405826 gene locus_tag LOCUS_19900 406503 405826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919795.1 protein_id gnl|my_center|LOCUS_19900 407758 406496 gene locus_tag LOCUS_19910 407758 406496 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919796.1 protein_id gnl|my_center|LOCUS_19910 408003 410072 gene locus_tag LOCUS_19920 408003 410072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 411411 410077 gene locus_tag LOCUS_19930 411411 410077 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919797.1 protein_id gnl|my_center|LOCUS_19930 411657 411421 gene locus_tag LOCUS_19940 411657 411421 CDS product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526683.1 protein_id gnl|my_center|LOCUS_19940 412092 411667 gene locus_tag LOCUS_19950 gene mce 412092 411667 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_19950 413797 412121 gene locus_tag LOCUS_19960 413797 412121 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_19960 414633 413887 gene locus_tag LOCUS_19970 414633 413887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 415429 414713 gene locus_tag LOCUS_19980 415429 414713 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385012.1 protein_id gnl|my_center|LOCUS_19980 416868 415426 gene locus_tag LOCUS_19990 gene nuoN 416868 415426 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087671.1 protein_id gnl|my_center|LOCUS_19990 418376 416889 gene locus_tag LOCUS_20000 418376 416889 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640368.1 protein_id gnl|my_center|LOCUS_20000 420453 418381 gene locus_tag LOCUS_20010 gene nuoL 420453 418381 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919805.1 protein_id gnl|my_center|LOCUS_20010 420781 420458 gene locus_tag LOCUS_20020 gene nuoK 420781 420458 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_20020 421395 420778 gene locus_tag LOCUS_20030 421395 420778 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531099.1 protein_id gnl|my_center|LOCUS_20030 421940 421455 gene locus_tag LOCUS_20040 gene nuoI 421940 421455 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719675.1 protein_id gnl|my_center|LOCUS_20040 423028 421940 gene locus_tag LOCUS_20050 gene nuoH 423028 421940 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919811.1 protein_id gnl|my_center|LOCUS_20050 425108 423033 gene locus_tag LOCUS_20060 gene nuoG 425108 423033 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327992.1 protein_id gnl|my_center|LOCUS_20060 425796 425482 gene locus_tag LOCUS_20070 425796 425482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 427232 425919 gene locus_tag LOCUS_20080 gene nuoF 427232 425919 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919813.1 protein_id gnl|my_center|LOCUS_20080 427896 427234 gene locus_tag LOCUS_20090 gene nuoE 427896 427234 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919816.1 protein_id gnl|my_center|LOCUS_20090 428237 427905 gene locus_tag LOCUS_20100 428237 427905 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919817.1 protein_id gnl|my_center|LOCUS_20100 429466 428237 gene locus_tag LOCUS_20110 429466 428237 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640370.1 protein_id gnl|my_center|LOCUS_20110 430086 429466 gene locus_tag LOCUS_20120 430086 429466 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327986.1 protein_id gnl|my_center|LOCUS_20120 430637 430083 gene locus_tag LOCUS_20130 430637 430083 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640371.1 protein_id gnl|my_center|LOCUS_20130 431026 430628 gene locus_tag LOCUS_20140 431026 430628 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919822.1 protein_id gnl|my_center|LOCUS_20140 431287 432681 gene locus_tag LOCUS_20150 431287 432681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 432876 432800 gene locus_tag LOCUS_t00180 432876 432800 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 433054 432979 gene locus_tag LOCUS_t00190 433054 432979 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 434263 433190 gene locus_tag LOCUS_20160 434263 433190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 436777 434375 gene locus_tag LOCUS_20170 gene lon 436777 434375 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531808.1 protein_id gnl|my_center|LOCUS_20170 438155 436887 gene locus_tag LOCUS_20180 gene clpX 438155 436887 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919827.1 protein_id gnl|my_center|LOCUS_20180 438960 438325 gene locus_tag LOCUS_20190 438960 438325 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640374.1 protein_id gnl|my_center|LOCUS_20190 440596 439130 gene locus_tag LOCUS_20200 gene tig 440596 439130 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919830.1 protein_id gnl|my_center|LOCUS_20200 440987 440903 gene locus_tag LOCUS_t00200 440987 440903 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 441872 441072 gene locus_tag LOCUS_20210 441872 441072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 445369 441911 gene locus_tag LOCUS_20220 gene mfd 445369 441911 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919710.1 protein_id gnl|my_center|LOCUS_20220 445436 445705 gene locus_tag LOCUS_20230 445436 445705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20230 445783 446259 gene locus_tag LOCUS_20240 445783 446259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 446552 446256 gene locus_tag LOCUS_20250 446552 446256 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640346.1 protein_id gnl|my_center|LOCUS_20250 447293 446622 gene locus_tag LOCUS_20260 447293 446622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 450256 447596 gene locus_tag LOCUS_20270 gene ppdK 450256 447596 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640245.1 protein_id gnl|my_center|LOCUS_20270 452398 450380 gene locus_tag LOCUS_20280 gene glyS 452398 450380 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085323.1 protein_id gnl|my_center|LOCUS_20280 453336 452398 gene locus_tag LOCUS_20290 453336 452398 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_20290 453493 454773 gene locus_tag LOCUS_20300 453493 454773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 456804 454774 gene locus_tag LOCUS_20310 456804 454774 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920040.1 protein_id gnl|my_center|LOCUS_20310 457211 456900 gene locus_tag LOCUS_20320 457211 456900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 457541 458614 gene locus_tag LOCUS_20330 457541 458614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 458627 459787 gene locus_tag LOCUS_20340 458627 459787 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 protein_id gnl|my_center|LOCUS_20340 459829 460701 gene locus_tag LOCUS_20350 459829 460701 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640279.1 protein_id gnl|my_center|LOCUS_20350 461622 460717 gene locus_tag LOCUS_20360 461622 460717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 463325 461793 gene locus_tag LOCUS_20370 463325 461793 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919841.1 protein_id gnl|my_center|LOCUS_20370 463497 464645 gene locus_tag LOCUS_20380 463497 464645 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_20380 464699 465028 gene locus_tag LOCUS_20390 464699 465028 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265672.1 protein_id gnl|my_center|LOCUS_20390 465410 465030 gene locus_tag LOCUS_20400 465410 465030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 465516 466598 gene locus_tag LOCUS_20410 465516 466598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 467440 466661 gene locus_tag LOCUS_20420 467440 466661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 467639 467896 gene locus_tag LOCUS_20430 467639 467896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 468058 470691 gene locus_tag LOCUS_20440 468058 470691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 471305 470661 gene locus_tag LOCUS_20450 471305 470661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 472408 471305 gene locus_tag LOCUS_20460 472408 471305 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920179.1 protein_id gnl|my_center|LOCUS_20460 473318 472518 gene locus_tag LOCUS_20470 473318 472518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_20470 474481 473315 gene locus_tag LOCUS_20480 474481 473315 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920177.1 protein_id gnl|my_center|LOCUS_20480 474593 475534 gene locus_tag LOCUS_20490 474593 475534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 475596 476576 gene locus_tag LOCUS_20500 475596 476576 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088636.1 protein_id gnl|my_center|LOCUS_20500 476578 477657 gene locus_tag LOCUS_20510 476578 477657 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_20510 477672 478502 gene locus_tag LOCUS_20520 477672 478502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 479354 478482 gene locus_tag LOCUS_20530 479354 478482 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_20530 479450 481537 gene locus_tag LOCUS_20540 479450 481537 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_20540 483296 481569 gene locus_tag LOCUS_20550 483296 481569 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198536.1 protein_id gnl|my_center|LOCUS_20550 485055 483391 gene locus_tag LOCUS_20560 485055 483391 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396632.1 protein_id gnl|my_center|LOCUS_20560 485175 486059 gene locus_tag LOCUS_20570 485175 486059 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919885.1 protein_id gnl|my_center|LOCUS_20570 486998 486060 gene locus_tag LOCUS_20580 486998 486060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 488106 487069 gene locus_tag LOCUS_20590 gene thiO 488106 487069 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402118.1 protein_id gnl|my_center|LOCUS_20590 488215 488139 gene locus_tag LOCUS_t00210 488215 488139 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 488388 489395 gene locus_tag LOCUS_20600 488388 489395 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836238.1 protein_id gnl|my_center|LOCUS_20600 489657 489385 gene locus_tag LOCUS_20610 489657 489385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 490701 489892 gene locus_tag LOCUS_20620 490701 489892 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_20620 490861 491418 gene locus_tag LOCUS_20630 490861 491418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 493974 491464 gene locus_tag LOCUS_20640 493974 491464 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_20640 494992 494195 gene locus_tag LOCUS_20650 494992 494195 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_20650 495204 495770 gene locus_tag LOCUS_20660 495204 495770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 496976 495816 gene locus_tag LOCUS_20670 gene rodA 496976 495816 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_20670 498850 496976 gene locus_tag LOCUS_20680 gene mrdA 498850 496976 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919420.1 protein_id gnl|my_center|LOCUS_20680 499347 498850 gene locus_tag LOCUS_20690 499347 498850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 500579 499383 gene locus_tag LOCUS_20700 500579 499383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 501641 500607 gene locus_tag LOCUS_20710 501641 500607 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919417.1 protein_id gnl|my_center|LOCUS_20710 504090 501862 gene locus_tag LOCUS_20720 gene uvrB 504090 501862 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920818.1 protein_id gnl|my_center|LOCUS_20720 504626 504147 gene locus_tag LOCUS_20730 504626 504147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20730 504844 504629 gene locus_tag LOCUS_20740 504844 504629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 505592 504906 gene locus_tag LOCUS_20750 505592 504906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 506249 505779 gene locus_tag LOCUS_20760 506249 505779 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674933.1 protein_id gnl|my_center|LOCUS_20760 506338 507249 gene locus_tag LOCUS_20770 506338 507249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 508208 507246 gene locus_tag LOCUS_20780 gene thrB 508208 507246 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921193.1 protein_id gnl|my_center|LOCUS_20780 508259 508732 gene locus_tag LOCUS_20790 gene ruvX 508259 508732 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384481.1 protein_id gnl|my_center|LOCUS_20790 509254 508946 gene locus_tag LOCUS_20800 509254 508946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 509442 510353 gene locus_tag LOCUS_20810 509442 510353 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920301.1 protein_id gnl|my_center|LOCUS_20810 510353 511648 gene locus_tag LOCUS_20820 gene pyrC 510353 511648 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920302.1 protein_id gnl|my_center|LOCUS_20820 511660 512250 gene locus_tag LOCUS_20830 gene plsY 511660 512250 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920304.1 protein_id gnl|my_center|LOCUS_20830 512250 513338 gene locus_tag LOCUS_20840 gene dprA 512250 513338 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920305.1 protein_id gnl|my_center|LOCUS_20840 513426 516041 gene locus_tag LOCUS_20850 gene topA 513426 516041 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920309.1 protein_id gnl|my_center|LOCUS_20850 516038 518338 gene locus_tag LOCUS_20860 gene rnr 516038 518338 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920311.1 protein_id gnl|my_center|LOCUS_20860 519222 518395 gene locus_tag LOCUS_20870 gene tatC 519222 518395 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919867.1 protein_id gnl|my_center|LOCUS_20870 519631 519215 gene locus_tag LOCUS_20880 519631 519215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 519876 519652 gene locus_tag LOCUS_20890 519876 519652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 521201 520362 gene locus_tag LOCUS_20900 521201 520362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 522035 521208 gene locus_tag LOCUS_20910 522035 521208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 522867 522127 gene locus_tag LOCUS_20920 gene scpB 522867 522127 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650870.1 protein_id gnl|my_center|LOCUS_20920 523664 522864 gene locus_tag LOCUS_20930 523664 522864 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919871.1 protein_id gnl|my_center|LOCUS_20930 524717 523665 gene locus_tag LOCUS_20940 gene nagZ 524717 523665 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_20940 525565 524756 gene locus_tag LOCUS_20950 525565 524756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 526814 525627 gene locus_tag LOCUS_20960 526814 525627 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919874.1 protein_id gnl|my_center|LOCUS_20960 526927 527292 gene locus_tag LOCUS_20970 gene erpA 526927 527292 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566170.1 protein_id gnl|my_center|LOCUS_20970 527289 528074 gene locus_tag LOCUS_20980 gene xth 527289 528074 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919877.1 protein_id gnl|my_center|LOCUS_20980 528786 528055 gene locus_tag LOCUS_20990 528786 528055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 528743 528991 gene locus_tag LOCUS_21000 528743 528991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 529002 530384 gene locus_tag LOCUS_21010 gene trmFO 529002 530384 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969291.1 protein_id gnl|my_center|LOCUS_21010 530713 530381 gene locus_tag LOCUS_21020 530713 530381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 530987 531403 gene locus_tag LOCUS_21030 530987 531403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 531419 531967 gene locus_tag LOCUS_21040 531419 531967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 532189 531968 gene locus_tag LOCUS_21050 532189 531968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528523.1 protein_id gnl|my_center|LOCUS_21050 532883 532383 gene locus_tag LOCUS_21060 gene smpB 532883 532383 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919079.1 protein_id gnl|my_center|LOCUS_21060 533770 532883 gene locus_tag LOCUS_21070 gene dapA 533770 532883 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919078.1 protein_id gnl|my_center|LOCUS_21070 534007 536250 gene locus_tag LOCUS_21080 534007 536250 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640172.1 protein_id gnl|my_center|LOCUS_21080 536595 536251 gene locus_tag LOCUS_21090 536595 536251 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444506.1 protein_id gnl|my_center|LOCUS_21090 536873 538465 gene locus_tag LOCUS_21100 536873 538465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 539045 538455 gene locus_tag LOCUS_21110 539045 538455 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_21110 539902 539174 gene locus_tag LOCUS_21120 539902 539174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 540775 539906 gene locus_tag LOCUS_21130 540775 539906 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920766.1 protein_id gnl|my_center|LOCUS_21130 540866 541342 gene locus_tag LOCUS_21140 540866 541342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 541352 542029 gene locus_tag LOCUS_21150 541352 542029 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 protein_id gnl|my_center|LOCUS_21150 542239 542033 gene locus_tag LOCUS_21160 542239 542033 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532639.1 protein_id gnl|my_center|LOCUS_21160 542527 542790 gene locus_tag LOCUS_21170 542527 542790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 542860 544212 gene locus_tag LOCUS_21180 542860 544212 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920769.1 protein_id gnl|my_center|LOCUS_21180 545001 544201 gene locus_tag LOCUS_21190 gene proC 545001 544201 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140370.1 protein_id gnl|my_center|LOCUS_21190 545543 545001 gene locus_tag LOCUS_21200 545543 545001 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918381.1 protein_id gnl|my_center|LOCUS_21200 545890 545645 gene locus_tag LOCUS_21210 545890 545645 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090176.1 protein_id gnl|my_center|LOCUS_21210 546179 547027 gene locus_tag LOCUS_21220 gene lgt 546179 547027 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967285.1 protein_id gnl|my_center|LOCUS_21220 547030 548076 gene locus_tag LOCUS_21230 547030 548076 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_21230 548073 548849 gene locus_tag LOCUS_21240 gene pgeF 548073 548849 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530005.1 protein_id gnl|my_center|LOCUS_21240 548850 550109 gene locus_tag LOCUS_21250 548850 550109 CDS product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640529.1 protein_id gnl|my_center|LOCUS_21250 550197 551126 gene locus_tag LOCUS_21260 550197 551126 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918375.1 protein_id gnl|my_center|LOCUS_21260 552083 551151 gene locus_tag LOCUS_21270 552083 551151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 552220 553899 gene locus_tag LOCUS_21280 552220 553899 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970278.1 protein_id gnl|my_center|LOCUS_21280 555204 553894 gene locus_tag LOCUS_21290 gene chrA 555204 553894 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174403731.1 protein_id gnl|my_center|LOCUS_21290 555492 556088 gene locus_tag LOCUS_21300 555492 556088 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918373.1 protein_id gnl|my_center|LOCUS_21300 556157 556762 gene locus_tag LOCUS_21310 gene pth 556157 556762 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_21310 557067 558149 gene locus_tag LOCUS_21320 gene ccrM 557067 558149 CDS product adenine-specific DNA-methyltransferase CcrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918266.1 protein_id gnl|my_center|LOCUS_21320 558184 558723 gene locus_tag LOCUS_21330 558184 558723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 558765 559451 gene locus_tag LOCUS_21340 558765 559451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 559460 560155 gene locus_tag LOCUS_21350 559460 560155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 560152 563610 gene locus_tag LOCUS_21360 gene smc 560152 563610 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918261.1 protein_id gnl|my_center|LOCUS_21360 563777 564136 gene locus_tag LOCUS_21370 563777 564136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 564167 564922 gene locus_tag LOCUS_21380 564167 564922 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_21380 564950 565177 gene locus_tag LOCUS_21390 564950 565177 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 protein_id gnl|my_center|LOCUS_21390 565227 565802 gene locus_tag LOCUS_21400 565227 565802 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974652.1 protein_id gnl|my_center|LOCUS_21400 565802 566302 gene locus_tag LOCUS_21410 565802 566302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 566439 567533 gene locus_tag LOCUS_21420 566439 567533 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408504.1 protein_id gnl|my_center|LOCUS_21420 569091 567550 gene locus_tag LOCUS_21430 gene gcvPB 569091 567550 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923258.1 protein_id gnl|my_center|LOCUS_21430 570440 569091 gene locus_tag LOCUS_21440 gene gcvPA 570440 569091 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 protein_id gnl|my_center|LOCUS_21440 570813 570442 gene locus_tag LOCUS_21450 gene gcvH 570813 570442 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921183.1 protein_id gnl|my_center|LOCUS_21450 572000 570828 gene locus_tag LOCUS_21460 gene gcvT 572000 570828 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921184.1 protein_id gnl|my_center|LOCUS_21460 572672 573580 gene locus_tag LOCUS_21470 572672 573580 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923262.1 protein_id gnl|my_center|LOCUS_21470 573581 574033 gene locus_tag LOCUS_21480 573581 574033 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038003.1 protein_id gnl|my_center|LOCUS_21480 575950 574028 gene locus_tag LOCUS_21490 575950 574028 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_21490 576494 576087 gene locus_tag LOCUS_21500 gene rplQ 576494 576087 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088131.1 protein_id gnl|my_center|LOCUS_21500 577589 576546 gene locus_tag LOCUS_21510 577589 576546 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919151.1 protein_id gnl|my_center|LOCUS_21510 578030 577641 gene locus_tag LOCUS_21520 gene rpsK 578030 577641 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 protein_id gnl|my_center|LOCUS_21520 578430 578050 gene locus_tag LOCUS_21530 gene rpsM 578430 578050 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313984.1 protein_id gnl|my_center|LOCUS_21530 578810 580246 gene locus_tag LOCUS_21540 578810 580246 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262914.1 protein_id gnl|my_center|LOCUS_21540 580871 580311 gene locus_tag LOCUS_21550 580871 580311 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919148.1 protein_id gnl|my_center|LOCUS_21550 582284 580917 gene locus_tag LOCUS_21560 gene secY 582284 580917 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088135.1 protein_id gnl|my_center|LOCUS_21560 582892 582416 gene locus_tag LOCUS_21570 gene rplO 582892 582416 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563657.1 protein_id gnl|my_center|LOCUS_21570 583095 582910 gene locus_tag LOCUS_21580 gene rpmD 583095 582910 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_21580 583663 583100 gene locus_tag LOCUS_21590 gene rpsE 583663 583100 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919144.1 protein_id gnl|my_center|LOCUS_21590 584031 583675 gene locus_tag LOCUS_21600 gene rplR 584031 583675 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919143.1 protein_id gnl|my_center|LOCUS_21600 584564 584031 gene locus_tag LOCUS_21610 gene rplF 584564 584031 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 protein_id gnl|my_center|LOCUS_21610 584974 584579 gene locus_tag LOCUS_21620 gene rpsH 584974 584579 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722516.1 protein_id gnl|my_center|LOCUS_21620 585290 584985 gene locus_tag LOCUS_21630 gene rpsN 585290 584985 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919140.1 protein_id gnl|my_center|LOCUS_21630 585850 585296 gene locus_tag LOCUS_21640 gene rplE 585850 585296 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919139.1 protein_id gnl|my_center|LOCUS_21640 586160 585840 gene locus_tag LOCUS_21650 gene rplX 586160 585840 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975178.1 protein_id gnl|my_center|LOCUS_21650 586528 586160 gene locus_tag LOCUS_21660 gene rplN 586528 586160 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603030.1 protein_id gnl|my_center|LOCUS_21660 586825 586586 gene locus_tag LOCUS_21670 gene rpsQ 586825 586586 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919136.1 protein_id gnl|my_center|LOCUS_21670 587035 586835 gene locus_tag LOCUS_21680 gene rpmC 587035 586835 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536529.1 protein_id gnl|my_center|LOCUS_21680 587470 587048 gene locus_tag LOCUS_21690 gene rplP 587470 587048 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919134.1 protein_id gnl|my_center|LOCUS_21690 588258 587485 gene locus_tag LOCUS_21700 gene rpsC 588258 587485 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919133.1 protein_id gnl|my_center|LOCUS_21700 588638 588258 gene locus_tag LOCUS_21710 gene rplV 588638 588258 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538011.1 protein_id gnl|my_center|LOCUS_21710 588919 588641 gene locus_tag LOCUS_21720 gene rpsS 588919 588641 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_21720 589757 588924 gene locus_tag LOCUS_21730 gene rplB 589757 588924 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722495.1 protein_id gnl|my_center|LOCUS_21730 590066 589770 gene locus_tag LOCUS_21740 590066 589770 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_21740 590761 590069 gene locus_tag LOCUS_21750 gene rplD 590761 590069 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919128.1 protein_id gnl|my_center|LOCUS_21750 591504 590761 gene locus_tag LOCUS_21760 gene rplC 591504 590761 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919127.1 protein_id gnl|my_center|LOCUS_21760 591824 591516 gene locus_tag LOCUS_21770 gene rpsJ 591824 591516 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909272.1 protein_id gnl|my_center|LOCUS_21770 592706 593074 gene locus_tag LOCUS_21780 592706 593074 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918309.1 protein_id gnl|my_center|LOCUS_21780 593511 593071 gene locus_tag LOCUS_21790 593511 593071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence4 <1 620 gene locus_tag LOCUS_21800 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399999.1:phage terminase large subunit 946 1899 gene locus_tag LOCUS_21810 946 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 1968 3137 gene locus_tag LOCUS_21820 1968 3137 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921438.1 protein_id gnl|my_center|LOCUS_21820 3141 4514 gene locus_tag LOCUS_21830 3141 4514 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_21830 4523 5092 gene locus_tag LOCUS_21840 4523 5092 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_21840 5232 6005 gene locus_tag LOCUS_21850 5232 6005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063033.1 protein_id gnl|my_center|LOCUS_21850 6007 6762 gene locus_tag LOCUS_21860 6007 6762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918520.1 protein_id gnl|my_center|LOCUS_21860 8420 6759 gene locus_tag LOCUS_21870 8420 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 9131 8514 gene locus_tag LOCUS_21880 9131 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 10689 9193 gene locus_tag LOCUS_21890 10689 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 10789 12282 gene locus_tag LOCUS_21900 10789 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 13207 12287 gene locus_tag LOCUS_21910 13207 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 14327 13236 gene locus_tag LOCUS_21920 14327 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 16992 14404 gene locus_tag LOCUS_21930 16992 14404 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807084.1 protein_id gnl|my_center|LOCUS_21930 18145 17093 gene locus_tag LOCUS_21940 18145 17093 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_21940 20021 18147 gene locus_tag LOCUS_21950 gene asnB 20021 18147 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_21950 21394 20021 gene locus_tag LOCUS_21960 21394 20021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 22457 21402 gene locus_tag LOCUS_21970 gene wlbD 22457 21402 CDS product O-antigen biosynthesis protein WlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447875.1 protein_id gnl|my_center|LOCUS_21970 23518 22454 gene locus_tag LOCUS_21980 23518 22454 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447870.1 protein_id gnl|my_center|LOCUS_21980 24468 23518 gene locus_tag LOCUS_21990 24468 23518 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807092.1 protein_id gnl|my_center|LOCUS_21990 25417 24473 gene locus_tag LOCUS_22000 25417 24473 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807090.1 protein_id gnl|my_center|LOCUS_22000 26499 25513 gene locus_tag LOCUS_22010 26499 25513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 26654 28561 gene locus_tag LOCUS_22020 gene asnB 26654 28561 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_22020 28574 29626 gene locus_tag LOCUS_22030 gene rfbB 28574 29626 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983494.1 protein_id gnl|my_center|LOCUS_22030 29626 30168 gene locus_tag LOCUS_22040 gene rfbC 29626 30168 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974015.1 protein_id gnl|my_center|LOCUS_22040 30278 31171 gene locus_tag LOCUS_22050 gene rfbA 30278 31171 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983464.1 protein_id gnl|my_center|LOCUS_22050 32354 31188 gene locus_tag LOCUS_22060 gene ugd 32354 31188 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 protein_id gnl|my_center|LOCUS_22060 32510 33088 gene locus_tag LOCUS_22070 32510 33088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 33094 33582 gene locus_tag LOCUS_22080 33094 33582 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_22080 33585 34058 gene locus_tag LOCUS_22090 gene ybaK 33585 34058 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970785.1 protein_id gnl|my_center|LOCUS_22090 34465 34121 gene locus_tag LOCUS_22100 34465 34121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 34764 35750 gene locus_tag LOCUS_22110 gene galE 34764 35750 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982270.1 protein_id gnl|my_center|LOCUS_22110 35843 37030 gene locus_tag LOCUS_22120 35843 37030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 37069 37725 gene locus_tag LOCUS_22130 37069 37725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 37843 37767 gene locus_tag LOCUS_t00220 37843 37767 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38352 38047 gene locus_tag LOCUS_22140 38352 38047 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_22140 38515 39549 gene locus_tag LOCUS_22150 38515 39549 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_22150 40666 39554 gene locus_tag LOCUS_22160 gene pmi 40666 39554 CDS product mannose-6-phosphate isomerase Pmi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397972.1 protein_id gnl|my_center|LOCUS_22160 41871 40675 gene locus_tag LOCUS_22170 41871 40675 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_22170 42832 41936 gene locus_tag LOCUS_22180 42832 41936 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 protein_id gnl|my_center|LOCUS_22180 43829 42933 gene locus_tag LOCUS_22190 gene rfbD 43829 42933 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061654.1 protein_id gnl|my_center|LOCUS_22190 46291 43943 gene locus_tag LOCUS_22200 46291 43943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 46918 46842 gene locus_tag LOCUS_t00230 46918 46842 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 47460 47023 gene locus_tag LOCUS_22210 47460 47023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 48764 47607 gene locus_tag LOCUS_22220 48764 47607 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976258.1 protein_id gnl|my_center|LOCUS_22220 50310 48925 gene locus_tag LOCUS_22230 50310 48925 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 protein_id gnl|my_center|LOCUS_22230 50754 50380 gene locus_tag LOCUS_22240 50754 50380 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_22240 52138 50768 gene locus_tag LOCUS_22250 52138 50768 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_22250 53803 52253 gene locus_tag LOCUS_22260 53803 52253 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397083.1 protein_id gnl|my_center|LOCUS_22260 54222 54148 gene locus_tag LOCUS_t00240 54222 54148 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 56061 54298 gene locus_tag LOCUS_22270 gene recJ 56061 54298 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919262.1 protein_id gnl|my_center|LOCUS_22270 57016 56063 gene locus_tag LOCUS_22280 gene glpX 57016 56063 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919260.1 protein_id gnl|my_center|LOCUS_22280 58298 57027 gene locus_tag LOCUS_22290 58298 57027 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919259.1 protein_id gnl|my_center|LOCUS_22290 59492 58317 gene locus_tag LOCUS_22300 59492 58317 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919258.1 protein_id gnl|my_center|LOCUS_22300 60014 59574 gene locus_tag LOCUS_22310 60014 59574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 60168 62021 gene locus_tag LOCUS_22320 60168 62021 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265707.1 protein_id gnl|my_center|LOCUS_22320 64047 62131 gene locus_tag LOCUS_22330 gene dxs 64047 62131 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919929.1 protein_id gnl|my_center|LOCUS_22330 64953 64057 gene locus_tag LOCUS_22340 64953 64057 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919930.1 protein_id gnl|my_center|LOCUS_22340 65214 64957 gene locus_tag LOCUS_22350 65214 64957 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919931.1 protein_id gnl|my_center|LOCUS_22350 65971 65294 gene locus_tag LOCUS_22360 65971 65294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 66865 66098 gene locus_tag LOCUS_22370 gene mipZ 66865 66098 CDS product division plane-positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920026.1 protein_id gnl|my_center|LOCUS_22370 68003 66918 gene locus_tag LOCUS_22380 68003 66918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 68934 68038 gene locus_tag LOCUS_22390 68934 68038 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_22390 69297 68935 gene locus_tag LOCUS_22400 69297 68935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 71286 69298 gene locus_tag LOCUS_22410 71286 69298 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061468.1 protein_id gnl|my_center|LOCUS_22410 72104 71307 gene locus_tag LOCUS_22420 72104 71307 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640424.1 protein_id gnl|my_center|LOCUS_22420 73788 72181 gene locus_tag LOCUS_22430 73788 72181 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920031.1 protein_id gnl|my_center|LOCUS_22430 73924 74598 gene locus_tag LOCUS_22440 73924 74598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 74602 76314 gene locus_tag LOCUS_22450 74602 76314 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265771.1 protein_id gnl|my_center|LOCUS_22450 76382 77101 gene locus_tag LOCUS_22460 76382 77101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 77705 78388 gene locus_tag LOCUS_22470 77705 78388 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577280.1 protein_id gnl|my_center|LOCUS_22470 79144 79383 gene locus_tag LOCUS_22480 79144 79383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 80661 79492 gene locus_tag LOCUS_22490 80661 79492 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044389757.1 protein_id gnl|my_center|LOCUS_22490 81896 80781 gene locus_tag LOCUS_22500 81896 80781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 83241 82012 gene locus_tag LOCUS_22510 83241 82012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 84810 83377 gene locus_tag LOCUS_22520 gene mgtE 84810 83377 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920035.1 protein_id gnl|my_center|LOCUS_22520 85138 85054 gene locus_tag LOCUS_t00250 85138 85054 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 85487 85242 gene locus_tag LOCUS_22530 85487 85242 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920036.1 protein_id gnl|my_center|LOCUS_22530 85701 86303 gene locus_tag LOCUS_22540 85701 86303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 86303 86953 gene locus_tag LOCUS_22550 gene lipB 86303 86953 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536740.1 protein_id gnl|my_center|LOCUS_22550 86955 87449 gene locus_tag LOCUS_22560 86955 87449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 88021 87446 gene locus_tag LOCUS_22570 88021 87446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 88633 88355 gene locus_tag LOCUS_22580 88633 88355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 88762 88986 gene locus_tag LOCUS_22590 88762 88986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 88983 89834 gene locus_tag LOCUS_22600 88983 89834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 89932 89720 gene locus_tag LOCUS_22610 89932 89720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 91529 90018 gene locus_tag LOCUS_22620 gene gatB 91529 90018 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401529.1 protein_id gnl|my_center|LOCUS_22620 92995 91541 gene locus_tag LOCUS_22630 gene gatA 92995 91541 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920295.1 protein_id gnl|my_center|LOCUS_22630 93283 92996 gene locus_tag LOCUS_22640 gene gatC 93283 92996 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920296.1 protein_id gnl|my_center|LOCUS_22640 94318 93548 gene locus_tag LOCUS_22650 94318 93548 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 protein_id gnl|my_center|LOCUS_22650 94461 95183 gene locus_tag LOCUS_22660 94461 95183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 97388 95226 gene locus_tag LOCUS_22670 97388 95226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 97717 98946 gene locus_tag LOCUS_22680 97717 98946 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494218.1 protein_id gnl|my_center|LOCUS_22680 98957 99190 gene locus_tag LOCUS_22690 98957 99190 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004621989.1 protein_id gnl|my_center|LOCUS_22690 99196 99651 gene locus_tag LOCUS_22700 99196 99651 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390043.1 protein_id gnl|my_center|LOCUS_22700 100632 99655 gene locus_tag LOCUS_22710 100632 99655 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_22710 100675 101169 gene locus_tag LOCUS_22720 100675 101169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 101789 101148 gene locus_tag LOCUS_22730 101789 101148 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288827.1 protein_id gnl|my_center|LOCUS_22730 102129 101779 gene locus_tag LOCUS_22740 102129 101779 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_22740 102387 102782 gene locus_tag LOCUS_22750 102387 102782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 102925 103704 gene locus_tag LOCUS_22760 102925 103704 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223116247.1 protein_id gnl|my_center|LOCUS_22760 104116 103694 gene locus_tag LOCUS_22770 104116 103694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 108547 104357 gene locus_tag LOCUS_22780 gene rpoC 108547 104357 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918391.1 protein_id gnl|my_center|LOCUS_22780 112783 108662 gene locus_tag LOCUS_22790 gene rpoB 112783 108662 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918390.1 protein_id gnl|my_center|LOCUS_22790 113938 113054 gene locus_tag LOCUS_22800 113938 113054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 114242 113940 gene locus_tag LOCUS_22810 114242 113940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 115226 114852 gene locus_tag LOCUS_22820 gene rplL 115226 114852 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 protein_id gnl|my_center|LOCUS_22820 115793 115278 gene locus_tag LOCUS_22830 gene rplJ 115793 115278 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918384.1 protein_id gnl|my_center|LOCUS_22830 116830 116129 gene locus_tag LOCUS_22840 gene rplA 116830 116129 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328057.1 protein_id gnl|my_center|LOCUS_22840 117270 116842 gene locus_tag LOCUS_22850 gene rplK 117270 116842 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531410.1 protein_id gnl|my_center|LOCUS_22850 117930 117385 gene locus_tag LOCUS_22860 gene nusG 117930 117385 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316434.1 protein_id gnl|my_center|LOCUS_22860 118181 117945 gene locus_tag LOCUS_22870 118181 117945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 118358 118283 gene locus_tag LOCUS_t00260 118358 118283 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 118780 120984 gene locus_tag LOCUS_22880 118780 120984 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 protein_id gnl|my_center|LOCUS_22880 121247 121879 gene locus_tag LOCUS_22890 121247 121879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 121967 123058 gene locus_tag LOCUS_22900 gene aroC 121967 123058 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968904.1 protein_id gnl|my_center|LOCUS_22900 123802 123059 gene locus_tag LOCUS_22910 123802 123059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 123954 124532 gene locus_tag LOCUS_22920 123954 124532 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992466.1 protein_id gnl|my_center|LOCUS_22920 125288 124533 gene locus_tag LOCUS_22930 125288 124533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 125369 126133 gene locus_tag LOCUS_22940 125369 126133 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265952.1 protein_id gnl|my_center|LOCUS_22940 127399 126143 gene locus_tag LOCUS_22950 127399 126143 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_22950 127585 128961 gene locus_tag LOCUS_22960 127585 128961 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920159.1 protein_id gnl|my_center|LOCUS_22960 130047 129136 gene locus_tag LOCUS_22970 gene murB 130047 129136 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089340.1 protein_id gnl|my_center|LOCUS_22970 130899 130066 gene locus_tag LOCUS_22980 130899 130066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 131845 131015 gene locus_tag LOCUS_22990 131845 131015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 132579 131845 gene locus_tag LOCUS_23000 132579 131845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061933.1 protein_id gnl|my_center|LOCUS_23000 133070 132612 gene locus_tag LOCUS_23010 133070 132612 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327944.1 protein_id gnl|my_center|LOCUS_23010 133083 134993 gene locus_tag LOCUS_23020 gene uvrC 133083 134993 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338696.1 protein_id gnl|my_center|LOCUS_23020 134999 135592 gene locus_tag LOCUS_23030 gene pgsA 134999 135592 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312874.1 protein_id gnl|my_center|LOCUS_23030 135697 137052 gene locus_tag LOCUS_23040 135697 137052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 137529 137053 gene locus_tag LOCUS_23050 137529 137053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 138299 137526 gene locus_tag LOCUS_23060 138299 137526 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379796.1 protein_id gnl|my_center|LOCUS_23060 138620 140083 gene locus_tag LOCUS_23070 138620 140083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 140251 140090 gene locus_tag LOCUS_23080 140251 140090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 140458 140856 gene locus_tag LOCUS_23090 140458 140856 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639955.1 protein_id gnl|my_center|LOCUS_23090 140994 141824 gene locus_tag LOCUS_23100 140994 141824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 141848 142027 gene locus_tag LOCUS_23110 141848 142027 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314023.1 protein_id gnl|my_center|LOCUS_23110 142080 143189 gene locus_tag LOCUS_23120 142080 143189 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_23120 143191 144513 gene locus_tag LOCUS_23130 143191 144513 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 protein_id gnl|my_center|LOCUS_23130 144516 146327 gene locus_tag LOCUS_23140 144516 146327 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918279.1 protein_id gnl|my_center|LOCUS_23140 146328 147872 gene locus_tag LOCUS_23150 146328 147872 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918281.1 protein_id gnl|my_center|LOCUS_23150 149503 147869 gene locus_tag LOCUS_23160 149503 147869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 150021 149518 gene locus_tag LOCUS_23170 150021 149518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 152324 150180 gene locus_tag LOCUS_23180 152324 150180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 155159 152724 gene locus_tag LOCUS_23190 gene pleC 155159 152724 CDS product cell cycle histidine kinase PleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920340.1 protein_id gnl|my_center|LOCUS_23190 157977 155353 gene locus_tag LOCUS_23200 gene pepN 157977 155353 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920339.1 protein_id gnl|my_center|LOCUS_23200 158495 158004 gene locus_tag LOCUS_23210 158495 158004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 protein_id gnl|my_center|LOCUS_23210 160349 158553 gene locus_tag LOCUS_23220 160349 158553 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640463.1 protein_id gnl|my_center|LOCUS_23220 161085 160519 gene locus_tag LOCUS_23230 161085 160519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 161497 161102 gene locus_tag LOCUS_23240 161497 161102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 161803 161719 gene locus_tag LOCUS_t00270 161803 161719 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 161971 162534 gene locus_tag LOCUS_23250 161971 162534 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920057.1 protein_id gnl|my_center|LOCUS_23250 162534 163094 gene locus_tag LOCUS_23260 162534 163094 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640434.1 protein_id gnl|my_center|LOCUS_23260 163107 163673 gene locus_tag LOCUS_23270 163107 163673 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094926.1 protein_id gnl|my_center|LOCUS_23270 164846 163659 gene locus_tag LOCUS_23280 164846 163659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 165733 164843 gene locus_tag LOCUS_23290 gene yghX 165733 164843 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302757.1 protein_id gnl|my_center|LOCUS_23290 167752 165788 gene locus_tag LOCUS_23300 167752 165788 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640014.1 protein_id gnl|my_center|LOCUS_23300 167928 171962 gene locus_tag LOCUS_23310 167928 171962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 172115 174553 gene locus_tag LOCUS_23320 172115 174553 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973547.1 protein_id gnl|my_center|LOCUS_23320 174550 176706 gene locus_tag LOCUS_23330 gene glgB 174550 176706 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532700.1 protein_id gnl|my_center|LOCUS_23330 176731 177993 gene locus_tag LOCUS_23340 gene glgC 176731 177993 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532699.1 protein_id gnl|my_center|LOCUS_23340 177993 179441 gene locus_tag LOCUS_23350 gene glgA 177993 179441 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066957.1 protein_id gnl|my_center|LOCUS_23350 180811 179438 gene locus_tag LOCUS_23360 180811 179438 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918691.1 protein_id gnl|my_center|LOCUS_23360 183930 180808 gene locus_tag LOCUS_23370 183930 180808 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 protein_id gnl|my_center|LOCUS_23370 185100 183931 gene locus_tag LOCUS_23380 185100 183931 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918693.1 protein_id gnl|my_center|LOCUS_23380 186215 185196 gene locus_tag LOCUS_23390 186215 185196 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035376.1 protein_id gnl|my_center|LOCUS_23390 189270 186319 gene locus_tag LOCUS_23400 189270 186319 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918330.1 protein_id gnl|my_center|LOCUS_23400 190349 189531 gene locus_tag LOCUS_23410 190349 189531 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035403.1 protein_id gnl|my_center|LOCUS_23410 191104 190349 gene locus_tag LOCUS_23420 gene kduD 191104 190349 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035409.1 protein_id gnl|my_center|LOCUS_23420 191988 191122 gene locus_tag LOCUS_23430 gene kduI 191988 191122 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035408.1 protein_id gnl|my_center|LOCUS_23430 193447 191999 gene locus_tag LOCUS_23440 gene uxaC 193447 191999 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919364.1 protein_id gnl|my_center|LOCUS_23440 194725 193541 gene locus_tag LOCUS_23450 194725 193541 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919363.1 protein_id gnl|my_center|LOCUS_23450 194808 196331 gene locus_tag LOCUS_23460 194808 196331 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964015.1 protein_id gnl|my_center|LOCUS_23460 196328 197767 gene locus_tag LOCUS_23470 196328 197767 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640251.1 protein_id gnl|my_center|LOCUS_23470 197754 199118 gene locus_tag LOCUS_23480 197754 199118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 200836 199262 gene locus_tag LOCUS_23490 200836 199262 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918698.1 protein_id gnl|my_center|LOCUS_23490 202411 200837 gene locus_tag LOCUS_23500 202411 200837 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640065.1 protein_id gnl|my_center|LOCUS_23500 203330 202419 gene locus_tag LOCUS_23510 203330 202419 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035400.1 protein_id gnl|my_center|LOCUS_23510 204625 203327 gene locus_tag LOCUS_23520 204625 203327 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_23520 205710 204733 gene locus_tag LOCUS_23530 gene moaA 205710 204733 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 protein_id gnl|my_center|LOCUS_23530 206539 205766 gene locus_tag LOCUS_23540 gene fdhD 206539 205766 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083120.1 protein_id gnl|my_center|LOCUS_23540 209364 206536 gene locus_tag LOCUS_23550 gene fdhF 209364 206536 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974090.1 protein_id gnl|my_center|LOCUS_23550 210823 209357 gene locus_tag LOCUS_23560 210823 209357 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085921.1 protein_id gnl|my_center|LOCUS_23560 211245 210820 gene locus_tag LOCUS_23570 211245 210820 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721449.1 protein_id gnl|my_center|LOCUS_23570 212504 211347 gene locus_tag LOCUS_23580 212504 211347 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082423.1 protein_id gnl|my_center|LOCUS_23580 212648 213235 gene locus_tag LOCUS_23590 212648 213235 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691204.1 protein_id gnl|my_center|LOCUS_23590 213914 213273 gene locus_tag LOCUS_23600 213914 213273 CDS product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_23600 215373 214087 gene locus_tag LOCUS_23610 gene fucP 215373 214087 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_23610 216613 215402 gene locus_tag LOCUS_23620 216613 215402 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 protein_id gnl|my_center|LOCUS_23620 218947 216719 gene locus_tag LOCUS_23630 218947 216719 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918852.1 protein_id gnl|my_center|LOCUS_23630 220464 218962 gene locus_tag LOCUS_23640 220464 218962 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918856.1 protein_id gnl|my_center|LOCUS_23640 221974 220469 gene locus_tag LOCUS_23650 221974 220469 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918855.1 protein_id gnl|my_center|LOCUS_23650 225288 222169 gene locus_tag LOCUS_23660 225288 222169 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265649.1 protein_id gnl|my_center|LOCUS_23660 225613 226641 gene locus_tag LOCUS_23670 225613 226641 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918853.1 protein_id gnl|my_center|LOCUS_23670 226717 227925 gene locus_tag LOCUS_23680 226717 227925 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_23680 228359 227946 gene locus_tag LOCUS_23690 228359 227946 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 protein_id gnl|my_center|LOCUS_23690 229013 228360 gene locus_tag LOCUS_23700 gene chrR 229013 228360 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 protein_id gnl|my_center|LOCUS_23700 229624 229013 gene locus_tag LOCUS_23710 229624 229013 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_23710 229760 231133 gene locus_tag LOCUS_23720 229760 231133 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_23720 231126 231896 gene locus_tag LOCUS_23730 231126 231896 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_23730 232912 231893 gene locus_tag LOCUS_23740 232912 231893 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920455.1 protein_id gnl|my_center|LOCUS_23740 233693 232923 gene locus_tag LOCUS_23750 233693 232923 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_23750 233790 234170 gene locus_tag LOCUS_23760 233790 234170 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971980.1 protein_id gnl|my_center|LOCUS_23760 235249 234815 gene locus_tag LOCUS_23770 gene nsrR 235249 234815 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_23770 235418 235903 gene locus_tag LOCUS_23780 235418 235903 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_23780 236253 237782 gene locus_tag LOCUS_23790 gene cydA 236253 237782 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097536.1 protein_id gnl|my_center|LOCUS_23790 237799 238938 gene locus_tag LOCUS_23800 gene cydB 237799 238938 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 protein_id gnl|my_center|LOCUS_23800 239376 239762 gene locus_tag LOCUS_23810 239376 239762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389789.1 protein_id gnl|my_center|LOCUS_23810 239860 240750 gene locus_tag LOCUS_23820 239860 240750 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_23820 240768 241544 gene locus_tag LOCUS_23830 240768 241544 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_23830 241577 242899 gene locus_tag LOCUS_23840 241577 242899 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175152.1 protein_id gnl|my_center|LOCUS_23840 242903 243427 gene locus_tag LOCUS_23850 242903 243427 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531509.1 protein_id gnl|my_center|LOCUS_23850 245541 243490 gene locus_tag LOCUS_23860 245541 243490 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 protein_id gnl|my_center|LOCUS_23860 247152 245896 gene locus_tag LOCUS_23870 247152 245896 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038798.1 protein_id gnl|my_center|LOCUS_23870 248566 247145 gene locus_tag LOCUS_23880 248566 247145 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919393.1 protein_id gnl|my_center|LOCUS_23880 249260 248559 gene locus_tag LOCUS_23890 249260 248559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919392.1 protein_id gnl|my_center|LOCUS_23890 249369 251441 gene locus_tag LOCUS_23900 249369 251441 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919391.1 protein_id gnl|my_center|LOCUS_23900 251574 252815 gene locus_tag LOCUS_23910 251574 252815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23910 252800 253687 gene locus_tag LOCUS_23920 252800 253687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23920 253687 254175 gene locus_tag LOCUS_23930 253687 254175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 255401 255000 gene locus_tag LOCUS_23940 gene cadR 255401 255000 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_23940 255474 257432 gene locus_tag LOCUS_23950 255474 257432 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_23950 257528 257821 gene locus_tag LOCUS_23960 257528 257821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 257867 259117 gene locus_tag LOCUS_23970 257867 259117 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920246.1 protein_id gnl|my_center|LOCUS_23970 259107 260300 gene locus_tag LOCUS_23980 259107 260300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 260313 263507 gene locus_tag LOCUS_23990 260313 263507 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007003880.1 protein_id gnl|my_center|LOCUS_23990 264172 265134 gene locus_tag LOCUS_24000 gene trbB 264172 265134 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 protein_id gnl|my_center|LOCUS_24000 265163 265501 gene locus_tag LOCUS_24010 265163 265501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 265504 265785 gene locus_tag LOCUS_24020 265504 265785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 265825 268299 gene locus_tag LOCUS_24030 265825 268299 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028755117.1 protein_id gnl|my_center|LOCUS_24030 268296 269048 gene locus_tag LOCUS_24040 268296 269048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 269048 270373 gene locus_tag LOCUS_24050 gene trbL 269048 270373 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815842.1 protein_id gnl|my_center|LOCUS_24050 270470 271174 gene locus_tag LOCUS_24060 270470 271174 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_24060 271184 272263 gene locus_tag LOCUS_24070 271184 272263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 272266 272718 gene locus_tag LOCUS_24080 272266 272718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 272715 274016 gene locus_tag LOCUS_24090 gene trbI 272715 274016 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970264.1 protein_id gnl|my_center|LOCUS_24090 275133 274543 gene locus_tag LOCUS_24100 275133 274543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 277085 275136 gene locus_tag LOCUS_24110 277085 275136 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 protein_id gnl|my_center|LOCUS_24110 278879 277170 gene locus_tag LOCUS_24120 278879 277170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 279037 278876 gene locus_tag LOCUS_24130 279037 278876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 279527 279826 gene locus_tag LOCUS_24140 279527 279826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 279841 281001 gene locus_tag LOCUS_24150 279841 281001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 281124 282722 gene locus_tag LOCUS_24160 281124 282722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 283142 283849 gene locus_tag LOCUS_24170 283142 283849 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 protein_id gnl|my_center|LOCUS_24170 283842 284762 gene locus_tag LOCUS_24180 283842 284762 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_24180 285338 284841 gene locus_tag LOCUS_24190 285338 284841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 285580 285389 gene locus_tag LOCUS_24200 285580 285389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 286909 286049 gene locus_tag LOCUS_24210 286909 286049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 288339 288037 gene locus_tag LOCUS_24220 288339 288037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 289127 288813 gene locus_tag LOCUS_24230 289127 288813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 290094 289171 gene locus_tag LOCUS_24240 290094 289171 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394832.1 protein_id gnl|my_center|LOCUS_24240 292360 290426 gene locus_tag LOCUS_24250 292360 290426 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036780.1 protein_id gnl|my_center|LOCUS_24250 292860 292357 gene locus_tag LOCUS_24260 292860 292357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 294040 292853 gene locus_tag LOCUS_24270 294040 292853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204895.1 protein_id gnl|my_center|LOCUS_24270 294665 294291 gene locus_tag LOCUS_24280 294665 294291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 295058 295234 gene locus_tag LOCUS_24290 295058 295234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 296586 295264 gene locus_tag LOCUS_24300 296586 295264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 298274 297129 gene locus_tag LOCUS_24310 298274 297129 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_24310 298417 298554 gene locus_tag LOCUS_24320 298417 298554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 298685 299059 gene locus_tag LOCUS_24330 298685 299059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 299246 300211 gene locus_tag LOCUS_24340 gene trbB 299246 300211 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 protein_id gnl|my_center|LOCUS_24340 300221 300556 gene locus_tag LOCUS_24350 300221 300556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 300565 300849 gene locus_tag LOCUS_24360 300565 300849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 300859 303336 gene locus_tag LOCUS_24370 300859 303336 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028755117.1 protein_id gnl|my_center|LOCUS_24370 303320 304057 gene locus_tag LOCUS_24380 303320 304057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 304059 305393 gene locus_tag LOCUS_24390 gene trbL 304059 305393 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815842.1 protein_id gnl|my_center|LOCUS_24390 305431 306135 gene locus_tag LOCUS_24400 305431 306135 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_24400 306501 306313 gene locus_tag LOCUS_24410 306501 306313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 306500 307219 gene locus_tag LOCUS_24420 gene trbG 306500 307219 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 protein_id gnl|my_center|LOCUS_24420 307223 307672 gene locus_tag LOCUS_24430 307223 307672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 307669 308970 gene locus_tag LOCUS_24440 gene trbI 307669 308970 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086083981.1 protein_id gnl|my_center|LOCUS_24440 309328 309519 gene locus_tag LOCUS_24450 309328 309519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 310557 309643 gene locus_tag LOCUS_24460 gene copD 310557 309643 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170439.1 protein_id gnl|my_center|LOCUS_24460 311664 310954 gene locus_tag LOCUS_24470 311664 310954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 313336 311654 gene locus_tag LOCUS_24480 313336 311654 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265648.1 protein_id gnl|my_center|LOCUS_24480 313767 313447 gene locus_tag LOCUS_24490 313767 313447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 314232 313885 gene locus_tag LOCUS_24500 314232 313885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 315335 315102 gene locus_tag LOCUS_24510 315335 315102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 317578 315383 gene locus_tag LOCUS_24520 317578 315383 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_24520 317859 317587 gene locus_tag LOCUS_24530 317859 317587 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015870.1 protein_id gnl|my_center|LOCUS_24530 318390 318680 gene locus_tag LOCUS_24540 318390 318680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24540 318841 319173 gene locus_tag LOCUS_24550 318841 319173 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219685598.1 protein_id gnl|my_center|LOCUS_24550 319860 319258 gene locus_tag LOCUS_24560 319860 319258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 321521 319860 gene locus_tag LOCUS_24570 321521 319860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 323650 321746 gene locus_tag LOCUS_24580 323650 321746 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938884.1 protein_id gnl|my_center|LOCUS_24580 324093 323755 gene locus_tag LOCUS_24590 gene traJ 324093 323755 CDS product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039733.1 protein_id gnl|my_center|LOCUS_24590 324464 324763 gene locus_tag LOCUS_24600 324464 324763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 324778 325944 gene locus_tag LOCUS_24610 324778 325944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 326942 325995 gene locus_tag LOCUS_24620 326942 325995 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_24620 327528 326935 gene locus_tag LOCUS_24630 327528 326935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 327666 328097 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgtggtttccctaccgatcttcctgtggtaggct 328484 328155 gene locus_tag LOCUS_24640 gene cas2 328484 328155 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_24640 329412 328501 gene locus_tag LOCUS_24650 gene cas1 329412 328501 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_24650 332855 329625 gene locus_tag LOCUS_24660 gene cas9 332855 329625 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_24660 333605 333108 gene locus_tag LOCUS_24670 333605 333108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 333845 333654 gene locus_tag LOCUS_24680 333845 333654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 334459 335496 gene locus_tag LOCUS_24690 334459 335496 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269088.1 protein_id gnl|my_center|LOCUS_24690 335742 335539 gene locus_tag LOCUS_24700 335742 335539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 336695 336381 gene locus_tag LOCUS_24710 336695 336381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 337140 336766 gene locus_tag LOCUS_24720 337140 336766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 337270 337479 gene locus_tag LOCUS_24730 337270 337479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 339058 337784 gene locus_tag LOCUS_24740 339058 337784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 339303 339227 gene locus_tag LOCUS_t00280 339303 339227 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence5 988 563 gene locus_tag LOCUS_24750 988 563 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 protein_id gnl|my_center|LOCUS_24750 1840 1064 gene locus_tag LOCUS_24760 1840 1064 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920480.1 protein_id gnl|my_center|LOCUS_24760 2204 2779 gene locus_tag LOCUS_24770 2204 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2779 3792 gene locus_tag LOCUS_24780 gene hfaB 2779 3792 CDS product holdfast anchoring protein HfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920482.1 protein_id gnl|my_center|LOCUS_24780 3866 5248 gene locus_tag LOCUS_24790 3866 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 5595 6848 gene locus_tag LOCUS_24800 gene hfaD 5595 6848 CDS product holdfast anchor protein HfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640542.1 protein_id gnl|my_center|LOCUS_24800 8264 6942 gene locus_tag LOCUS_24810 gene rimO 8264 6942 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531645.1 protein_id gnl|my_center|LOCUS_24810 8380 8934 gene locus_tag LOCUS_24820 8380 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 8968 9528 gene locus_tag LOCUS_24830 8968 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 9546 10169 gene locus_tag LOCUS_24840 9546 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 10178 11254 gene locus_tag LOCUS_24850 10178 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 11261 11854 gene locus_tag LOCUS_24860 11261 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 12667 11861 gene locus_tag LOCUS_24870 12667 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 12811 14016 gene locus_tag LOCUS_24880 12811 14016 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919408.1 protein_id gnl|my_center|LOCUS_24880 14281 14102 gene locus_tag LOCUS_24890 14281 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 14205 14705 gene locus_tag LOCUS_24900 14205 14705 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532366.1 protein_id gnl|my_center|LOCUS_24900 16758 14845 gene locus_tag LOCUS_24910 16758 14845 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_24910 18747 17032 gene locus_tag LOCUS_24920 gene metG 18747 17032 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919354.1 protein_id gnl|my_center|LOCUS_24920 19379 18771 gene locus_tag LOCUS_24930 19379 18771 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 protein_id gnl|my_center|LOCUS_24930 19414 19489 gene locus_tag LOCUS_t00290 19414 19489 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21227 19650 gene locus_tag LOCUS_24940 gene serA 21227 19650 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921048.1 protein_id gnl|my_center|LOCUS_24940 22569 21373 gene locus_tag LOCUS_24950 22569 21373 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 protein_id gnl|my_center|LOCUS_24950 23401 22790 gene locus_tag LOCUS_24960 23401 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 23813 23475 gene locus_tag LOCUS_24970 23813 23475 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392551.1 protein_id gnl|my_center|LOCUS_24970 24322 23948 gene locus_tag LOCUS_24980 24322 23948 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_24980 24436 24843 gene locus_tag LOCUS_24990 24436 24843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 25444 24824 gene locus_tag LOCUS_25000 25444 24824 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265992.1 protein_id gnl|my_center|LOCUS_25000 25526 26266 gene locus_tag LOCUS_25010 25526 26266 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_25010 26916 26263 gene locus_tag LOCUS_25020 26916 26263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 27759 26986 gene locus_tag LOCUS_25030 27759 26986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 28278 27853 gene locus_tag LOCUS_25040 28278 27853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035594.1 protein_id gnl|my_center|LOCUS_25040 28645 28271 gene locus_tag LOCUS_25050 28645 28271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 28719 29279 gene locus_tag LOCUS_25060 28719 29279 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312084.1 protein_id gnl|my_center|LOCUS_25060 31088 29286 gene locus_tag LOCUS_25070 31088 29286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532689.1 protein_id gnl|my_center|LOCUS_25070 32998 31175 gene locus_tag LOCUS_25080 32998 31175 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640139.1 protein_id gnl|my_center|LOCUS_25080 35064 33127 gene locus_tag LOCUS_25090 gene acs 35064 33127 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 protein_id gnl|my_center|LOCUS_25090 35227 35973 gene locus_tag LOCUS_25100 35227 35973 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_25100 37358 35985 gene locus_tag LOCUS_25110 37358 35985 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268984.1 protein_id gnl|my_center|LOCUS_25110 37912 37364 gene locus_tag LOCUS_25120 37912 37364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 38759 37971 gene locus_tag LOCUS_25130 38759 37971 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061718.1 protein_id gnl|my_center|LOCUS_25130 40550 38793 gene locus_tag LOCUS_25140 gene mnmD 40550 38793 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265612.1 protein_id gnl|my_center|LOCUS_25140 40898 40638 gene locus_tag LOCUS_25150 40898 40638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 42257 41391 gene locus_tag LOCUS_25160 gene motA 42257 41391 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_25160 43513 42368 gene locus_tag LOCUS_25170 gene argE 43513 42368 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_25170 44122 43514 gene locus_tag LOCUS_25180 44122 43514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 45351 44137 gene locus_tag LOCUS_25190 45351 44137 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921462.1 protein_id gnl|my_center|LOCUS_25190 45589 45894 gene locus_tag LOCUS_25200 45589 45894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 47110 45908 gene locus_tag LOCUS_25210 47110 45908 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205497.1 protein_id gnl|my_center|LOCUS_25210 47974 47120 gene locus_tag LOCUS_25220 47974 47120 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968826.1 protein_id gnl|my_center|LOCUS_25220 49262 48027 gene locus_tag LOCUS_25230 49262 48027 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 protein_id gnl|my_center|LOCUS_25230 49551 49366 gene locus_tag LOCUS_25240 49551 49366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 50441 49560 gene locus_tag LOCUS_25250 50441 49560 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_25250 50592 53513 gene locus_tag LOCUS_25260 gene ileS 50592 53513 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918587.1 protein_id gnl|my_center|LOCUS_25260 53510 54235 gene locus_tag LOCUS_25270 53510 54235 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_25270 54236 54421 gene locus_tag LOCUS_25280 54236 54421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 54425 54943 gene locus_tag LOCUS_25290 54425 54943 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921501.1 protein_id gnl|my_center|LOCUS_25290 54975 55214 gene locus_tag LOCUS_25300 54975 55214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 55278 55715 gene locus_tag LOCUS_25310 55278 55715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 55902 55991 gene locus_tag LOCUS_t00300 55902 55991 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56675 56100 gene locus_tag LOCUS_25320 56675 56100 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169574787.1 protein_id gnl|my_center|LOCUS_25320 59862 56710 gene locus_tag LOCUS_25330 59862 56710 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067229.1 protein_id gnl|my_center|LOCUS_25330 61448 59868 gene locus_tag LOCUS_25340 61448 59868 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393812.1 protein_id gnl|my_center|LOCUS_25340 62181 61366 gene locus_tag LOCUS_25350 62181 61366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 62532 66320 gene locus_tag LOCUS_25360 62532 66320 CDS product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399367.1 protein_id gnl|my_center|LOCUS_25360 66674 66429 gene locus_tag LOCUS_25370 66674 66429 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 protein_id gnl|my_center|LOCUS_25370 66834 67460 gene locus_tag LOCUS_25380 66834 67460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 67463 67987 gene locus_tag LOCUS_25390 67463 67987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 68609 68046 gene locus_tag LOCUS_25400 68609 68046 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_25400 70872 68839 gene locus_tag LOCUS_25410 70872 68839 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679307.1 protein_id gnl|my_center|LOCUS_25410 72801 70876 gene locus_tag LOCUS_25420 72801 70876 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679308.1 protein_id gnl|my_center|LOCUS_25420 74104 73424 gene locus_tag LOCUS_25430 74104 73424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 74562 74323 gene locus_tag LOCUS_25440 74562 74323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 75853 74654 gene locus_tag LOCUS_25450 75853 74654 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_25450 76277 76675 gene locus_tag LOCUS_25460 76277 76675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 76687 77511 gene locus_tag LOCUS_25470 76687 77511 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092499.1 protein_id gnl|my_center|LOCUS_25470 81601 77558 gene locus_tag LOCUS_25480 81601 77558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 81751 82059 gene locus_tag LOCUS_25490 81751 82059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 82077 82637 gene locus_tag LOCUS_25500 gene dps 82077 82637 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_25500 82637 83227 gene locus_tag LOCUS_25510 82637 83227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 83306 83872 gene locus_tag LOCUS_25520 83306 83872 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931004.1 protein_id gnl|my_center|LOCUS_25520 83939 84976 gene locus_tag LOCUS_25530 83939 84976 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200942.1 protein_id gnl|my_center|LOCUS_25530 85623 85039 gene locus_tag LOCUS_25540 85623 85039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 87023 85722 gene locus_tag LOCUS_25550 87023 85722 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087901.1 protein_id gnl|my_center|LOCUS_25550 89247 86974 gene locus_tag LOCUS_25560 89247 86974 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087902.1 protein_id gnl|my_center|LOCUS_25560 89547 89275 gene locus_tag LOCUS_25570 89547 89275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 89689 90729 gene locus_tag LOCUS_25580 89689 90729 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_25580 91834 90833 gene locus_tag LOCUS_25590 91834 90833 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110374.1 protein_id gnl|my_center|LOCUS_25590 91910 92386 gene locus_tag LOCUS_25600 gene tadA 91910 92386 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918120.1 protein_id gnl|my_center|LOCUS_25600 92477 93058 gene locus_tag LOCUS_25610 92477 93058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 93708 93196 gene locus_tag LOCUS_25620 93708 93196 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_25620 94683 93718 gene locus_tag LOCUS_25630 gene corA 94683 93718 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626268.1 protein_id gnl|my_center|LOCUS_25630 95963 94686 gene locus_tag LOCUS_25640 gene purD 95963 94686 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918186.1 protein_id gnl|my_center|LOCUS_25640 96686 96285 gene locus_tag LOCUS_25650 gene mutT 96686 96285 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385432.1 protein_id gnl|my_center|LOCUS_25650 97912 96686 gene locus_tag LOCUS_25660 gene argJ 97912 96686 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_25660 98161 100920 gene locus_tag LOCUS_25670 gene secA 98161 100920 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920904.1 protein_id gnl|my_center|LOCUS_25670 101048 101260 gene locus_tag LOCUS_25680 101048 101260 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 protein_id gnl|my_center|LOCUS_25680 101409 102086 gene locus_tag LOCUS_25690 gene tolQ 101409 102086 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921066.1 protein_id gnl|my_center|LOCUS_25690 102086 102511 gene locus_tag LOCUS_25700 gene tolR 102086 102511 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066848.1 protein_id gnl|my_center|LOCUS_25700 102508 103449 gene locus_tag LOCUS_25710 102508 103449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 103539 104828 gene locus_tag LOCUS_25720 gene tolB 103539 104828 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640704.1 protein_id gnl|my_center|LOCUS_25720 104838 105428 gene locus_tag LOCUS_25730 gene pal 104838 105428 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921062.1 protein_id gnl|my_center|LOCUS_25730 105442 106404 gene locus_tag LOCUS_25740 105442 106404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 106465 107544 gene locus_tag LOCUS_25750 106465 107544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 107658 109553 gene locus_tag LOCUS_25760 gene ftsH 107658 109553 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066842.1 protein_id gnl|my_center|LOCUS_25760 109556 110368 gene locus_tag LOCUS_25770 gene folP 109556 110368 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_25770 110370 111179 gene locus_tag LOCUS_25780 gene thiD 110370 111179 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_25780 111641 111219 gene locus_tag LOCUS_25790 111641 111219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035743039.1 protein_id gnl|my_center|LOCUS_25790 111782 112351 gene locus_tag LOCUS_25800 111782 112351 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921055.1 protein_id gnl|my_center|LOCUS_25800 112431 113087 gene locus_tag LOCUS_25810 gene purQ 112431 113087 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920354.1 protein_id gnl|my_center|LOCUS_25810 113084 113524 gene locus_tag LOCUS_25820 113084 113524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 113524 115725 gene locus_tag LOCUS_25830 gene purL 113524 115725 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920357.1 protein_id gnl|my_center|LOCUS_25830 115731 116504 gene locus_tag LOCUS_25840 115731 116504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 116714 116514 gene locus_tag LOCUS_25850 116714 116514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 116938 116699 gene locus_tag LOCUS_25860 116938 116699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 117256 116939 gene locus_tag LOCUS_25870 117256 116939 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_25870 117540 118286 gene locus_tag LOCUS_25880 117540 118286 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008974302.1 protein_id gnl|my_center|LOCUS_25880 118300 118542 gene locus_tag LOCUS_25890 gene purS 118300 118542 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_25890 118623 120503 gene locus_tag LOCUS_25900 118623 120503 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395394.1 protein_id gnl|my_center|LOCUS_25900 123583 120518 gene locus_tag LOCUS_25910 123583 120518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 126344 123681 gene locus_tag LOCUS_25920 126344 123681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 129153 126505 gene locus_tag LOCUS_25930 gene mutS 129153 126505 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917902.1 protein_id gnl|my_center|LOCUS_25930 129380 131134 gene locus_tag LOCUS_25940 129380 131134 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918156.1 protein_id gnl|my_center|LOCUS_25940 131292 131618 gene locus_tag LOCUS_25950 131292 131618 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158176.1 protein_id gnl|my_center|LOCUS_25950 133981 131813 gene locus_tag LOCUS_25960 gene pnp 133981 131813 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917924.1 protein_id gnl|my_center|LOCUS_25960 134585 134316 gene locus_tag LOCUS_25970 gene rpsO 134585 134316 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_25970 135554 134604 gene locus_tag LOCUS_25980 gene truB 135554 134604 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917926.1 protein_id gnl|my_center|LOCUS_25980 135991 135557 gene locus_tag LOCUS_25990 gene rbfA 135991 135557 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917927.1 protein_id gnl|my_center|LOCUS_25990 138754 136160 gene locus_tag LOCUS_26000 138754 136160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 139577 138960 gene locus_tag LOCUS_26010 139577 138960 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917933.1 protein_id gnl|my_center|LOCUS_26010 141156 139564 gene locus_tag LOCUS_26020 gene nusA 141156 139564 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917934.1 protein_id gnl|my_center|LOCUS_26020 141766 141158 gene locus_tag LOCUS_26030 gene rimP 141766 141158 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639861.1 protein_id gnl|my_center|LOCUS_26030 142709 141966 gene locus_tag LOCUS_26040 142709 141966 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921365.1 protein_id gnl|my_center|LOCUS_26040 143796 142702 gene locus_tag LOCUS_26050 143796 142702 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 protein_id gnl|my_center|LOCUS_26050 144265 143783 gene locus_tag LOCUS_26060 gene tsaE 144265 143783 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 protein_id gnl|my_center|LOCUS_26060 144382 145773 gene locus_tag LOCUS_26070 gene ahcY 144382 145773 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918146.1 protein_id gnl|my_center|LOCUS_26070 146059 148341 gene locus_tag LOCUS_26080 gene divL 146059 148341 CDS product cell cycle protein kinase DivL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921313.1 protein_id gnl|my_center|LOCUS_26080 148389 148748 gene locus_tag LOCUS_26090 148389 148748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 148811 149254 gene locus_tag LOCUS_26100 148811 149254 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_26100 149712 149392 gene locus_tag LOCUS_26110 149712 149392 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_26110 150980 149742 gene locus_tag LOCUS_26120 150980 149742 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_26120 151337 152527 gene locus_tag LOCUS_26130 151337 152527 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_26130 152543 153583 gene locus_tag LOCUS_26140 152543 153583 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639944.1 protein_id gnl|my_center|LOCUS_26140 154281 153622 gene locus_tag LOCUS_26150 154281 153622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 155192 154530 gene locus_tag LOCUS_26160 155192 154530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 155696 155205 gene locus_tag LOCUS_26170 155696 155205 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920194.1 protein_id gnl|my_center|LOCUS_26170 156230 155757 gene locus_tag LOCUS_26180 156230 155757 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920194.1 protein_id gnl|my_center|LOCUS_26180 157104 156262 gene locus_tag LOCUS_26190 157104 156262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 158413 157556 gene locus_tag LOCUS_26200 gene aguB 158413 157556 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 protein_id gnl|my_center|LOCUS_26200 159437 158424 gene locus_tag LOCUS_26210 159437 158424 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639908.1 protein_id gnl|my_center|LOCUS_26210 160370 159492 gene locus_tag LOCUS_26220 160370 159492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 162050 160458 gene locus_tag LOCUS_26230 162050 160458 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771483.1 protein_id gnl|my_center|LOCUS_26230 162728 162060 gene locus_tag LOCUS_26240 162728 162060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 165354 162844 gene locus_tag LOCUS_26250 165354 162844 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265514.1 protein_id gnl|my_center|LOCUS_26250 165337 165519 gene locus_tag LOCUS_26260 165337 165519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 169187 165645 gene locus_tag LOCUS_26270 169187 165645 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640052.1 protein_id gnl|my_center|LOCUS_26270 169913 169371 gene locus_tag LOCUS_26280 169913 169371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 171774 170236 gene locus_tag LOCUS_26290 gene ahpF 171774 170236 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599501.1 protein_id gnl|my_center|LOCUS_26290 172495 171929 gene locus_tag LOCUS_26300 gene ahpC 172495 171929 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705621.1 protein_id gnl|my_center|LOCUS_26300 172619 173524 gene locus_tag LOCUS_26310 172619 173524 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 protein_id gnl|my_center|LOCUS_26310 174292 173513 gene locus_tag LOCUS_26320 174292 173513 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 protein_id gnl|my_center|LOCUS_26320 174366 175199 gene locus_tag LOCUS_26330 174366 175199 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_26330 175196 175918 gene locus_tag LOCUS_26340 gene phoN2 175196 175918 CDS product PAP2 family phosphatase PhoN2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850660.1 protein_id gnl|my_center|LOCUS_26340 175997 176701 gene locus_tag LOCUS_26350 175997 176701 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918126.1 protein_id gnl|my_center|LOCUS_26350 176701 178290 gene locus_tag LOCUS_26360 176701 178290 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918127.1 protein_id gnl|my_center|LOCUS_26360 178987 178283 gene locus_tag LOCUS_26370 178987 178283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 179455 179000 gene locus_tag LOCUS_26380 179455 179000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 180169 180474 gene locus_tag LOCUS_26390 180169 180474 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 protein_id gnl|my_center|LOCUS_26390 181655 180618 gene locus_tag LOCUS_26400 181655 180618 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265781.1 protein_id gnl|my_center|LOCUS_26400 181716 182915 gene locus_tag LOCUS_26410 181716 182915 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241461.1 protein_id gnl|my_center|LOCUS_26410 183019 183855 gene locus_tag LOCUS_26420 183019 183855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 184278 183844 gene locus_tag LOCUS_26430 184278 183844 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 protein_id gnl|my_center|LOCUS_26430 184753 184280 gene locus_tag LOCUS_26440 184753 184280 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530198.1 protein_id gnl|my_center|LOCUS_26440 186046 184754 gene locus_tag LOCUS_26450 gene hisD 186046 184754 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970966.1 protein_id gnl|my_center|LOCUS_26450 186475 186047 gene locus_tag LOCUS_26460 186475 186047 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265795.1 protein_id gnl|my_center|LOCUS_26460 187747 186476 gene locus_tag LOCUS_26470 gene murA 187747 186476 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920208.1 protein_id gnl|my_center|LOCUS_26470 187948 187820 gene locus_tag LOCUS_26480 187948 187820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 188880 188023 gene locus_tag LOCUS_26490 188880 188023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 190103 189219 gene locus_tag LOCUS_26500 190103 189219 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110418.1 protein_id gnl|my_center|LOCUS_26500 191395 190115 gene locus_tag LOCUS_26510 191395 190115 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_26510 192247 191510 gene locus_tag LOCUS_26520 192247 191510 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639963.1 protein_id gnl|my_center|LOCUS_26520 192697 192831 gene locus_tag LOCUS_26530 192697 192831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 192803 192982 gene locus_tag LOCUS_26540 192803 192982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 192997 193695 gene locus_tag LOCUS_26550 192997 193695 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267339.1 protein_id gnl|my_center|LOCUS_26550 193703 194041 gene locus_tag LOCUS_26560 193703 194041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26560 194120 194476 gene locus_tag LOCUS_26570 194120 194476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26570 194574 194648 gene locus_tag LOCUS_t00310 194574 194648 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 194867 195481 gene locus_tag LOCUS_26580 194867 195481 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_26580 195697 197607 gene locus_tag LOCUS_26590 195697 197607 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639885.1 protein_id gnl|my_center|LOCUS_26590 197617 199092 gene locus_tag LOCUS_26600 197617 199092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 199085 199774 gene locus_tag LOCUS_26610 199085 199774 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_26610 200293 199817 gene locus_tag LOCUS_26620 200293 199817 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919963.1 protein_id gnl|my_center|LOCUS_26620 201016 200525 gene locus_tag LOCUS_26630 201016 200525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 201106 201480 gene locus_tag LOCUS_26640 201106 201480 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070495.1 protein_id gnl|my_center|LOCUS_26640 201461 201841 gene locus_tag LOCUS_26650 201461 201841 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463606.1 protein_id gnl|my_center|LOCUS_26650 202524 201838 gene locus_tag LOCUS_26660 202524 201838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 203150 203473 gene locus_tag LOCUS_26670 203150 203473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 203482 203970 gene locus_tag LOCUS_26680 203482 203970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 203980 205011 gene locus_tag LOCUS_26690 gene arsB 203980 205011 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_26690 205032 205850 gene locus_tag LOCUS_26700 205032 205850 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919985.1 protein_id gnl|my_center|LOCUS_26700 205869 206846 gene locus_tag LOCUS_26710 205869 206846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 206908 207363 gene locus_tag LOCUS_26720 206908 207363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 207397 208167 gene locus_tag LOCUS_26730 207397 208167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 208175 208510 gene locus_tag LOCUS_26740 208175 208510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 210493 208511 gene locus_tag LOCUS_26750 210493 208511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 210583 212019 gene locus_tag LOCUS_26760 gene glpK 210583 212019 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136815.1 protein_id gnl|my_center|LOCUS_26760 212028 212792 gene locus_tag LOCUS_26770 212028 212792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 213362 212793 gene locus_tag LOCUS_26780 213362 212793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 214770 213343 gene locus_tag LOCUS_26790 214770 213343 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946399.1 protein_id gnl|my_center|LOCUS_26790 215879 214767 gene locus_tag LOCUS_26800 215879 214767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946398.1 protein_id gnl|my_center|LOCUS_26800 217024 215879 gene locus_tag LOCUS_26810 217024 215879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061626.1 protein_id gnl|my_center|LOCUS_26810 218781 217021 gene locus_tag LOCUS_26820 218781 217021 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 protein_id gnl|my_center|LOCUS_26820 219770 218781 gene locus_tag LOCUS_26830 gene hlyD 219770 218781 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061628.1 protein_id gnl|my_center|LOCUS_26830 220452 219763 gene locus_tag LOCUS_26840 220452 219763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 221046 220510 gene locus_tag LOCUS_26850 221046 220510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 221190 222212 gene locus_tag LOCUS_26860 221190 222212 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262467.1 protein_id gnl|my_center|LOCUS_26860 222673 222209 gene locus_tag LOCUS_26870 222673 222209 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083642.1 protein_id gnl|my_center|LOCUS_26870 222727 223026 gene locus_tag LOCUS_26880 222727 223026 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253939.1 protein_id gnl|my_center|LOCUS_26880 224282 223023 gene locus_tag LOCUS_26890 224282 223023 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971719.1 protein_id gnl|my_center|LOCUS_26890 224457 225713 gene locus_tag LOCUS_26900 224457 225713 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730071.1 protein_id gnl|my_center|LOCUS_26900 226105 226488 gene locus_tag LOCUS_26910 226105 226488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 226485 227774 gene locus_tag LOCUS_26920 226485 227774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 228639 227782 gene locus_tag LOCUS_26930 228639 227782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 229591 228722 gene locus_tag LOCUS_26940 229591 228722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 230854 229592 gene locus_tag LOCUS_26950 230854 229592 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071664104.1 protein_id gnl|my_center|LOCUS_26950 231069 230854 gene locus_tag LOCUS_26960 231069 230854 CDS product type II toxin-antitoxin system Y4mF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875278.1 protein_id gnl|my_center|LOCUS_26960 231309 232451 gene locus_tag LOCUS_26970 231309 232451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 233027 232491 gene locus_tag LOCUS_26980 233027 232491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 233383 236979 gene locus_tag LOCUS_26990 233383 236979 CDS product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399367.1 protein_id gnl|my_center|LOCUS_26990 237948 237031 gene locus_tag LOCUS_27000 237948 237031 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394832.1 protein_id gnl|my_center|LOCUS_27000 241113 238180 gene locus_tag LOCUS_27010 241113 238180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 241926 241114 gene locus_tag LOCUS_27020 241926 241114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 242658 241942 gene locus_tag LOCUS_27030 242658 241942 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_27030 245708 242658 gene locus_tag LOCUS_27040 245708 242658 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_27040 246649 245714 gene locus_tag LOCUS_27050 246649 245714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 247860 246646 gene locus_tag LOCUS_27060 247860 246646 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058063.1 protein_id gnl|my_center|LOCUS_27060 250274 247854 gene locus_tag LOCUS_27070 250274 247854 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_27070 251668 251030 gene locus_tag LOCUS_27080 251668 251030 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904930.1 protein_id gnl|my_center|LOCUS_27080 251840 252616 gene locus_tag LOCUS_27090 251840 252616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 252647 253132 gene locus_tag LOCUS_27100 252647 253132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 253950 253129 gene locus_tag LOCUS_27110 253950 253129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 254077 254661 gene locus_tag LOCUS_27120 254077 254661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 254832 255896 gene locus_tag LOCUS_27130 254832 255896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 255893 256633 gene locus_tag LOCUS_27140 255893 256633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 256973 257497 gene locus_tag LOCUS_27150 256973 257497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 257911 257540 gene locus_tag LOCUS_27160 257911 257540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 258348 258953 gene locus_tag LOCUS_27170 258348 258953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 259318 259485 gene locus_tag LOCUS_27180 259318 259485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 259701 259516 gene locus_tag LOCUS_27190 259701 259516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 261483 260050 gene locus_tag LOCUS_27200 261483 260050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096324.1 protein_id gnl|my_center|LOCUS_27200 261805 261500 gene locus_tag LOCUS_27210 261805 261500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 261967 262152 gene locus_tag LOCUS_27220 261967 262152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 262420 262608 gene locus_tag LOCUS_27230 262420 262608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 262673 263482 gene locus_tag LOCUS_27240 262673 263482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 263485 265044 gene locus_tag LOCUS_27250 263485 265044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 265041 265421 gene locus_tag LOCUS_27260 265041 265421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 265494 266306 gene locus_tag LOCUS_27270 265494 266306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 266512 266844 gene locus_tag LOCUS_27280 266512 266844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 266841 268523 gene locus_tag LOCUS_27290 266841 268523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 268474 268387 gene locus_tag LOCUS_t00320 268474 268387 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 269323 268574 gene locus_tag LOCUS_27300 269323 268574 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_27300 269424 270272 gene locus_tag LOCUS_27310 gene map 269424 270272 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920527.1 protein_id gnl|my_center|LOCUS_27310 270273 270947 gene locus_tag LOCUS_27320 gene radC 270273 270947 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971736.1 protein_id gnl|my_center|LOCUS_27320 272079 270931 gene locus_tag LOCUS_27330 272079 270931 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_27330 273332 272196 gene locus_tag LOCUS_27340 gene dnaJ 273332 272196 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531907.1 protein_id gnl|my_center|LOCUS_27340 273528 273325 gene locus_tag LOCUS_27350 273528 273325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 275452 273539 gene locus_tag LOCUS_27360 gene dnaK 275452 273539 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917900.1 protein_id gnl|my_center|LOCUS_27360 277135 275957 gene locus_tag LOCUS_27370 277135 275957 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086505.1 protein_id gnl|my_center|LOCUS_27370 277158 277346 gene locus_tag LOCUS_27380 277158 277346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 277349 277936 gene locus_tag LOCUS_27390 gene phaR 277349 277936 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 protein_id gnl|my_center|LOCUS_27390 278466 277963 gene locus_tag LOCUS_27400 278466 277963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 279169 278609 gene locus_tag LOCUS_27410 279169 278609 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_27410 279696 279166 gene locus_tag LOCUS_27420 279696 279166 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_27420 280249 279743 gene locus_tag LOCUS_27430 280249 279743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_27430 281008 280256 gene locus_tag LOCUS_27440 281008 280256 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073654.1 protein_id gnl|my_center|LOCUS_27440 281200 281913 gene locus_tag LOCUS_27450 281200 281913 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086341.1 protein_id gnl|my_center|LOCUS_27450 281903 283084 gene locus_tag LOCUS_27460 281903 283084 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086340.1 protein_id gnl|my_center|LOCUS_27460 283205 283804 gene locus_tag LOCUS_27470 283205 283804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 283966 284571 gene locus_tag LOCUS_27480 283966 284571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 284830 284600 gene locus_tag LOCUS_27490 284830 284600 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_27490 286152 284833 gene locus_tag LOCUS_27500 gene purB 286152 284833 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383544.1 protein_id gnl|my_center|LOCUS_27500 286298 287170 gene locus_tag LOCUS_27510 286298 287170 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086776.1 protein_id gnl|my_center|LOCUS_27510 287345 287172 gene locus_tag LOCUS_27520 287345 287172 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920802.1 protein_id gnl|my_center|LOCUS_27520 288259 287411 gene locus_tag LOCUS_27530 gene dapD 288259 287411 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639928.1 protein_id gnl|my_center|LOCUS_27530 288977 288270 gene locus_tag LOCUS_27540 288977 288270 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 protein_id gnl|my_center|LOCUS_27540 289898 288978 gene locus_tag LOCUS_27550 gene argB 289898 288978 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918172.1 protein_id gnl|my_center|LOCUS_27550 290097 291611 gene locus_tag LOCUS_27560 290097 291611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 291708 292712 gene locus_tag LOCUS_27570 291708 292712 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_27570 292699 293586 gene locus_tag LOCUS_27580 292699 293586 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 protein_id gnl|my_center|LOCUS_27580 293590 294282 gene locus_tag LOCUS_27590 gene trmD 293590 294282 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382927.1 protein_id gnl|my_center|LOCUS_27590 294361 297003 gene locus_tag LOCUS_27600 294361 297003 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207265.1 protein_id gnl|my_center|LOCUS_27600 297995 297000 gene locus_tag LOCUS_27610 297995 297000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 299002 297992 gene locus_tag LOCUS_27620 299002 297992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 300086 298989 gene locus_tag LOCUS_27630 300086 298989 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_27630 301276 300083 gene locus_tag LOCUS_27640 301276 300083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038124.1 protein_id gnl|my_center|LOCUS_27640 302109 301276 gene locus_tag LOCUS_27650 302109 301276 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695246.1 protein_id gnl|my_center|LOCUS_27650 303092 302106 gene locus_tag LOCUS_27660 303092 302106 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_27660 304087 303089 gene locus_tag LOCUS_27670 304087 303089 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368573.1 protein_id gnl|my_center|LOCUS_27670 305126 304158 gene locus_tag LOCUS_27680 305126 304158 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083401.1 protein_id gnl|my_center|LOCUS_27680 305336 306019 gene locus_tag LOCUS_27690 305336 306019 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728517.1 protein_id gnl|my_center|LOCUS_27690 306022 306795 gene locus_tag LOCUS_27700 306022 306795 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065081.1 protein_id gnl|my_center|LOCUS_27700 306798 307217 gene locus_tag LOCUS_27710 306798 307217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 308228 307218 gene locus_tag LOCUS_27720 gene hcpC 308228 307218 CDS product Sel1-like repeat protein HcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892717.1 protein_id gnl|my_center|LOCUS_27720 308617 308931 gene locus_tag LOCUS_27730 308617 308931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 309357 309728 gene locus_tag LOCUS_27740 gene rpsL 309357 309728 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624021.1 protein_id gnl|my_center|LOCUS_27740 309817 310287 gene locus_tag LOCUS_27750 gene rpsG 309817 310287 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624018.1 protein_id gnl|my_center|LOCUS_27750 310306 312384 gene locus_tag LOCUS_27760 gene fusA 310306 312384 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088153.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence6 821 369 gene locus_tag LOCUS_27770 821 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2022 814 gene locus_tag LOCUS_27780 2022 814 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_27780 2921 2265 gene locus_tag LOCUS_27790 2921 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3049 3450 gene locus_tag LOCUS_27800 3049 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3451 3951 gene locus_tag LOCUS_27810 3451 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 3948 5504 gene locus_tag LOCUS_27820 3948 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 5763 8030 gene locus_tag LOCUS_27830 5763 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 8032 9078 gene locus_tag LOCUS_27840 gene mcrC 8032 9078 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_27840 9207 10076 gene locus_tag LOCUS_27850 9207 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 10073 11635 gene locus_tag LOCUS_27860 10073 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 15055 11783 gene locus_tag LOCUS_27870 15055 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 16330 15401 gene locus_tag LOCUS_27880 16330 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27880 16944 16869 gene locus_tag LOCUS_t00330 16944 16869 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17577 17059 gene locus_tag LOCUS_27890 17577 17059 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265982.1 protein_id gnl|my_center|LOCUS_27890 17675 18295 gene locus_tag LOCUS_27900 gene cmk 17675 18295 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083564.1 protein_id gnl|my_center|LOCUS_27900 18279 18752 gene locus_tag LOCUS_27910 18279 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 19199 18807 gene locus_tag LOCUS_27920 19199 18807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 19565 21256 gene locus_tag LOCUS_27930 gene rpsA 19565 21256 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923317.1 protein_id gnl|my_center|LOCUS_27930 21498 21824 gene locus_tag LOCUS_27940 gene ihfB 21498 21824 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 protein_id gnl|my_center|LOCUS_27940 21984 22382 gene locus_tag LOCUS_27950 gene mscL 21984 22382 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399960.1 protein_id gnl|my_center|LOCUS_27950 22495 24309 gene locus_tag LOCUS_27960 22495 24309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 24321 25070 gene locus_tag LOCUS_27970 24321 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 26817 25090 gene locus_tag LOCUS_27980 gene ggt 26817 25090 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639997.1 protein_id gnl|my_center|LOCUS_27980 27028 27651 gene locus_tag LOCUS_27990 27028 27651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 29420 27657 gene locus_tag LOCUS_28000 29420 27657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918026.1 protein_id gnl|my_center|LOCUS_28000 31208 29568 gene locus_tag LOCUS_28010 31208 29568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 32999 31266 gene locus_tag LOCUS_28020 32999 31266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 33051 34658 gene locus_tag LOCUS_28030 gene pgi 33051 34658 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243039.1 protein_id gnl|my_center|LOCUS_28030 34764 35774 gene locus_tag LOCUS_28040 34764 35774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 35904 37043 gene locus_tag LOCUS_28050 35904 37043 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286766.1 protein_id gnl|my_center|LOCUS_28050 37045 37755 gene locus_tag LOCUS_28060 37045 37755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 37755 38471 gene locus_tag LOCUS_28070 37755 38471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 38514 38945 gene locus_tag LOCUS_28080 38514 38945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 40481 38946 gene locus_tag LOCUS_28090 40481 38946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 41183 40590 gene locus_tag LOCUS_28100 41183 40590 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205456.1 protein_id gnl|my_center|LOCUS_28100 41295 41591 gene locus_tag LOCUS_28110 41295 41591 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_28110 41598 42545 gene locus_tag LOCUS_28120 41598 42545 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529715.1 protein_id gnl|my_center|LOCUS_28120 43510 42671 gene locus_tag LOCUS_28130 43510 42671 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265533.1 protein_id gnl|my_center|LOCUS_28130 43634 44995 gene locus_tag LOCUS_28140 43634 44995 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384606.1 protein_id gnl|my_center|LOCUS_28140 45657 45004 gene locus_tag LOCUS_28150 45657 45004 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921316.1 protein_id gnl|my_center|LOCUS_28150 46532 45846 gene locus_tag LOCUS_28160 46532 45846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 46957 46571 gene locus_tag LOCUS_28170 46957 46571 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_28170 47047 47508 gene locus_tag LOCUS_28180 47047 47508 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_28180 47512 48444 gene locus_tag LOCUS_28190 gene ribF 47512 48444 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704352.1 protein_id gnl|my_center|LOCUS_28190 48441 49328 gene locus_tag LOCUS_28200 48441 49328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 49328 50215 gene locus_tag LOCUS_28210 49328 50215 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583214.1 protein_id gnl|my_center|LOCUS_28210 52152 50329 gene locus_tag LOCUS_28220 52152 50329 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640139.1 protein_id gnl|my_center|LOCUS_28220 53983 52166 gene locus_tag LOCUS_28230 53983 52166 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640139.1 protein_id gnl|my_center|LOCUS_28230 54240 54527 gene locus_tag LOCUS_28240 gene groES 54240 54527 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_28240 54566 56200 gene locus_tag LOCUS_28250 gene groL 54566 56200 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918571.1 protein_id gnl|my_center|LOCUS_28250 56893 57516 gene locus_tag LOCUS_28260 56893 57516 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478718.1 protein_id gnl|my_center|LOCUS_28260 58428 57553 gene locus_tag LOCUS_28270 58428 57553 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 protein_id gnl|my_center|LOCUS_28270 58532 60025 gene locus_tag LOCUS_28280 58532 60025 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919179.1 protein_id gnl|my_center|LOCUS_28280 60036 60812 gene locus_tag LOCUS_28290 60036 60812 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330822.1 protein_id gnl|my_center|LOCUS_28290 60812 61948 gene locus_tag LOCUS_28300 60812 61948 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 protein_id gnl|my_center|LOCUS_28300 61945 62988 gene locus_tag LOCUS_28310 61945 62988 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958492.1 protein_id gnl|my_center|LOCUS_28310 62996 63883 gene locus_tag LOCUS_28320 gene mmsB 62996 63883 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_28320 65421 63880 gene locus_tag LOCUS_28330 gene vceB 65421 63880 CDS product multidrug efflux MFS transporter permease subunit VceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019055.1 protein_id gnl|my_center|LOCUS_28330 66623 65430 gene locus_tag LOCUS_28340 gene vceA 66623 65430 CDS product multidrug efflux MFS transporter adaptor subunit VceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625982.1 protein_id gnl|my_center|LOCUS_28340 68196 66640 gene locus_tag LOCUS_28350 68196 66640 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 protein_id gnl|my_center|LOCUS_28350 68339 68959 gene locus_tag LOCUS_28360 68339 68959 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037814.1 protein_id gnl|my_center|LOCUS_28360 69038 69781 gene locus_tag LOCUS_28370 69038 69781 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 protein_id gnl|my_center|LOCUS_28370