>Feature sequence001 813 412 gene locus_tag LOCUS_00010 813 412 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085898.1 protein_id gnl|my_center|LOCUS_00010 2598 1096 gene locus_tag LOCUS_00020 2598 1096 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_00020 5035 2978 gene locus_tag LOCUS_00030 gene htpG 5035 2978 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057033.1 protein_id gnl|my_center|LOCUS_00030 6287 5190 gene locus_tag LOCUS_00040 gene ribD 6287 5190 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057986.1 protein_id gnl|my_center|LOCUS_00040 6770 8206 gene locus_tag LOCUS_00050 6770 8206 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_00050 8382 9806 gene locus_tag LOCUS_00060 8382 9806 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_00060 10660 10211 gene locus_tag LOCUS_00070 10660 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00070 11092 10685 gene locus_tag LOCUS_00080 11092 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11383 11643 gene locus_tag LOCUS_00090 11383 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12865 11831 gene locus_tag LOCUS_00100 12865 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13363 14229 gene locus_tag LOCUS_00110 13363 14229 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 protein_id gnl|my_center|LOCUS_00110 15100 14291 gene locus_tag LOCUS_00120 15100 14291 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_00120 16658 15483 gene locus_tag LOCUS_00130 16658 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17399 16953 gene locus_tag LOCUS_00140 17399 16953 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_00140 19644 17338 gene locus_tag LOCUS_00150 19644 17338 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_00150 20310 20029 gene locus_tag LOCUS_00160 20310 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20531 20307 gene locus_tag LOCUS_00170 20531 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22924 20873 gene locus_tag LOCUS_00180 22924 20873 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_00180 24755 23721 gene locus_tag LOCUS_00190 gene cobW 24755 23721 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_00190 24959 25147 gene locus_tag LOCUS_00200 24959 25147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27092 25188 gene locus_tag LOCUS_00210 27092 25188 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706692.1 protein_id gnl|my_center|LOCUS_00210 27476 28987 gene locus_tag LOCUS_00220 gene crtH 27476 28987 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_00220 29230 30909 gene locus_tag LOCUS_00230 29230 30909 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_00230 32152 31094 gene locus_tag LOCUS_00240 32152 31094 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 protein_id gnl|my_center|LOCUS_00240 32155 33405 gene locus_tag LOCUS_00250 32155 33405 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_00250 34133 33552 gene locus_tag LOCUS_00260 34133 33552 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_00260 35652 34294 gene locus_tag LOCUS_00270 gene glmU 35652 34294 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_00270 35838 36005 gene locus_tag LOCUS_00280 35838 36005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 36098 36841 gene locus_tag LOCUS_00290 36098 36841 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_00290 37112 38371 gene locus_tag LOCUS_00300 37112 38371 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057139.1 protein_id gnl|my_center|LOCUS_00300 38636 39583 gene locus_tag LOCUS_00310 38636 39583 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920765.1 protein_id gnl|my_center|LOCUS_00310 39959 39732 gene locus_tag LOCUS_00320 39959 39732 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024016.1 protein_id gnl|my_center|LOCUS_00320 40161 39952 gene locus_tag LOCUS_00330 40161 39952 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_00330 41240 40845 gene locus_tag LOCUS_00340 41240 40845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41909 41697 gene locus_tag LOCUS_00350 41909 41697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 43969 41999 gene locus_tag LOCUS_00360 gene acs 43969 41999 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056731.1 protein_id gnl|my_center|LOCUS_00360 44221 44466 gene locus_tag LOCUS_00370 gene psaC 44221 44466 CDS product photosystem I iron-sulfur center protein PsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125916.1 protein_id gnl|my_center|LOCUS_00370 45501 44791 gene locus_tag LOCUS_00380 45501 44791 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928653.1 protein_id gnl|my_center|LOCUS_00380 45577 46305 gene locus_tag LOCUS_00390 45577 46305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47111 46308 gene locus_tag LOCUS_00400 47111 46308 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_00400 47566 48675 gene locus_tag LOCUS_00410 gene thrC 47566 48675 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_00410 49335 48706 gene locus_tag LOCUS_00420 gene hisB 49335 48706 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055988.1 protein_id gnl|my_center|LOCUS_00420 51120 49624 gene locus_tag LOCUS_00430 51120 49624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 51968 51285 gene locus_tag LOCUS_00440 51968 51285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52445 52657 gene locus_tag LOCUS_00450 52445 52657 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058042.1 protein_id gnl|my_center|LOCUS_00450 53561 52716 gene locus_tag LOCUS_00460 gene dapF 53561 52716 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_00460 53623 53835 gene locus_tag LOCUS_00470 53623 53835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058128.1 protein_id gnl|my_center|LOCUS_00470 54197 55369 gene locus_tag LOCUS_00480 54197 55369 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_00480 55670 56509 gene locus_tag LOCUS_00490 55670 56509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57982 58878 gene locus_tag LOCUS_00500 57982 58878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59295 60413 gene locus_tag LOCUS_00510 59295 60413 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868574.1 protein_id gnl|my_center|LOCUS_00510 60453 61388 gene locus_tag LOCUS_00520 60453 61388 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118888.1 protein_id gnl|my_center|LOCUS_00520 62825 63385 gene locus_tag LOCUS_00530 62825 63385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 63801 63520 gene locus_tag LOCUS_00540 63801 63520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 66342 63877 gene locus_tag LOCUS_00550 66342 63877 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_00550 66805 67029 gene locus_tag LOCUS_00560 66805 67029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 67026 67322 gene locus_tag LOCUS_00570 67026 67322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 68091 67585 gene locus_tag LOCUS_00580 68091 67585 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141597.1 protein_id gnl|my_center|LOCUS_00580 68782 68189 gene locus_tag LOCUS_00590 68782 68189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 70087 68897 gene locus_tag LOCUS_00600 70087 68897 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 protein_id gnl|my_center|LOCUS_00600 70656 70084 gene locus_tag LOCUS_00610 gene rimI 70656 70084 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056322.1 protein_id gnl|my_center|LOCUS_00610 71275 72255 gene locus_tag LOCUS_00620 71275 72255 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_00620 72329 72646 gene locus_tag LOCUS_00630 72329 72646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 73391 72912 gene locus_tag LOCUS_00640 73391 72912 CDS product DUF3172 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920879.1 protein_id gnl|my_center|LOCUS_00640 74041 75378 gene locus_tag LOCUS_00650 74041 75378 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_00650 75485 76657 gene locus_tag LOCUS_00660 75485 76657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 76712 78718 gene locus_tag LOCUS_00670 76712 78718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_00670 78968 80338 gene locus_tag LOCUS_00680 78968 80338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 80594 80355 gene locus_tag LOCUS_00690 80594 80355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 80930 81823 gene locus_tag LOCUS_00700 gene yhdJ 80930 81823 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258898.1 protein_id gnl|my_center|LOCUS_00700 81804 82478 gene locus_tag LOCUS_00710 81804 82478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 82660 82923 gene locus_tag LOCUS_00720 82660 82923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 82983 84617 gene locus_tag LOCUS_00730 82983 84617 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058039.1 protein_id gnl|my_center|LOCUS_00730 84730 85440 gene locus_tag LOCUS_00740 84730 85440 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_00740 85637 86668 gene locus_tag LOCUS_00750 85637 86668 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920983.1 protein_id gnl|my_center|LOCUS_00750 86922 88046 gene locus_tag LOCUS_00760 86922 88046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 88064 91213 gene locus_tag LOCUS_00770 88064 91213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 91311 92855 gene locus_tag LOCUS_00780 91311 92855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 93375 92860 gene locus_tag LOCUS_00790 93375 92860 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_00790 93574 94959 gene locus_tag LOCUS_00800 93574 94959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 94982 95623 gene locus_tag LOCUS_00810 94982 95623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 95703 95936 gene locus_tag LOCUS_00820 95703 95936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 95951 96358 gene locus_tag LOCUS_00830 95951 96358 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence002 825 475 gene locus_tag LOCUS_00840 825 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1415 834 gene locus_tag LOCUS_00850 1415 834 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_00850 2257 2673 gene locus_tag LOCUS_00860 2257 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 2856 2674 gene locus_tag LOCUS_00870 2856 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 3345 4916 gene locus_tag LOCUS_00880 3345 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 5038 6072 gene locus_tag LOCUS_00890 gene tsaD 5038 6072 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_00890 6353 7234 gene locus_tag LOCUS_00900 gene truB 6353 7234 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057445.1 protein_id gnl|my_center|LOCUS_00900 7723 7451 gene locus_tag LOCUS_00910 7723 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 8871 7825 gene locus_tag LOCUS_00920 gene hisC 8871 7825 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_00920 10426 9185 gene locus_tag LOCUS_00930 gene ispG 10426 9185 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056840.1 protein_id gnl|my_center|LOCUS_00930 11354 10440 gene locus_tag LOCUS_00940 11354 10440 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_00940 11699 12268 gene locus_tag LOCUS_00950 11699 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 12382 14103 gene locus_tag LOCUS_00960 gene lysS 12382 14103 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015229441.1 protein_id gnl|my_center|LOCUS_00960 15810 14164 gene locus_tag LOCUS_00970 15810 14164 CDS product DUF3685 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_00970 16309 15869 gene locus_tag LOCUS_00980 16309 15869 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_00980 16910 17488 gene locus_tag LOCUS_00990 16910 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 18575 18105 gene locus_tag LOCUS_01000 18575 18105 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_01000 18754 19812 gene locus_tag LOCUS_01010 18754 19812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 protein_id gnl|my_center|LOCUS_01010 19822 20589 gene locus_tag LOCUS_01020 19822 20589 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_01020 20864 22591 gene locus_tag LOCUS_01030 gene recN 20864 22591 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140275.1 protein_id gnl|my_center|LOCUS_01030 23236 22595 gene locus_tag LOCUS_01040 23236 22595 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_01040 23902 23261 gene locus_tag LOCUS_01050 23902 23261 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_01050 24024 25217 gene locus_tag LOCUS_01060 24024 25217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 25495 25220 gene locus_tag LOCUS_01070 25495 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 25812 27254 gene locus_tag LOCUS_01080 gene cysS 25812 27254 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920936.1 protein_id gnl|my_center|LOCUS_01080 28766 27237 gene locus_tag LOCUS_01090 28766 27237 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986277.1 protein_id gnl|my_center|LOCUS_01090 28885 29889 gene locus_tag LOCUS_01100 28885 29889 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_01100 29902 31335 gene locus_tag LOCUS_01110 29902 31335 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_01110 31932 31636 gene locus_tag LOCUS_01120 31932 31636 CDS product DUF1816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057540.1 protein_id gnl|my_center|LOCUS_01120 32911 32045 gene locus_tag LOCUS_01130 gene rlmB 32911 32045 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144167.1 protein_id gnl|my_center|LOCUS_01130 33371 32955 gene locus_tag LOCUS_01140 33371 32955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 33725 33375 gene locus_tag LOCUS_01150 33725 33375 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524127.1 protein_id gnl|my_center|LOCUS_01150 34948 33800 gene locus_tag LOCUS_01160 gene carA 34948 33800 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056605.1 protein_id gnl|my_center|LOCUS_01160 35146 36039 gene locus_tag LOCUS_01170 35146 36039 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056458.1 protein_id gnl|my_center|LOCUS_01170 36296 39013 gene locus_tag LOCUS_01180 36296 39013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 40452 39010 gene locus_tag LOCUS_01190 40452 39010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 41181 42110 gene locus_tag LOCUS_01200 41181 42110 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093421.1 protein_id gnl|my_center|LOCUS_01200 42142 42804 gene locus_tag LOCUS_01210 gene nox 42142 42804 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227925.1 protein_id gnl|my_center|LOCUS_01210 42898 46692 gene locus_tag LOCUS_01220 42898 46692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 46888 52332 gene locus_tag LOCUS_01230 46888 52332 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141952.1 protein_id gnl|my_center|LOCUS_01230 52373 56335 gene locus_tag LOCUS_01240 52373 56335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 56364 57683 gene locus_tag LOCUS_01250 56364 57683 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530640.1 protein_id gnl|my_center|LOCUS_01250 57733 58908 gene locus_tag LOCUS_01260 57733 58908 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408248.1 protein_id gnl|my_center|LOCUS_01260 58921 59526 gene locus_tag LOCUS_01270 58921 59526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 59607 61238 gene locus_tag LOCUS_01280 59607 61238 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_01280 61287 62588 gene locus_tag LOCUS_01290 61287 62588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_01290 62649 64004 gene locus_tag LOCUS_01300 62649 64004 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_01300 64047 67145 gene locus_tag LOCUS_01310 64047 67145 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921798.1 protein_id gnl|my_center|LOCUS_01310 67691 68470 gene locus_tag LOCUS_01320 67691 68470 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184994.1 protein_id gnl|my_center|LOCUS_01320 69127 68606 gene locus_tag LOCUS_01330 69127 68606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 69495 70016 gene locus_tag LOCUS_01340 69495 70016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 70074 71621 gene locus_tag LOCUS_01350 70074 71621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 72456 71644 gene locus_tag LOCUS_01360 72456 71644 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085861.1 protein_id gnl|my_center|LOCUS_01360 72534 72606 gene locus_tag LOCUS_t00010 72534 72606 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 72896 73678 gene locus_tag LOCUS_01370 gene recO 72896 73678 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058068.1 protein_id gnl|my_center|LOCUS_01370 73701 75191 gene locus_tag LOCUS_01380 73701 75191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_01380 75966 76634 gene locus_tag LOCUS_01390 75966 76634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 76925 77626 gene locus_tag LOCUS_01400 76925 77626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 79106 77982 gene locus_tag LOCUS_01410 gene tgt 79106 77982 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055935.1 protein_id gnl|my_center|LOCUS_01410 79679 79152 gene locus_tag LOCUS_01420 79679 79152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 80426 79824 gene locus_tag LOCUS_01430 gene clpP 80426 79824 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125072.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence003 282 467 gene locus_tag LOCUS_01440 282 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 759 1043 gene locus_tag LOCUS_01450 759 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 1043 1390 gene locus_tag LOCUS_01460 1043 1390 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_01460 2244 2074 gene locus_tag LOCUS_01470 2244 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 2359 2751 gene locus_tag LOCUS_01480 2359 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142930.1 protein_id gnl|my_center|LOCUS_01480 2748 3191 gene locus_tag LOCUS_01490 2748 3191 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_01490 3225 4145 gene locus_tag LOCUS_01500 3225 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 4219 4887 gene locus_tag LOCUS_01510 4219 4887 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_01510 4930 5376 gene locus_tag LOCUS_01520 4930 5376 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_01520 5412 5981 gene locus_tag LOCUS_01530 5412 5981 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928692.1 protein_id gnl|my_center|LOCUS_01530 6013 7956 gene locus_tag LOCUS_01540 6013 7956 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816805.1 protein_id gnl|my_center|LOCUS_01540 8037 8294 gene locus_tag LOCUS_01550 8037 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 8341 8568 gene locus_tag LOCUS_01560 8341 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 9370 8579 gene locus_tag LOCUS_01570 9370 8579 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 protein_id gnl|my_center|LOCUS_01570 9439 12309 gene locus_tag LOCUS_01580 9439 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 12601 13626 gene locus_tag LOCUS_01590 12601 13626 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_01590 13623 14030 gene locus_tag LOCUS_01600 13623 14030 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920821.1 protein_id gnl|my_center|LOCUS_01600 14090 14290 gene locus_tag LOCUS_01610 14090 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 14529 15311 gene locus_tag LOCUS_01620 14529 15311 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_01620 16168 15635 gene locus_tag LOCUS_01630 gene pyrR 16168 15635 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921232.1 protein_id gnl|my_center|LOCUS_01630 16312 17709 gene locus_tag LOCUS_01640 16312 17709 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_01640 19918 18044 gene locus_tag LOCUS_01650 19918 18044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_01650 20488 21123 gene locus_tag LOCUS_01660 20488 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 21165 23489 gene locus_tag LOCUS_01670 gene feoB 21165 23489 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057577.1 protein_id gnl|my_center|LOCUS_01670 23599 23838 gene locus_tag LOCUS_01680 23599 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 24176 25186 gene locus_tag LOCUS_01690 24176 25186 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_01690 26007 25309 gene locus_tag LOCUS_01700 26007 25309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892606.1 protein_id gnl|my_center|LOCUS_01700 26838 26029 gene locus_tag LOCUS_01710 26838 26029 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125718.1 protein_id gnl|my_center|LOCUS_01710 27617 26838 gene locus_tag LOCUS_01720 27617 26838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 28490 28870 gene locus_tag LOCUS_01730 28490 28870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 28899 29216 gene locus_tag LOCUS_01740 28899 29216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 29239 30360 gene locus_tag LOCUS_01750 29239 30360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 31463 31023 gene locus_tag LOCUS_01760 31463 31023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 31528 32313 gene locus_tag LOCUS_01770 gene rncS 31528 32313 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_01770 33112 32333 gene locus_tag LOCUS_01780 33112 32333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 33283 34326 gene locus_tag LOCUS_01790 33283 34326 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_01790 34338 34679 gene locus_tag LOCUS_01800 34338 34679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 34699 35541 gene locus_tag LOCUS_01810 gene cysT 34699 35541 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056130.1 protein_id gnl|my_center|LOCUS_01810 35583 36425 gene locus_tag LOCUS_01820 gene cysW 35583 36425 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_01820 36441 37481 gene locus_tag LOCUS_01830 36441 37481 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_01830 39687 38005 gene locus_tag LOCUS_01840 39687 38005 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 protein_id gnl|my_center|LOCUS_01840 39942 40580 gene locus_tag LOCUS_01850 gene hisH 39942 40580 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057376.1 protein_id gnl|my_center|LOCUS_01850 41321 40569 gene locus_tag LOCUS_01860 41321 40569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_01860 42548 41433 gene locus_tag LOCUS_01870 42548 41433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 42842 43498 gene locus_tag LOCUS_01880 42842 43498 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 protein_id gnl|my_center|LOCUS_01880 44040 43513 gene locus_tag LOCUS_01890 44040 43513 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_01890 44327 44034 gene locus_tag LOCUS_01900 44327 44034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 45096 44458 gene locus_tag LOCUS_01910 45096 44458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_01910 46942 45419 gene locus_tag LOCUS_01920 46942 45419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329014.1 protein_id gnl|my_center|LOCUS_01920 47280 47576 gene locus_tag LOCUS_01930 47280 47576 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_01930 47566 47850 gene locus_tag LOCUS_01940 47566 47850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 48062 48262 gene locus_tag LOCUS_01950 48062 48262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 48222 48671 gene locus_tag LOCUS_01960 48222 48671 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770968.1 protein_id gnl|my_center|LOCUS_01960 50541 48664 gene locus_tag LOCUS_01970 gene uvrC 50541 48664 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057590.1 protein_id gnl|my_center|LOCUS_01970 51069 50809 gene locus_tag LOCUS_01980 51069 50809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 52234 51149 gene locus_tag LOCUS_01990 gene leuB 52234 51149 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_01990 53703 52630 gene locus_tag LOCUS_02000 53703 52630 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_02000 54583 53708 gene locus_tag LOCUS_02010 gene rfbD 54583 53708 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_02010 55134 54589 gene locus_tag LOCUS_02020 gene rfbC 55134 54589 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_02020 55268 56362 gene locus_tag LOCUS_02030 gene bioB 55268 56362 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_02030 56433 56984 gene locus_tag LOCUS_02040 56433 56984 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_02040 56996 57463 gene locus_tag LOCUS_02050 gene lspA 56996 57463 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140076.1 protein_id gnl|my_center|LOCUS_02050 59575 57782 gene locus_tag LOCUS_02060 59575 57782 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_02060 59907 60629 gene locus_tag LOCUS_02070 59907 60629 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929431.1 protein_id gnl|my_center|LOCUS_02070 60654 61187 gene locus_tag LOCUS_02080 gene purE 60654 61187 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056434.1 protein_id gnl|my_center|LOCUS_02080 61230 62030 gene locus_tag LOCUS_02090 61230 62030 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_02090 62506 63327 gene locus_tag LOCUS_02100 62506 63327 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073519.1 protein_id gnl|my_center|LOCUS_02100 63385 64251 gene locus_tag LOCUS_02110 63385 64251 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_02110 64903 64706 gene locus_tag LOCUS_02120 64903 64706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 65503 65709 gene locus_tag LOCUS_02130 65503 65709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 65712 66233 gene locus_tag LOCUS_02140 65712 66233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 68243 66372 gene locus_tag LOCUS_02150 68243 66372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 69331 68456 gene locus_tag LOCUS_02160 69331 68456 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929069.1 protein_id gnl|my_center|LOCUS_02160 70266 69424 gene locus_tag LOCUS_02170 70266 69424 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_02170 71715 70516 gene locus_tag LOCUS_02180 71715 70516 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057053.1 protein_id gnl|my_center|LOCUS_02180 >Feature sequence004 371 673 gene locus_tag LOCUS_02190 gene ureA 371 673 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_02190 693 1019 gene locus_tag LOCUS_02200 693 1019 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_02200 1101 1976 gene locus_tag LOCUS_02210 1101 1976 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_02210 3387 2431 gene locus_tag LOCUS_02220 3387 2431 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_02220 3996 4634 gene locus_tag LOCUS_02230 3996 4634 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_02230 4857 5459 gene locus_tag LOCUS_02240 4857 5459 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_02240 6368 5475 gene locus_tag LOCUS_02250 6368 5475 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017291357.1 protein_id gnl|my_center|LOCUS_02250 6802 7293 gene locus_tag LOCUS_02260 6802 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 7307 7795 gene locus_tag LOCUS_02270 7307 7795 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_02270 7806 8273 gene locus_tag LOCUS_02280 7806 8273 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_02280 8701 8312 gene locus_tag LOCUS_02290 8701 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057706.1 protein_id gnl|my_center|LOCUS_02290 9952 8900 gene locus_tag LOCUS_02300 9952 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 10866 10168 gene locus_tag LOCUS_02310 10866 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 12160 10871 gene locus_tag LOCUS_02320 12160 10871 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_02320 15852 12235 gene locus_tag LOCUS_02330 gene cobN 15852 12235 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_02330 16255 18456 gene locus_tag LOCUS_02340 16255 18456 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 protein_id gnl|my_center|LOCUS_02340 19705 19223 gene locus_tag LOCUS_02350 19705 19223 CDS product photosystem I reaction center protein subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058236.1 protein_id gnl|my_center|LOCUS_02350 20444 20034 gene locus_tag LOCUS_02360 20444 20034 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_02360 20608 21816 gene locus_tag LOCUS_02370 20608 21816 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_02370 22857 22273 gene locus_tag LOCUS_02380 22857 22273 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_02380 24464 23109 gene locus_tag LOCUS_02390 gene opcA 24464 23109 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_02390 24409 24588 gene locus_tag LOCUS_02400 24409 24588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 26197 24668 gene locus_tag LOCUS_02410 gene zwf 26197 24668 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_02410 27775 26528 gene locus_tag LOCUS_02420 27775 26528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 28177 34314 gene locus_tag LOCUS_02430 28177 34314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 34397 34888 gene locus_tag LOCUS_02440 34397 34888 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 protein_id gnl|my_center|LOCUS_02440 35314 35817 gene locus_tag LOCUS_02450 35314 35817 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_02450 37426 35744 gene locus_tag LOCUS_02460 37426 35744 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_02460 38527 37430 gene locus_tag LOCUS_02470 38527 37430 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 protein_id gnl|my_center|LOCUS_02470 40059 38620 gene locus_tag LOCUS_02480 40059 38620 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920897.1 protein_id gnl|my_center|LOCUS_02480 40897 42243 gene locus_tag LOCUS_02490 40897 42243 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_02490 42648 43406 gene locus_tag LOCUS_02500 42648 43406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 43492 45042 gene locus_tag LOCUS_02510 43492 45042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 45092 45994 gene locus_tag LOCUS_02520 45092 45994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 46022 46837 gene locus_tag LOCUS_02530 46022 46837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 46979 47887 gene locus_tag LOCUS_02540 46979 47887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 48026 49510 gene locus_tag LOCUS_02550 48026 49510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 49569 50570 gene locus_tag LOCUS_02560 49569 50570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_02560 50720 51700 gene locus_tag LOCUS_02570 50720 51700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 52094 55216 gene locus_tag LOCUS_02580 52094 55216 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 protein_id gnl|my_center|LOCUS_02580 55230 56069 gene locus_tag LOCUS_02590 55230 56069 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142412.1 protein_id gnl|my_center|LOCUS_02590 56295 57569 gene locus_tag LOCUS_02600 56295 57569 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_02600 57569 57994 gene locus_tag LOCUS_02610 57569 57994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 58301 60322 gene locus_tag LOCUS_02620 58301 60322 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144393.1 protein_id gnl|my_center|LOCUS_02620 62089 60332 gene locus_tag LOCUS_02630 62089 60332 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926968.1 protein_id gnl|my_center|LOCUS_02630 62331 64004 gene locus_tag LOCUS_02640 gene groL 62331 64004 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142891.1 protein_id gnl|my_center|LOCUS_02640 64195 66084 gene locus_tag LOCUS_02650 64195 66084 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_02650 66152 68287 gene locus_tag LOCUS_02660 66152 68287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 68299 68772 gene locus_tag LOCUS_02670 68299 68772 CDS product ASCH domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725285.1 protein_id gnl|my_center|LOCUS_02670 69412 68939 gene locus_tag LOCUS_02680 69412 68939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 70208 69609 gene locus_tag LOCUS_02690 70208 69609 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_02690 70479 70297 gene locus_tag LOCUS_02700 70479 70297 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057752.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence005 1822 119 gene locus_tag LOCUS_02710 1822 119 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_02710 4086 2122 gene locus_tag LOCUS_02720 4086 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_02720 4208 4450 gene locus_tag LOCUS_02730 4208 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4458 5273 gene locus_tag LOCUS_02740 4458 5273 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142967.1 protein_id gnl|my_center|LOCUS_02740 5440 6120 gene locus_tag LOCUS_02750 5440 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 7225 6164 gene locus_tag LOCUS_02760 7225 6164 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031370.1 protein_id gnl|my_center|LOCUS_02760 7410 7745 gene locus_tag LOCUS_02770 7410 7745 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058261.1 protein_id gnl|my_center|LOCUS_02770 8075 10225 gene locus_tag LOCUS_02780 8075 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 10243 12402 gene locus_tag LOCUS_02790 10243 12402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 12415 14580 gene locus_tag LOCUS_02800 12415 14580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 15536 14586 gene locus_tag LOCUS_02810 gene pip 15536 14586 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_02810 15728 17119 gene locus_tag LOCUS_02820 15728 17119 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_02820 17151 17885 gene locus_tag LOCUS_02830 17151 17885 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056776.1 protein_id gnl|my_center|LOCUS_02830 18226 18417 gene locus_tag LOCUS_02840 18226 18417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 18520 18903 gene locus_tag LOCUS_02850 18520 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02850 18971 19240 gene locus_tag LOCUS_02860 18971 19240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124299.1 protein_id gnl|my_center|LOCUS_02860 19496 20068 gene locus_tag LOCUS_02870 19496 20068 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920717.1 protein_id gnl|my_center|LOCUS_02870 20091 20702 gene locus_tag LOCUS_02880 20091 20702 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_02880 21550 20831 gene locus_tag LOCUS_02890 gene sfsA 21550 20831 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057534.1 protein_id gnl|my_center|LOCUS_02890 22061 23161 gene locus_tag LOCUS_02900 gene aroC 22061 23161 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_02900 23175 24377 gene locus_tag LOCUS_02910 23175 24377 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_02910 25173 24583 gene locus_tag LOCUS_02920 25173 24583 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_02920 25250 25534 gene locus_tag LOCUS_02930 25250 25534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 25531 25950 gene locus_tag LOCUS_02940 25531 25950 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_02940 25991 27586 gene locus_tag LOCUS_02950 25991 27586 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_02950 27698 27970 gene locus_tag LOCUS_02960 27698 27970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 27963 28235 gene locus_tag LOCUS_02970 27963 28235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 28710 33347 gene locus_tag LOCUS_02980 28710 33347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 34111 33521 gene locus_tag LOCUS_02990 34111 33521 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_02990 35008 34514 gene locus_tag LOCUS_03000 35008 34514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 35373 36203 gene locus_tag LOCUS_03010 35373 36203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 37016 36333 gene locus_tag LOCUS_03020 37016 36333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 36981 37157 gene locus_tag LOCUS_03030 36981 37157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 38157 37243 gene locus_tag LOCUS_03040 38157 37243 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_03040 38746 38231 gene locus_tag LOCUS_03050 38746 38231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 39303 38914 gene locus_tag LOCUS_03060 39303 38914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 40432 39470 gene locus_tag LOCUS_03070 40432 39470 CDS product orange carotenoid protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 protein_id gnl|my_center|LOCUS_03070 41708 40950 gene locus_tag LOCUS_03080 41708 40950 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_03080 42594 41779 gene locus_tag LOCUS_03090 42594 41779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_03090 43721 42681 gene locus_tag LOCUS_03100 43721 42681 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315613.1 protein_id gnl|my_center|LOCUS_03100 44474 43785 gene locus_tag LOCUS_03110 gene hypB 44474 43785 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_03110 44889 44533 gene locus_tag LOCUS_03120 44889 44533 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939601.1 protein_id gnl|my_center|LOCUS_03120 45261 44905 gene locus_tag LOCUS_03130 45261 44905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 46494 45313 gene locus_tag LOCUS_03140 46494 45313 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_03140 47196 47405 gene locus_tag LOCUS_03150 47196 47405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 47402 47656 gene locus_tag LOCUS_03160 47402 47656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 48809 47844 gene locus_tag LOCUS_03170 48809 47844 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_03170 50429 49092 gene locus_tag LOCUS_03180 50429 49092 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920668.1 protein_id gnl|my_center|LOCUS_03180 50934 50557 gene locus_tag LOCUS_03190 50934 50557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_03190 52689 50971 gene locus_tag LOCUS_03200 52689 50971 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_03200 53544 52861 gene locus_tag LOCUS_03210 53544 52861 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_03210 54300 54061 gene locus_tag LOCUS_03220 54300 54061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 54309 54575 gene locus_tag LOCUS_03230 54309 54575 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_03230 55980 54799 gene locus_tag LOCUS_03240 55980 54799 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920982.1 protein_id gnl|my_center|LOCUS_03240 56808 56008 gene locus_tag LOCUS_03250 56808 56008 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057950.1 protein_id gnl|my_center|LOCUS_03250 57170 58318 gene locus_tag LOCUS_03260 57170 58318 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056182.1 protein_id gnl|my_center|LOCUS_03260 58328 59662 gene locus_tag LOCUS_03270 58328 59662 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799062.1 protein_id gnl|my_center|LOCUS_03270 59910 60209 gene locus_tag LOCUS_03280 59910 60209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 60286 60900 gene locus_tag LOCUS_03290 60286 60900 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_03290 62220 61165 gene locus_tag LOCUS_03300 62220 61165 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_03300 62468 65089 gene locus_tag LOCUS_03310 62468 65089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 66253 65180 gene locus_tag LOCUS_03320 66253 65180 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799067.1 protein_id gnl|my_center|LOCUS_03320 66691 66281 gene locus_tag LOCUS_03330 66691 66281 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_03330 66912 66679 gene locus_tag LOCUS_03340 66912 66679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 67111 67989 gene locus_tag LOCUS_03350 67111 67989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_03350 68038 68397 gene locus_tag LOCUS_03360 gene trxA 68038 68397 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385489.1 protein_id gnl|my_center|LOCUS_03360 68414 69592 gene locus_tag LOCUS_03370 68414 69592 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124972844.1 protein_id gnl|my_center|LOCUS_03370 69573 69761 gene locus_tag LOCUS_03380 69573 69761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 <70478 69827 gene locus_tag LOCUS_03390 <70478 69827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144335.1:DUF4351 domain-containing protein >Feature sequence006 708 1748 gene locus_tag LOCUS_03400 708 1748 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_03400 3572 1986 gene locus_tag LOCUS_03410 3572 1986 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_03410 5393 3903 gene locus_tag LOCUS_03420 5393 3903 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057081.1 protein_id gnl|my_center|LOCUS_03420 5724 6470 gene locus_tag LOCUS_03430 5724 6470 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 protein_id gnl|my_center|LOCUS_03430 8150 6477 gene locus_tag LOCUS_03440 8150 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 10590 8485 gene locus_tag LOCUS_03450 10590 8485 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_03450 10899 11081 gene locus_tag LOCUS_03460 10899 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 11613 11074 gene locus_tag LOCUS_03470 11613 11074 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_03470 11734 12036 gene locus_tag LOCUS_03480 gene rpsN 11734 12036 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057663.1 protein_id gnl|my_center|LOCUS_03480 14540 12387 gene locus_tag LOCUS_03490 14540 12387 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058027.1 protein_id gnl|my_center|LOCUS_03490 15180 16280 gene locus_tag LOCUS_03500 gene prfA 15180 16280 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056003.1 protein_id gnl|my_center|LOCUS_03500 17578 16601 gene locus_tag LOCUS_03510 17578 16601 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03510 17788 17991 gene locus_tag LOCUS_03520 gene rpmI 17788 17991 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_03520 18023 18370 gene locus_tag LOCUS_03530 gene rplT 18023 18370 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057992.1 protein_id gnl|my_center|LOCUS_03530 18384 19340 gene locus_tag LOCUS_03540 18384 19340 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_03540 20784 19669 gene locus_tag LOCUS_03550 20784 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 21180 22691 gene locus_tag LOCUS_03560 21180 22691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 22698 23657 gene locus_tag LOCUS_03570 22698 23657 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_03570 23654 26542 gene locus_tag LOCUS_03580 23654 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 27239 28036 gene locus_tag LOCUS_03590 27239 28036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 28479 28679 gene locus_tag LOCUS_03600 28479 28679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 28704 29672 gene locus_tag LOCUS_03610 28704 29672 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_03610 29831 30109 gene locus_tag LOCUS_03620 29831 30109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 30528 30331 gene locus_tag LOCUS_03630 30528 30331 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681551.1 protein_id gnl|my_center|LOCUS_03630 30774 30529 gene locus_tag LOCUS_03640 30774 30529 CDS product DUF1902 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228375.1 protein_id gnl|my_center|LOCUS_03640 30875 34591 gene locus_tag LOCUS_03650 30875 34591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 34962 34588 gene locus_tag LOCUS_03660 34962 34588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 37662 35110 gene locus_tag LOCUS_03670 gene leuS 37662 35110 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057933.1 protein_id gnl|my_center|LOCUS_03670 38208 38675 gene locus_tag LOCUS_03680 38208 38675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 38682 39050 gene locus_tag LOCUS_03690 38682 39050 CDS product DUF1818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 protein_id gnl|my_center|LOCUS_03690 39116 40186 gene locus_tag LOCUS_03700 39116 40186 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_03700 41192 40197 gene locus_tag LOCUS_03710 41192 40197 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 protein_id gnl|my_center|LOCUS_03710 41540 42010 gene locus_tag LOCUS_03720 41540 42010 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171945.1 protein_id gnl|my_center|LOCUS_03720 42755 41946 gene locus_tag LOCUS_03730 42755 41946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 43345 42758 gene locus_tag LOCUS_03740 43345 42758 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920984.1 protein_id gnl|my_center|LOCUS_03740 44785 43631 gene locus_tag LOCUS_03750 44785 43631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 45378 44788 gene locus_tag LOCUS_03760 45378 44788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03760 45890 46417 gene locus_tag LOCUS_03770 45890 46417 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_03770 46647 47681 gene locus_tag LOCUS_03780 gene trpD 46647 47681 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057551.1 protein_id gnl|my_center|LOCUS_03780 47960 49501 gene locus_tag LOCUS_03790 47960 49501 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_03790 50789 49755 gene locus_tag LOCUS_03800 50789 49755 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_03800 51308 52429 gene locus_tag LOCUS_03810 gene pstS 51308 52429 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_03810 52524 53483 gene locus_tag LOCUS_03820 gene pstC 52524 53483 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124751.1 protein_id gnl|my_center|LOCUS_03820 53575 54468 gene locus_tag LOCUS_03830 gene pstA 53575 54468 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_03830 54557 55360 gene locus_tag LOCUS_03840 gene pstB 54557 55360 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_03840 55517 56314 gene locus_tag LOCUS_03850 gene pstB 55517 56314 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_03850 57397 56381 gene locus_tag LOCUS_03860 57397 56381 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530078.1 protein_id gnl|my_center|LOCUS_03860 58013 58951 gene locus_tag LOCUS_03870 gene pstS 58013 58951 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_03870 59106 60101 gene locus_tag LOCUS_03880 gene pstC 59106 60101 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_03880 60106 60990 gene locus_tag LOCUS_03890 gene pstA 60106 60990 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_03890 61002 61811 gene locus_tag LOCUS_03900 gene pstB 61002 61811 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140451.1 protein_id gnl|my_center|LOCUS_03900 62215 62979 gene locus_tag LOCUS_03910 gene map 62215 62979 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142406.1 protein_id gnl|my_center|LOCUS_03910 63141 64322 gene locus_tag LOCUS_03920 63141 64322 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_03920 64928 64323 gene locus_tag LOCUS_03930 gene cobO 64928 64323 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_03930 65936 65151 gene locus_tag LOCUS_03940 65936 65151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence007 1566 142 gene locus_tag LOCUS_03950 1566 142 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_03950 2269 3255 gene locus_tag LOCUS_03960 2269 3255 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329020.1 protein_id gnl|my_center|LOCUS_03960 3356 3829 gene locus_tag LOCUS_03970 3356 3829 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_03970 5024 3933 gene locus_tag LOCUS_03980 5024 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 5755 5090 gene locus_tag LOCUS_03990 5755 5090 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921118.1 protein_id gnl|my_center|LOCUS_03990 5833 6549 gene locus_tag LOCUS_04000 5833 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 7524 6571 gene locus_tag LOCUS_04010 7524 6571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_04010 8007 8222 gene locus_tag LOCUS_04020 8007 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_04020 9140 8319 gene locus_tag LOCUS_04030 9140 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 9288 10172 gene locus_tag LOCUS_04040 9288 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 10421 11197 gene locus_tag LOCUS_04050 10421 11197 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_04050 12317 11187 gene locus_tag LOCUS_04060 12317 11187 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_04060 12747 13046 gene locus_tag LOCUS_04070 12747 13046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 14064 13831 gene locus_tag LOCUS_04080 gene rpmE 14064 13831 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125833.1 protein_id gnl|my_center|LOCUS_04080 14497 14084 gene locus_tag LOCUS_04090 gene rpsI 14497 14084 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055964.1 protein_id gnl|my_center|LOCUS_04090 14957 14502 gene locus_tag LOCUS_04100 gene rplM 14957 14502 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_04100 15905 15075 gene locus_tag LOCUS_04110 gene truA 15905 15075 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055962.1 protein_id gnl|my_center|LOCUS_04110 16240 15908 gene locus_tag LOCUS_04120 gene rplQ 16240 15908 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055961.1 protein_id gnl|my_center|LOCUS_04120 17221 16280 gene locus_tag LOCUS_04130 17221 16280 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143560.1 protein_id gnl|my_center|LOCUS_04130 17807 17415 gene locus_tag LOCUS_04140 gene rpsK 17807 17415 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055959.1 protein_id gnl|my_center|LOCUS_04140 18230 17847 gene locus_tag LOCUS_04150 gene rpsM 18230 17847 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_04150 18794 18564 gene locus_tag LOCUS_04160 gene infA 18794 18564 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_04160 19370 19104 gene locus_tag LOCUS_04170 19370 19104 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920742.1 protein_id gnl|my_center|LOCUS_04170 19531 20082 gene locus_tag LOCUS_04180 19531 20082 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920958.1 protein_id gnl|my_center|LOCUS_04180 20230 21696 gene locus_tag LOCUS_04190 20230 21696 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_04190 22490 21726 gene locus_tag LOCUS_04200 22490 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 23327 22560 gene locus_tag LOCUS_04210 23327 22560 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_04210 23402 24154 gene locus_tag LOCUS_04220 23402 24154 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_04220 24202 25494 gene locus_tag LOCUS_04230 24202 25494 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 protein_id gnl|my_center|LOCUS_04230 25644 26312 gene locus_tag LOCUS_04240 gene phoU 25644 26312 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583268.1 protein_id gnl|my_center|LOCUS_04240 27230 26361 gene locus_tag LOCUS_04250 27230 26361 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920815.1 protein_id gnl|my_center|LOCUS_04250 27543 28019 gene locus_tag LOCUS_04260 gene ndhN 27543 28019 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056972.1 protein_id gnl|my_center|LOCUS_04260 28450 28163 gene locus_tag LOCUS_04270 28450 28163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 28746 30188 gene locus_tag LOCUS_04280 gene gltX 28746 30188 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056357.1 protein_id gnl|my_center|LOCUS_04280 30441 31523 gene locus_tag LOCUS_04290 30441 31523 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388802.1 protein_id gnl|my_center|LOCUS_04290 31654 33066 gene locus_tag LOCUS_04300 31654 33066 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_04300 33066 34037 gene locus_tag LOCUS_04310 33066 34037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 34278 34646 gene locus_tag LOCUS_04320 34278 34646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 35929 34988 gene locus_tag LOCUS_04330 35929 34988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 36160 37419 gene locus_tag LOCUS_04340 gene coaBC 36160 37419 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_04340 37463 37762 gene locus_tag LOCUS_04350 37463 37762 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_04350 38273 37833 gene locus_tag LOCUS_04360 38273 37833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 39774 38641 gene locus_tag LOCUS_04370 39774 38641 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_04370 39994 41184 gene locus_tag LOCUS_04380 39994 41184 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228024.1 protein_id gnl|my_center|LOCUS_04380 41197 41913 gene locus_tag LOCUS_04390 gene fabG 41197 41913 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 protein_id gnl|my_center|LOCUS_04390 42137 42349 gene locus_tag LOCUS_04400 42137 42349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 42429 43424 gene locus_tag LOCUS_04410 42429 43424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 43576 44670 gene locus_tag LOCUS_04420 43576 44670 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_04420 44896 46113 gene locus_tag LOCUS_04430 gene chlP 44896 46113 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_04430 46681 47625 gene locus_tag LOCUS_04440 46681 47625 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_04440 47696 48883 gene locus_tag LOCUS_04450 47696 48883 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799340.1 protein_id gnl|my_center|LOCUS_04450 50754 49450 gene locus_tag LOCUS_04460 50754 49450 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_04460 52271 51033 gene locus_tag LOCUS_04470 52271 51033 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_04470 53542 52463 gene locus_tag LOCUS_04480 gene fba 53542 52463 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_04480 54802 53675 gene locus_tag LOCUS_04490 54802 53675 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_04490 55355 56830 gene locus_tag LOCUS_04500 55355 56830 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 protein_id gnl|my_center|LOCUS_04500 58055 58498 gene locus_tag LOCUS_04510 58055 58498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 58633 59817 gene locus_tag LOCUS_04520 58633 59817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 59895 61772 gene locus_tag LOCUS_04530 gene ftsH 59895 61772 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_04530 62083 62415 gene locus_tag LOCUS_04540 62083 62415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 62521 63894 gene locus_tag LOCUS_04550 62521 63894 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence008 223 498 gene locus_tag LOCUS_04560 223 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 495 860 gene locus_tag LOCUS_04570 495 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1110 1385 gene locus_tag LOCUS_04580 1110 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_04580 1385 1750 gene locus_tag LOCUS_04590 1385 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2280 2516 gene locus_tag LOCUS_04600 2280 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2497 2805 gene locus_tag LOCUS_04610 2497 2805 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_04610 3284 3523 gene locus_tag LOCUS_04620 3284 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3516 3905 gene locus_tag LOCUS_04630 3516 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4143 4373 gene locus_tag LOCUS_04640 4143 4373 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_04640 4377 4748 gene locus_tag LOCUS_04650 4377 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4941 5429 gene locus_tag LOCUS_04660 4941 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 5432 5635 gene locus_tag LOCUS_04670 5432 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 5860 6102 gene locus_tag LOCUS_04680 5860 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 6089 6304 gene locus_tag LOCUS_04690 6089 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 7516 6359 gene locus_tag LOCUS_04700 gene bioF 7516 6359 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140400.1 protein_id gnl|my_center|LOCUS_04700 7923 7564 gene locus_tag LOCUS_04710 7923 7564 CDS product DUF6464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057913.1 protein_id gnl|my_center|LOCUS_04710 8132 8680 gene locus_tag LOCUS_04720 8132 8680 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920976.1 protein_id gnl|my_center|LOCUS_04720 8898 8823 gene locus_tag LOCUS_t00020 8898 8823 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9254 9063 gene locus_tag LOCUS_04730 9254 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 9461 11986 gene locus_tag LOCUS_04740 9461 11986 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_04740 13448 12066 gene locus_tag LOCUS_04750 13448 12066 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_04750 13558 14406 gene locus_tag LOCUS_04760 13558 14406 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_04760 15401 15165 gene locus_tag LOCUS_04770 15401 15165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 16640 15948 gene locus_tag LOCUS_04780 16640 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 16935 16654 gene locus_tag LOCUS_04790 16935 16654 CDS product sulfiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 protein_id gnl|my_center|LOCUS_04790 17051 17200 gene locus_tag LOCUS_04800 17051 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 17369 17707 gene locus_tag LOCUS_04810 17369 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 18751 18194 gene locus_tag LOCUS_04820 18751 18194 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_04820 18930 19424 gene locus_tag LOCUS_04830 18930 19424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 19568 20668 gene locus_tag LOCUS_04840 19568 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 20728 21336 gene locus_tag LOCUS_04850 20728 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 21376 25011 gene locus_tag LOCUS_04860 21376 25011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 25022 25378 gene locus_tag LOCUS_04870 25022 25378 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 protein_id gnl|my_center|LOCUS_04870 25375 25686 gene locus_tag LOCUS_04880 25375 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 25921 26193 gene locus_tag LOCUS_04890 25921 26193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 26180 26455 gene locus_tag LOCUS_04900 26180 26455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 26630 26923 gene locus_tag LOCUS_04910 26630 26923 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_04910 26920 27279 gene locus_tag LOCUS_04920 26920 27279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 28449 27637 gene locus_tag LOCUS_04930 gene murI 28449 27637 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_04930 30445 28547 gene locus_tag LOCUS_04940 30445 28547 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920663.1 protein_id gnl|my_center|LOCUS_04940 32153 30765 gene locus_tag LOCUS_04950 32153 30765 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_04950 33645 32419 gene locus_tag LOCUS_04960 33645 32419 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 protein_id gnl|my_center|LOCUS_04960 35841 33808 gene locus_tag LOCUS_04970 35841 33808 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 protein_id gnl|my_center|LOCUS_04970 36174 37313 gene locus_tag LOCUS_04980 gene ychF 36174 37313 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_04980 37718 39751 gene locus_tag LOCUS_04990 37718 39751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 40150 40791 gene locus_tag LOCUS_05000 40150 40791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 43036 41495 gene locus_tag LOCUS_05010 43036 41495 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_05010 43544 43816 gene locus_tag LOCUS_05020 43544 43816 CDS product PipX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_05020 43820 44479 gene locus_tag LOCUS_05030 43820 44479 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_05030 44828 45400 gene locus_tag LOCUS_05040 44828 45400 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928580.1 protein_id gnl|my_center|LOCUS_05040 45462 46337 gene locus_tag LOCUS_05050 gene proC 45462 46337 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_05050 46416 47936 gene locus_tag LOCUS_05060 46416 47936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 48492 47956 gene locus_tag LOCUS_05070 48492 47956 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 protein_id gnl|my_center|LOCUS_05070 48574 48645 gene locus_tag LOCUS_t00030 48574 48645 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 48803 49150 gene locus_tag LOCUS_05080 48803 49150 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140974.1 protein_id gnl|my_center|LOCUS_05080 49340 50764 gene locus_tag LOCUS_05090 49340 50764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 51056 50841 gene locus_tag LOCUS_05100 51056 50841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 51209 51331 gene locus_tag LOCUS_05110 51209 51331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 51343 51663 gene locus_tag LOCUS_05120 51343 51663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 51862 53577 gene locus_tag LOCUS_05130 51862 53577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 54276 54668 gene locus_tag LOCUS_05140 54276 54668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 54661 54957 gene locus_tag LOCUS_05150 54661 54957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 55392 55766 gene locus_tag LOCUS_05160 55392 55766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 55763 56068 gene locus_tag LOCUS_05170 55763 56068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 56119 56322 gene locus_tag LOCUS_05180 56119 56322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 56432 56668 gene locus_tag LOCUS_05190 56432 56668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 56646 57029 gene locus_tag LOCUS_05200 56646 57029 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_05200 59806 57431 gene locus_tag LOCUS_05210 59806 57431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 60278 61120 gene locus_tag LOCUS_05220 60278 61120 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056332.1 protein_id gnl|my_center|LOCUS_05220 61177 61491 gene locus_tag LOCUS_05230 gene kaiB 61177 61491 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_05230 61685 63247 gene locus_tag LOCUS_05240 gene kaiC 61685 63247 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056334.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence009 828 433 gene locus_tag LOCUS_05250 gene queF 828 433 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_05250 1195 2376 gene locus_tag LOCUS_05260 1195 2376 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_05260 2399 2866 gene locus_tag LOCUS_05270 2399 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2881 3582 gene locus_tag LOCUS_05280 gene pyrF 2881 3582 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141657.1 protein_id gnl|my_center|LOCUS_05280 3546 4082 gene locus_tag LOCUS_05290 3546 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4963 4079 gene locus_tag LOCUS_05300 gene prmC 4963 4079 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187304.1 protein_id gnl|my_center|LOCUS_05300 5766 4969 gene locus_tag LOCUS_05310 5766 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057863.1 protein_id gnl|my_center|LOCUS_05310 6807 6373 gene locus_tag LOCUS_05320 6807 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 7157 7084 gene locus_tag LOCUS_t00040 7157 7084 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7260 7646 gene locus_tag LOCUS_05330 7260 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 8285 7782 gene locus_tag LOCUS_05340 8285 7782 CDS product DUF3122 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 protein_id gnl|my_center|LOCUS_05340 8613 11240 gene locus_tag LOCUS_05350 8613 11240 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_05350 11629 11249 gene locus_tag LOCUS_05360 11629 11249 CDS product DUF1830 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057308.1 protein_id gnl|my_center|LOCUS_05360 12478 15225 gene locus_tag LOCUS_05370 12478 15225 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_05370 15254 15424 gene locus_tag LOCUS_05380 15254 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 15434 16885 gene locus_tag LOCUS_05390 15434 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 17161 17559 gene locus_tag LOCUS_05400 17161 17559 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_05400 17574 17945 gene locus_tag LOCUS_05410 17574 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 17932 18252 gene locus_tag LOCUS_05420 17932 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 18277 19764 gene locus_tag LOCUS_05430 18277 19764 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_05430 20128 20340 gene locus_tag LOCUS_05440 20128 20340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05440 20968 20459 gene locus_tag LOCUS_05450 20968 20459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 22203 20965 gene locus_tag LOCUS_05460 22203 20965 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_05460 25152 22447 gene locus_tag LOCUS_05470 25152 22447 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_05470 25665 25327 gene locus_tag LOCUS_05480 25665 25327 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_05480 26517 25810 gene locus_tag LOCUS_05490 26517 25810 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_05490 26594 27772 gene locus_tag LOCUS_05500 26594 27772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 28599 28090 gene locus_tag LOCUS_05510 28599 28090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 28860 29111 gene locus_tag LOCUS_05520 28860 29111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 29113 29619 gene locus_tag LOCUS_05530 29113 29619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 33691 29705 gene locus_tag LOCUS_05540 33691 29705 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 protein_id gnl|my_center|LOCUS_05540 34741 38964 gene locus_tag LOCUS_05550 34741 38964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 39661 40536 gene locus_tag LOCUS_05560 39661 40536 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403590.1 protein_id gnl|my_center|LOCUS_05560 41345 40533 gene locus_tag LOCUS_05570 gene lpxC 41345 40533 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_05570 43415 41430 gene locus_tag LOCUS_05580 43415 41430 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 protein_id gnl|my_center|LOCUS_05580 44655 43777 gene locus_tag LOCUS_05590 44655 43777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 46120 45014 gene locus_tag LOCUS_05600 46120 45014 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_05600 46817 46668 gene locus_tag LOCUS_05610 46817 46668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 46857 47252 gene locus_tag LOCUS_05620 46857 47252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 47249 47557 gene locus_tag LOCUS_05630 47249 47557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 50456 48027 gene locus_tag LOCUS_05640 50456 48027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 51460 50456 gene locus_tag LOCUS_05650 51460 50456 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_05650 52396 52061 gene locus_tag LOCUS_05660 52396 52061 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142155.1 protein_id gnl|my_center|LOCUS_05660 52810 52412 gene locus_tag LOCUS_05670 52810 52412 CDS product chaperonin family protein RbcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_05670 54356 52941 gene locus_tag LOCUS_05680 54356 52941 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142153.1 protein_id gnl|my_center|LOCUS_05680 55570 54908 gene locus_tag LOCUS_05690 55570 54908 CDS product carbon dioxide concentrating mechanism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142090.1 protein_id gnl|my_center|LOCUS_05690 57660 55702 gene locus_tag LOCUS_05700 57660 55702 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171949.1 protein_id gnl|my_center|LOCUS_05700 58042 57731 gene locus_tag LOCUS_05710 58042 57731 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_05710 58416 58075 gene locus_tag LOCUS_05720 58416 58075 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_05720 58794 58483 gene locus_tag LOCUS_05730 58794 58483 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_05730 59935 59651 gene locus_tag LOCUS_05740 59935 59651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 60301 61641 gene locus_tag LOCUS_05750 gene miaB 60301 61641 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057155.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence010 554 883 gene locus_tag LOCUS_05760 554 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1213 3381 gene locus_tag LOCUS_05770 gene ppk1 1213 3381 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_05770 3617 3862 gene locus_tag LOCUS_05780 3617 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 4261 5736 gene locus_tag LOCUS_05790 4261 5736 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_05790 7987 6263 gene locus_tag LOCUS_05800 7987 6263 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 protein_id gnl|my_center|LOCUS_05800 9279 8569 gene locus_tag LOCUS_05810 9279 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 9885 11288 gene locus_tag LOCUS_05820 gene lysA 9885 11288 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057598.1 protein_id gnl|my_center|LOCUS_05820 11310 12230 gene locus_tag LOCUS_05830 gene cdaA 11310 12230 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 protein_id gnl|my_center|LOCUS_05830 12227 12976 gene locus_tag LOCUS_05840 gene uppS 12227 12976 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 protein_id gnl|my_center|LOCUS_05840 13215 13529 gene locus_tag LOCUS_05850 13215 13529 CDS product DUF1825 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_05850 13660 14772 gene locus_tag LOCUS_05860 13660 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 15940 14891 gene locus_tag LOCUS_05870 15940 14891 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057531.1 protein_id gnl|my_center|LOCUS_05870 16075 16002 gene locus_tag LOCUS_t00050 16075 16002 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17021 16122 gene locus_tag LOCUS_05880 gene speB 17021 16122 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_05880 17530 17928 gene locus_tag LOCUS_05890 17530 17928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 18180 18443 gene locus_tag LOCUS_05900 18180 18443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 19400 18603 gene locus_tag LOCUS_05910 19400 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 20038 21273 gene locus_tag LOCUS_05920 20038 21273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 21655 21894 gene locus_tag LOCUS_05930 21655 21894 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_05930 21854 22117 gene locus_tag LOCUS_05940 21854 22117 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_05940 22837 22439 gene locus_tag LOCUS_05950 22837 22439 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_05950 23079 22834 gene locus_tag LOCUS_05960 23079 22834 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_05960 23369 23659 gene locus_tag LOCUS_05970 23369 23659 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_05970 23669 23959 gene locus_tag LOCUS_05980 23669 23959 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_05980 24230 25030 gene locus_tag LOCUS_05990 gene cobA 24230 25030 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 protein_id gnl|my_center|LOCUS_05990 25041 25460 gene locus_tag LOCUS_06000 25041 25460 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_06000 25593 26087 gene locus_tag LOCUS_06010 25593 26087 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058243.1 protein_id gnl|my_center|LOCUS_06010 26428 28026 gene locus_tag LOCUS_06020 26428 28026 CDS product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_06020 28963 28013 gene locus_tag LOCUS_06030 28963 28013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 29242 29030 gene locus_tag LOCUS_06040 29242 29030 CDS product DUF3148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530158.1 protein_id gnl|my_center|LOCUS_06040 29634 30269 gene locus_tag LOCUS_06050 29634 30269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 30443 30688 gene locus_tag LOCUS_06060 30443 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 30685 31185 gene locus_tag LOCUS_06070 30685 31185 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_06070 32417 31518 gene locus_tag LOCUS_06080 32417 31518 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 protein_id gnl|my_center|LOCUS_06080 33090 33716 gene locus_tag LOCUS_06090 gene tenA 33090 33716 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877712.1 protein_id gnl|my_center|LOCUS_06090 33732 34139 gene locus_tag LOCUS_06100 33732 34139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 34238 34543 gene locus_tag LOCUS_06110 34238 34543 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_06110 34663 35208 gene locus_tag LOCUS_06120 34663 35208 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_06120 35215 38736 gene locus_tag LOCUS_06130 35215 38736 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_06130 38708 39214 gene locus_tag LOCUS_06140 38708 39214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 39106 39486 gene locus_tag LOCUS_06150 39106 39486 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_06150 39561 42539 gene locus_tag LOCUS_06160 39561 42539 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_06160 42616 42825 gene locus_tag LOCUS_06170 42616 42825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 42822 43235 gene locus_tag LOCUS_06180 42822 43235 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633012.1 protein_id gnl|my_center|LOCUS_06180 43487 44827 gene locus_tag LOCUS_06190 43487 44827 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_06190 44832 45350 gene locus_tag LOCUS_06200 44832 45350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_06200 45571 48963 gene locus_tag LOCUS_06210 45571 48963 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_06210 49832 49266 gene locus_tag LOCUS_06220 49832 49266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 51525 50065 gene locus_tag LOCUS_06230 51525 50065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 52032 54281 gene locus_tag LOCUS_06240 gene psaA 52032 54281 CDS product photosystem I core protein PsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920748.1 protein_id gnl|my_center|LOCUS_06240 54460 56673 gene locus_tag LOCUS_06250 gene psaB 54460 56673 CDS product photosystem I core protein PsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056579.1 protein_id gnl|my_center|LOCUS_06250 56963 57337 gene locus_tag LOCUS_06260 56963 57337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence011 145 669 gene locus_tag LOCUS_06270 gene ilvN 145 669 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_06270 778 3030 gene locus_tag LOCUS_06280 778 3030 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_06280 5050 3359 gene locus_tag LOCUS_06290 5050 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4953 5216 gene locus_tag LOCUS_06300 4953 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 5718 5203 gene locus_tag LOCUS_06310 gene pgsA 5718 5203 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_06310 6987 5893 gene locus_tag LOCUS_06320 6987 5893 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_06320 7233 8381 gene locus_tag LOCUS_06330 7233 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 8398 9762 gene locus_tag LOCUS_06340 8398 9762 CDS product DUF1822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057814.1 protein_id gnl|my_center|LOCUS_06340 9795 12362 gene locus_tag LOCUS_06350 9795 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 12470 13189 gene locus_tag LOCUS_06360 12470 13189 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143369.1 protein_id gnl|my_center|LOCUS_06360 13201 14550 gene locus_tag LOCUS_06370 13201 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 14814 15524 gene locus_tag LOCUS_06380 14814 15524 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_06380 15937 18603 gene locus_tag LOCUS_06390 15937 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 18879 18682 gene locus_tag LOCUS_06400 18879 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 19129 18800 gene locus_tag LOCUS_06410 19129 18800 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_06410 19639 19151 gene locus_tag LOCUS_06420 19639 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 19572 19760 gene locus_tag LOCUS_06430 19572 19760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 20280 21008 gene locus_tag LOCUS_06440 20280 21008 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_06440 21037 21360 gene locus_tag LOCUS_06450 21037 21360 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140295.1 protein_id gnl|my_center|LOCUS_06450 21479 22252 gene locus_tag LOCUS_06460 gene cbiQ 21479 22252 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140294.1 protein_id gnl|my_center|LOCUS_06460 22372 23148 gene locus_tag LOCUS_06470 22372 23148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_06470 23260 24450 gene locus_tag LOCUS_06480 23260 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 27073 24833 gene locus_tag LOCUS_06490 27073 24833 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920844.1 protein_id gnl|my_center|LOCUS_06490 27991 27299 gene locus_tag LOCUS_06500 27991 27299 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_06500 28627 28133 gene locus_tag LOCUS_06510 28627 28133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 30336 28675 gene locus_tag LOCUS_06520 30336 28675 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929004.1 protein_id gnl|my_center|LOCUS_06520 32155 30413 gene locus_tag LOCUS_06530 32155 30413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 protein_id gnl|my_center|LOCUS_06530 33413 34735 gene locus_tag LOCUS_06540 33413 34735 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057190.1 protein_id gnl|my_center|LOCUS_06540 34880 35707 gene locus_tag LOCUS_06550 gene ntrB 34880 35707 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142085.1 protein_id gnl|my_center|LOCUS_06550 35841 37847 gene locus_tag LOCUS_06560 35841 37847 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057192.1 protein_id gnl|my_center|LOCUS_06560 38121 39119 gene locus_tag LOCUS_06570 38121 39119 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142088.1 protein_id gnl|my_center|LOCUS_06570 40016 39390 gene locus_tag LOCUS_06580 40016 39390 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_06580 40261 42192 gene locus_tag LOCUS_06590 40261 42192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 43808 42273 gene locus_tag LOCUS_06600 43808 42273 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_06600 45418 43877 gene locus_tag LOCUS_06610 45418 43877 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_06610 46618 45587 gene locus_tag LOCUS_06620 gene lpxD 46618 45587 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142707.1 protein_id gnl|my_center|LOCUS_06620 47694 46810 gene locus_tag LOCUS_06630 47694 46810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 48005 49030 gene locus_tag LOCUS_06640 48005 49030 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920628.1 protein_id gnl|my_center|LOCUS_06640 49113 49808 gene locus_tag LOCUS_06650 gene fabG 49113 49808 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144338.1 protein_id gnl|my_center|LOCUS_06650 49878 50513 gene locus_tag LOCUS_06660 gene plsY 49878 50513 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531489.1 protein_id gnl|my_center|LOCUS_06660 51580 50579 gene locus_tag LOCUS_06670 51580 50579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 53220 51715 gene locus_tag LOCUS_06680 53220 51715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 53348 53420 gene locus_tag LOCUS_t00060 53348 53420 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 54789 53440 gene locus_tag LOCUS_06690 54789 53440 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921237.1 protein_id gnl|my_center|LOCUS_06690 55020 54838 gene locus_tag LOCUS_06700 55020 54838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 55109 55582 gene locus_tag LOCUS_06710 55109 55582 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125731.1 protein_id gnl|my_center|LOCUS_06710 55586 56440 gene locus_tag LOCUS_06720 55586 56440 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_06720 56702 56773 gene locus_tag LOCUS_t00070 56702 56773 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 57072 56836 gene locus_tag LOCUS_06730 57072 56836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence012 458 1384 gene locus_tag LOCUS_06740 gene argF 458 1384 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920816.1 protein_id gnl|my_center|LOCUS_06740 1475 1942 gene locus_tag LOCUS_06750 1475 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797542.1 protein_id gnl|my_center|LOCUS_06750 3495 1993 gene locus_tag LOCUS_06760 gene malQ 3495 1993 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_06760 6016 3998 gene locus_tag LOCUS_06770 6016 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 6558 6019 gene locus_tag LOCUS_06780 6558 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 7095 6613 gene locus_tag LOCUS_06790 7095 6613 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_06790 7353 7283 gene locus_tag LOCUS_t00080 7353 7283 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8176 7439 gene locus_tag LOCUS_06800 8176 7439 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_06800 11191 8471 gene locus_tag LOCUS_06810 11191 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 12868 11573 gene locus_tag LOCUS_06820 12868 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 13183 12878 gene locus_tag LOCUS_06830 13183 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 13990 15537 gene locus_tag LOCUS_06840 13990 15537 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058282.1 protein_id gnl|my_center|LOCUS_06840 15534 17357 gene locus_tag LOCUS_06850 15534 17357 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 protein_id gnl|my_center|LOCUS_06850 17372 17695 gene locus_tag LOCUS_06860 17372 17695 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_06860 17702 18220 gene locus_tag LOCUS_06870 17702 18220 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140843.1 protein_id gnl|my_center|LOCUS_06870 18642 18304 gene locus_tag LOCUS_06880 gene psb28 18642 18304 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920702.1 protein_id gnl|my_center|LOCUS_06880 18843 20351 gene locus_tag LOCUS_06890 18843 20351 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920839.1 protein_id gnl|my_center|LOCUS_06890 22126 20579 gene locus_tag LOCUS_06900 22126 20579 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_06900 22521 22186 gene locus_tag LOCUS_06910 22521 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 22697 24298 gene locus_tag LOCUS_06920 22697 24298 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057237.1 protein_id gnl|my_center|LOCUS_06920 25004 26254 gene locus_tag LOCUS_06930 gene rpoD 25004 26254 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173878.1 protein_id gnl|my_center|LOCUS_06930 26549 28645 gene locus_tag LOCUS_06940 26549 28645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 28709 29038 gene locus_tag LOCUS_06950 28709 29038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 29181 30581 gene locus_tag LOCUS_06960 29181 30581 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_06960 30696 31133 gene locus_tag LOCUS_06970 30696 31133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 31172 32344 gene locus_tag LOCUS_06980 31172 32344 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_06980 32642 35428 gene locus_tag LOCUS_06990 32642 35428 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_06990 35897 36301 gene locus_tag LOCUS_07000 35897 36301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 36324 38165 gene locus_tag LOCUS_07010 36324 38165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07010 38274 39338 gene locus_tag LOCUS_07020 38274 39338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 39406 39600 gene locus_tag LOCUS_07030 39406 39600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 40095 39871 gene locus_tag LOCUS_07040 40095 39871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 40282 40082 gene locus_tag LOCUS_07050 40282 40082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 41043 40612 gene locus_tag LOCUS_07060 41043 40612 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227761.1 protein_id gnl|my_center|LOCUS_07060 41303 41052 gene locus_tag LOCUS_07070 41303 41052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 41872 42552 gene locus_tag LOCUS_07080 41872 42552 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056503.1 protein_id gnl|my_center|LOCUS_07080 42578 43339 gene locus_tag LOCUS_07090 42578 43339 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_07090 43348 44196 gene locus_tag LOCUS_07100 43348 44196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 44461 44234 gene locus_tag LOCUS_07110 44461 44234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 45721 44585 gene locus_tag LOCUS_07120 45721 44585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 47188 46196 gene locus_tag LOCUS_07130 47188 46196 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_07130 50305 47240 gene locus_tag LOCUS_07140 50305 47240 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_07140 51989 50529 gene locus_tag LOCUS_07150 51989 50529 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_07150 52253 53587 gene locus_tag LOCUS_07160 52253 53587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence013 574 1035 gene locus_tag LOCUS_07170 574 1035 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_07170 2352 1138 gene locus_tag LOCUS_07180 2352 1138 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_07180 2775 2431 gene locus_tag LOCUS_07190 2775 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_07190 3396 3202 gene locus_tag LOCUS_07200 3396 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 3755 4105 gene locus_tag LOCUS_07210 3755 4105 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 protein_id gnl|my_center|LOCUS_07210 4398 5327 gene locus_tag LOCUS_07220 4398 5327 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_07220 5350 5682 gene locus_tag LOCUS_07230 5350 5682 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174551.1 protein_id gnl|my_center|LOCUS_07230 6713 5796 gene locus_tag LOCUS_07240 6713 5796 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_07240 6975 7769 gene locus_tag LOCUS_07250 gene trpA 6975 7769 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056294.1 protein_id gnl|my_center|LOCUS_07250 9207 7852 gene locus_tag LOCUS_07260 9207 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 9509 9351 gene locus_tag LOCUS_07270 9509 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 10204 9980 gene locus_tag LOCUS_07280 10204 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 10446 10210 gene locus_tag LOCUS_07290 10446 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 11382 10648 gene locus_tag LOCUS_07300 11382 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 12937 11483 gene locus_tag LOCUS_07310 12937 11483 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625978.1 protein_id gnl|my_center|LOCUS_07310 15558 12940 gene locus_tag LOCUS_07320 15558 12940 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_07320 16033 15566 gene locus_tag LOCUS_07330 16033 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 16591 17190 gene locus_tag LOCUS_07340 16591 17190 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_07340 17360 18619 gene locus_tag LOCUS_07350 17360 18619 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_07350 19324 19040 gene locus_tag LOCUS_07360 19324 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 19464 19730 gene locus_tag LOCUS_07370 19464 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 19881 19714 gene locus_tag LOCUS_07380 19881 19714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 20378 20127 gene locus_tag LOCUS_07390 20378 20127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 20945 20382 gene locus_tag LOCUS_07400 20945 20382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 22129 20999 gene locus_tag LOCUS_07410 22129 20999 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_07410 22517 22161 gene locus_tag LOCUS_07420 22517 22161 CDS product DUF1823 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 protein_id gnl|my_center|LOCUS_07420 22715 23608 gene locus_tag LOCUS_07430 22715 23608 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 protein_id gnl|my_center|LOCUS_07430 24093 24587 gene locus_tag LOCUS_07440 24093 24587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 24565 25227 gene locus_tag LOCUS_07450 24565 25227 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058167.1 protein_id gnl|my_center|LOCUS_07450 25763 25380 gene locus_tag LOCUS_07460 25763 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 protein_id gnl|my_center|LOCUS_07460 25848 26762 gene locus_tag LOCUS_07470 gene hslO 25848 26762 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056651.1 protein_id gnl|my_center|LOCUS_07470 26826 28781 gene locus_tag LOCUS_07480 26826 28781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 29238 30449 gene locus_tag LOCUS_07490 29238 30449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 30560 32218 gene locus_tag LOCUS_07500 30560 32218 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_07500 32427 34076 gene locus_tag LOCUS_07510 32427 34076 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_07510 34477 34187 gene locus_tag LOCUS_07520 34477 34187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 36798 34531 gene locus_tag LOCUS_07530 36798 34531 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_07530 37119 37313 gene locus_tag LOCUS_07540 37119 37313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 37756 37340 gene locus_tag LOCUS_07550 37756 37340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 38260 39372 gene locus_tag LOCUS_07560 38260 39372 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 protein_id gnl|my_center|LOCUS_07560 40069 39515 gene locus_tag LOCUS_07570 40069 39515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 40193 40465 gene locus_tag LOCUS_07580 40193 40465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 40732 42408 gene locus_tag LOCUS_07590 40732 42408 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_07590 42487 42918 gene locus_tag LOCUS_07600 42487 42918 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140553.1 protein_id gnl|my_center|LOCUS_07600 43043 46201 gene locus_tag LOCUS_07610 43043 46201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 46446 46670 gene locus_tag LOCUS_07620 46446 46670 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_07620 46667 46999 gene locus_tag LOCUS_07630 46667 46999 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_07630 47201 47431 gene locus_tag LOCUS_07640 47201 47431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 47421 47804 gene locus_tag LOCUS_07650 47421 47804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 49268 47925 gene locus_tag LOCUS_07660 49268 47925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 51021 49576 gene locus_tag LOCUS_07670 51021 49576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 51746 51018 gene locus_tag LOCUS_07680 51746 51018 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_07680 52088 52795 gene locus_tag LOCUS_07690 52088 52795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence014 281 919 gene locus_tag LOCUS_07700 281 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1114 2394 gene locus_tag LOCUS_07710 1114 2394 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776584.1 protein_id gnl|my_center|LOCUS_07710 2814 5894 gene locus_tag LOCUS_07720 2814 5894 CDS product patatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928891.1 protein_id gnl|my_center|LOCUS_07720 7674 6097 gene locus_tag LOCUS_07730 7674 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 8842 7757 gene locus_tag LOCUS_07740 gene cax 8842 7757 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_07740 9300 8839 gene locus_tag LOCUS_07750 9300 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 9860 9552 gene locus_tag LOCUS_07760 9860 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057985.1 protein_id gnl|my_center|LOCUS_07760 11064 10213 gene locus_tag LOCUS_07770 11064 10213 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_07770 11269 11748 gene locus_tag LOCUS_07780 11269 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 12155 12427 gene locus_tag LOCUS_07790 12155 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 14129 12654 gene locus_tag LOCUS_07800 14129 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 16077 14134 gene locus_tag LOCUS_07810 16077 14134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 16530 16141 gene locus_tag LOCUS_07820 16530 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 17114 16551 gene locus_tag LOCUS_07830 17114 16551 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141208.1 protein_id gnl|my_center|LOCUS_07830 17903 17124 gene locus_tag LOCUS_07840 gene cmr4 17903 17124 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_07840 19470 18346 gene locus_tag LOCUS_07850 19470 18346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 22481 19443 gene locus_tag LOCUS_07860 22481 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 23518 24537 gene locus_tag LOCUS_07870 23518 24537 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_07870 26015 24582 gene locus_tag LOCUS_07880 26015 24582 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920889.1 protein_id gnl|my_center|LOCUS_07880 26428 26084 gene locus_tag LOCUS_07890 26428 26084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056902.1 protein_id gnl|my_center|LOCUS_07890 26816 27649 gene locus_tag LOCUS_07900 26816 27649 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056297.1 protein_id gnl|my_center|LOCUS_07900 28648 27866 gene locus_tag LOCUS_07910 28648 27866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 29826 28645 gene locus_tag LOCUS_07920 29826 28645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 31288 30137 gene locus_tag LOCUS_07930 31288 30137 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_07930 31488 31937 gene locus_tag LOCUS_07940 31488 31937 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_07940 31950 32699 gene locus_tag LOCUS_07950 31950 32699 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_07950 34283 32718 gene locus_tag LOCUS_07960 34283 32718 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_07960 37745 34443 gene locus_tag LOCUS_07970 37745 34443 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_07970 38951 37752 gene locus_tag LOCUS_07980 38951 37752 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_07980 40385 39252 gene locus_tag LOCUS_07990 40385 39252 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_07990 40679 40858 gene locus_tag LOCUS_08000 40679 40858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 40934 41281 gene locus_tag LOCUS_08010 40934 41281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 41396 43387 gene locus_tag LOCUS_08020 41396 43387 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_08020 43727 43368 gene locus_tag LOCUS_08030 43727 43368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 44332 43925 gene locus_tag LOCUS_08040 44332 43925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 44377 45282 gene locus_tag LOCUS_08050 44377 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 45628 46356 gene locus_tag LOCUS_08060 45628 46356 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 protein_id gnl|my_center|LOCUS_08060 46406 47104 gene locus_tag LOCUS_08070 gene folE 46406 47104 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_08070 47798 47160 gene locus_tag LOCUS_08080 47798 47160 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140756.1 protein_id gnl|my_center|LOCUS_08080 47919 48185 gene locus_tag LOCUS_08090 gene psaK 47919 48185 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_08090 48776 48534 gene locus_tag LOCUS_08100 48776 48534 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878574.1 protein_id gnl|my_center|LOCUS_08100 49020 48793 gene locus_tag LOCUS_08110 49020 48793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 49828 49301 gene locus_tag LOCUS_08120 49828 49301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence015 2016 16 gene locus_tag LOCUS_08130 2016 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2628 2170 gene locus_tag LOCUS_08140 2628 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4476 2671 gene locus_tag LOCUS_08150 4476 2671 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_08150 6496 4970 gene locus_tag LOCUS_08160 6496 4970 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058227.1 protein_id gnl|my_center|LOCUS_08160 6816 7526 gene locus_tag LOCUS_08170 6816 7526 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_08170 7523 8863 gene locus_tag LOCUS_08180 7523 8863 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_08180 8865 9275 gene locus_tag LOCUS_08190 8865 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 11196 9562 gene locus_tag LOCUS_08200 11196 9562 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_08200 14483 11514 gene locus_tag LOCUS_08210 gene pruA 14483 11514 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 protein_id gnl|my_center|LOCUS_08210 15004 16158 gene locus_tag LOCUS_08220 15004 16158 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057128.1 protein_id gnl|my_center|LOCUS_08220 16464 16276 gene locus_tag LOCUS_08230 16464 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 16588 17934 gene locus_tag LOCUS_08240 16588 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 17916 18911 gene locus_tag LOCUS_08250 17916 18911 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778163.1 protein_id gnl|my_center|LOCUS_08250 18920 21640 gene locus_tag LOCUS_08260 18920 21640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 22182 22406 gene locus_tag LOCUS_08270 22182 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 22430 22750 gene locus_tag LOCUS_08280 22430 22750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083794109.1 protein_id gnl|my_center|LOCUS_08280 22738 22953 gene locus_tag LOCUS_08290 22738 22953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 23167 23391 gene locus_tag LOCUS_08300 23167 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 23641 25989 gene locus_tag LOCUS_08310 23641 25989 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096663323.1 protein_id gnl|my_center|LOCUS_08310 26025 26666 gene locus_tag LOCUS_08320 26025 26666 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 protein_id gnl|my_center|LOCUS_08320 27274 26702 gene locus_tag LOCUS_08330 27274 26702 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_08330 27484 30342 gene locus_tag LOCUS_08340 gene ileS 27484 30342 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921027.1 protein_id gnl|my_center|LOCUS_08340 30427 31536 gene locus_tag LOCUS_08350 30427 31536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 31526 32026 gene locus_tag LOCUS_08360 31526 32026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 32152 32568 gene locus_tag LOCUS_08370 32152 32568 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_08370 34489 32609 gene locus_tag LOCUS_08380 34489 32609 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056488.1 protein_id gnl|my_center|LOCUS_08380 36175 34670 gene locus_tag LOCUS_08390 36175 34670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 37798 36218 gene locus_tag LOCUS_08400 37798 36218 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_08400 41444 38082 gene locus_tag LOCUS_08410 gene smc 41444 38082 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057762.1 protein_id gnl|my_center|LOCUS_08410 42055 41786 gene locus_tag LOCUS_08420 42055 41786 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 protein_id gnl|my_center|LOCUS_08420 42377 43624 gene locus_tag LOCUS_08430 42377 43624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 44990 43917 gene locus_tag LOCUS_08440 44990 43917 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106290870.1 protein_id gnl|my_center|LOCUS_08440 46178 45000 gene locus_tag LOCUS_08450 46178 45000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 47957 46290 gene locus_tag LOCUS_08460 gene nadB 47957 46290 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058240.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence016 <1 733 gene locus_tag LOCUS_08470 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099258551.1:cadherin domain-containing protein 921 1550 gene locus_tag LOCUS_08480 921 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1630 4809 gene locus_tag LOCUS_08490 1630 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5839 4958 gene locus_tag LOCUS_08500 5839 4958 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056446.1 protein_id gnl|my_center|LOCUS_08500 5851 7071 gene locus_tag LOCUS_08510 5851 7071 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_08510 8218 7292 gene locus_tag LOCUS_08520 gene fabD 8218 7292 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920631.1 protein_id gnl|my_center|LOCUS_08520 9331 8357 gene locus_tag LOCUS_08530 9331 8357 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056689.1 protein_id gnl|my_center|LOCUS_08530 10611 9556 gene locus_tag LOCUS_08540 gene plsX 10611 9556 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056688.1 protein_id gnl|my_center|LOCUS_08540 10761 12053 gene locus_tag LOCUS_08550 10761 12053 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_08550 13621 12560 gene locus_tag LOCUS_08560 gene argC 13621 12560 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058053.1 protein_id gnl|my_center|LOCUS_08560 14159 13896 gene locus_tag LOCUS_08570 14159 13896 CDS product DUF3146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_08570 15166 14246 gene locus_tag LOCUS_08580 15166 14246 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 protein_id gnl|my_center|LOCUS_08580 15743 15543 gene locus_tag LOCUS_08590 15743 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08590 17164 17682 gene locus_tag LOCUS_08600 17164 17682 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_08600 17749 18237 gene locus_tag LOCUS_08610 gene cpcA 17749 18237 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_08610 18414 19292 gene locus_tag LOCUS_08620 18414 19292 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_08620 19430 21106 gene locus_tag LOCUS_08630 gene ribBA 19430 21106 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920923.1 protein_id gnl|my_center|LOCUS_08630 21173 21916 gene locus_tag LOCUS_08640 21173 21916 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929431.1 protein_id gnl|my_center|LOCUS_08640 23032 21974 gene locus_tag LOCUS_08650 23032 21974 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_08650 24329 23265 gene locus_tag LOCUS_08660 24329 23265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 24934 24332 gene locus_tag LOCUS_08670 24934 24332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 28925 25362 gene locus_tag LOCUS_08680 gene metH 28925 25362 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_08680 30194 29064 gene locus_tag LOCUS_08690 30194 29064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 31046 30414 gene locus_tag LOCUS_08700 31046 30414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142166.1 protein_id gnl|my_center|LOCUS_08700 31970 31473 gene locus_tag LOCUS_08710 31970 31473 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_08710 32283 32591 gene locus_tag LOCUS_08720 32283 32591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 32697 33140 gene locus_tag LOCUS_08730 32697 33140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 33496 33263 gene locus_tag LOCUS_08740 33496 33263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 35451 33913 gene locus_tag LOCUS_08750 35451 33913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 37108 35687 gene locus_tag LOCUS_08760 37108 35687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 37346 38455 gene locus_tag LOCUS_08770 37346 38455 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_08770 39060 40934 gene locus_tag LOCUS_08780 gene mrdA 39060 40934 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_08780 41737 40931 gene locus_tag LOCUS_08790 41737 40931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 41849 41755 gene locus_tag LOCUS_t00090 41849 41755 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 42629 41910 gene locus_tag LOCUS_08800 42629 41910 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_08800 43820 42648 gene locus_tag LOCUS_08810 gene devC 43820 42648 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_08810 45111 43828 gene locus_tag LOCUS_08820 45111 43828 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530103.1 protein_id gnl|my_center|LOCUS_08820 45715 45143 gene locus_tag LOCUS_08830 45715 45143 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124477.1 protein_id gnl|my_center|LOCUS_08830 45851 46141 gene locus_tag LOCUS_08840 45851 46141 CDS product DUF2288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence017 <1 5275 gene locus_tag LOCUS_08850 <1 5275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_128975410.1:non-ribosomal peptide synthase/polyketide synthase 5442 9656 gene locus_tag LOCUS_08860 5442 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 9934 10413 gene locus_tag LOCUS_08870 9934 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 10732 10568 gene locus_tag LOCUS_08880 10732 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 11238 10912 gene locus_tag LOCUS_08890 11238 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 11606 12394 gene locus_tag LOCUS_08900 11606 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 12433 13167 gene locus_tag LOCUS_08910 12433 13167 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_08910 13799 13542 gene locus_tag LOCUS_08920 13799 13542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 14091 13789 gene locus_tag LOCUS_08930 14091 13789 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680062.1 protein_id gnl|my_center|LOCUS_08930 14266 14505 gene locus_tag LOCUS_08940 14266 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 15207 14980 gene locus_tag LOCUS_08950 15207 14980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 15707 15210 gene locus_tag LOCUS_08960 15707 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 17738 15912 gene locus_tag LOCUS_08970 17738 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 18138 17905 gene locus_tag LOCUS_08980 18138 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 18608 18273 gene locus_tag LOCUS_08990 18608 18273 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_08990 18898 18605 gene locus_tag LOCUS_09000 18898 18605 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_09000 19728 18961 gene locus_tag LOCUS_09010 19728 18961 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119074.1 protein_id gnl|my_center|LOCUS_09010 20398 19742 gene locus_tag LOCUS_09020 20398 19742 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_09020 21004 20663 gene locus_tag LOCUS_09030 21004 20663 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057922.1 protein_id gnl|my_center|LOCUS_09030 21794 21093 gene locus_tag LOCUS_09040 21794 21093 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_09040 21982 22275 gene locus_tag LOCUS_09050 21982 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 23151 22621 gene locus_tag LOCUS_09060 gene infC 23151 22621 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_09060 23554 24981 gene locus_tag LOCUS_09070 23554 24981 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_09070 24992 25693 gene locus_tag LOCUS_09080 24992 25693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 26718 25891 gene locus_tag LOCUS_09090 26718 25891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 28204 26753 gene locus_tag LOCUS_09100 28204 26753 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_09100 29714 28419 gene locus_tag LOCUS_09110 gene purB 29714 28419 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057666.1 protein_id gnl|my_center|LOCUS_09110 31365 30031 gene locus_tag LOCUS_09120 31365 30031 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_09120 32308 31757 gene locus_tag LOCUS_09130 32308 31757 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_09130 32417 32932 gene locus_tag LOCUS_09140 32417 32932 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_09140 33076 33510 gene locus_tag LOCUS_09150 33076 33510 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 protein_id gnl|my_center|LOCUS_09150 34175 33507 gene locus_tag LOCUS_09160 34175 33507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 34347 35048 gene locus_tag LOCUS_09170 34347 35048 CDS product DUF3120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190832035.1 protein_id gnl|my_center|LOCUS_09170 35100 36134 gene locus_tag LOCUS_09180 35100 36134 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058242.1 protein_id gnl|my_center|LOCUS_09180 37251 36259 gene locus_tag LOCUS_09190 37251 36259 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_09190 38000 37485 gene locus_tag LOCUS_09200 gene nrdR 38000 37485 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_09200 38715 38323 gene locus_tag LOCUS_09210 gene rplL 38715 38323 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141601.1 protein_id gnl|my_center|LOCUS_09210 39307 38759 gene locus_tag LOCUS_09220 gene rplJ 39307 38759 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056152.1 protein_id gnl|my_center|LOCUS_09220 41076 39547 gene locus_tag LOCUS_09230 41076 39547 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_09230 41257 42351 gene locus_tag LOCUS_09240 41257 42351 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_09240 42344 43045 gene locus_tag LOCUS_09250 42344 43045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 43583 43098 gene locus_tag LOCUS_09260 gene psbV 43583 43098 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_09260 43918 43712 gene locus_tag LOCUS_09270 43918 43712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 44361 44630 gene locus_tag LOCUS_09280 44361 44630 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_09280 44643 45197 gene locus_tag LOCUS_09290 gene gmk 44643 45197 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence018 185 2257 gene locus_tag LOCUS_09300 185 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2487 3137 gene locus_tag LOCUS_09310 2487 3137 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_09310 3611 3099 gene locus_tag LOCUS_09320 3611 3099 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798971.1 protein_id gnl|my_center|LOCUS_09320 3995 3690 gene locus_tag LOCUS_09330 3995 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4462 4055 gene locus_tag LOCUS_09340 gene speD 4462 4055 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 protein_id gnl|my_center|LOCUS_09340 5300 4647 gene locus_tag LOCUS_09350 5300 4647 CDS product DUF4335 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056686.1 protein_id gnl|my_center|LOCUS_09350 5929 5303 gene locus_tag LOCUS_09360 5929 5303 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799761.1 protein_id gnl|my_center|LOCUS_09360 6028 6546 gene locus_tag LOCUS_09370 6028 6546 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_09370 6703 7764 gene locus_tag LOCUS_09380 6703 7764 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_09380 8126 8434 gene locus_tag LOCUS_09390 8126 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 8438 9316 gene locus_tag LOCUS_09400 8438 9316 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_09400 10864 9659 gene locus_tag LOCUS_09410 10864 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 10929 11078 gene locus_tag LOCUS_09420 10929 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 11985 11131 gene locus_tag LOCUS_09430 11985 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 13295 12015 gene locus_tag LOCUS_09440 13295 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 14259 13303 gene locus_tag LOCUS_09450 14259 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 16622 14421 gene locus_tag LOCUS_09460 16622 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 19414 16802 gene locus_tag LOCUS_09470 19414 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 20333 19419 gene locus_tag LOCUS_09480 20333 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 21165 20320 gene locus_tag LOCUS_09490 21165 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 21949 21185 gene locus_tag LOCUS_09500 21949 21185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 22279 22986 gene locus_tag LOCUS_09510 22279 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 23005 23916 gene locus_tag LOCUS_09520 23005 23916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 24178 24969 gene locus_tag LOCUS_09530 24178 24969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 24976 25482 gene locus_tag LOCUS_09540 24976 25482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929475.1 protein_id gnl|my_center|LOCUS_09540 25473 25949 gene locus_tag LOCUS_09550 25473 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 27985 25955 gene locus_tag LOCUS_09560 27985 25955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 30437 28320 gene locus_tag LOCUS_09570 30437 28320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 31444 30464 gene locus_tag LOCUS_09580 31444 30464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 33299 31476 gene locus_tag LOCUS_09590 33299 31476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 33927 33364 gene locus_tag LOCUS_09600 33927 33364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 35398 34016 gene locus_tag LOCUS_09610 35398 34016 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480136.1 protein_id gnl|my_center|LOCUS_09610 35814 35422 gene locus_tag LOCUS_09620 35814 35422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 38008 35834 gene locus_tag LOCUS_09630 38008 35834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 40313 38160 gene locus_tag LOCUS_09640 40313 38160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 41696 41202 gene locus_tag LOCUS_09650 41696 41202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 43159 41702 gene locus_tag LOCUS_09660 43159 41702 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 protein_id gnl|my_center|LOCUS_09660 43874 43272 gene locus_tag LOCUS_09670 43874 43272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 43958 44938 gene locus_tag LOCUS_09680 43958 44938 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243618.1 protein_id gnl|my_center|LOCUS_09680 45240 44962 gene locus_tag LOCUS_09690 45240 44962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence019 1538 216 gene locus_tag LOCUS_09700 1538 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3048 1531 gene locus_tag LOCUS_09710 3048 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3248 3096 gene locus_tag LOCUS_09720 3248 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3619 4434 gene locus_tag LOCUS_09730 3619 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 4654 5247 gene locus_tag LOCUS_09740 4654 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 5317 6894 gene locus_tag LOCUS_09750 gene dnaK 5317 6894 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_09750 6935 8521 gene locus_tag LOCUS_09760 6935 8521 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030106.1 protein_id gnl|my_center|LOCUS_09760 8711 9937 gene locus_tag LOCUS_09770 8711 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 9996 10361 gene locus_tag LOCUS_09780 9996 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 10434 10706 gene locus_tag LOCUS_09790 10434 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 10766 11224 gene locus_tag LOCUS_09800 10766 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 11260 12981 gene locus_tag LOCUS_09810 11260 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 12987 13535 gene locus_tag LOCUS_09820 12987 13535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 13577 13951 gene locus_tag LOCUS_09830 13577 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 14234 17317 gene locus_tag LOCUS_09840 14234 17317 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530011.1 protein_id gnl|my_center|LOCUS_09840 19838 17445 gene locus_tag LOCUS_09850 19838 17445 CDS product DUF3769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184012.1 protein_id gnl|my_center|LOCUS_09850 20479 21318 gene locus_tag LOCUS_09860 gene rsmI 20479 21318 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_09860 22524 21355 gene locus_tag LOCUS_09870 22524 21355 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_09870 23284 22556 gene locus_tag LOCUS_09880 gene lptB 23284 22556 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045053120.1 protein_id gnl|my_center|LOCUS_09880 23996 23496 gene locus_tag LOCUS_09890 23996 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 24469 24044 gene locus_tag LOCUS_09900 24469 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 24838 24479 gene locus_tag LOCUS_09910 24838 24479 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_09910 25094 25393 gene locus_tag LOCUS_09920 25094 25393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 25362 26009 gene locus_tag LOCUS_09930 25362 26009 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_09930 26393 26692 gene locus_tag LOCUS_09940 26393 26692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 27873 26941 gene locus_tag LOCUS_09950 27873 26941 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_09950 28473 30359 gene locus_tag LOCUS_09960 gene ftsH2 28473 30359 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_09960 30856 30644 gene locus_tag LOCUS_09970 30856 30644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 31859 30894 gene locus_tag LOCUS_09980 31859 30894 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_09980 31872 32213 gene locus_tag LOCUS_09990 31872 32213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 34742 32412 gene locus_tag LOCUS_10000 34742 32412 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 protein_id gnl|my_center|LOCUS_10000 34900 35775 gene locus_tag LOCUS_10010 34900 35775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 36374 37729 gene locus_tag LOCUS_10020 36374 37729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 38162 37941 gene locus_tag LOCUS_10030 38162 37941 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048105191.1 protein_id gnl|my_center|LOCUS_10030 38416 38159 gene locus_tag LOCUS_10040 38416 38159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 39253 38891 gene locus_tag LOCUS_10050 39253 38891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 39480 39256 gene locus_tag LOCUS_10060 39480 39256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 39723 40214 gene locus_tag LOCUS_10070 39723 40214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 40201 40410 gene locus_tag LOCUS_10080 40201 40410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 41019 42101 gene locus_tag LOCUS_10090 41019 42101 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_10090 42452 42832 gene locus_tag LOCUS_10100 42452 42832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 42832 43479 gene locus_tag LOCUS_10110 42832 43479 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_10110 44006 44878 gene locus_tag LOCUS_10120 44006 44878 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876261.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence020 1323 292 gene locus_tag LOCUS_10130 1323 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_10130 3331 1328 gene locus_tag LOCUS_10140 gene uvrB 3331 1328 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057868.1 protein_id gnl|my_center|LOCUS_10140 3523 4011 gene locus_tag LOCUS_10150 3523 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4092 4841 gene locus_tag LOCUS_10160 4092 4841 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_10160 8255 5145 gene locus_tag LOCUS_10170 8255 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 8365 9027 gene locus_tag LOCUS_10180 8365 9027 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_10180 9260 9172 gene locus_tag LOCUS_t00100 9260 9172 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9506 10447 gene locus_tag LOCUS_10190 9506 10447 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_10190 10444 12693 gene locus_tag LOCUS_10200 10444 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 12858 13226 gene locus_tag LOCUS_10210 12858 13226 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_10210 13241 14071 gene locus_tag LOCUS_10220 13241 14071 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_10220 14115 15056 gene locus_tag LOCUS_10230 14115 15056 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_10230 15094 16311 gene locus_tag LOCUS_10240 15094 16311 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056036.1 protein_id gnl|my_center|LOCUS_10240 16400 16912 gene locus_tag LOCUS_10250 16400 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 18146 17283 gene locus_tag LOCUS_10260 18146 17283 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_10260 18643 19146 gene locus_tag LOCUS_10270 18643 19146 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_10270 19759 19148 gene locus_tag LOCUS_10280 19759 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 19894 20559 gene locus_tag LOCUS_10290 19894 20559 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_10290 20710 21660 gene locus_tag LOCUS_10300 20710 21660 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_10300 21666 22256 gene locus_tag LOCUS_10310 gene wcaF 21666 22256 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_10310 22700 23326 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccaactaatcctatttgacctaataggtaagg 23988 24590 gene locus_tag LOCUS_10320 23988 24590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 24606 25634 gene locus_tag LOCUS_10330 24606 25634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 25642 27066 gene locus_tag LOCUS_10340 25642 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 27077 28060 gene locus_tag LOCUS_10350 27077 28060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 28342 28467 gene locus_tag LOCUS_10360 28342 28467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 28610 29437 gene locus_tag LOCUS_10370 gene cmr4 28610 29437 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_10370 29457 29864 gene locus_tag LOCUS_10380 29457 29864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 29870 31498 gene locus_tag LOCUS_10390 29870 31498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 32729 31821 gene locus_tag LOCUS_10400 32729 31821 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085605.1 protein_id gnl|my_center|LOCUS_10400 32885 34321 gene locus_tag LOCUS_10410 32885 34321 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_10410 34772 34476 gene locus_tag LOCUS_10420 34772 34476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 34945 34757 gene locus_tag LOCUS_10430 34945 34757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 35420 36112 gene locus_tag LOCUS_10440 35420 36112 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_10440 36402 36587 gene locus_tag LOCUS_10450 36402 36587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 36741 37520 gene locus_tag LOCUS_10460 36741 37520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 38309 37596 gene locus_tag LOCUS_10470 38309 37596 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921210.1 protein_id gnl|my_center|LOCUS_10470 38534 38449 gene locus_tag LOCUS_t00110 38534 38449 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38713 40038 gene locus_tag LOCUS_10480 gene murA 38713 40038 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056623.1 protein_id gnl|my_center|LOCUS_10480 40762 40160 gene locus_tag LOCUS_10490 40762 40160 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_10490 42128 41181 gene locus_tag LOCUS_10500 42128 41181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_10500 42634 43275 gene locus_tag LOCUS_10510 42634 43275 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007353051.1 protein_id gnl|my_center|LOCUS_10510 43394 44242 gene locus_tag LOCUS_10520 43394 44242 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_10520 44387 44659 gene locus_tag LOCUS_10530 44387 44659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence021 1549 326 gene locus_tag LOCUS_10540 1549 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2774 1833 gene locus_tag LOCUS_10550 2774 1833 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_10550 3160 4599 gene locus_tag LOCUS_10560 gene glmM 3160 4599 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013191710.1 protein_id gnl|my_center|LOCUS_10560 4657 6384 gene locus_tag LOCUS_10570 4657 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 6811 7806 gene locus_tag LOCUS_10580 6811 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 7803 8972 gene locus_tag LOCUS_10590 7803 8972 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_10590 9192 9776 gene locus_tag LOCUS_10600 9192 9776 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_10600 9776 10150 gene locus_tag LOCUS_10610 9776 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 10171 10671 gene locus_tag LOCUS_10620 10171 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 11924 10773 gene locus_tag LOCUS_10630 11924 10773 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_10630 12391 14241 gene locus_tag LOCUS_10640 12391 14241 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928942.1 protein_id gnl|my_center|LOCUS_10640 14287 15060 gene locus_tag LOCUS_10650 gene gloB 14287 15060 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057476.1 protein_id gnl|my_center|LOCUS_10650 18136 15443 gene locus_tag LOCUS_10660 gene adhE 18136 15443 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_10660 22149 18427 gene locus_tag LOCUS_10670 22149 18427 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203101.1 protein_id gnl|my_center|LOCUS_10670 22803 23381 gene locus_tag LOCUS_10680 22803 23381 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_10680 23714 24508 gene locus_tag LOCUS_10690 gene pgeF 23714 24508 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799068.1 protein_id gnl|my_center|LOCUS_10690 24550 25527 gene locus_tag LOCUS_10700 gene fmt 24550 25527 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406043.1 protein_id gnl|my_center|LOCUS_10700 25937 25557 gene locus_tag LOCUS_10710 25937 25557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 27414 26608 gene locus_tag LOCUS_10720 27414 26608 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 protein_id gnl|my_center|LOCUS_10720 27554 27775 gene locus_tag LOCUS_10730 27554 27775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 27889 28890 gene locus_tag LOCUS_10740 27889 28890 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_10740 29013 30758 gene locus_tag LOCUS_10750 29013 30758 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_10750 30770 32197 gene locus_tag LOCUS_10760 30770 32197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 32276 33091 gene locus_tag LOCUS_10770 32276 33091 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_10770 33205 33939 gene locus_tag LOCUS_10780 33205 33939 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_10780 34036 34893 gene locus_tag LOCUS_10790 34036 34893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 35081 35938 gene locus_tag LOCUS_10800 35081 35938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_10800 35952 36611 gene locus_tag LOCUS_10810 35952 36611 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 protein_id gnl|my_center|LOCUS_10810 36637 37506 gene locus_tag LOCUS_10820 gene garR 36637 37506 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_10820 38287 37937 gene locus_tag LOCUS_10830 38287 37937 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_10830 38942 38424 gene locus_tag LOCUS_10840 gene scpB 38942 38424 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056690.1 protein_id gnl|my_center|LOCUS_10840 39004 39816 gene locus_tag LOCUS_10850 39004 39816 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_10850 40073 40837 gene locus_tag LOCUS_10860 40073 40837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_10860 41430 41152 gene locus_tag LOCUS_10870 41430 41152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 41834 41472 gene locus_tag LOCUS_10880 41834 41472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 42205 41876 gene locus_tag LOCUS_10890 42205 41876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 44167 42584 gene locus_tag LOCUS_10900 gene ndhD1 44167 42584 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit D1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056566.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence022 591 379 gene locus_tag LOCUS_10910 591 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 840 682 gene locus_tag LOCUS_10920 840 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1292 1059 gene locus_tag LOCUS_10930 1292 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1603 1277 gene locus_tag LOCUS_10940 1603 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1986 3713 gene locus_tag LOCUS_10950 gene murJ 1986 3713 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058183.1 protein_id gnl|my_center|LOCUS_10950 4578 3928 gene locus_tag LOCUS_10960 4578 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 6013 4733 gene locus_tag LOCUS_10970 gene hisS 6013 4733 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057735.1 protein_id gnl|my_center|LOCUS_10970 7944 6034 gene locus_tag LOCUS_10980 7944 6034 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083788.1 protein_id gnl|my_center|LOCUS_10980 8441 11581 gene locus_tag LOCUS_10990 8441 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 11585 12295 gene locus_tag LOCUS_11000 11585 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 12303 12611 gene locus_tag LOCUS_11010 12303 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 12771 12690 gene locus_tag LOCUS_t00120 12771 12690 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 12845 12764 gene locus_tag LOCUS_t00130 12845 12764 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13742 12966 gene locus_tag LOCUS_11020 gene fabI 13742 12966 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_11020 13957 14634 gene locus_tag LOCUS_11030 gene ntcA 13957 14634 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 protein_id gnl|my_center|LOCUS_11030 14642 16129 gene locus_tag LOCUS_11040 14642 16129 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_11040 16739 16143 gene locus_tag LOCUS_11050 16739 16143 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_11050 17383 16808 gene locus_tag LOCUS_11060 17383 16808 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_11060 18674 17430 gene locus_tag LOCUS_11070 18674 17430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 20350 19028 gene locus_tag LOCUS_11080 20350 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 21300 20407 gene locus_tag LOCUS_11090 21300 20407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 22532 21546 gene locus_tag LOCUS_11100 gene ccsB 22532 21546 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057454.1 protein_id gnl|my_center|LOCUS_11100 22665 24629 gene locus_tag LOCUS_11110 gene ftsH 22665 24629 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_11110 26776 24875 gene locus_tag LOCUS_11120 26776 24875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 27113 26760 gene locus_tag LOCUS_11130 27113 26760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 27861 27310 gene locus_tag LOCUS_11140 27861 27310 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 protein_id gnl|my_center|LOCUS_11140 27903 28307 gene locus_tag LOCUS_11150 27903 28307 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_11150 28543 29952 gene locus_tag LOCUS_11160 28543 29952 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_11160 31340 29964 gene locus_tag LOCUS_11170 31340 29964 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_11170 32850 31372 gene locus_tag LOCUS_11180 32850 31372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_11180 33681 32890 gene locus_tag LOCUS_11190 33681 32890 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_11190 34716 33706 gene locus_tag LOCUS_11200 34716 33706 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_11200 35803 34994 gene locus_tag LOCUS_11210 gene larE 35803 34994 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_11210 36251 36099 gene locus_tag LOCUS_11220 36251 36099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 37062 36337 gene locus_tag LOCUS_11230 37062 36337 CDS product PEP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933411.1 protein_id gnl|my_center|LOCUS_11230 38659 37556 gene locus_tag LOCUS_11240 38659 37556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 39196 40836 gene locus_tag LOCUS_11250 39196 40836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 41030 41425 gene locus_tag LOCUS_11260 41030 41425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 41583 42662 gene locus_tag LOCUS_11270 gene mtnA 41583 42662 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056904.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence023 496 726 gene locus_tag LOCUS_11280 496 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1421 792 gene locus_tag LOCUS_11290 1421 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1448 1639 gene locus_tag LOCUS_11300 1448 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2859 1669 gene locus_tag LOCUS_11310 2859 1669 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056256.1 protein_id gnl|my_center|LOCUS_11310 3800 3141 gene locus_tag LOCUS_11320 3800 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5052 4051 gene locus_tag LOCUS_11330 5052 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5700 5960 gene locus_tag LOCUS_11340 5700 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 6219 5923 gene locus_tag LOCUS_11350 6219 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6576 6232 gene locus_tag LOCUS_11360 6576 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 6932 6585 gene locus_tag LOCUS_11370 6932 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 10073 6936 gene locus_tag LOCUS_11380 10073 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 12758 10305 gene locus_tag LOCUS_11390 12758 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13901 12774 gene locus_tag LOCUS_11400 13901 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 15151 13904 gene locus_tag LOCUS_11410 15151 13904 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140224.1 protein_id gnl|my_center|LOCUS_11410 15714 16301 gene locus_tag LOCUS_11420 15714 16301 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_11420 16965 16774 gene locus_tag LOCUS_11430 16965 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 18045 17218 gene locus_tag LOCUS_11440 18045 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 18785 18516 gene locus_tag LOCUS_11450 18785 18516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 20866 19187 gene locus_tag LOCUS_11460 20866 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 21249 20983 gene locus_tag LOCUS_11470 21249 20983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 21496 21873 gene locus_tag LOCUS_11480 gene petE 21496 21873 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 protein_id gnl|my_center|LOCUS_11480 22137 23864 gene locus_tag LOCUS_11490 22137 23864 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_11490 23948 24021 gene locus_tag LOCUS_t00140 23948 24021 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 24771 24058 gene locus_tag LOCUS_11500 24771 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 25076 25720 gene locus_tag LOCUS_11510 25076 25720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 25963 28482 gene locus_tag LOCUS_11520 25963 28482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 28527 28754 gene locus_tag LOCUS_11530 28527 28754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 28751 29137 gene locus_tag LOCUS_11540 28751 29137 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_11540 29211 29393 gene locus_tag LOCUS_11550 29211 29393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 29386 29631 gene locus_tag LOCUS_11560 29386 29631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 29628 29897 gene locus_tag LOCUS_11570 29628 29897 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_11570 30134 30367 gene locus_tag LOCUS_11580 30134 30367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 30541 30879 gene locus_tag LOCUS_11590 30541 30879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 30976 31194 gene locus_tag LOCUS_11600 30976 31194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 31303 31617 gene locus_tag LOCUS_11610 31303 31617 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_11610 31607 31879 gene locus_tag LOCUS_11620 31607 31879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 31911 32066 gene locus_tag LOCUS_11630 31911 32066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 32089 32334 gene locus_tag LOCUS_11640 32089 32334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 32749 32402 gene locus_tag LOCUS_11650 32749 32402 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_11650 33162 32854 gene locus_tag LOCUS_11660 33162 32854 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_11660 33708 33214 gene locus_tag LOCUS_11670 gene msrA 33708 33214 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_11670 34468 33701 gene locus_tag LOCUS_11680 gene panB 34468 33701 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928599.1 protein_id gnl|my_center|LOCUS_11680 35164 34472 gene locus_tag LOCUS_11690 gene bchM 35164 34472 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_11690 35757 37040 gene locus_tag LOCUS_11700 35757 37040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 37180 37392 gene locus_tag LOCUS_11710 37180 37392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 37778 39121 gene locus_tag LOCUS_11720 gene pyk 37778 39121 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143313.1 protein_id gnl|my_center|LOCUS_11720 39328 40125 gene locus_tag LOCUS_11730 gene modA 39328 40125 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032249.1 protein_id gnl|my_center|LOCUS_11730 40129 41967 gene locus_tag LOCUS_11740 40129 41967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence024 684 466 gene locus_tag LOCUS_11750 684 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 873 721 gene locus_tag LOCUS_11760 873 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1139 879 gene locus_tag LOCUS_11770 1139 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2581 1466 gene locus_tag LOCUS_11780 2581 1466 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122758.1 protein_id gnl|my_center|LOCUS_11780 3261 2923 gene locus_tag LOCUS_11790 3261 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3665 3246 gene locus_tag LOCUS_11800 3665 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4181 5329 gene locus_tag LOCUS_11810 gene chrA 4181 5329 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_11810 6175 5525 gene locus_tag LOCUS_11820 gene hisG 6175 5525 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056035.1 protein_id gnl|my_center|LOCUS_11820 7119 6382 gene locus_tag LOCUS_11830 7119 6382 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_11830 7995 7318 gene locus_tag LOCUS_11840 gene deoC 7995 7318 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056922.1 protein_id gnl|my_center|LOCUS_11840 8155 10764 gene locus_tag LOCUS_11850 gene acnB 8155 10764 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797887.1 protein_id gnl|my_center|LOCUS_11850 10904 11197 gene locus_tag LOCUS_11860 10904 11197 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_11860 11145 11411 gene locus_tag LOCUS_11870 11145 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 11543 11896 gene locus_tag LOCUS_11880 11543 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 12130 12471 gene locus_tag LOCUS_11890 12130 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 12650 13546 gene locus_tag LOCUS_11900 12650 13546 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_11900 13628 15337 gene locus_tag LOCUS_11910 gene ureC 13628 15337 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055860.1 protein_id gnl|my_center|LOCUS_11910 16088 15933 gene locus_tag LOCUS_11920 16088 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 16757 16467 gene locus_tag LOCUS_11930 16757 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 17243 17079 gene locus_tag LOCUS_11940 17243 17079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 20512 17354 gene locus_tag LOCUS_11950 20512 17354 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_11950 21603 20515 gene locus_tag LOCUS_11960 21603 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 21892 22140 gene locus_tag LOCUS_11970 21892 22140 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_11970 22967 22638 gene locus_tag LOCUS_11980 22967 22638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 23221 22964 gene locus_tag LOCUS_11990 23221 22964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 23533 23784 gene locus_tag LOCUS_12000 23533 23784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 23845 24108 gene locus_tag LOCUS_12010 23845 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 24105 24518 gene locus_tag LOCUS_12020 24105 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 25847 24534 gene locus_tag LOCUS_12030 25847 24534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 26212 26139 gene locus_tag LOCUS_t00150 26212 26139 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26256 26756 gene locus_tag LOCUS_12040 gene moaC 26256 26756 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530031.1 protein_id gnl|my_center|LOCUS_12040 30713 27048 gene locus_tag LOCUS_12050 30713 27048 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_12050 31427 31095 gene locus_tag LOCUS_12060 31427 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 31964 32248 gene locus_tag LOCUS_12070 31964 32248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 32235 32717 gene locus_tag LOCUS_12080 32235 32717 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_12080 34520 32790 gene locus_tag LOCUS_12090 34520 32790 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_12090 34886 35179 gene locus_tag LOCUS_12100 34886 35179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 37774 35510 gene locus_tag LOCUS_12110 gene hypF 37774 35510 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_12110 38499 37825 gene locus_tag LOCUS_12120 38499 37825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_12120 39004 38552 gene locus_tag LOCUS_12130 39004 38552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 39380 40186 gene locus_tag LOCUS_12140 gene hisN 39380 40186 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_12140 41160 40453 gene locus_tag LOCUS_12150 gene rpe 41160 40453 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence025 712 1698 gene locus_tag LOCUS_12160 gene nadA 712 1698 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_12160 3276 1819 gene locus_tag LOCUS_12170 3276 1819 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_12170 3315 3407 gene locus_tag LOCUS_t00160 3315 3407 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5802 3490 gene locus_tag LOCUS_12180 5802 3490 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_12180 6052 6822 gene locus_tag LOCUS_12190 6052 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6971 7291 gene locus_tag LOCUS_12200 6971 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 7376 7675 gene locus_tag LOCUS_12210 7376 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7760 8116 gene locus_tag LOCUS_12220 7760 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8720 9736 gene locus_tag LOCUS_12230 8720 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 9925 11487 gene locus_tag LOCUS_12240 9925 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 11632 12831 gene locus_tag LOCUS_12250 11632 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 12872 14224 gene locus_tag LOCUS_12260 12872 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 14942 15766 gene locus_tag LOCUS_12270 14942 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 16016 16864 gene locus_tag LOCUS_12280 16016 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 16892 17146 gene locus_tag LOCUS_12290 16892 17146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 17125 17394 gene locus_tag LOCUS_12300 17125 17394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 17446 18378 gene locus_tag LOCUS_12310 17446 18378 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_12310 18811 19221 gene locus_tag LOCUS_12320 18811 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 19313 20137 gene locus_tag LOCUS_12330 19313 20137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 20219 20386 gene locus_tag LOCUS_12340 20219 20386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 20485 21651 gene locus_tag LOCUS_12350 20485 21651 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_12350 21732 22523 gene locus_tag LOCUS_12360 21732 22523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 22551 23276 gene locus_tag LOCUS_12370 22551 23276 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_12370 23343 23669 gene locus_tag LOCUS_12380 23343 23669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 24343 25005 gene locus_tag LOCUS_12390 24343 25005 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929453.1 protein_id gnl|my_center|LOCUS_12390 25370 26302 gene locus_tag LOCUS_12400 25370 26302 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793191.1 protein_id gnl|my_center|LOCUS_12400 26299 27273 gene locus_tag LOCUS_12410 26299 27273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 27318 28364 gene locus_tag LOCUS_12420 27318 28364 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478388.1 protein_id gnl|my_center|LOCUS_12420 28414 29085 gene locus_tag LOCUS_12430 28414 29085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 29376 30155 gene locus_tag LOCUS_12440 29376 30155 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_12440 30176 31156 gene locus_tag LOCUS_12450 30176 31156 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 protein_id gnl|my_center|LOCUS_12450 33888 31180 gene locus_tag LOCUS_12460 33888 31180 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057097.1 protein_id gnl|my_center|LOCUS_12460 34138 34533 gene locus_tag LOCUS_12470 gene gcvH 34138 34533 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057515.1 protein_id gnl|my_center|LOCUS_12470 34693 35865 gene locus_tag LOCUS_12480 gene moeB 34693 35865 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_12480 36106 36687 gene locus_tag LOCUS_12490 36106 36687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 37130 36756 gene locus_tag LOCUS_12500 37130 36756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 37296 40523 gene locus_tag LOCUS_12510 37296 40523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 40627 41055 gene locus_tag LOCUS_12520 40627 41055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 41076 41453 gene locus_tag LOCUS_12530 41076 41453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence026 364 813 gene locus_tag LOCUS_12540 gene ndk 364 813 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_12540 1629 2555 gene locus_tag LOCUS_12550 1629 2555 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928449.1 protein_id gnl|my_center|LOCUS_12550 3176 5338 gene locus_tag LOCUS_12560 gene dnaK 3176 5338 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920992.1 protein_id gnl|my_center|LOCUS_12560 5533 6408 gene locus_tag LOCUS_12570 5533 6408 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_12570 6513 7721 gene locus_tag LOCUS_12580 6513 7721 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056427.1 protein_id gnl|my_center|LOCUS_12580 7957 9642 gene locus_tag LOCUS_12590 7957 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 10377 11966 gene locus_tag LOCUS_12600 10377 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 13187 11940 gene locus_tag LOCUS_12610 13187 11940 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_12610 13997 13272 gene locus_tag LOCUS_12620 13997 13272 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056258.1 protein_id gnl|my_center|LOCUS_12620 14464 14880 gene locus_tag LOCUS_12630 14464 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 14868 15203 gene locus_tag LOCUS_12640 14868 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 17001 15817 gene locus_tag LOCUS_12650 17001 15817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 17229 17056 gene locus_tag LOCUS_12660 17229 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 17387 17566 gene locus_tag LOCUS_12670 17387 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 17962 18915 gene locus_tag LOCUS_12680 17962 18915 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_12680 19043 20110 gene locus_tag LOCUS_12690 gene recA 19043 20110 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125865.1 protein_id gnl|my_center|LOCUS_12690 20730 20134 gene locus_tag LOCUS_12700 20730 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 21643 20774 gene locus_tag LOCUS_12710 21643 20774 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_12710 22822 23295 gene locus_tag LOCUS_12720 22822 23295 CDS product CRR6 family NdhI maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057132.1 protein_id gnl|my_center|LOCUS_12720 23390 24598 gene locus_tag LOCUS_12730 23390 24598 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_12730 24959 24780 gene locus_tag LOCUS_12740 24959 24780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 25809 24979 gene locus_tag LOCUS_12750 25809 24979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 26095 25916 gene locus_tag LOCUS_12760 26095 25916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 26270 27139 gene locus_tag LOCUS_12770 gene bchL 26270 27139 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921031.1 protein_id gnl|my_center|LOCUS_12770 27272 28036 gene locus_tag LOCUS_12780 27272 28036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 28053 29453 gene locus_tag LOCUS_12790 28053 29453 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058178.1 protein_id gnl|my_center|LOCUS_12790 29623 30915 gene locus_tag LOCUS_12800 29623 30915 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_12800 30917 31561 gene locus_tag LOCUS_12810 30917 31561 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994243.1 protein_id gnl|my_center|LOCUS_12810 31673 32476 gene locus_tag LOCUS_12820 gene udp 31673 32476 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016796.1 protein_id gnl|my_center|LOCUS_12820 32809 33210 gene locus_tag LOCUS_12830 32809 33210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 36631 33290 gene locus_tag LOCUS_12840 36631 33290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 36827 36537 gene locus_tag LOCUS_12850 36827 36537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 37174 36953 gene locus_tag LOCUS_12860 37174 36953 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_12860 37370 37164 gene locus_tag LOCUS_12870 37370 37164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 37554 37330 gene locus_tag LOCUS_12880 37554 37330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 38038 37724 gene locus_tag LOCUS_12890 38038 37724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 38329 38048 gene locus_tag LOCUS_12900 38329 38048 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_12900 38787 38629 gene locus_tag LOCUS_12910 38787 38629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 39018 38806 gene locus_tag LOCUS_12920 39018 38806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 39352 39011 gene locus_tag LOCUS_12930 39352 39011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 39556 39353 gene locus_tag LOCUS_12940 39556 39353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence027 524 135 gene locus_tag LOCUS_12950 524 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1330 2097 gene locus_tag LOCUS_12960 1330 2097 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931025.1 protein_id gnl|my_center|LOCUS_12960 3070 2150 gene locus_tag LOCUS_12970 3070 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3950 3147 gene locus_tag LOCUS_12980 3950 3147 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_12980 5416 4079 gene locus_tag LOCUS_12990 5416 4079 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_12990 5580 6770 gene locus_tag LOCUS_13000 5580 6770 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_13000 6845 7993 gene locus_tag LOCUS_13010 6845 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 8371 8060 gene locus_tag LOCUS_13020 gene nuoK 8371 8060 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_13020 8987 8391 gene locus_tag LOCUS_13030 8987 8391 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_13030 9653 9081 gene locus_tag LOCUS_13040 gene ndhI 9653 9081 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056515.1 protein_id gnl|my_center|LOCUS_13040 10814 9696 gene locus_tag LOCUS_13050 gene nuoH 10814 9696 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126985484.1 protein_id gnl|my_center|LOCUS_13050 12005 11418 gene locus_tag LOCUS_13060 gene pyrE 12005 11418 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_13060 12161 12613 gene locus_tag LOCUS_13070 12161 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 12766 12593 gene locus_tag LOCUS_13080 12766 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 13803 12760 gene locus_tag LOCUS_13090 gene fni 13803 12760 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_13090 14547 15332 gene locus_tag LOCUS_13100 14547 15332 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_13100 18313 15677 gene locus_tag LOCUS_13110 gene topA 18313 15677 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_13110 18822 19511 gene locus_tag LOCUS_13120 18822 19511 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_13120 21259 19661 gene locus_tag LOCUS_13130 21259 19661 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 protein_id gnl|my_center|LOCUS_13130 22509 21460 gene locus_tag LOCUS_13140 22509 21460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_13140 24602 22635 gene locus_tag LOCUS_13150 24602 22635 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 protein_id gnl|my_center|LOCUS_13150 25436 24981 gene locus_tag LOCUS_13160 25436 24981 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929341.1 protein_id gnl|my_center|LOCUS_13160 25910 25749 gene locus_tag LOCUS_13170 25910 25749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 26045 26842 gene locus_tag LOCUS_13180 26045 26842 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_13180 27731 26883 gene locus_tag LOCUS_13190 gene nadC 27731 26883 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_13190 28369 27803 gene locus_tag LOCUS_13200 28369 27803 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_13200 28531 28998 gene locus_tag LOCUS_13210 28531 28998 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_13210 29484 30530 gene locus_tag LOCUS_13220 29484 30530 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_13220 32762 30690 gene locus_tag LOCUS_13230 32762 30690 CDS product AMIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058177.1 protein_id gnl|my_center|LOCUS_13230 33609 32836 gene locus_tag LOCUS_13240 33609 32836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 34376 33606 gene locus_tag LOCUS_13250 34376 33606 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 protein_id gnl|my_center|LOCUS_13250 35483 34386 gene locus_tag LOCUS_13260 gene pilM 35483 34386 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_13260 35997 36989 gene locus_tag LOCUS_13270 gene ilvC 35997 36989 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_13270 37874 37086 gene locus_tag LOCUS_13280 37874 37086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 38178 38462 gene locus_tag LOCUS_13290 38178 38462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 38526 39302 gene locus_tag LOCUS_13300 38526 39302 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921020.1 protein_id gnl|my_center|LOCUS_13300 39347 39547 gene locus_tag LOCUS_13310 39347 39547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence028 <1 1230 gene locus_tag LOCUS_13320 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233171.1:subtilisin AprE 1498 2793 gene locus_tag LOCUS_13330 1498 2793 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_13330 3867 2836 gene locus_tag LOCUS_13340 gene pyrC 3867 2836 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_13340 4451 4960 gene locus_tag LOCUS_13350 4451 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798166.1 protein_id gnl|my_center|LOCUS_13350 5032 5811 gene locus_tag LOCUS_13360 5032 5811 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_13360 5832 7904 gene locus_tag LOCUS_13370 5832 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 7939 8565 gene locus_tag LOCUS_13380 7939 8565 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_13380 8582 9895 gene locus_tag LOCUS_13390 8582 9895 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_13390 9956 10966 gene locus_tag LOCUS_13400 gene trpS 9956 10966 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057831.1 protein_id gnl|my_center|LOCUS_13400 11203 12252 gene locus_tag LOCUS_13410 11203 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 12482 12661 gene locus_tag LOCUS_13420 12482 12661 CDS product ssl1498 family light-harvesting-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055918.1 protein_id gnl|my_center|LOCUS_13420 13518 12736 gene locus_tag LOCUS_13430 13518 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 13581 14129 gene locus_tag LOCUS_13440 gene psbP 13581 14129 CDS product photosystem II reaction center PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_13440 14426 14968 gene locus_tag LOCUS_13450 14426 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 14953 15540 gene locus_tag LOCUS_13460 14953 15540 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057142.1 protein_id gnl|my_center|LOCUS_13460 15716 16309 gene locus_tag LOCUS_13470 gene ureG 15716 16309 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055912.1 protein_id gnl|my_center|LOCUS_13470 17053 16319 gene locus_tag LOCUS_13480 17053 16319 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_13480 18472 17072 gene locus_tag LOCUS_13490 18472 17072 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_13490 20266 18665 gene locus_tag LOCUS_13500 20266 18665 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_13500 20606 20791 gene locus_tag LOCUS_13510 20606 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 20788 22119 gene locus_tag LOCUS_13520 20788 22119 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 protein_id gnl|my_center|LOCUS_13520 23375 22206 gene locus_tag LOCUS_13530 23375 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 23541 24818 gene locus_tag LOCUS_13540 23541 24818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 24805 25596 gene locus_tag LOCUS_13550 24805 25596 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_13550 26116 25679 gene locus_tag LOCUS_13560 26116 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 27099 26176 gene locus_tag LOCUS_13570 27099 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 27319 28380 gene locus_tag LOCUS_13580 27319 28380 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_13580 28697 29872 gene locus_tag LOCUS_13590 gene rodA 28697 29872 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920901.1 protein_id gnl|my_center|LOCUS_13590 30395 30547 gene locus_tag LOCUS_13600 30395 30547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 30826 31806 gene locus_tag LOCUS_13610 30826 31806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_13610 31862 32836 gene locus_tag LOCUS_13620 31862 32836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_13620 33572 33039 gene locus_tag LOCUS_13630 33572 33039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 35773 33710 gene locus_tag LOCUS_13640 35773 33710 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_13640 36254 36000 gene locus_tag LOCUS_13650 36254 36000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920999.1 protein_id gnl|my_center|LOCUS_13650 37297 36353 gene locus_tag LOCUS_13660 37297 36353 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_13660 37395 38222 gene locus_tag LOCUS_13670 37395 38222 CDS product YaaW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920905.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence029 592 275 gene locus_tag LOCUS_13680 592 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 3294 1048 gene locus_tag LOCUS_13690 3294 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3542 4576 gene locus_tag LOCUS_13700 gene pdhA 3542 4576 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057011.1 protein_id gnl|my_center|LOCUS_13700 4912 5694 gene locus_tag LOCUS_13710 4912 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 6123 7061 gene locus_tag LOCUS_13720 6123 7061 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_13720 7122 8723 gene locus_tag LOCUS_13730 7122 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9079 8738 gene locus_tag LOCUS_13740 9079 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_13740 9125 9694 gene locus_tag LOCUS_13750 gene aat 9125 9694 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920768.1 protein_id gnl|my_center|LOCUS_13750 10141 11247 gene locus_tag LOCUS_13760 10141 11247 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_13760 11295 12668 gene locus_tag LOCUS_13770 11295 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13609 12866 gene locus_tag LOCUS_13780 13609 12866 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_13780 15321 13633 gene locus_tag LOCUS_13790 15321 13633 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088894694.1 protein_id gnl|my_center|LOCUS_13790 15717 15412 gene locus_tag LOCUS_13800 15717 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_13800 15990 17213 gene locus_tag LOCUS_13810 15990 17213 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_13810 18067 17834 gene locus_tag LOCUS_13820 18067 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 18997 18476 gene locus_tag LOCUS_13830 18997 18476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 20324 19155 gene locus_tag LOCUS_13840 gene acsF 20324 19155 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920870.1 protein_id gnl|my_center|LOCUS_13840 20682 21101 gene locus_tag LOCUS_13850 20682 21101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 21825 22382 gene locus_tag LOCUS_13860 21825 22382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 22614 24593 gene locus_tag LOCUS_13870 22614 24593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 24641 26179 gene locus_tag LOCUS_13880 24641 26179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 26167 27582 gene locus_tag LOCUS_13890 26167 27582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 27583 29247 gene locus_tag LOCUS_13900 27583 29247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 29252 31663 gene locus_tag LOCUS_13910 29252 31663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 31946 32251 gene locus_tag LOCUS_13920 31946 32251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 32637 32419 gene locus_tag LOCUS_13930 32637 32419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 32748 33143 gene locus_tag LOCUS_13940 32748 33143 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_13940 33115 33453 gene locus_tag LOCUS_13950 33115 33453 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_13950 33626 34387 gene locus_tag LOCUS_13960 gene tatC 33626 34387 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141910.1 protein_id gnl|my_center|LOCUS_13960 34596 34919 gene locus_tag LOCUS_13970 34596 34919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 protein_id gnl|my_center|LOCUS_13970 35270 36796 gene locus_tag LOCUS_13980 gene psbB 35270 36796 CDS product photosystem II chlorophyll-binding protein CP47 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057370.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence030 <1 535 gene locus_tag LOCUS_13990 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140481.1:Rpn family recombination-promoting nuclease/putative transposase 1890 736 gene locus_tag LOCUS_14000 1890 736 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_14000 3064 2174 gene locus_tag LOCUS_14010 gene trpC 3064 2174 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_14010 3415 3203 gene locus_tag LOCUS_14020 3415 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3997 4223 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaaaaacagttaattgaaaaattatcgagtcaattaag 4389 4679 gene locus_tag LOCUS_14030 4389 4679 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057272.1 protein_id gnl|my_center|LOCUS_14030 5628 4723 gene locus_tag LOCUS_14040 5628 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6811 5801 gene locus_tag LOCUS_14050 6811 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 6930 7325 gene locus_tag LOCUS_14060 6930 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 9293 7386 gene locus_tag LOCUS_14070 gene shc 9293 7386 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058142.1 protein_id gnl|my_center|LOCUS_14070 10305 9550 gene locus_tag LOCUS_14080 gene tsf 10305 9550 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124978.1 protein_id gnl|my_center|LOCUS_14080 11219 10422 gene locus_tag LOCUS_14090 gene rpsB 11219 10422 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057525.1 protein_id gnl|my_center|LOCUS_14090 11844 11377 gene locus_tag LOCUS_14100 gene bcp 11844 11377 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233532.1 protein_id gnl|my_center|LOCUS_14100 12695 11847 gene locus_tag LOCUS_14110 12695 11847 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 protein_id gnl|my_center|LOCUS_14110 13183 12695 gene locus_tag LOCUS_14120 13183 12695 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_14120 13204 13503 gene locus_tag LOCUS_14130 13204 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 13802 14962 gene locus_tag LOCUS_14140 13802 14962 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_14140 15133 16371 gene locus_tag LOCUS_14150 15133 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 protein_id gnl|my_center|LOCUS_14150 18264 16384 gene locus_tag LOCUS_14160 gene dnaG 18264 16384 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057157.1 protein_id gnl|my_center|LOCUS_14160 19802 18663 gene locus_tag LOCUS_14170 19802 18663 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_14170 20658 19921 gene locus_tag LOCUS_14180 20658 19921 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_14180 21253 20687 gene locus_tag LOCUS_14190 21253 20687 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057228.1 protein_id gnl|my_center|LOCUS_14190 21681 23480 gene locus_tag LOCUS_14200 21681 23480 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208105.1 protein_id gnl|my_center|LOCUS_14200 23458 23820 gene locus_tag LOCUS_14210 23458 23820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 24765 24142 gene locus_tag LOCUS_14220 24765 24142 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_14220 26576 24900 gene locus_tag LOCUS_14230 gene ctaD 26576 24900 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_14230 27484 26615 gene locus_tag LOCUS_14240 27484 26615 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057846.1 protein_id gnl|my_center|LOCUS_14240 27886 28806 gene locus_tag LOCUS_14250 27886 28806 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_14250 28820 29770 gene locus_tag LOCUS_14260 28820 29770 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_14260 31342 30008 gene locus_tag LOCUS_14270 gene dnaA 31342 30008 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056451.1 protein_id gnl|my_center|LOCUS_14270 31463 32005 gene locus_tag LOCUS_14280 gene def 31463 32005 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206042.1 protein_id gnl|my_center|LOCUS_14280 32379 33035 gene locus_tag LOCUS_14290 gene folE 32379 33035 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_14290 33152 34132 gene locus_tag LOCUS_14300 gene hemB 33152 34132 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_14300 34737 34129 gene locus_tag LOCUS_14310 34737 34129 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928520.1 protein_id gnl|my_center|LOCUS_14310 34816 36894 gene locus_tag LOCUS_14320 34816 36894 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920751.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence031 1050 238 gene locus_tag LOCUS_14330 1050 238 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143024.1 protein_id gnl|my_center|LOCUS_14330 2061 1066 gene locus_tag LOCUS_14340 gene dusA 2061 1066 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 protein_id gnl|my_center|LOCUS_14340 3740 2376 gene locus_tag LOCUS_14350 3740 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3947 5236 gene locus_tag LOCUS_14360 3947 5236 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920845.1 protein_id gnl|my_center|LOCUS_14360 5660 6757 gene locus_tag LOCUS_14370 5660 6757 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 protein_id gnl|my_center|LOCUS_14370 7435 6917 gene locus_tag LOCUS_14380 7435 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 7968 7432 gene locus_tag LOCUS_14390 7968 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 8796 7981 gene locus_tag LOCUS_14400 8796 7981 CDS product Ycf66 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057849.1 protein_id gnl|my_center|LOCUS_14400 9492 11174 gene locus_tag LOCUS_14410 9492 11174 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_14410 11331 13106 gene locus_tag LOCUS_14420 gene pyk 11331 13106 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_14420 13245 14057 gene locus_tag LOCUS_14430 13245 14057 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009454959.1 protein_id gnl|my_center|LOCUS_14430 14112 14543 gene locus_tag LOCUS_14440 14112 14543 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_14440 14713 15336 gene locus_tag LOCUS_14450 14713 15336 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057797.1 protein_id gnl|my_center|LOCUS_14450 15399 16172 gene locus_tag LOCUS_14460 15399 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 16379 17272 gene locus_tag LOCUS_14470 16379 17272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 17410 17886 gene locus_tag LOCUS_14480 17410 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143509.1 protein_id gnl|my_center|LOCUS_14480 18290 18571 gene locus_tag LOCUS_14490 18290 18571 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928995.1 protein_id gnl|my_center|LOCUS_14490 18626 18838 gene locus_tag LOCUS_14500 18626 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 18835 19188 gene locus_tag LOCUS_14510 18835 19188 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_14510 19195 19881 gene locus_tag LOCUS_14520 19195 19881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 20673 19897 gene locus_tag LOCUS_14530 20673 19897 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_14530 20822 21034 gene locus_tag LOCUS_14540 20822 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 21199 22197 gene locus_tag LOCUS_14550 21199 22197 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_14550 22771 22397 gene locus_tag LOCUS_14560 22771 22397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 22961 22755 gene locus_tag LOCUS_14570 22961 22755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 23945 23316 gene locus_tag LOCUS_14580 23945 23316 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895592.1 protein_id gnl|my_center|LOCUS_14580 24845 24450 gene locus_tag LOCUS_14590 24845 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 25216 24842 gene locus_tag LOCUS_14600 25216 24842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 26114 25650 gene locus_tag LOCUS_14610 26114 25650 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_14610 26589 26131 gene locus_tag LOCUS_14620 26589 26131 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_14620 27616 26633 gene locus_tag LOCUS_14630 gene msrP 27616 26633 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_14630 29202 27703 gene locus_tag LOCUS_14640 29202 27703 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_14640 29480 30235 gene locus_tag LOCUS_14650 29480 30235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 30864 30241 gene locus_tag LOCUS_14660 gene rnhB 30864 30241 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770967.1 protein_id gnl|my_center|LOCUS_14660 33032 30861 gene locus_tag LOCUS_14670 33032 30861 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_14670 34595 33840 gene locus_tag LOCUS_14680 34595 33840 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_14680 34837 34992 gene locus_tag LOCUS_14690 34837 34992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 35411 36250 gene locus_tag LOCUS_14700 gene ylqF 35411 36250 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057347.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence032 1417 1683 gene locus_tag LOCUS_14710 1417 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141573.1 protein_id gnl|my_center|LOCUS_14710 1680 2102 gene locus_tag LOCUS_14720 1680 2102 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141572.1 protein_id gnl|my_center|LOCUS_14720 2368 2129 gene locus_tag LOCUS_14730 2368 2129 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_14730 3444 2623 gene locus_tag LOCUS_14740 3444 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4207 3437 gene locus_tag LOCUS_14750 4207 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4601 4954 gene locus_tag LOCUS_14760 4601 4954 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_14760 5322 6434 gene locus_tag LOCUS_14770 5322 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 6434 7090 gene locus_tag LOCUS_14780 6434 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 8618 7179 gene locus_tag LOCUS_14790 8618 7179 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_14790 9904 8660 gene locus_tag LOCUS_14800 gene rimO 9904 8660 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_14800 10155 11006 gene locus_tag LOCUS_14810 10155 11006 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_14810 11177 12163 gene locus_tag LOCUS_14820 11177 12163 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920721.1 protein_id gnl|my_center|LOCUS_14820 12273 13466 gene locus_tag LOCUS_14830 12273 13466 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259289.1 protein_id gnl|my_center|LOCUS_14830 13568 14347 gene locus_tag LOCUS_14840 13568 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 14396 15634 gene locus_tag LOCUS_14850 gene dcm 14396 15634 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_14850 16292 15846 gene locus_tag LOCUS_14860 16292 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 17949 16336 gene locus_tag LOCUS_14870 17949 16336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_14870 19055 18135 gene locus_tag LOCUS_14880 19055 18135 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 protein_id gnl|my_center|LOCUS_14880 19524 19090 gene locus_tag LOCUS_14890 19524 19090 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025263.1 protein_id gnl|my_center|LOCUS_14890 20612 19752 gene locus_tag LOCUS_14900 20612 19752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 22508 20823 gene locus_tag LOCUS_14910 gene ilvD 22508 20823 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_14910 23518 23192 gene locus_tag LOCUS_14920 23518 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 23960 23505 gene locus_tag LOCUS_14930 23960 23505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 24852 24097 gene locus_tag LOCUS_14940 24852 24097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 <36398 24911 gene locus_tag LOCUS_14950 <36398 24911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162305080.1:calcium-binding protein >Feature sequence033 163 1203 gene locus_tag LOCUS_14960 163 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1200 1610 gene locus_tag LOCUS_14970 1200 1610 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142297.1 protein_id gnl|my_center|LOCUS_14970 2669 1611 gene locus_tag LOCUS_14980 2669 1611 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_14980 2796 4079 gene locus_tag LOCUS_14990 2796 4079 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_14990 4552 5568 gene locus_tag LOCUS_15000 4552 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 6004 8142 gene locus_tag LOCUS_15010 6004 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8954 8673 gene locus_tag LOCUS_15020 8954 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 9529 10371 gene locus_tag LOCUS_15030 9529 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 12643 10721 gene locus_tag LOCUS_15040 12643 10721 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_15040 12849 12774 gene locus_tag LOCUS_t00170 12849 12774 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14147 12942 gene locus_tag LOCUS_15050 14147 12942 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_15050 14355 15197 gene locus_tag LOCUS_15060 14355 15197 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_15060 15547 15323 gene locus_tag LOCUS_15070 15547 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940650.1 protein_id gnl|my_center|LOCUS_15070 15931 15858 gene locus_tag LOCUS_t00180 15931 15858 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17876 16023 gene locus_tag LOCUS_15080 17876 16023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 21889 18422 gene locus_tag LOCUS_15090 21889 18422 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_15090 22324 21992 gene locus_tag LOCUS_15100 22324 21992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 26997 22393 gene locus_tag LOCUS_15110 26997 22393 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 protein_id gnl|my_center|LOCUS_15110 28185 27298 gene locus_tag LOCUS_15120 gene sucD 28185 27298 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694247.1 protein_id gnl|my_center|LOCUS_15120 30159 29296 gene locus_tag LOCUS_15130 30159 29296 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_15130 31925 31446 gene locus_tag LOCUS_15140 31925 31446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 32397 32215 gene locus_tag LOCUS_15150 32397 32215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 32718 33020 gene locus_tag LOCUS_15160 32718 33020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 33154 33336 gene locus_tag LOCUS_15170 33154 33336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence034 503 2383 gene locus_tag LOCUS_15180 503 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2508 2589 gene locus_tag LOCUS_t00190 2508 2589 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2771 3331 gene locus_tag LOCUS_15190 2771 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3340 4191 gene locus_tag LOCUS_15200 3340 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 4192 5451 gene locus_tag LOCUS_15210 4192 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5775 6173 gene locus_tag LOCUS_15220 5775 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 6557 7051 gene locus_tag LOCUS_15230 6557 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 7467 7168 gene locus_tag LOCUS_15240 7467 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 7821 9293 gene locus_tag LOCUS_15250 7821 9293 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921221.1 protein_id gnl|my_center|LOCUS_15250 10519 9356 gene locus_tag LOCUS_15260 10519 9356 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598138.1 protein_id gnl|my_center|LOCUS_15260 10765 11583 gene locus_tag LOCUS_15270 10765 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 11724 12125 gene locus_tag LOCUS_15280 11724 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 12246 12809 gene locus_tag LOCUS_15290 12246 12809 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090605.1 protein_id gnl|my_center|LOCUS_15290 13210 12788 gene locus_tag LOCUS_15300 13210 12788 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_15300 14560 13298 gene locus_tag LOCUS_15310 14560 13298 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039737632.1 protein_id gnl|my_center|LOCUS_15310 15570 14638 gene locus_tag LOCUS_15320 15570 14638 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_15320 15721 17061 gene locus_tag LOCUS_15330 15721 17061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 17236 18945 gene locus_tag LOCUS_15340 gene menD 17236 18945 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_15340 19232 20365 gene locus_tag LOCUS_15350 19232 20365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 20782 20372 gene locus_tag LOCUS_15360 20782 20372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 21213 20956 gene locus_tag LOCUS_15370 21213 20956 CDS product chlororespiratory reduction protein 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920866.1 protein_id gnl|my_center|LOCUS_15370 21296 22720 gene locus_tag LOCUS_15380 21296 22720 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_15380 23061 23528 gene locus_tag LOCUS_15390 23061 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 24212 24478 gene locus_tag LOCUS_15400 24212 24478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 24483 24863 gene locus_tag LOCUS_15410 24483 24863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 24995 26290 gene locus_tag LOCUS_15420 24995 26290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 26516 26956 gene locus_tag LOCUS_15430 26516 26956 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_15430 27013 30330 gene locus_tag LOCUS_15440 27013 30330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 30330 30635 gene locus_tag LOCUS_15450 30330 30635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083794109.1 protein_id gnl|my_center|LOCUS_15450 30623 30850 gene locus_tag LOCUS_15460 30623 30850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 30741 30956 gene locus_tag LOCUS_15470 30741 30956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 30962 31378 gene locus_tag LOCUS_15480 30962 31378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 31366 31701 gene locus_tag LOCUS_15490 31366 31701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 31658 31813 gene locus_tag LOCUS_15500 31658 31813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 32544 33248 gene locus_tag LOCUS_15510 32544 33248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 33758 33585 gene locus_tag LOCUS_15520 33758 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence035 559 1161 gene locus_tag LOCUS_15530 559 1161 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057675.1 protein_id gnl|my_center|LOCUS_15530 1272 2234 gene locus_tag LOCUS_15540 1272 2234 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_15540 2805 2296 gene locus_tag LOCUS_15550 2805 2296 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142230.1 protein_id gnl|my_center|LOCUS_15550 3070 4023 gene locus_tag LOCUS_15560 3070 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 6964 4037 gene locus_tag LOCUS_15570 6964 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 7179 8111 gene locus_tag LOCUS_15580 7179 8111 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_15580 8108 8890 gene locus_tag LOCUS_15590 8108 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 9143 9679 gene locus_tag LOCUS_15600 9143 9679 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921042.1 protein_id gnl|my_center|LOCUS_15600 11534 9735 gene locus_tag LOCUS_15610 11534 9735 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421615.1 protein_id gnl|my_center|LOCUS_15610 14319 11539 gene locus_tag LOCUS_15620 14319 11539 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_15620 14757 16187 gene locus_tag LOCUS_15630 gene pds 14757 16187 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_15630 16293 17225 gene locus_tag LOCUS_15640 16293 17225 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_15640 17939 17532 gene locus_tag LOCUS_15650 17939 17532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 18267 18509 gene locus_tag LOCUS_15660 18267 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 18698 18991 gene locus_tag LOCUS_15670 18698 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057054.1 protein_id gnl|my_center|LOCUS_15670 19071 20141 gene locus_tag LOCUS_15680 19071 20141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 20862 20158 gene locus_tag LOCUS_15690 gene rnc 20862 20158 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142642.1 protein_id gnl|my_center|LOCUS_15690 22010 22837 gene locus_tag LOCUS_15700 22010 22837 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_15700 23969 22815 gene locus_tag LOCUS_15710 23969 22815 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055884.1 protein_id gnl|my_center|LOCUS_15710 24117 25706 gene locus_tag LOCUS_15720 24117 25706 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_15720 27496 25958 gene locus_tag LOCUS_15730 27496 25958 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056298.1 protein_id gnl|my_center|LOCUS_15730 28652 29566 gene locus_tag LOCUS_15740 28652 29566 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_15740 29568 30758 gene locus_tag LOCUS_15750 29568 30758 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920967.1 protein_id gnl|my_center|LOCUS_15750 31258 30824 gene locus_tag LOCUS_15760 31258 30824 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_15760 31559 33355 gene locus_tag LOCUS_15770 31559 33355 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199341128.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence036 1909 2697 gene locus_tag LOCUS_15780 1909 2697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545759.1 protein_id gnl|my_center|LOCUS_15780 2869 3453 gene locus_tag LOCUS_15790 2869 3453 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_15790 3557 4945 gene locus_tag LOCUS_15800 3557 4945 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_15800 4945 5511 gene locus_tag LOCUS_15810 4945 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 6014 5586 gene locus_tag LOCUS_15820 6014 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_15820 6213 7514 gene locus_tag LOCUS_15830 6213 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_15830 9315 7789 gene locus_tag LOCUS_15840 9315 7789 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_15840 9496 9837 gene locus_tag LOCUS_15850 9496 9837 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_15850 9921 10454 gene locus_tag LOCUS_15860 9921 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 11722 10637 gene locus_tag LOCUS_15870 gene hppD 11722 10637 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_15870 12661 11957 gene locus_tag LOCUS_15880 12661 11957 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056362.1 protein_id gnl|my_center|LOCUS_15880 12793 13962 gene locus_tag LOCUS_15890 gene sat 12793 13962 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_15890 14356 16383 gene locus_tag LOCUS_15900 14356 16383 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 protein_id gnl|my_center|LOCUS_15900 16459 18129 gene locus_tag LOCUS_15910 16459 18129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 protein_id gnl|my_center|LOCUS_15910 18258 18920 gene locus_tag LOCUS_15920 gene msrA 18258 18920 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_15920 21431 19041 gene locus_tag LOCUS_15930 21431 19041 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057093.1 protein_id gnl|my_center|LOCUS_15930 21628 23565 gene locus_tag LOCUS_15940 gene sir 21628 23565 CDS product sulfite reductase, ferredoxin dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920675.1 protein_id gnl|my_center|LOCUS_15940 23665 25230 gene locus_tag LOCUS_15950 23665 25230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 25234 26487 gene locus_tag LOCUS_15960 25234 26487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 27721 26792 gene locus_tag LOCUS_15970 27721 26792 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143656.1 protein_id gnl|my_center|LOCUS_15970 27998 28429 gene locus_tag LOCUS_15980 27998 28429 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_15980 29892 28675 gene locus_tag LOCUS_15990 29892 28675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_15990 31480 30053 gene locus_tag LOCUS_16000 31480 30053 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_16000 31659 32540 gene locus_tag LOCUS_16010 31659 32540 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550718.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence037 651 244 gene locus_tag LOCUS_16020 gene psbU 651 244 CDS product photosystem II complex extrinsic protein PsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058241.1 protein_id gnl|my_center|LOCUS_16020 1184 1819 gene locus_tag LOCUS_16030 1184 1819 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_16030 2407 2706 gene locus_tag LOCUS_16040 gene petF1 2407 2706 CDS product ferredoxin PetF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056851.1 protein_id gnl|my_center|LOCUS_16040 2841 2925 gene locus_tag LOCUS_t00200 2841 2925 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2934 3005 gene locus_tag LOCUS_t00210 2934 3005 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3371 6379 gene locus_tag LOCUS_16050 3371 6379 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_16050 6507 6376 gene locus_tag LOCUS_16060 gene psbN 6507 6376 CDS product photosystem II reaction center protein PsbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057227.1 protein_id gnl|my_center|LOCUS_16060 6676 7524 gene locus_tag LOCUS_16070 6676 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7607 8623 gene locus_tag LOCUS_16080 7607 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 9166 9525 gene locus_tag LOCUS_16090 9166 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 9526 9891 gene locus_tag LOCUS_16100 9526 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 protein_id gnl|my_center|LOCUS_16100 12741 10117 gene locus_tag LOCUS_16110 12741 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 13278 14084 gene locus_tag LOCUS_16120 13278 14084 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524138.1 protein_id gnl|my_center|LOCUS_16120 14552 15256 gene locus_tag LOCUS_16130 14552 15256 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921011.1 protein_id gnl|my_center|LOCUS_16130 16458 15307 gene locus_tag LOCUS_16140 16458 15307 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231833781.1 protein_id gnl|my_center|LOCUS_16140 17279 16581 gene locus_tag LOCUS_16150 gene ubiE 17279 16581 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_16150 18275 17406 gene locus_tag LOCUS_16160 18275 17406 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_16160 18414 19643 gene locus_tag LOCUS_16170 18414 19643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 20534 19620 gene locus_tag LOCUS_16180 20534 19620 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_16180 21717 20674 gene locus_tag LOCUS_16190 21717 20674 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141878.1 protein_id gnl|my_center|LOCUS_16190 22607 21747 gene locus_tag LOCUS_16200 22607 21747 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_16200 23050 22673 gene locus_tag LOCUS_16210 23050 22673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 24296 23301 gene locus_tag LOCUS_16220 24296 23301 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190761.1 protein_id gnl|my_center|LOCUS_16220 24400 24897 gene locus_tag LOCUS_16230 24400 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 25273 25061 gene locus_tag LOCUS_16240 25273 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 25457 25260 gene locus_tag LOCUS_16250 25457 25260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 26799 25510 gene locus_tag LOCUS_16260 26799 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 30208 28637 gene locus_tag LOCUS_16270 30208 28637 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_16270 30333 30884 gene locus_tag LOCUS_16280 30333 30884 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_16280 31053 32390 gene locus_tag LOCUS_16290 31053 32390 CDS product DUF4335 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057325.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence038 2943 139 gene locus_tag LOCUS_16300 2943 139 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057035.1 protein_id gnl|my_center|LOCUS_16300 4510 3284 gene locus_tag LOCUS_16310 4510 3284 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_16310 5757 4630 gene locus_tag LOCUS_16320 5757 4630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_16320 5842 6771 gene locus_tag LOCUS_16330 5842 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 9042 6844 gene locus_tag LOCUS_16340 9042 6844 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143066.1 protein_id gnl|my_center|LOCUS_16340 9203 10672 gene locus_tag LOCUS_16350 9203 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 10793 10984 gene locus_tag LOCUS_16360 10793 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 11031 11990 gene locus_tag LOCUS_16370 11031 11990 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_16370 12101 12676 gene locus_tag LOCUS_16380 12101 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 14302 12659 gene locus_tag LOCUS_16390 14302 12659 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_16390 14438 16132 gene locus_tag LOCUS_16400 14438 16132 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_16400 16182 16637 gene locus_tag LOCUS_16410 16182 16637 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_16410 18040 17165 gene locus_tag LOCUS_16420 18040 17165 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_16420 19402 18044 gene locus_tag LOCUS_16430 gene der 19402 18044 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056722.1 protein_id gnl|my_center|LOCUS_16430 19689 20159 gene locus_tag LOCUS_16440 19689 20159 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_16440 22212 20560 gene locus_tag LOCUS_16450 gene mutL 22212 20560 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137908825.1 protein_id gnl|my_center|LOCUS_16450 22828 23283 gene locus_tag LOCUS_16460 gene aroQ 22828 23283 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_16460 25107 23308 gene locus_tag LOCUS_16470 25107 23308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 protein_id gnl|my_center|LOCUS_16470 26224 25148 gene locus_tag LOCUS_16480 26224 25148 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_16480 26636 26262 gene locus_tag LOCUS_16490 26636 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_16490 28005 26749 gene locus_tag LOCUS_16500 28005 26749 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_16500 28394 28708 gene locus_tag LOCUS_16510 28394 28708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 29299 30315 gene locus_tag LOCUS_16520 29299 30315 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140533.1 protein_id gnl|my_center|LOCUS_16520 31097 30321 gene locus_tag LOCUS_16530 gene fetB 31097 30321 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_16530 31224 32336 gene locus_tag LOCUS_16540 31224 32336 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence039 1184 318 gene locus_tag LOCUS_16550 1184 318 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_16550 2185 1184 gene locus_tag LOCUS_16560 2185 1184 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_16560 3704 2268 gene locus_tag LOCUS_16570 3704 2268 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_16570 3943 4611 gene locus_tag LOCUS_16580 3943 4611 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056639.1 protein_id gnl|my_center|LOCUS_16580 4663 5145 gene locus_tag LOCUS_16590 gene petD 4663 5145 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056640.1 protein_id gnl|my_center|LOCUS_16590 6254 5445 gene locus_tag LOCUS_16600 6254 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 6748 6524 gene locus_tag LOCUS_16610 6748 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 9170 7530 gene locus_tag LOCUS_16620 gene hmpF 9170 7530 CDS product pilus motility taxis protein HmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058194.1 protein_id gnl|my_center|LOCUS_16620 9998 10255 gene locus_tag LOCUS_16630 9998 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 11013 11378 gene locus_tag LOCUS_16640 11013 11378 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_16640 11561 12784 gene locus_tag LOCUS_16650 11561 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 12830 13360 gene locus_tag LOCUS_16660 12830 13360 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_16660 13454 16120 gene locus_tag LOCUS_16670 13454 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 16194 17405 gene locus_tag LOCUS_16680 16194 17405 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_16680 17854 19191 gene locus_tag LOCUS_16690 17854 19191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 25002 19213 gene locus_tag LOCUS_16700 25002 19213 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_16700 26086 25094 gene locus_tag LOCUS_16710 26086 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 27224 26139 gene locus_tag LOCUS_16720 27224 26139 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_16720 27594 27791 gene locus_tag LOCUS_16730 27594 27791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 27775 28029 gene locus_tag LOCUS_16740 27775 28029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 28333 28118 gene locus_tag LOCUS_16750 28333 28118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 28656 28330 gene locus_tag LOCUS_16760 28656 28330 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_16760 29168 30265 gene locus_tag LOCUS_16770 29168 30265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 30412 31095 gene locus_tag LOCUS_16780 30412 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 31354 31641 gene locus_tag LOCUS_16790 31354 31641 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_16790 31619 31891 gene locus_tag LOCUS_16800 31619 31891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence040 442 245 gene locus_tag LOCUS_16810 442 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1766 582 gene locus_tag LOCUS_16820 1766 582 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218596652.1 protein_id gnl|my_center|LOCUS_16820 1804 2979 gene locus_tag LOCUS_16830 1804 2979 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_16830 3642 3091 gene locus_tag LOCUS_16840 3642 3091 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_16840 4848 4024 gene locus_tag LOCUS_16850 4848 4024 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_16850 5260 4817 gene locus_tag LOCUS_16860 5260 4817 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_16860 5431 6567 gene locus_tag LOCUS_16870 5431 6567 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_16870 6891 6568 gene locus_tag LOCUS_16880 6891 6568 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_16880 7037 8683 gene locus_tag LOCUS_16890 7037 8683 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_16890 9694 9443 gene locus_tag LOCUS_16900 9694 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 10147 9938 gene locus_tag LOCUS_16910 10147 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 10362 10144 gene locus_tag LOCUS_16920 10362 10144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 11943 10423 gene locus_tag LOCUS_16930 11943 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 12106 11927 gene locus_tag LOCUS_16940 12106 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 12592 12233 gene locus_tag LOCUS_16950 12592 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 13085 12816 gene locus_tag LOCUS_16960 13085 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 13829 15034 gene locus_tag LOCUS_16970 13829 15034 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256400.1 protein_id gnl|my_center|LOCUS_16970 15036 16346 gene locus_tag LOCUS_16980 15036 16346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 16684 18366 gene locus_tag LOCUS_16990 16684 18366 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_16990 18509 19060 gene locus_tag LOCUS_17000 18509 19060 CDS product DUF2854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_17000 19061 19822 gene locus_tag LOCUS_17010 19061 19822 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_17010 20320 21357 gene locus_tag LOCUS_17020 gene glpX 20320 21357 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057116.1 protein_id gnl|my_center|LOCUS_17020 21542 22828 gene locus_tag LOCUS_17030 21542 22828 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057575.1 protein_id gnl|my_center|LOCUS_17030 23263 23745 gene locus_tag LOCUS_17040 23263 23745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 23752 24030 gene locus_tag LOCUS_17050 23752 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 24011 24244 gene locus_tag LOCUS_17060 24011 24244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 24516 25697 gene locus_tag LOCUS_17070 24516 25697 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_17070 25857 26393 gene locus_tag LOCUS_17080 25857 26393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 27277 29088 gene locus_tag LOCUS_17090 27277 29088 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056620.1 protein_id gnl|my_center|LOCUS_17090 30361 29711 gene locus_tag LOCUS_17100 30361 29711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_17100 30878 30672 gene locus_tag LOCUS_17110 30878 30672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 31273 31052 gene locus_tag LOCUS_17120 31273 31052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 31795 31301 gene locus_tag LOCUS_17130 31795 31301 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_17130 32069 31779 gene locus_tag LOCUS_17140 32069 31779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence041 1391 384 gene locus_tag LOCUS_17150 1391 384 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_17150 2246 1596 gene locus_tag LOCUS_17160 2246 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4788 2419 gene locus_tag LOCUS_17170 gene glgX 4788 2419 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_17170 7302 5059 gene locus_tag LOCUS_17180 7302 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 8097 7306 gene locus_tag LOCUS_17190 8097 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 8294 8650 gene locus_tag LOCUS_17200 8294 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 8656 9321 gene locus_tag LOCUS_17210 8656 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 10357 9362 gene locus_tag LOCUS_17220 10357 9362 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_17220 12349 11795 gene locus_tag LOCUS_17230 12349 11795 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_17230 13089 12466 gene locus_tag LOCUS_17240 13089 12466 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141483.1 protein_id gnl|my_center|LOCUS_17240 13209 14372 gene locus_tag LOCUS_17250 gene hemH 13209 14372 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920998.1 protein_id gnl|my_center|LOCUS_17250 14719 14468 gene locus_tag LOCUS_17260 14719 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 15812 14802 gene locus_tag LOCUS_17270 gene prfB 15812 14802 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126988096.1 protein_id gnl|my_center|LOCUS_17270 17320 16193 gene locus_tag LOCUS_17280 17320 16193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 17681 19030 gene locus_tag LOCUS_17290 gene murD 17681 19030 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_17290 19315 21942 gene locus_tag LOCUS_17300 19315 21942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 22293 22111 gene locus_tag LOCUS_17310 22293 22111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 24190 22685 gene locus_tag LOCUS_17320 24190 22685 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275247.1 protein_id gnl|my_center|LOCUS_17320 25487 24225 gene locus_tag LOCUS_17330 25487 24225 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_17330 26868 25543 gene locus_tag LOCUS_17340 gene sufD 26868 25543 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_17340 27775 27005 gene locus_tag LOCUS_17350 gene sufC 27775 27005 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_17350 29341 27899 gene locus_tag LOCUS_17360 gene sufB 29341 27899 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_17360 29565 30203 gene locus_tag LOCUS_17370 gene sufR 29565 30203 CDS product iron-sulfur cluster biosynthesis transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence042 335 1546 gene locus_tag LOCUS_17380 335 1546 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126018.1 protein_id gnl|my_center|LOCUS_17380 3000 2104 gene locus_tag LOCUS_17390 3000 2104 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_17390 3648 3049 gene locus_tag LOCUS_17400 3648 3049 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_17400 3944 3810 gene locus_tag LOCUS_17410 3944 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 4949 4086 gene locus_tag LOCUS_17420 4949 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 7581 5155 gene locus_tag LOCUS_17430 7581 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 7810 9450 gene locus_tag LOCUS_17440 7810 9450 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_17440 9802 9491 gene locus_tag LOCUS_17450 9802 9491 CDS product DUF2488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_17450 10628 9870 gene locus_tag LOCUS_17460 10628 9870 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140107.1 protein_id gnl|my_center|LOCUS_17460 10996 10652 gene locus_tag LOCUS_17470 10996 10652 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056570.1 protein_id gnl|my_center|LOCUS_17470 11261 12457 gene locus_tag LOCUS_17480 11261 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 13624 12803 gene locus_tag LOCUS_17490 13624 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 14046 16298 gene locus_tag LOCUS_17500 14046 16298 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_17500 16301 17083 gene locus_tag LOCUS_17510 16301 17083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 17449 18495 gene locus_tag LOCUS_17520 gene fbp 17449 18495 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056391.1 protein_id gnl|my_center|LOCUS_17520 19190 18804 gene locus_tag LOCUS_17530 19190 18804 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_17530 19420 19196 gene locus_tag LOCUS_17540 19420 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 20572 19775 gene locus_tag LOCUS_17550 20572 19775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726986.1 protein_id gnl|my_center|LOCUS_17550 21335 20565 gene locus_tag LOCUS_17560 21335 20565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_17560 22862 21336 gene locus_tag LOCUS_17570 22862 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 23974 22898 gene locus_tag LOCUS_17580 23974 22898 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733143.1 protein_id gnl|my_center|LOCUS_17580 24176 25546 gene locus_tag LOCUS_17590 24176 25546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 26479 26727 gene locus_tag LOCUS_17600 26479 26727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 26724 28160 gene locus_tag LOCUS_17610 26724 28160 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920933.1 protein_id gnl|my_center|LOCUS_17610 28157 28540 gene locus_tag LOCUS_17620 28157 28540 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_17620 28537 28788 gene locus_tag LOCUS_17630 28537 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_17630 28785 29054 gene locus_tag LOCUS_17640 28785 29054 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920932.1 protein_id gnl|my_center|LOCUS_17640 29063 29605 gene locus_tag LOCUS_17650 29063 29605 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 protein_id gnl|my_center|LOCUS_17650 29605 30267 gene locus_tag LOCUS_17660 29605 30267 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence043 709 305 gene locus_tag LOCUS_17670 709 305 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887981.1 protein_id gnl|my_center|LOCUS_17670 1813 737 gene locus_tag LOCUS_17680 gene hisC 1813 737 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_17680 3716 1965 gene locus_tag LOCUS_17690 3716 1965 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_17690 8003 3792 gene locus_tag LOCUS_17700 8003 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 15721 8000 gene locus_tag LOCUS_17710 15721 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 19194 15958 gene locus_tag LOCUS_17720 19194 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 25700 19200 gene locus_tag LOCUS_17730 25700 19200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17730 26194 27372 gene locus_tag LOCUS_17740 26194 27372 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 protein_id gnl|my_center|LOCUS_17740 27356 28420 gene locus_tag LOCUS_17750 gene leuB 27356 28420 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_17750 28433 30163 gene locus_tag LOCUS_17760 28433 30163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence044 599 1387 gene locus_tag LOCUS_17770 gene cobM 599 1387 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056411.1 protein_id gnl|my_center|LOCUS_17770 2223 1753 gene locus_tag LOCUS_17780 gene tspO 2223 1753 CDS product tryptophan-rich sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338115.1 protein_id gnl|my_center|LOCUS_17780 2571 2230 gene locus_tag LOCUS_17790 2571 2230 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_17790 4315 2783 gene locus_tag LOCUS_17800 4315 2783 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043195.1 protein_id gnl|my_center|LOCUS_17800 5748 4615 gene locus_tag LOCUS_17810 5748 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 6235 6014 gene locus_tag LOCUS_17820 6235 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 6527 6240 gene locus_tag LOCUS_17830 gene higB 6527 6240 CDS product type II toxin-antitoxin system toxin HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550189.1 protein_id gnl|my_center|LOCUS_17830 7666 6557 gene locus_tag LOCUS_17840 7666 6557 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524107.1 protein_id gnl|my_center|LOCUS_17840 8243 7686 gene locus_tag LOCUS_17850 8243 7686 CDS product Ycf51 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_17850 8220 8837 gene locus_tag LOCUS_17860 8220 8837 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_17860 9117 9434 gene locus_tag LOCUS_17870 9117 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 9431 9793 gene locus_tag LOCUS_17880 9431 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 9793 10491 gene locus_tag LOCUS_17890 gene queC 9793 10491 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_17890 11081 10509 gene locus_tag LOCUS_17900 11081 10509 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_17900 11549 11358 gene locus_tag LOCUS_17910 11549 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 11749 12702 gene locus_tag LOCUS_17920 11749 12702 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056398.1 protein_id gnl|my_center|LOCUS_17920 12887 15274 gene locus_tag LOCUS_17930 12887 15274 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_17930 16121 17569 gene locus_tag LOCUS_17940 gene atpD 16121 17569 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056375.1 protein_id gnl|my_center|LOCUS_17940 17644 18060 gene locus_tag LOCUS_17950 gene atpC 17644 18060 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056376.1 protein_id gnl|my_center|LOCUS_17950 18597 18274 gene locus_tag LOCUS_17960 18597 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 18701 19123 gene locus_tag LOCUS_17970 18701 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 19120 19383 gene locus_tag LOCUS_17980 19120 19383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 19429 20496 gene locus_tag LOCUS_17990 gene mraY 19429 20496 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799153.1 protein_id gnl|my_center|LOCUS_17990 20820 20497 gene locus_tag LOCUS_18000 20820 20497 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_18000 21237 21527 gene locus_tag LOCUS_18010 21237 21527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 21624 21857 gene locus_tag LOCUS_18020 21624 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 22060 22263 gene locus_tag LOCUS_18030 22060 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 27954 22264 gene locus_tag LOCUS_18040 27954 22264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 28413 28087 gene locus_tag LOCUS_18050 28413 28087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence045 1254 2822 gene locus_tag LOCUS_18060 gene kdpA 1254 2822 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140576.1 protein_id gnl|my_center|LOCUS_18060 2838 4997 gene locus_tag LOCUS_18070 gene kdpB 2838 4997 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140577.1 protein_id gnl|my_center|LOCUS_18070 4997 5272 gene locus_tag LOCUS_18080 4997 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 5282 6220 gene locus_tag LOCUS_18090 5282 6220 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114936010.1 protein_id gnl|my_center|LOCUS_18090 6864 7508 gene locus_tag LOCUS_18100 gene kdpC 6864 7508 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140578.1 protein_id gnl|my_center|LOCUS_18100 8324 7641 gene locus_tag LOCUS_18110 8324 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 11529 8872 gene locus_tag LOCUS_18120 11529 8872 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057456.1 protein_id gnl|my_center|LOCUS_18120 11612 12016 gene locus_tag LOCUS_18130 11612 12016 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_18130 12966 12274 gene locus_tag LOCUS_18140 12966 12274 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_18140 14850 13249 gene locus_tag LOCUS_18150 gene dndC 14850 13249 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_18150 15833 14874 gene locus_tag LOCUS_18160 15833 14874 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_18160 16370 16050 gene locus_tag LOCUS_18170 16370 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 18242 16428 gene locus_tag LOCUS_18180 18242 16428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056007.1 protein_id gnl|my_center|LOCUS_18180 18806 18477 gene locus_tag LOCUS_18190 18806 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 20673 18862 gene locus_tag LOCUS_18200 gene lepA 20673 18862 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_18200 21007 21237 gene locus_tag LOCUS_18210 21007 21237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 21464 21850 gene locus_tag LOCUS_18220 21464 21850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 22075 22338 gene locus_tag LOCUS_18230 22075 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 23383 23093 gene locus_tag LOCUS_18240 23383 23093 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_18240 23580 23380 gene locus_tag LOCUS_18250 23580 23380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 23850 24098 gene locus_tag LOCUS_18260 23850 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 24144 24368 gene locus_tag LOCUS_18270 24144 24368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 24365 24550 gene locus_tag LOCUS_18280 24365 24550 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_18280 25186 24584 gene locus_tag LOCUS_18290 25186 24584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 25656 27596 gene locus_tag LOCUS_18300 25656 27596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 27712 28590 gene locus_tag LOCUS_18310 27712 28590 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence046 659 1798 gene locus_tag LOCUS_18320 659 1798 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_18320 2231 3973 gene locus_tag LOCUS_18330 2231 3973 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_18330 3973 5241 gene locus_tag LOCUS_18340 3973 5241 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330441.1 protein_id gnl|my_center|LOCUS_18340 5848 5504 gene locus_tag LOCUS_18350 5848 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 6138 5845 gene locus_tag LOCUS_18360 6138 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6459 6737 gene locus_tag LOCUS_18370 6459 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 6730 7143 gene locus_tag LOCUS_18380 6730 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 7301 7555 gene locus_tag LOCUS_18390 7301 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 10700 8337 gene locus_tag LOCUS_18400 10700 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 12193 11198 gene locus_tag LOCUS_18410 12193 11198 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143314.1 protein_id gnl|my_center|LOCUS_18410 12532 12873 gene locus_tag LOCUS_18420 12532 12873 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_18420 14163 12850 gene locus_tag LOCUS_18430 14163 12850 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_18430 15487 14600 gene locus_tag LOCUS_18440 gene cofG 15487 14600 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057355.1 protein_id gnl|my_center|LOCUS_18440 15600 17264 gene locus_tag LOCUS_18450 15600 17264 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_18450 17527 17261 gene locus_tag LOCUS_18460 17527 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 18064 17666 gene locus_tag LOCUS_18470 18064 17666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 18347 18048 gene locus_tag LOCUS_18480 18347 18048 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_18480 18643 19353 gene locus_tag LOCUS_18490 18643 19353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 19350 19814 gene locus_tag LOCUS_18500 19350 19814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 19993 21357 gene locus_tag LOCUS_18510 19993 21357 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_18510 21497 22018 gene locus_tag LOCUS_18520 21497 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 22362 24050 gene locus_tag LOCUS_18530 22362 24050 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_18530 25256 24534 gene locus_tag LOCUS_18540 25256 24534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 25747 26916 gene locus_tag LOCUS_18550 25747 26916 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_18550 27005 27904 gene locus_tag LOCUS_18560 27005 27904 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938053.1 protein_id gnl|my_center|LOCUS_18560 27919 28293 gene locus_tag LOCUS_18570 27919 28293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence047 2154 376 gene locus_tag LOCUS_18580 2154 376 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928808.1 protein_id gnl|my_center|LOCUS_18580 2724 2290 gene locus_tag LOCUS_18590 2724 2290 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_18590 4335 2980 gene locus_tag LOCUS_18600 4335 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 5386 4376 gene locus_tag LOCUS_18610 gene egtD 5386 4376 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_18610 5900 5616 gene locus_tag LOCUS_18620 5900 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 6526 5933 gene locus_tag LOCUS_18630 6526 5933 CDS product DUF3177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_18630 6926 6702 gene locus_tag LOCUS_18640 6926 6702 CDS product Calvin cycle protein CP12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_18640 7537 7385 gene locus_tag LOCUS_18650 7537 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 7559 7894 gene locus_tag LOCUS_18660 7559 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 8287 7901 gene locus_tag LOCUS_18670 8287 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 8982 8898 gene locus_tag LOCUS_t00220 8982 8898 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9848 8961 gene locus_tag LOCUS_18680 9848 8961 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_18680 10260 9841 gene locus_tag LOCUS_18690 10260 9841 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_18690 11117 10380 gene locus_tag LOCUS_18700 11117 10380 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 protein_id gnl|my_center|LOCUS_18700 11916 11149 gene locus_tag LOCUS_18710 11916 11149 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_18710 12792 12028 gene locus_tag LOCUS_18720 gene fabG 12792 12028 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_18720 13845 12946 gene locus_tag LOCUS_18730 13845 12946 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_18730 14436 13951 gene locus_tag LOCUS_18740 14436 13951 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_18740 15069 14833 gene locus_tag LOCUS_18750 15069 14833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 15372 15076 gene locus_tag LOCUS_18760 15372 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 15622 15801 gene locus_tag LOCUS_18770 15622 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 16017 16793 gene locus_tag LOCUS_18780 16017 16793 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202282.1 protein_id gnl|my_center|LOCUS_18780 19662 16750 gene locus_tag LOCUS_18790 gene uvrA 19662 16750 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524117.1 protein_id gnl|my_center|LOCUS_18790 20648 19875 gene locus_tag LOCUS_18800 gene cysE 20648 19875 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_18800 20864 22519 gene locus_tag LOCUS_18810 20864 22519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 23122 22520 gene locus_tag LOCUS_18820 gene tsaB 23122 22520 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 protein_id gnl|my_center|LOCUS_18820 23223 23152 gene locus_tag LOCUS_t00230 23223 23152 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 24159 23287 gene locus_tag LOCUS_18830 24159 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 protein_id gnl|my_center|LOCUS_18830 25008 24322 gene locus_tag LOCUS_18840 25008 24322 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_18840 25046 25294 gene locus_tag LOCUS_18850 gene yidD 25046 25294 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_18850 26069 25311 gene locus_tag LOCUS_18860 26069 25311 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 protein_id gnl|my_center|LOCUS_18860 26268 27407 gene locus_tag LOCUS_18870 26268 27407 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928444.1 protein_id gnl|my_center|LOCUS_18870 27463 27537 gene locus_tag LOCUS_t00240 27463 27537 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 1616 1936 gene locus_tag LOCUS_18880 1616 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1926 2369 gene locus_tag LOCUS_18890 gene yhaV 1926 2369 CDS product type II toxin-antitoxin system ribonuclease toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347267.1 protein_id gnl|my_center|LOCUS_18890 2516 2797 gene locus_tag LOCUS_18900 2516 2797 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_18900 2814 3128 gene locus_tag LOCUS_18910 2814 3128 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_18910 4607 3288 gene locus_tag LOCUS_18920 4607 3288 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 protein_id gnl|my_center|LOCUS_18920 4758 5594 gene locus_tag LOCUS_18930 gene lpxA 4758 5594 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_18930 5781 7010 gene locus_tag LOCUS_18940 gene lpxB 5781 7010 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_18940 10037 7050 gene locus_tag LOCUS_18950 gene gcvP 10037 7050 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_18950 11867 10242 gene locus_tag LOCUS_18960 11867 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 11897 12697 gene locus_tag LOCUS_18970 11897 12697 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142576.1 protein_id gnl|my_center|LOCUS_18970 13333 12983 gene locus_tag LOCUS_18980 13333 12983 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057330.1 protein_id gnl|my_center|LOCUS_18980 13560 14600 gene locus_tag LOCUS_18990 13560 14600 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_18990 14691 15440 gene locus_tag LOCUS_19000 14691 15440 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_19000 15452 15988 gene locus_tag LOCUS_19010 gene mreD 15452 15988 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144384.1 protein_id gnl|my_center|LOCUS_19010 16101 18551 gene locus_tag LOCUS_19020 16101 18551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 18879 20639 gene locus_tag LOCUS_19030 18879 20639 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_19030 20663 21589 gene locus_tag LOCUS_19040 20663 21589 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057302.1 protein_id gnl|my_center|LOCUS_19040 21817 21668 gene locus_tag LOCUS_19050 21817 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 22144 23664 gene locus_tag LOCUS_19060 gene kaiC 22144 23664 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_19060 23804 24568 gene locus_tag LOCUS_19070 23804 24568 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929594.1 protein_id gnl|my_center|LOCUS_19070 24653 27277 gene locus_tag LOCUS_19080 24653 27277 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha N-terminal partner DnaE-N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057891.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence049 2433 151 gene locus_tag LOCUS_19090 gene recJ 2433 151 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_19090 2757 2503 gene locus_tag LOCUS_19100 2757 2503 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_19100 5800 2777 gene locus_tag LOCUS_19110 5800 2777 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_19110 6178 6516 gene locus_tag LOCUS_19120 6178 6516 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_19120 6869 7945 gene locus_tag LOCUS_19130 gene hrcA 6869 7945 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_19130 8225 7932 gene locus_tag LOCUS_19140 8225 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 8455 9363 gene locus_tag LOCUS_19150 gene menA 8455 9363 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592656.1 protein_id gnl|my_center|LOCUS_19150 9536 11230 gene locus_tag LOCUS_19160 9536 11230 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_19160 11287 11739 gene locus_tag LOCUS_19170 11287 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 11742 13109 gene locus_tag LOCUS_19180 gene rlmD 11742 13109 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_19180 13451 13852 gene locus_tag LOCUS_19190 13451 13852 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083625306.1 protein_id gnl|my_center|LOCUS_19190 14130 13849 gene locus_tag LOCUS_19200 14130 13849 CDS product DUF6439 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056108.1 protein_id gnl|my_center|LOCUS_19200 14203 14604 gene locus_tag LOCUS_19210 14203 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 16431 14875 gene locus_tag LOCUS_19220 16431 14875 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920854.1 protein_id gnl|my_center|LOCUS_19220 18559 16970 gene locus_tag LOCUS_19230 18559 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 20834 18570 gene locus_tag LOCUS_19240 20834 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 21621 21959 gene locus_tag LOCUS_19250 21621 21959 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154861.1 protein_id gnl|my_center|LOCUS_19250 22085 23230 gene locus_tag LOCUS_19260 gene arsB 22085 23230 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_19260 23240 23887 gene locus_tag LOCUS_19270 gene arsH 23240 23887 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928410.1 protein_id gnl|my_center|LOCUS_19270 23911 24309 gene locus_tag LOCUS_19280 gene arsC 23911 24309 CDS product arsenate reductase, glutathione/glutaredoxin type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_19280 25483 24602 gene locus_tag LOCUS_19290 25483 24602 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057174.1 protein_id gnl|my_center|LOCUS_19290 25817 25617 gene locus_tag LOCUS_19300 25817 25617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence050 256 501 gene locus_tag LOCUS_19310 256 501 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615098.1 protein_id gnl|my_center|LOCUS_19310 571 1821 gene locus_tag LOCUS_19320 gene fabF 571 1821 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_19320 1904 3910 gene locus_tag LOCUS_19330 gene tkt 1904 3910 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057707.1 protein_id gnl|my_center|LOCUS_19330 4078 4845 gene locus_tag LOCUS_19340 4078 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 4842 5312 gene locus_tag LOCUS_19350 4842 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 5428 5682 gene locus_tag LOCUS_19360 5428 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6585 5692 gene locus_tag LOCUS_19370 6585 5692 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_19370 6978 6796 gene locus_tag LOCUS_19380 6978 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 6977 8554 gene locus_tag LOCUS_19390 6977 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 8834 9061 gene locus_tag LOCUS_19400 8834 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 9043 9459 gene locus_tag LOCUS_19410 9043 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 9567 9869 gene locus_tag LOCUS_19420 9567 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 10148 10432 gene locus_tag LOCUS_19430 10148 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 10891 10819 gene locus_tag LOCUS_t00250 10891 10819 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11004 11249 gene locus_tag LOCUS_19440 11004 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 11282 12613 gene locus_tag LOCUS_19450 11282 12613 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_19450 12837 13958 gene locus_tag LOCUS_19460 12837 13958 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_19460 14034 15197 gene locus_tag LOCUS_19470 gene grrM 14034 15197 CDS product GRRM system radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_19470 16211 15501 gene locus_tag LOCUS_19480 16211 15501 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_19480 16503 17447 gene locus_tag LOCUS_19490 16503 17447 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_19490 17494 19347 gene locus_tag LOCUS_19500 17494 19347 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056748.1 protein_id gnl|my_center|LOCUS_19500 19428 20153 gene locus_tag LOCUS_19510 19428 20153 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_19510 20232 21782 gene locus_tag LOCUS_19520 20232 21782 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 protein_id gnl|my_center|LOCUS_19520 21840 23135 gene locus_tag LOCUS_19530 21840 23135 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 protein_id gnl|my_center|LOCUS_19530 23441 25072 gene locus_tag LOCUS_19540 23441 25072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 25234 25527 gene locus_tag LOCUS_19550 25234 25527 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_19550 25524 25859 gene locus_tag LOCUS_19560 25524 25859 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_19560 26430 25999 gene locus_tag LOCUS_19570 26430 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence051 6657 1960 gene locus_tag LOCUS_19580 6657 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 16301 6654 gene locus_tag LOCUS_19590 16301 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 17712 16336 gene locus_tag LOCUS_19600 17712 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 18385 18119 gene locus_tag LOCUS_19610 18385 18119 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141943.1 protein_id gnl|my_center|LOCUS_19610 20276 18534 gene locus_tag LOCUS_19620 20276 18534 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_19620 22879 20849 gene locus_tag LOCUS_19630 22879 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 23892 23227 gene locus_tag LOCUS_19640 gene bioD 23892 23227 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406219.1 protein_id gnl|my_center|LOCUS_19640 24338 26116 gene locus_tag LOCUS_19650 gene ilvB 24338 26116 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057136.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence052 233 871 gene locus_tag LOCUS_19660 233 871 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798139.1 protein_id gnl|my_center|LOCUS_19660 930 1565 gene locus_tag LOCUS_19670 930 1565 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 protein_id gnl|my_center|LOCUS_19670 2024 2737 gene locus_tag LOCUS_19680 2024 2737 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_19680 2783 4027 gene locus_tag LOCUS_19690 2783 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4376 4657 gene locus_tag LOCUS_19700 4376 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4659 4814 gene locus_tag LOCUS_19710 4659 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 7265 5124 gene locus_tag LOCUS_19720 7265 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 7454 8620 gene locus_tag LOCUS_19730 7454 8620 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_19730 8819 8622 gene locus_tag LOCUS_19740 8819 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 9186 10127 gene locus_tag LOCUS_19750 9186 10127 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_19750 11261 10320 gene locus_tag LOCUS_19760 11261 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_19760 12031 11489 gene locus_tag LOCUS_19770 12031 11489 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_19770 14208 12613 gene locus_tag LOCUS_19780 14208 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 15940 14777 gene locus_tag LOCUS_19790 15940 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 16628 16188 gene locus_tag LOCUS_19800 16628 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 16903 17226 gene locus_tag LOCUS_19810 gene trxA 16903 17226 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966364.1 protein_id gnl|my_center|LOCUS_19810 17687 18304 gene locus_tag LOCUS_19820 17687 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 19354 18458 gene locus_tag LOCUS_19830 19354 18458 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_19830 19625 19876 gene locus_tag LOCUS_19840 19625 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 19961 21082 gene locus_tag LOCUS_19850 19961 21082 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379429.1 protein_id gnl|my_center|LOCUS_19850 21158 21496 gene locus_tag LOCUS_19860 21158 21496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 21892 23256 gene locus_tag LOCUS_19870 21892 23256 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_19870 23498 23908 gene locus_tag LOCUS_19880 23498 23908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 25059 23875 gene locus_tag LOCUS_19890 25059 23875 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_19890 25355 26149 gene locus_tag LOCUS_19900 25355 26149 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence053 2522 168 gene locus_tag LOCUS_19910 2522 168 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797719.1 protein_id gnl|my_center|LOCUS_19910 3362 2919 gene locus_tag LOCUS_19920 3362 2919 CDS product DUF3531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_19920 4003 3422 gene locus_tag LOCUS_19930 4003 3422 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 protein_id gnl|my_center|LOCUS_19930 5058 4000 gene locus_tag LOCUS_19940 5058 4000 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_19940 5231 5055 gene locus_tag LOCUS_19950 5231 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 5575 6129 gene locus_tag LOCUS_19960 5575 6129 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_19960 6783 6208 gene locus_tag LOCUS_19970 6783 6208 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143800.1 protein_id gnl|my_center|LOCUS_19970 8752 7082 gene locus_tag LOCUS_19980 8752 7082 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_19980 10522 9302 gene locus_tag LOCUS_19990 10522 9302 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920707.1 protein_id gnl|my_center|LOCUS_19990 10787 10566 gene locus_tag LOCUS_20000 10787 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 11843 10956 gene locus_tag LOCUS_20010 gene argB 11843 10956 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_20010 13146 11923 gene locus_tag LOCUS_20020 13146 11923 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_20020 14791 14234 gene locus_tag LOCUS_20030 14791 14234 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140402.1 protein_id gnl|my_center|LOCUS_20030 16162 14819 gene locus_tag LOCUS_20040 16162 14819 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_20040 16457 16290 gene locus_tag LOCUS_20050 16457 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 17681 16518 gene locus_tag LOCUS_20060 17681 16518 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055867.1 protein_id gnl|my_center|LOCUS_20060 17889 18941 gene locus_tag LOCUS_20070 17889 18941 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_20070 18934 19977 gene locus_tag LOCUS_20080 18934 19977 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_20080 24771 20164 gene locus_tag LOCUS_20090 24771 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077139241.1 protein_id gnl|my_center|LOCUS_20090 25426 24989 gene locus_tag LOCUS_20100 25426 24989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 25653 25997 gene locus_tag LOCUS_20110 25653 25997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence054 1175 180 gene locus_tag LOCUS_20120 1175 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2455 1358 gene locus_tag LOCUS_20130 2455 1358 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_20130 3849 2461 gene locus_tag LOCUS_20140 gene hpnO 3849 2461 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_20140 4523 4290 gene locus_tag LOCUS_20150 4523 4290 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124526.1 protein_id gnl|my_center|LOCUS_20150 5232 4603 gene locus_tag LOCUS_20160 5232 4603 CDS product DUF6391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_20160 6376 5675 gene locus_tag LOCUS_20170 6376 5675 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920927.1 protein_id gnl|my_center|LOCUS_20170 6657 6866 gene locus_tag LOCUS_20180 6657 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 6876 8822 gene locus_tag LOCUS_20190 6876 8822 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_20190 8822 9229 gene locus_tag LOCUS_20200 8822 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 9523 9272 gene locus_tag LOCUS_20210 9523 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_20210 10307 9528 gene locus_tag LOCUS_20220 10307 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105219828.1 protein_id gnl|my_center|LOCUS_20220 10709 10317 gene locus_tag LOCUS_20230 10709 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 13137 11380 gene locus_tag LOCUS_20240 gene argS 13137 11380 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056669.1 protein_id gnl|my_center|LOCUS_20240 13616 13230 gene locus_tag LOCUS_20250 13616 13230 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681559.1 protein_id gnl|my_center|LOCUS_20250 13843 13616 gene locus_tag LOCUS_20260 13843 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 14364 13885 gene locus_tag LOCUS_20270 gene ispF 14364 13885 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_20270 15524 14913 gene locus_tag LOCUS_20280 15524 14913 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_20280 16736 15549 gene locus_tag LOCUS_20290 16736 15549 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_20290 20163 17347 gene locus_tag LOCUS_20300 gene secA 20163 17347 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057688.1 protein_id gnl|my_center|LOCUS_20300 20386 21375 gene locus_tag LOCUS_20310 20386 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 21378 22034 gene locus_tag LOCUS_20320 21378 22034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 25516 22319 gene locus_tag LOCUS_20330 25516 22319 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_20330 25686 25940 gene locus_tag LOCUS_20340 25686 25940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence055 524 838 gene locus_tag LOCUS_20350 524 838 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_20350 1333 1124 gene locus_tag LOCUS_20360 1333 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1654 1409 gene locus_tag LOCUS_20370 1654 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 4529 1659 gene locus_tag LOCUS_20380 gene polA 4529 1659 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 protein_id gnl|my_center|LOCUS_20380 4702 5628 gene locus_tag LOCUS_20390 4702 5628 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_20390 5674 7059 gene locus_tag LOCUS_20400 5674 7059 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_20400 7299 7982 gene locus_tag LOCUS_20410 7299 7982 CDS product Mo-dependent nitrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142802.1 protein_id gnl|my_center|LOCUS_20410 8111 9799 gene locus_tag LOCUS_20420 8111 9799 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_20420 10483 10701 gene locus_tag LOCUS_20430 10483 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 11139 10846 gene locus_tag LOCUS_20440 11139 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 11276 11599 gene locus_tag LOCUS_20450 11276 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 11666 11890 gene locus_tag LOCUS_20460 11666 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 12947 12255 gene locus_tag LOCUS_20470 12947 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 13366 12917 gene locus_tag LOCUS_20480 13366 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 14000 13299 gene locus_tag LOCUS_20490 14000 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 16751 14118 gene locus_tag LOCUS_20500 gene cphA 16751 14118 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_20500 17713 16859 gene locus_tag LOCUS_20510 17713 16859 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058003.1 protein_id gnl|my_center|LOCUS_20510 18087 18782 gene locus_tag LOCUS_20520 gene trmD 18087 18782 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057450.1 protein_id gnl|my_center|LOCUS_20520 19121 20845 gene locus_tag LOCUS_20530 19121 20845 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056931.1 protein_id gnl|my_center|LOCUS_20530 21009 21509 gene locus_tag LOCUS_20540 21009 21509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 21554 23299 gene locus_tag LOCUS_20550 21554 23299 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057213.1 protein_id gnl|my_center|LOCUS_20550 23466 24206 gene locus_tag LOCUS_20560 23466 24206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 24212 24484 gene locus_tag LOCUS_20570 24212 24484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920941.1 protein_id gnl|my_center|LOCUS_20570 24763 25506 gene locus_tag LOCUS_20580 24763 25506 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_20580 25680 25868 gene locus_tag LOCUS_20590 25680 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence056 36 116 gene locus_tag LOCUS_t00260 36 116 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 204 554 gene locus_tag LOCUS_20600 204 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 690 1910 gene locus_tag LOCUS_20610 690 1910 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676943.1 protein_id gnl|my_center|LOCUS_20610 2184 3728 gene locus_tag LOCUS_20620 2184 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 4057 5184 gene locus_tag LOCUS_20630 4057 5184 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_20630 6162 5185 gene locus_tag LOCUS_20640 gene mdh 6162 5185 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142537.1 protein_id gnl|my_center|LOCUS_20640 6440 6189 gene locus_tag LOCUS_20650 gene ndhO 6440 6189 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055872.1 protein_id gnl|my_center|LOCUS_20650 6720 7373 gene locus_tag LOCUS_20660 gene upp 6720 7373 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920929.1 protein_id gnl|my_center|LOCUS_20660 7388 7675 gene locus_tag LOCUS_20670 7388 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 8494 7994 gene locus_tag LOCUS_20680 8494 7994 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_20680 8847 9455 gene locus_tag LOCUS_20690 gene rpsD 8847 9455 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_20690 10056 10343 gene locus_tag LOCUS_20700 10056 10343 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929315.1 protein_id gnl|my_center|LOCUS_20700 10780 10340 gene locus_tag LOCUS_20710 10780 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920753.1 protein_id gnl|my_center|LOCUS_20710 11252 11512 gene locus_tag LOCUS_20720 gene grxC 11252 11512 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_20720 11528 12511 gene locus_tag LOCUS_20730 gene gshB 11528 12511 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_20730 12654 12965 gene locus_tag LOCUS_20740 12654 12965 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_20740 12958 13287 gene locus_tag LOCUS_20750 12958 13287 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_20750 13460 14479 gene locus_tag LOCUS_20760 13460 14479 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_20760 14590 15465 gene locus_tag LOCUS_20770 14590 15465 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_20770 17054 15510 gene locus_tag LOCUS_20780 17054 15510 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042464373.1 protein_id gnl|my_center|LOCUS_20780 19265 17094 gene locus_tag LOCUS_20790 19265 17094 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_20790 19657 20247 gene locus_tag LOCUS_20800 19657 20247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 20591 20319 gene locus_tag LOCUS_20810 20591 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 20874 20575 gene locus_tag LOCUS_20820 20874 20575 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_20820 21253 21465 gene locus_tag LOCUS_20830 21253 21465 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048048124.1 protein_id gnl|my_center|LOCUS_20830 21462 21686 gene locus_tag LOCUS_20840 21462 21686 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_20840 21764 22036 gene locus_tag LOCUS_20850 21764 22036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 22400 22645 gene locus_tag LOCUS_20860 22400 22645 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_20860 22645 22866 gene locus_tag LOCUS_20870 22645 22866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 24342 22963 gene locus_tag LOCUS_20880 24342 22963 CDS product folate/biopterin family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_20880 24756 24995 gene locus_tag LOCUS_20890 24756 24995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence057 1654 125 gene locus_tag LOCUS_20900 1654 125 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056367.1 protein_id gnl|my_center|LOCUS_20900 2139 3611 gene locus_tag LOCUS_20910 gene gatB 2139 3611 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_20910 3761 4426 gene locus_tag LOCUS_20920 3761 4426 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920739.1 protein_id gnl|my_center|LOCUS_20920 4896 4444 gene locus_tag LOCUS_20930 4896 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 5730 4945 gene locus_tag LOCUS_20940 5730 4945 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920643.1 protein_id gnl|my_center|LOCUS_20940 6447 7445 gene locus_tag LOCUS_20950 6447 7445 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_20950 7464 8321 gene locus_tag LOCUS_20960 7464 8321 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167919.1 protein_id gnl|my_center|LOCUS_20960 8328 9740 gene locus_tag LOCUS_20970 8328 9740 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_20970 10629 9682 gene locus_tag LOCUS_20980 gene miaA 10629 9682 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056495.1 protein_id gnl|my_center|LOCUS_20980 12806 10953 gene locus_tag LOCUS_20990 gene ftsH3 12806 10953 CDS product ATP-dependent zinc metalloprotease FtsH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055986.1 protein_id gnl|my_center|LOCUS_20990 15687 13198 gene locus_tag LOCUS_21000 15687 13198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 16293 17354 gene locus_tag LOCUS_21010 16293 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 17441 18061 gene locus_tag LOCUS_21020 17441 18061 CDS product CPP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_21020 18717 18058 gene locus_tag LOCUS_21030 18717 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 19084 20055 gene locus_tag LOCUS_21040 gene sds 19084 20055 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_21040 20597 20052 gene locus_tag LOCUS_21050 20597 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_21050 21274 20936 gene locus_tag LOCUS_21060 21274 20936 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_21060 21337 22977 gene locus_tag LOCUS_21070 gene cimA 21337 22977 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_21070 23773 23279 gene locus_tag LOCUS_21080 23773 23279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243886.1 protein_id gnl|my_center|LOCUS_21080 24329 23862 gene locus_tag LOCUS_21090 24329 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 24568 24326 gene locus_tag LOCUS_21100 24568 24326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence058 759 1649 gene locus_tag LOCUS_21110 759 1649 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 protein_id gnl|my_center|LOCUS_21110 2693 1863 gene locus_tag LOCUS_21120 2693 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2977 4017 gene locus_tag LOCUS_21130 2977 4017 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920837.1 protein_id gnl|my_center|LOCUS_21130 4515 4108 gene locus_tag LOCUS_21140 4515 4108 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_21140 5030 4524 gene locus_tag LOCUS_21150 5030 4524 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_21150 5242 6483 gene locus_tag LOCUS_21160 5242 6483 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 protein_id gnl|my_center|LOCUS_21160 6483 6941 gene locus_tag LOCUS_21170 gene ruvX 6483 6941 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_21170 7507 6998 gene locus_tag LOCUS_21180 gene apcB 7507 6998 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_21180 8829 7690 gene locus_tag LOCUS_21190 gene proB 8829 7690 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057952.1 protein_id gnl|my_center|LOCUS_21190 10962 8998 gene locus_tag LOCUS_21200 10962 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 11662 11021 gene locus_tag LOCUS_21210 11662 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 12120 11659 gene locus_tag LOCUS_21220 12120 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 14204 12195 gene locus_tag LOCUS_21230 14204 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 14388 15071 gene locus_tag LOCUS_21240 14388 15071 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_21240 15216 15815 gene locus_tag LOCUS_21250 15216 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022055.1 protein_id gnl|my_center|LOCUS_21250 16038 16856 gene locus_tag LOCUS_21260 16038 16856 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_21260 17831 17025 gene locus_tag LOCUS_21270 17831 17025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 17913 18986 gene locus_tag LOCUS_21280 gene murG 17913 18986 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057646.1 protein_id gnl|my_center|LOCUS_21280 19558 18968 gene locus_tag LOCUS_21290 19558 18968 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_21290 20454 19594 gene locus_tag LOCUS_21300 20454 19594 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_21300 21925 20636 gene locus_tag LOCUS_21310 21925 20636 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_21310 22595 23962 gene locus_tag LOCUS_21320 22595 23962 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531469.1 protein_id gnl|my_center|LOCUS_21320 24027 24281 gene locus_tag LOCUS_21330 24027 24281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence059 <1 561 gene locus_tag LOCUS_21340 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140481.1:Rpn family recombination-promoting nuclease/putative transposase 1059 2852 gene locus_tag LOCUS_21350 1059 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2884 4200 gene locus_tag LOCUS_21360 2884 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5336 4260 gene locus_tag LOCUS_21370 gene rsgA 5336 4260 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056831.1 protein_id gnl|my_center|LOCUS_21370 5558 5337 gene locus_tag LOCUS_21380 5558 5337 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_21380 6875 5751 gene locus_tag LOCUS_21390 gene dnaJ 6875 5751 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_21390 9138 7090 gene locus_tag LOCUS_21400 gene dnaK 9138 7090 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056634.1 protein_id gnl|my_center|LOCUS_21400 9538 10542 gene locus_tag LOCUS_21410 9538 10542 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_21410 11741 11151 gene locus_tag LOCUS_21420 11741 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 12339 13739 gene locus_tag LOCUS_21430 gene leuC 12339 13739 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143406.1 protein_id gnl|my_center|LOCUS_21430 16837 14399 gene locus_tag LOCUS_21440 16837 14399 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892072.1 protein_id gnl|my_center|LOCUS_21440 16975 18435 gene locus_tag LOCUS_21450 gene zds 16975 18435 CDS product 9,9'-di-cis-zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056192.1 protein_id gnl|my_center|LOCUS_21450 18664 19359 gene locus_tag LOCUS_21460 18664 19359 CDS product aldehyde oxygenase (deformylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057153.1 protein_id gnl|my_center|LOCUS_21460 19508 20527 gene locus_tag LOCUS_21470 19508 20527 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_21470 21442 22578 gene locus_tag LOCUS_21480 21442 22578 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_21480 22786 24042 gene locus_tag LOCUS_21490 22786 24042 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence060 1796 294 gene locus_tag LOCUS_21500 1796 294 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036534662.1 protein_id gnl|my_center|LOCUS_21500 3137 2598 gene locus_tag LOCUS_21510 3137 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 3207 3824 gene locus_tag LOCUS_21520 3207 3824 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_21520 5043 4237 gene locus_tag LOCUS_21530 5043 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 5464 5162 gene locus_tag LOCUS_21540 5464 5162 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_21540 6552 5719 gene locus_tag LOCUS_21550 gene menB 6552 5719 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_21550 6740 6925 gene locus_tag LOCUS_21560 6740 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 7912 6962 gene locus_tag LOCUS_21570 7912 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 8017 8634 gene locus_tag LOCUS_21580 8017 8634 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971715.1 protein_id gnl|my_center|LOCUS_21580 9309 8629 gene locus_tag LOCUS_21590 gene ispD 9309 8629 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056453.1 protein_id gnl|my_center|LOCUS_21590 9917 9510 gene locus_tag LOCUS_21600 9917 9510 CDS product DUF1824 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929141.1 protein_id gnl|my_center|LOCUS_21600 11215 10325 gene locus_tag LOCUS_21610 11215 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_21610 11729 11226 gene locus_tag LOCUS_21620 11729 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797617.1 protein_id gnl|my_center|LOCUS_21620 12321 13193 gene locus_tag LOCUS_21630 12321 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 14295 16055 gene locus_tag LOCUS_21640 14295 16055 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_21640 16114 17088 gene locus_tag LOCUS_21650 16114 17088 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141944.1 protein_id gnl|my_center|LOCUS_21650 17093 17368 gene locus_tag LOCUS_21660 17093 17368 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141943.1 protein_id gnl|my_center|LOCUS_21660 17368 18684 gene locus_tag LOCUS_21670 17368 18684 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 protein_id gnl|my_center|LOCUS_21670 18711 22151 gene locus_tag LOCUS_21680 18711 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 22211 23413 gene locus_tag LOCUS_21690 22211 23413 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141940.1 protein_id gnl|my_center|LOCUS_21690 23565 23825 gene locus_tag LOCUS_21700 23565 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence061 174 938 gene locus_tag LOCUS_21710 174 938 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337498.1 protein_id gnl|my_center|LOCUS_21710 2104 857 gene locus_tag LOCUS_21720 2104 857 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920848.1 protein_id gnl|my_center|LOCUS_21720 2879 2247 gene locus_tag LOCUS_21730 2879 2247 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057328.1 protein_id gnl|my_center|LOCUS_21730 3720 2998 gene locus_tag LOCUS_21740 gene pgl 3720 2998 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_21740 4116 4907 gene locus_tag LOCUS_21750 4116 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5643 6374 gene locus_tag LOCUS_21760 5643 6374 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_21760 7627 7388 gene locus_tag LOCUS_21770 7627 7388 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809228.1 protein_id gnl|my_center|LOCUS_21770 8103 7801 gene locus_tag LOCUS_21780 8103 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 8799 8392 gene locus_tag LOCUS_21790 8799 8392 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142874.1 protein_id gnl|my_center|LOCUS_21790 9185 8799 gene locus_tag LOCUS_21800 9185 8799 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_21800 9445 9230 gene locus_tag LOCUS_21810 9445 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 9756 10757 gene locus_tag LOCUS_21820 9756 10757 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_21820 11680 10754 gene locus_tag LOCUS_21830 11680 10754 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_21830 12340 11987 gene locus_tag LOCUS_21840 12340 11987 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_21840 12539 12928 gene locus_tag LOCUS_21850 12539 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 13229 13585 gene locus_tag LOCUS_21860 13229 13585 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986038.1 protein_id gnl|my_center|LOCUS_21860 13760 17752 gene locus_tag LOCUS_21870 13760 17752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 18006 18347 gene locus_tag LOCUS_21880 18006 18347 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_21880 19405 18485 gene locus_tag LOCUS_21890 19405 18485 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143980.1 protein_id gnl|my_center|LOCUS_21890 19552 20235 gene locus_tag LOCUS_21900 19552 20235 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633409.1 protein_id gnl|my_center|LOCUS_21900 20589 21023 gene locus_tag LOCUS_21910 20589 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 21831 21034 gene locus_tag LOCUS_21920 21831 21034 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223173767.1 protein_id gnl|my_center|LOCUS_21920 22117 23121 gene locus_tag LOCUS_21930 22117 23121 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_21930 23637 23482 gene locus_tag LOCUS_21940 23637 23482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence062 1284 724 gene locus_tag LOCUS_21950 1284 724 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_21950 1747 1268 gene locus_tag LOCUS_21960 1747 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 4470 1933 gene locus_tag LOCUS_21970 4470 1933 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968158.1 protein_id gnl|my_center|LOCUS_21970 6726 4711 gene locus_tag LOCUS_21980 6726 4711 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_21980 8852 6813 gene locus_tag LOCUS_21990 gene speA 8852 6813 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_21990 9095 9697 gene locus_tag LOCUS_22000 9095 9697 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_22000 9864 10430 gene locus_tag LOCUS_22010 gene recR 9864 10430 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058038.1 protein_id gnl|my_center|LOCUS_22010 12041 10674 gene locus_tag LOCUS_22020 12041 10674 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187164.1 protein_id gnl|my_center|LOCUS_22020 12561 12142 gene locus_tag LOCUS_22030 12561 12142 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_22030 13370 12672 gene locus_tag LOCUS_22040 13370 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 13556 14317 gene locus_tag LOCUS_22050 gene folD 13556 14317 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920629.1 protein_id gnl|my_center|LOCUS_22050 14585 15595 gene locus_tag LOCUS_22060 14585 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057618.1 protein_id gnl|my_center|LOCUS_22060 18394 15953 gene locus_tag LOCUS_22070 gene ppsA 18394 15953 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_22070 19016 18762 gene locus_tag LOCUS_22080 19016 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 20538 19090 gene locus_tag LOCUS_22090 20538 19090 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_22090 22600 21038 gene locus_tag LOCUS_22100 22600 21038 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_22100 23434 22871 gene locus_tag LOCUS_22110 23434 22871 CDS product thylakoid membrane photosystem I accumulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798220.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence063 411 1793 gene locus_tag LOCUS_22120 gene thiC 411 1793 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_22120 2419 1880 gene locus_tag LOCUS_22130 2419 1880 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141530.1 protein_id gnl|my_center|LOCUS_22130 2799 3719 gene locus_tag LOCUS_22140 2799 3719 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056335.1 protein_id gnl|my_center|LOCUS_22140 5190 4123 gene locus_tag LOCUS_22150 5190 4123 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897713.1 protein_id gnl|my_center|LOCUS_22150 5696 5244 gene locus_tag LOCUS_22160 5696 5244 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817109.1 protein_id gnl|my_center|LOCUS_22160 6172 5708 gene locus_tag LOCUS_22170 6172 5708 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_22170 6654 6172 gene locus_tag LOCUS_22180 6654 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 9017 6705 gene locus_tag LOCUS_22190 9017 6705 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016141.1 protein_id gnl|my_center|LOCUS_22190 9472 12387 gene locus_tag LOCUS_22200 9472 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 14561 12612 gene locus_tag LOCUS_22210 14561 12612 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948595.1 protein_id gnl|my_center|LOCUS_22210 15605 14955 gene locus_tag LOCUS_22220 15605 14955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 15812 17236 gene locus_tag LOCUS_22230 15812 17236 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_22230 18506 17265 gene locus_tag LOCUS_22240 18506 17265 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_22240 18813 19433 gene locus_tag LOCUS_22250 18813 19433 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057925.1 protein_id gnl|my_center|LOCUS_22250 19861 21195 gene locus_tag LOCUS_22260 19861 21195 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_22260 21318 22295 gene locus_tag LOCUS_22270 gene arsS 21318 22295 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272452.1 protein_id gnl|my_center|LOCUS_22270 22915 22643 gene locus_tag LOCUS_22280 22915 22643 CDS product DUF3143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_22280 23415 22921 gene locus_tag LOCUS_22290 23415 22921 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence064 362 655 gene locus_tag LOCUS_22300 gene rpsT 362 655 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_22300 706 1485 gene locus_tag LOCUS_22310 706 1485 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057029.1 protein_id gnl|my_center|LOCUS_22310 1640 4951 gene locus_tag LOCUS_22320 gene rpoB 1640 4951 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056489.1 protein_id gnl|my_center|LOCUS_22320 5251 9258 gene locus_tag LOCUS_22330 5251 9258 CDS product DNA-directed RNA polymerase subunit beta'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056487.1 protein_id gnl|my_center|LOCUS_22330 9858 9784 gene locus_tag LOCUS_t00270 9858 9784 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10414 9899 gene locus_tag LOCUS_22340 10414 9899 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_22340 10606 10520 gene locus_tag LOCUS_t00280 10606 10520 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11013 11774 gene locus_tag LOCUS_22350 11013 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 11851 14820 gene locus_tag LOCUS_22360 11851 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 15015 16790 gene locus_tag LOCUS_22370 15015 16790 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_22370 17548 16787 gene locus_tag LOCUS_22380 gene hisA 17548 16787 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140708.1 protein_id gnl|my_center|LOCUS_22380 18033 18314 gene locus_tag LOCUS_22390 18033 18314 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 protein_id gnl|my_center|LOCUS_22390 18328 18849 gene locus_tag LOCUS_22400 18328 18849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 19257 21110 gene locus_tag LOCUS_22410 19257 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 21609 21268 gene locus_tag LOCUS_22420 21609 21268 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124133.1 protein_id gnl|my_center|LOCUS_22420 22963 21800 gene locus_tag LOCUS_22430 22963 21800 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_22430 23291 23046 gene locus_tag LOCUS_22440 23291 23046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence065 598 236 gene locus_tag LOCUS_22450 598 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1177 2691 gene locus_tag LOCUS_22460 1177 2691 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_22460 3703 2786 gene locus_tag LOCUS_22470 3703 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 4461 3700 gene locus_tag LOCUS_22480 4461 3700 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131423.1 protein_id gnl|my_center|LOCUS_22480 5999 4488 gene locus_tag LOCUS_22490 5999 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6504 6106 gene locus_tag LOCUS_22500 gene dndE 6504 6106 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_22500 8940 6955 gene locus_tag LOCUS_22510 gene dndD 8940 6955 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_22510 9315 10958 gene locus_tag LOCUS_22520 9315 10958 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_22520 11103 12476 gene locus_tag LOCUS_22530 11103 12476 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015158974.1 protein_id gnl|my_center|LOCUS_22530 13401 12478 gene locus_tag LOCUS_22540 13401 12478 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_22540 13656 14174 gene locus_tag LOCUS_22550 13656 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 14181 14453 gene locus_tag LOCUS_22560 14181 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 15373 14450 gene locus_tag LOCUS_22570 15373 14450 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012163110.1 protein_id gnl|my_center|LOCUS_22570 16229 15516 gene locus_tag LOCUS_22580 gene rplA 16229 15516 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056151.1 protein_id gnl|my_center|LOCUS_22580 16710 16285 gene locus_tag LOCUS_22590 gene rplK 16710 16285 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_22590 17331 16714 gene locus_tag LOCUS_22600 gene nusG 17331 16714 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056149.1 protein_id gnl|my_center|LOCUS_22600 17564 17328 gene locus_tag LOCUS_22610 gene secE 17564 17328 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056148.1 protein_id gnl|my_center|LOCUS_22610 17761 17689 gene locus_tag LOCUS_t00290 17761 17689 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 18225 17863 gene locus_tag LOCUS_22620 gene rplS 18225 17863 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057143.1 protein_id gnl|my_center|LOCUS_22620 19069 19491 gene locus_tag LOCUS_22630 19069 19491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 19518 19913 gene locus_tag LOCUS_22640 19518 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence066 541 197 gene locus_tag LOCUS_22650 541 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1441 554 gene locus_tag LOCUS_22660 1441 554 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_22660 2512 1457 gene locus_tag LOCUS_22670 2512 1457 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 protein_id gnl|my_center|LOCUS_22670 2620 3096 gene locus_tag LOCUS_22680 2620 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4194 3562 gene locus_tag LOCUS_22690 4194 3562 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258297.1 protein_id gnl|my_center|LOCUS_22690 5065 4880 gene locus_tag LOCUS_22700 5065 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 5553 5068 gene locus_tag LOCUS_22710 5553 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 7104 6139 gene locus_tag LOCUS_22720 7104 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 7501 8259 gene locus_tag LOCUS_22730 gene cobS 7501 8259 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057177.1 protein_id gnl|my_center|LOCUS_22730 8717 8256 gene locus_tag LOCUS_22740 8717 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 9228 9028 gene locus_tag LOCUS_22750 9228 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 10377 9322 gene locus_tag LOCUS_22760 10377 9322 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057218.1 protein_id gnl|my_center|LOCUS_22760 11364 10519 gene locus_tag LOCUS_22770 11364 10519 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057406.1 protein_id gnl|my_center|LOCUS_22770 12930 11587 gene locus_tag LOCUS_22780 12930 11587 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056530.1 protein_id gnl|my_center|LOCUS_22780 13709 12981 gene locus_tag LOCUS_22790 13709 12981 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_22790 14090 13728 gene locus_tag LOCUS_22800 14090 13728 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_22800 15049 14093 gene locus_tag LOCUS_22810 15049 14093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_22810 16762 15050 gene locus_tag LOCUS_22820 16762 15050 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041470421.1 protein_id gnl|my_center|LOCUS_22820 17895 17644 gene locus_tag LOCUS_22830 17895 17644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 18224 19918 gene locus_tag LOCUS_22840 18224 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 19921 22032 gene locus_tag LOCUS_22850 19921 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence067 1784 228 gene locus_tag LOCUS_22860 1784 228 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 protein_id gnl|my_center|LOCUS_22860 3189 1963 gene locus_tag LOCUS_22870 3189 1963 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_22870 4663 3398 gene locus_tag LOCUS_22880 gene purD 4663 3398 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920939.1 protein_id gnl|my_center|LOCUS_22880 5362 6726 gene locus_tag LOCUS_22890 5362 6726 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057393.1 protein_id gnl|my_center|LOCUS_22890 6734 7684 gene locus_tag LOCUS_22900 6734 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 8307 8894 gene locus_tag LOCUS_22910 gene hemJ 8307 8894 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_22910 9239 10702 gene locus_tag LOCUS_22920 9239 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 10840 11493 gene locus_tag LOCUS_22930 gene nusB 10840 11493 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056630.1 protein_id gnl|my_center|LOCUS_22930 11985 11512 gene locus_tag LOCUS_22940 11985 11512 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_22940 12406 11996 gene locus_tag LOCUS_22950 gene gloA 12406 11996 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_22950 12840 13973 gene locus_tag LOCUS_22960 12840 13973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 15569 14049 gene locus_tag LOCUS_22970 gene trpE 15569 14049 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_22970 16330 15905 gene locus_tag LOCUS_22980 16330 15905 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_22980 18252 16615 gene locus_tag LOCUS_22990 18252 16615 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_22990 19171 18362 gene locus_tag LOCUS_23000 19171 18362 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920882.1 protein_id gnl|my_center|LOCUS_23000 19820 19233 gene locus_tag LOCUS_23010 19820 19233 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_23010 20448 19948 gene locus_tag LOCUS_23020 20448 19948 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_23020 21839 20451 gene locus_tag LOCUS_23030 21839 20451 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence068 1032 70 gene locus_tag LOCUS_23040 1032 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5657 1083 gene locus_tag LOCUS_23050 gene gltB 5657 1083 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_23050 6044 5880 gene locus_tag LOCUS_23060 6044 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 6158 6379 gene locus_tag LOCUS_23070 6158 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 6369 6506 gene locus_tag LOCUS_23080 6369 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 7335 6772 gene locus_tag LOCUS_23090 7335 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 7773 8282 gene locus_tag LOCUS_23100 7773 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 8444 9337 gene locus_tag LOCUS_23110 8444 9337 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_23110 9457 9774 gene locus_tag LOCUS_23120 9457 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 10329 9775 gene locus_tag LOCUS_23130 10329 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 11268 10468 gene locus_tag LOCUS_23140 gene xth 11268 10468 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920930.1 protein_id gnl|my_center|LOCUS_23140 12095 11511 gene locus_tag LOCUS_23150 12095 11511 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_23150 12653 12195 gene locus_tag LOCUS_23160 gene rplI 12653 12195 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058245.1 protein_id gnl|my_center|LOCUS_23160 13145 12723 gene locus_tag LOCUS_23170 13145 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 13818 13240 gene locus_tag LOCUS_23180 13818 13240 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_23180 14326 13928 gene locus_tag LOCUS_23190 14326 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 15997 14507 gene locus_tag LOCUS_23200 15997 14507 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_23200 16945 16025 gene locus_tag LOCUS_23210 gene murQ 16945 16025 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057013.1 protein_id gnl|my_center|LOCUS_23210 17140 17529 gene locus_tag LOCUS_23220 gene rplU 17140 17529 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056022.1 protein_id gnl|my_center|LOCUS_23220 17564 17833 gene locus_tag LOCUS_23230 gene rpmA 17564 17833 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_23230 17980 18912 gene locus_tag LOCUS_23240 17980 18912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 20134 19145 gene locus_tag LOCUS_23250 20134 19145 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057151.1 protein_id gnl|my_center|LOCUS_23250 20309 21256 gene locus_tag LOCUS_23260 gene speE 20309 21256 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence069 494 252 gene locus_tag LOCUS_23270 494 252 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140099.1 protein_id gnl|my_center|LOCUS_23270 1362 586 gene locus_tag LOCUS_23280 1362 586 CDS product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967308.1 protein_id gnl|my_center|LOCUS_23280 2057 1395 gene locus_tag LOCUS_23290 2057 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2488 3456 gene locus_tag LOCUS_23300 2488 3456 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463394.1 protein_id gnl|my_center|LOCUS_23300 3758 4219 gene locus_tag LOCUS_23310 3758 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 5107 5586 gene locus_tag LOCUS_23320 5107 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 5806 7458 gene locus_tag LOCUS_23330 5806 7458 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_23330 8806 7559 gene locus_tag LOCUS_23340 8806 7559 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 protein_id gnl|my_center|LOCUS_23340 9224 10561 gene locus_tag LOCUS_23350 9224 10561 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_23350 12275 10767 gene locus_tag LOCUS_23360 gene crtD 12275 10767 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_23360 13414 12488 gene locus_tag LOCUS_23370 gene thrB 13414 12488 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057602.1 protein_id gnl|my_center|LOCUS_23370 14127 13417 gene locus_tag LOCUS_23380 14127 13417 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_23380 15004 14330 gene locus_tag LOCUS_23390 15004 14330 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_23390 15387 15803 gene locus_tag LOCUS_23400 15387 15803 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_23400 17704 15851 gene locus_tag LOCUS_23410 17704 15851 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_23410 18235 18621 gene locus_tag LOCUS_23420 18235 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 20415 19039 gene locus_tag LOCUS_23430 20415 19039 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920940.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence070 1410 2123 gene locus_tag LOCUS_23440 1410 2123 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_23440 3177 2176 gene locus_tag LOCUS_23450 3177 2176 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057751.1 protein_id gnl|my_center|LOCUS_23450 5267 3453 gene locus_tag LOCUS_23460 5267 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 5653 5315 gene locus_tag LOCUS_23470 5653 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 6363 6285 gene locus_tag LOCUS_t00300 6363 6285 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6549 8075 gene locus_tag LOCUS_23480 6549 8075 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_23480 8132 8695 gene locus_tag LOCUS_23490 8132 8695 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_23490 8939 10990 gene locus_tag LOCUS_23500 8939 10990 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_23500 14557 11159 gene locus_tag LOCUS_23510 14557 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 15391 15684 gene locus_tag LOCUS_23520 15391 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 16166 16906 gene locus_tag LOCUS_23530 16166 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 17329 18309 gene locus_tag LOCUS_23540 17329 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 19047 18313 gene locus_tag LOCUS_23550 19047 18313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 20526 19378 gene locus_tag LOCUS_23560 gene dnaN 20526 19378 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058182.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence071 445 221 gene locus_tag LOCUS_23570 445 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 840 577 gene locus_tag LOCUS_23580 840 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1286 1050 gene locus_tag LOCUS_23590 1286 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1521 1297 gene locus_tag LOCUS_23600 1521 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 3779 1728 gene locus_tag LOCUS_23610 3779 1728 CDS product NAD(P)H-quinone oxidoreductase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 protein_id gnl|my_center|LOCUS_23610 4933 3944 gene locus_tag LOCUS_23620 4933 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 5817 5080 gene locus_tag LOCUS_23630 5817 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 8003 5814 gene locus_tag LOCUS_23640 8003 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 8223 8525 gene locus_tag LOCUS_23650 8223 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 8569 8769 gene locus_tag LOCUS_23660 8569 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 8769 9140 gene locus_tag LOCUS_23670 8769 9140 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142420.1 protein_id gnl|my_center|LOCUS_23670 9861 9184 gene locus_tag LOCUS_23680 9861 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 protein_id gnl|my_center|LOCUS_23680 10134 9901 gene locus_tag LOCUS_23690 gene secG 10134 9901 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_23690 10694 10407 gene locus_tag LOCUS_23700 10694 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 10935 10678 gene locus_tag LOCUS_23710 10935 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 12563 10965 gene locus_tag LOCUS_23720 gene gpmI 12563 10965 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056006.1 protein_id gnl|my_center|LOCUS_23720 14055 13285 gene locus_tag LOCUS_23730 14055 13285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_23730 15276 14068 gene locus_tag LOCUS_23740 15276 14068 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 protein_id gnl|my_center|LOCUS_23740 16063 15281 gene locus_tag LOCUS_23750 16063 15281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 protein_id gnl|my_center|LOCUS_23750 17175 16060 gene locus_tag LOCUS_23760 17175 16060 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117847.1 protein_id gnl|my_center|LOCUS_23760 17718 17188 gene locus_tag LOCUS_23770 17718 17188 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171919.1 protein_id gnl|my_center|LOCUS_23770 18401 18586 gene locus_tag LOCUS_23780 18401 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 19029 19541 gene locus_tag LOCUS_23790 19029 19541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 19691 20464 gene locus_tag LOCUS_23800 19691 20464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 20566 20691 gene locus_tag LOCUS_23810 20566 20691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence072 306 1115 gene locus_tag LOCUS_23820 306 1115 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799517.1 protein_id gnl|my_center|LOCUS_23820 1217 1366 gene locus_tag LOCUS_23830 1217 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1386 2336 gene locus_tag LOCUS_23840 gene accD 1386 2336 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057480.1 protein_id gnl|my_center|LOCUS_23840 2820 2437 gene locus_tag LOCUS_23850 2820 2437 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_23850 2852 3127 gene locus_tag LOCUS_23860 gene purS 2852 3127 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_23860 3231 3917 gene locus_tag LOCUS_23870 gene purQ 3231 3917 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_23870 4271 5197 gene locus_tag LOCUS_23880 4271 5197 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920864.1 protein_id gnl|my_center|LOCUS_23880 5229 6320 gene locus_tag LOCUS_23890 gene rfbB 5229 6320 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_23890 6515 6763 gene locus_tag LOCUS_23900 6515 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 6756 7121 gene locus_tag LOCUS_23910 6756 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 8159 7131 gene locus_tag LOCUS_23920 gene obgE 8159 7131 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058186.1 protein_id gnl|my_center|LOCUS_23920 8768 8547 gene locus_tag LOCUS_23930 8768 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 9041 10852 gene locus_tag LOCUS_23940 gene sppA 9041 10852 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_23940 10907 13066 gene locus_tag LOCUS_23950 10907 13066 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_23950 13586 13056 gene locus_tag LOCUS_23960 13586 13056 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144198.1 protein_id gnl|my_center|LOCUS_23960 14229 14582 gene locus_tag LOCUS_23970 14229 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_23970 14585 15529 gene locus_tag LOCUS_23980 14585 15529 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_23980 16775 15540 gene locus_tag LOCUS_23990 16775 15540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 16988 18415 gene locus_tag LOCUS_24000 16988 18415 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_24000 18933 19319 gene locus_tag LOCUS_24010 18933 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence073 33 643 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaattaatcttaaaccctattagggattgaaac 1515 856 gene locus_tag LOCUS_24020 1515 856 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_24020 3570 1606 gene locus_tag LOCUS_24030 3570 1606 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_24030 3661 3798 gene locus_tag LOCUS_24040 gene rpmH 3661 3798 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141474.1 protein_id gnl|my_center|LOCUS_24040 3825 4187 gene locus_tag LOCUS_24050 3825 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24050 4177 4572 gene locus_tag LOCUS_24060 4177 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24060 4657 5805 gene locus_tag LOCUS_24070 gene yidC 4657 5805 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056448.1 protein_id gnl|my_center|LOCUS_24070 5805 6299 gene locus_tag LOCUS_24080 5805 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142229.1 protein_id gnl|my_center|LOCUS_24080 6807 6406 gene locus_tag LOCUS_24090 6807 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 7780 7058 gene locus_tag LOCUS_24100 gene grpE 7780 7058 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057154.1 protein_id gnl|my_center|LOCUS_24100 8114 10126 gene locus_tag LOCUS_24110 8114 10126 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_24110 10330 11436 gene locus_tag LOCUS_24120 10330 11436 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_24120 11556 12770 gene locus_tag LOCUS_24130 11556 12770 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_24130 12879 13415 gene locus_tag LOCUS_24140 12879 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524130.1 protein_id gnl|my_center|LOCUS_24140 16295 13725 gene locus_tag LOCUS_24150 16295 13725 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_24150 16529 17311 gene locus_tag LOCUS_24160 16529 17311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_24160 17358 18689 gene locus_tag LOCUS_24170 17358 18689 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 protein_id gnl|my_center|LOCUS_24170 18797 19900 gene locus_tag LOCUS_24180 gene wecB 18797 19900 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_24180 19904 20389 gene locus_tag LOCUS_24190 gene ruvC 19904 20389 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence074 584 1045 gene locus_tag LOCUS_24200 584 1045 CDS product DUF2996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799827.1 protein_id gnl|my_center|LOCUS_24200 1092 1502 gene locus_tag LOCUS_24210 1092 1502 CDS product DUF3110 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_24210 1666 2085 gene locus_tag LOCUS_24220 1666 2085 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057574.1 protein_id gnl|my_center|LOCUS_24220 3479 2661 gene locus_tag LOCUS_24230 3479 2661 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_24230 3754 4626 gene locus_tag LOCUS_24240 3754 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920996.1 protein_id gnl|my_center|LOCUS_24240 5168 4695 gene locus_tag LOCUS_24250 5168 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 5207 6130 gene locus_tag LOCUS_24260 5207 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 6432 6196 gene locus_tag LOCUS_24270 6432 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 6906 6550 gene locus_tag LOCUS_24280 6906 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 7021 10347 gene locus_tag LOCUS_24290 7021 10347 CDS product AAA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_24290 11752 10616 gene locus_tag LOCUS_24300 11752 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 13446 11752 gene locus_tag LOCUS_24310 13446 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 15074 13443 gene locus_tag LOCUS_24320 15074 13443 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140772.1 protein_id gnl|my_center|LOCUS_24320 16583 15342 gene locus_tag LOCUS_24330 16583 15342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 16885 16580 gene locus_tag LOCUS_24340 16885 16580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 18249 16951 gene locus_tag LOCUS_24350 18249 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 18957 18262 gene locus_tag LOCUS_24360 18957 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 20061 19015 gene locus_tag LOCUS_24370 20061 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence075 1133 705 gene locus_tag LOCUS_24380 1133 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2054 1212 gene locus_tag LOCUS_24390 gene folP 2054 1212 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_24390 2986 2189 gene locus_tag LOCUS_24400 2986 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3806 3147 gene locus_tag LOCUS_24410 3806 3147 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057008.1 protein_id gnl|my_center|LOCUS_24410 4316 3843 gene locus_tag LOCUS_24420 gene coaD 4316 3843 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_24420 4597 4313 gene locus_tag LOCUS_24430 4597 4313 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_24430 4948 4631 gene locus_tag LOCUS_24440 gene trxA 4948 4631 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921014.1 protein_id gnl|my_center|LOCUS_24440 5081 5926 gene locus_tag LOCUS_24450 gene map 5081 5926 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056279.1 protein_id gnl|my_center|LOCUS_24450 5995 6396 gene locus_tag LOCUS_24460 5995 6396 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920646.1 protein_id gnl|my_center|LOCUS_24460 6842 7066 gene locus_tag LOCUS_24470 6842 7066 CDS product DUF2811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140944.1 protein_id gnl|my_center|LOCUS_24470 7116 7742 gene locus_tag LOCUS_24480 gene pth 7116 7742 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_24480 7877 10204 gene locus_tag LOCUS_24490 7877 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 11728 10325 gene locus_tag LOCUS_24500 gene fumC 11728 10325 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083118.1 protein_id gnl|my_center|LOCUS_24500 12002 12289 gene locus_tag LOCUS_24510 12002 12289 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920900.1 protein_id gnl|my_center|LOCUS_24510 13448 12294 gene locus_tag LOCUS_24520 gene gshA 13448 12294 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_24520 13880 13488 gene locus_tag LOCUS_24530 gene ruvX 13880 13488 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_24530 14040 14942 gene locus_tag LOCUS_24540 14040 14942 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_24540 16198 14936 gene locus_tag LOCUS_24550 16198 14936 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_24550 17906 16653 gene locus_tag LOCUS_24560 17906 16653 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920968.1 protein_id gnl|my_center|LOCUS_24560 20113 18554 gene locus_tag LOCUS_24570 20113 18554 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence076 1092 208 gene locus_tag LOCUS_24580 gene lipA 1092 208 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056422.1 protein_id gnl|my_center|LOCUS_24580 1716 1393 gene locus_tag LOCUS_24590 gene grxD 1716 1393 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_24590 4212 1804 gene locus_tag LOCUS_24600 4212 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4455 6677 gene locus_tag LOCUS_24610 4455 6677 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_24610 6939 6727 gene locus_tag LOCUS_24620 6939 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 7798 7235 gene locus_tag LOCUS_24630 7798 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 8858 7962 gene locus_tag LOCUS_24640 8858 7962 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920906.1 protein_id gnl|my_center|LOCUS_24640 9612 8818 gene locus_tag LOCUS_24650 9612 8818 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_24650 10524 9925 gene locus_tag LOCUS_24660 10524 9925 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932882.1 protein_id gnl|my_center|LOCUS_24660 10944 11138 gene locus_tag LOCUS_24670 gene psbH 10944 11138 CDS product photosystem II reaction center protein PsbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057226.1 protein_id gnl|my_center|LOCUS_24670 11243 11491 gene locus_tag LOCUS_24680 11243 11491 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057225.1 protein_id gnl|my_center|LOCUS_24680 11849 14128 gene locus_tag LOCUS_24690 gene glgB 11849 14128 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_24690 15175 14774 gene locus_tag LOCUS_24700 15175 14774 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141008.1 protein_id gnl|my_center|LOCUS_24700 16001 16957 gene locus_tag LOCUS_24710 16001 16957 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224412629.1 protein_id gnl|my_center|LOCUS_24710 16960 20196 gene locus_tag LOCUS_24720 16960 20196 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920803.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence077 1591 1845 gene locus_tag LOCUS_24730 1591 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1826 2086 gene locus_tag LOCUS_24740 1826 2086 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417760.1 protein_id gnl|my_center|LOCUS_24740 2588 2274 gene locus_tag LOCUS_24750 2588 2274 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_24750 2880 2599 gene locus_tag LOCUS_24760 2880 2599 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_24760 3434 6004 gene locus_tag LOCUS_24770 3434 6004 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_24770 6142 7389 gene locus_tag LOCUS_24780 gene trpB 6142 7389 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058306.1 protein_id gnl|my_center|LOCUS_24780 7488 8477 gene locus_tag LOCUS_24790 7488 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 8634 9263 gene locus_tag LOCUS_24800 8634 9263 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_24800 9579 10229 gene locus_tag LOCUS_24810 9579 10229 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_24810 10343 11338 gene locus_tag LOCUS_24820 10343 11338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 11325 11777 gene locus_tag LOCUS_24830 11325 11777 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_24830 13229 11784 gene locus_tag LOCUS_24840 13229 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 14578 13325 gene locus_tag LOCUS_24850 gene sbcD 14578 13325 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057812.1 protein_id gnl|my_center|LOCUS_24850 14768 14625 gene locus_tag LOCUS_24860 14768 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 14960 15355 gene locus_tag LOCUS_24870 14960 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 15490 16590 gene locus_tag LOCUS_24880 gene aroB 15490 16590 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056627.1 protein_id gnl|my_center|LOCUS_24880 17703 16567 gene locus_tag LOCUS_24890 17703 16567 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921229.1 protein_id gnl|my_center|LOCUS_24890 17917 19101 gene locus_tag LOCUS_24900 17917 19101 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_24900 19101 19691 gene locus_tag LOCUS_24910 19101 19691 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence078 272 60 gene locus_tag LOCUS_24920 272 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 599 898 gene locus_tag LOCUS_24930 599 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 1367 1167 gene locus_tag LOCUS_24940 1367 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1589 1822 gene locus_tag LOCUS_24950 1589 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1812 2228 gene locus_tag LOCUS_24960 1812 2228 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_24960 4245 2302 gene locus_tag LOCUS_24970 4245 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 5253 4915 gene locus_tag LOCUS_24980 5253 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 6582 5887 gene locus_tag LOCUS_24990 6582 5887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_24990 7528 6593 gene locus_tag LOCUS_25000 7528 6593 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_25000 8162 11644 gene locus_tag LOCUS_25010 gene mfd 8162 11644 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056796.1 protein_id gnl|my_center|LOCUS_25010 12022 11934 gene locus_tag LOCUS_t00310 12022 11934 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12093 12314 gene locus_tag LOCUS_25020 12093 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 13371 12274 gene locus_tag LOCUS_25030 13371 12274 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_25030 15426 13597 gene locus_tag LOCUS_25040 15426 13597 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_25040 16459 15629 gene locus_tag LOCUS_25050 16459 15629 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_25050 17787 16552 gene locus_tag LOCUS_25060 17787 16552 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_25060 17941 18153 gene locus_tag LOCUS_25070 17941 18153 CDS product DUF2839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_25070 19384 18449 gene locus_tag LOCUS_25080 19384 18449 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence079 159 425 gene locus_tag LOCUS_25090 159 425 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928542.1 protein_id gnl|my_center|LOCUS_25090 415 618 gene locus_tag LOCUS_25100 415 618 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140566.1 protein_id gnl|my_center|LOCUS_25100 1029 1469 gene locus_tag LOCUS_25110 1029 1469 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_25110 2830 1964 gene locus_tag LOCUS_25120 2830 1964 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_25120 3094 4074 gene locus_tag LOCUS_25130 3094 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4186 5127 gene locus_tag LOCUS_25140 4186 5127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_25140 5117 5947 gene locus_tag LOCUS_25150 5117 5947 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_25150 5950 7476 gene locus_tag LOCUS_25160 5950 7476 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_25160 7524 8144 gene locus_tag LOCUS_25170 7524 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 8257 8832 gene locus_tag LOCUS_25180 8257 8832 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_25180 10611 9157 gene locus_tag LOCUS_25190 10611 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 11601 10702 gene locus_tag LOCUS_25200 11601 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 11824 12438 gene locus_tag LOCUS_25210 11824 12438 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162810208.1 protein_id gnl|my_center|LOCUS_25210 12557 12955 gene locus_tag LOCUS_25220 12557 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 12959 13366 gene locus_tag LOCUS_25230 12959 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 13515 13739 gene locus_tag LOCUS_25240 13515 13739 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_25240 13902 14066 gene locus_tag LOCUS_25250 13902 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 14417 14115 gene locus_tag LOCUS_25260 14417 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 14821 14402 gene locus_tag LOCUS_25270 14821 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 15252 15722 gene locus_tag LOCUS_25280 15252 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 18211 18660 gene locus_tag LOCUS_25290 18211 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 18815 19207 gene locus_tag LOCUS_25300 18815 19207 CDS product DUF4278 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056168.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence080 315 500 gene locus_tag LOCUS_25310 315 500 CDS product PCP reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143955.1 protein_id gnl|my_center|LOCUS_25310 1506 505 gene locus_tag LOCUS_25320 gene moaA 1506 505 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143017.1 protein_id gnl|my_center|LOCUS_25320 1922 3265 gene locus_tag LOCUS_25330 1922 3265 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_25330 3695 3273 gene locus_tag LOCUS_25340 3695 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 4024 3809 gene locus_tag LOCUS_25350 4024 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 4380 4455 gene locus_tag LOCUS_t00320 4380 4455 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7074 4540 gene locus_tag LOCUS_25360 7074 4540 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_25360 7982 7578 gene locus_tag LOCUS_25370 gene crcB 7982 7578 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639315.1 protein_id gnl|my_center|LOCUS_25370 8563 8174 gene locus_tag LOCUS_25380 gene crcB 8563 8174 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258331.1 protein_id gnl|my_center|LOCUS_25380 8688 9494 gene locus_tag LOCUS_25390 gene rsmA 8688 9494 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056506.1 protein_id gnl|my_center|LOCUS_25390 9512 10453 gene locus_tag LOCUS_25400 gene ispE 9512 10453 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056351.1 protein_id gnl|my_center|LOCUS_25400 11287 10475 gene locus_tag LOCUS_25410 11287 10475 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056386.1 protein_id gnl|my_center|LOCUS_25410 11811 11287 gene locus_tag LOCUS_25420 11811 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 12178 14730 gene locus_tag LOCUS_25430 gene gyrA 12178 14730 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057209.1 protein_id gnl|my_center|LOCUS_25430 15473 14943 gene locus_tag LOCUS_25440 15473 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 15868 15473 gene locus_tag LOCUS_25450 15868 15473 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_25450 16070 17434 gene locus_tag LOCUS_25460 gene asnS 16070 17434 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_25460 17920 17597 gene locus_tag LOCUS_25470 17920 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 18194 17910 gene locus_tag LOCUS_25480 18194 17910 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_25480 18440 18871 gene locus_tag LOCUS_25490 18440 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence081 196 450 gene locus_tag LOCUS_25500 196 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 1154 543 gene locus_tag LOCUS_25510 1154 543 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_25510 1524 1730 gene locus_tag LOCUS_25520 1524 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3941 1809 gene locus_tag LOCUS_25530 3941 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 4389 3949 gene locus_tag LOCUS_25540 4389 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4912 4664 gene locus_tag LOCUS_25550 4912 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 5495 6577 gene locus_tag LOCUS_25560 5495 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 6858 7115 gene locus_tag LOCUS_25570 6858 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 7118 7558 gene locus_tag LOCUS_25580 7118 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 7558 8148 gene locus_tag LOCUS_25590 7558 8148 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048752389.1 protein_id gnl|my_center|LOCUS_25590 8680 9246 gene locus_tag LOCUS_25600 8680 9246 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_25600 9243 9971 gene locus_tag LOCUS_25610 9243 9971 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_25610 9984 11642 gene locus_tag LOCUS_25620 9984 11642 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_25620 12755 11748 gene locus_tag LOCUS_25630 12755 11748 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_25630 13120 12752 gene locus_tag LOCUS_25640 13120 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799199.1 protein_id gnl|my_center|LOCUS_25640 14214 13180 gene locus_tag LOCUS_25650 gene gap 14214 13180 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055898.1 protein_id gnl|my_center|LOCUS_25650 14764 17184 gene locus_tag LOCUS_25660 14764 17184 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_25660 17604 17185 gene locus_tag LOCUS_25670 17604 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 17868 17608 gene locus_tag LOCUS_25680 17868 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 18503 18264 gene locus_tag LOCUS_25690 18503 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 18759 18496 gene locus_tag LOCUS_25700 18759 18496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence082 482 688 gene locus_tag LOCUS_25710 482 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1609 1007 gene locus_tag LOCUS_25720 1609 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1930 2367 gene locus_tag LOCUS_25730 1930 2367 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_25730 4175 2733 gene locus_tag LOCUS_25740 4175 2733 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920812.1 protein_id gnl|my_center|LOCUS_25740 4731 4186 gene locus_tag LOCUS_25750 4731 4186 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 protein_id gnl|my_center|LOCUS_25750 6203 4734 gene locus_tag LOCUS_25760 6203 4734 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 protein_id gnl|my_center|LOCUS_25760 6388 6852 gene locus_tag LOCUS_25770 6388 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920763.1 protein_id gnl|my_center|LOCUS_25770 7121 7508 gene locus_tag LOCUS_tm00010 7121 7508 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 7521 8687 gene locus_tag LOCUS_25780 7521 8687 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881286.1 protein_id gnl|my_center|LOCUS_25780 9684 8806 gene locus_tag LOCUS_25790 gene rsmH 9684 8806 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057907.1 protein_id gnl|my_center|LOCUS_25790 11441 9930 gene locus_tag LOCUS_25800 gene ilvA 11441 9930 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_25800 11730 11978 gene locus_tag LOCUS_25810 11730 11978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 13588 14295 gene locus_tag LOCUS_25820 13588 14295 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061513.1 protein_id gnl|my_center|LOCUS_25820 14386 14952 gene locus_tag LOCUS_25830 14386 14952 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_25830 14964 15806 gene locus_tag LOCUS_25840 14964 15806 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061502.1 protein_id gnl|my_center|LOCUS_25840 18363 16066 gene locus_tag LOCUS_25850 18363 16066 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920718.1 protein_id gnl|my_center|LOCUS_25850 18590 18946 gene locus_tag LOCUS_25860 18590 18946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence083 1307 2437 gene locus_tag LOCUS_25870 1307 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2695 3765 gene locus_tag LOCUS_25880 2695 3765 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_25880 4922 3969 gene locus_tag LOCUS_25890 4922 3969 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_25890 5948 5166 gene locus_tag LOCUS_25900 5948 5166 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_25900 6469 7896 gene locus_tag LOCUS_25910 gene gndA 6469 7896 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056424.1 protein_id gnl|my_center|LOCUS_25910 9695 8034 gene locus_tag LOCUS_25920 9695 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 10292 9807 gene locus_tag LOCUS_25930 10292 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 12350 10344 gene locus_tag LOCUS_25940 12350 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 13840 12671 gene locus_tag LOCUS_25950 13840 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 15971 13902 gene locus_tag LOCUS_25960 15971 13902 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence084 491 1501 gene locus_tag LOCUS_25970 491 1501 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874555.1 protein_id gnl|my_center|LOCUS_25970 1777 2079 gene locus_tag LOCUS_25980 1777 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2060 2434 gene locus_tag LOCUS_25990 2060 2434 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256573.1 protein_id gnl|my_center|LOCUS_25990 2793 3068 gene locus_tag LOCUS_26000 2793 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 3065 3478 gene locus_tag LOCUS_26010 3065 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 4839 3832 gene locus_tag LOCUS_26020 4839 3832 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_26020 4924 6963 gene locus_tag LOCUS_26030 4924 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 7616 6996 gene locus_tag LOCUS_26040 7616 6996 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157768333.1 protein_id gnl|my_center|LOCUS_26040 8062 7766 gene locus_tag LOCUS_26050 8062 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 8722 8063 gene locus_tag LOCUS_26060 8722 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 8875 9972 gene locus_tag LOCUS_26070 8875 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 10517 10227 gene locus_tag LOCUS_26080 gene kaiB 10517 10227 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_26080 11380 10514 gene locus_tag LOCUS_26090 11380 10514 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391041.1 protein_id gnl|my_center|LOCUS_26090 13817 11616 gene locus_tag LOCUS_26100 13817 11616 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_26100 14211 14534 gene locus_tag LOCUS_26110 14211 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 15258 14572 gene locus_tag LOCUS_26120 15258 14572 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058093.1 protein_id gnl|my_center|LOCUS_26120 15881 15372 gene locus_tag LOCUS_26130 15881 15372 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921201.1 protein_id gnl|my_center|LOCUS_26130 18156 16978 gene locus_tag LOCUS_26140 18156 16978 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence085 2752 32 gene locus_tag LOCUS_26150 2752 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 5148 2641 gene locus_tag LOCUS_26160 5148 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 6248 7672 gene locus_tag LOCUS_26170 6248 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 7674 8300 gene locus_tag LOCUS_26180 7674 8300 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763134.1 protein_id gnl|my_center|LOCUS_26180 8297 9001 gene locus_tag LOCUS_26190 8297 9001 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 protein_id gnl|my_center|LOCUS_26190 9435 12035 gene locus_tag LOCUS_26200 9435 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 12290 12595 gene locus_tag LOCUS_26210 12290 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 12585 12923 gene locus_tag LOCUS_26220 12585 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 13313 14461 gene locus_tag LOCUS_26230 gene dprA 13313 14461 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920872.1 protein_id gnl|my_center|LOCUS_26230 14884 14528 gene locus_tag LOCUS_26240 gene trxA 14884 14528 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_26240 15353 16558 gene locus_tag LOCUS_26250 15353 16558 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_26250 17114 16563 gene locus_tag LOCUS_26260 17114 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 17884 17228 gene locus_tag LOCUS_26270 17884 17228 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence086 101 397 gene locus_tag LOCUS_26280 101 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 511 828 gene locus_tag LOCUS_26290 511 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2264 891 gene locus_tag LOCUS_26300 gene mnmE 2264 891 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056805.1 protein_id gnl|my_center|LOCUS_26300 2318 2851 gene locus_tag LOCUS_26310 2318 2851 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055993.1 protein_id gnl|my_center|LOCUS_26310 3545 3147 gene locus_tag LOCUS_26320 3545 3147 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_26320 3856 3542 gene locus_tag LOCUS_26330 3856 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 4624 4367 gene locus_tag LOCUS_26340 4624 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_26340 4823 4602 gene locus_tag LOCUS_26350 4823 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 5819 5379 gene locus_tag LOCUS_26360 5819 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 6078 5821 gene locus_tag LOCUS_26370 6078 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 6310 6044 gene locus_tag LOCUS_26380 6310 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 7555 6524 gene locus_tag LOCUS_26390 7555 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 9112 7592 gene locus_tag LOCUS_26400 9112 7592 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502785.1 protein_id gnl|my_center|LOCUS_26400 10466 9093 gene locus_tag LOCUS_26410 10466 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 10921 10484 gene locus_tag LOCUS_26420 10921 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 11747 11166 gene locus_tag LOCUS_26430 11747 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_26430 12594 11992 gene locus_tag LOCUS_26440 12594 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_26440 13502 13323 gene locus_tag LOCUS_26450 13502 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 13738 13499 gene locus_tag LOCUS_26460 13738 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 14302 14090 gene locus_tag LOCUS_26470 14302 14090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 14505 14305 gene locus_tag LOCUS_26480 14505 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 14702 14920 gene locus_tag LOCUS_26490 14702 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 14913 15305 gene locus_tag LOCUS_26500 14913 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 16043 15537 gene locus_tag LOCUS_26510 16043 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 16088 16330 gene locus_tag LOCUS_26520 16088 16330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 17188 16334 gene locus_tag LOCUS_26530 17188 16334 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_26530 17536 18513 gene locus_tag LOCUS_26540 17536 18513 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence087 846 247 gene locus_tag LOCUS_26550 gene coaE 846 247 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_26550 1633 908 gene locus_tag LOCUS_26560 1633 908 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057336.1 protein_id gnl|my_center|LOCUS_26560 1973 2269 gene locus_tag LOCUS_26570 1973 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_26570 4330 2531 gene locus_tag LOCUS_26580 gene thrS 4330 2531 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216087114.1 protein_id gnl|my_center|LOCUS_26580 4465 5385 gene locus_tag LOCUS_26590 4465 5385 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530028.1 protein_id gnl|my_center|LOCUS_26590 6790 5687 gene locus_tag LOCUS_26600 6790 5687 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_26600 7330 6893 gene locus_tag LOCUS_26610 7330 6893 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 protein_id gnl|my_center|LOCUS_26610 7419 9971 gene locus_tag LOCUS_26620 7419 9971 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_26620 10202 12553 gene locus_tag LOCUS_26630 10202 12553 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_26630 12609 13838 gene locus_tag LOCUS_26640 12609 13838 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_26640 13948 14181 gene locus_tag LOCUS_26650 13948 14181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 14200 15723 gene locus_tag LOCUS_26660 14200 15723 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_26660 16493 15999 gene locus_tag LOCUS_26670 gene sixA 16493 15999 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_26670 17769 16546 gene locus_tag LOCUS_26680 17769 16546 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence088 992 420 gene locus_tag LOCUS_26690 992 420 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_26690 2052 1039 gene locus_tag LOCUS_26700 2052 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2295 2089 gene locus_tag LOCUS_26710 2295 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2770 2339 gene locus_tag LOCUS_26720 2770 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3182 3754 gene locus_tag LOCUS_26730 3182 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3901 4233 gene locus_tag LOCUS_26740 3901 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 4230 4589 gene locus_tag LOCUS_26750 4230 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 6008 4617 gene locus_tag LOCUS_26760 6008 4617 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 protein_id gnl|my_center|LOCUS_26760 6869 6090 gene locus_tag LOCUS_26770 6869 6090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_26770 7529 6897 gene locus_tag LOCUS_26780 7529 6897 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929521.1 protein_id gnl|my_center|LOCUS_26780 7721 7966 gene locus_tag LOCUS_26790 7721 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 7947 8717 gene locus_tag LOCUS_26800 7947 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 10004 8709 gene locus_tag LOCUS_26810 10004 8709 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222757.1 protein_id gnl|my_center|LOCUS_26810 10220 12655 gene locus_tag LOCUS_26820 gene pheT 10220 12655 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920733.1 protein_id gnl|my_center|LOCUS_26820 14167 12821 gene locus_tag LOCUS_26830 14167 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 14414 14602 gene locus_tag LOCUS_26840 14414 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 14731 15342 gene locus_tag LOCUS_26850 14731 15342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 15369 16637 gene locus_tag LOCUS_26860 15369 16637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 17099 17308 gene locus_tag LOCUS_26870 17099 17308 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_26870 17305 17544 gene locus_tag LOCUS_26880 17305 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence089 1876 392 gene locus_tag LOCUS_26890 1876 392 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_26890 2144 3451 gene locus_tag LOCUS_26900 2144 3451 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_26900 3488 4282 gene locus_tag LOCUS_26910 3488 4282 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_26910 5655 4318 gene locus_tag LOCUS_26920 5655 4318 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_26920 5733 7850 gene locus_tag LOCUS_26930 5733 7850 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_26930 9216 8230 gene locus_tag LOCUS_26940 gene hemB 9216 8230 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_26940 9792 10157 gene locus_tag LOCUS_26950 9792 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 10217 10597 gene locus_tag LOCUS_26960 10217 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 10826 10677 gene locus_tag LOCUS_26970 10826 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 11292 11023 gene locus_tag LOCUS_26980 11292 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 11345 12931 gene locus_tag LOCUS_26990 11345 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 13427 13245 gene locus_tag LOCUS_27000 13427 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 14168 13536 gene locus_tag LOCUS_27010 14168 13536 CDS product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266385.1 protein_id gnl|my_center|LOCUS_27010 15445 14165 gene locus_tag LOCUS_27020 15445 14165 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_27020 15732 16922 gene locus_tag LOCUS_27030 15732 16922 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_27030 17390 17151 gene locus_tag LOCUS_27040 17390 17151 CDS product DUF4327 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence090 927 142 gene locus_tag LOCUS_27050 927 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1471 1701 gene locus_tag LOCUS_27060 1471 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2569 3294 gene locus_tag LOCUS_27070 2569 3294 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_27070 4253 3330 gene locus_tag LOCUS_27080 4253 3330 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_27080 4853 4494 gene locus_tag LOCUS_27090 gene psb28 4853 4494 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928665.1 protein_id gnl|my_center|LOCUS_27090 5445 5945 gene locus_tag LOCUS_27100 5445 5945 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 protein_id gnl|my_center|LOCUS_27100 6197 6021 gene locus_tag LOCUS_27110 6197 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 6315 6509 gene locus_tag LOCUS_27120 6315 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 6685 7515 gene locus_tag LOCUS_27130 6685 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_27130 7587 10211 gene locus_tag LOCUS_27140 gene alaS 7587 10211 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057938.1 protein_id gnl|my_center|LOCUS_27140 10263 11744 gene locus_tag LOCUS_27150 10263 11744 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_27150 11737 12492 gene locus_tag LOCUS_27160 11737 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 13979 12663 gene locus_tag LOCUS_27170 13979 12663 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_27170 15650 14073 gene locus_tag LOCUS_27180 15650 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 17448 15652 gene locus_tag LOCUS_27190 17448 15652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence091 1262 570 gene locus_tag LOCUS_27200 1262 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2593 1259 gene locus_tag LOCUS_27210 2593 1259 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920917.1 protein_id gnl|my_center|LOCUS_27210 2678 3097 gene locus_tag LOCUS_27220 2678 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 4270 3077 gene locus_tag LOCUS_27230 4270 3077 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_27230 4683 5033 gene locus_tag LOCUS_27240 4683 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_27240 5603 5034 gene locus_tag LOCUS_27250 5603 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 6260 5622 gene locus_tag LOCUS_27260 6260 5622 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920671.1 protein_id gnl|my_center|LOCUS_27260 7589 6642 gene locus_tag LOCUS_27270 7589 6642 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_27270 9293 7785 gene locus_tag LOCUS_27280 gene atpA 9293 7785 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_27280 9910 9362 gene locus_tag LOCUS_27290 gene atpH 9910 9362 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056289.1 protein_id gnl|my_center|LOCUS_27290 10453 9911 gene locus_tag LOCUS_27300 10453 9911 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524128.1 protein_id gnl|my_center|LOCUS_27300 11153 10722 gene locus_tag LOCUS_27310 11153 10722 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056287.1 protein_id gnl|my_center|LOCUS_27310 11594 11349 gene locus_tag LOCUS_27320 gene atpE 11594 11349 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125083.1 protein_id gnl|my_center|LOCUS_27320 12574 11825 gene locus_tag LOCUS_27330 gene atpB 12574 11825 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056285.1 protein_id gnl|my_center|LOCUS_27330 12995 12633 gene locus_tag LOCUS_27340 12995 12633 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920689.1 protein_id gnl|my_center|LOCUS_27340 14167 13379 gene locus_tag LOCUS_27350 14167 13379 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408189.1 protein_id gnl|my_center|LOCUS_27350 15164 14247 gene locus_tag LOCUS_27360 15164 14247 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056702.1 protein_id gnl|my_center|LOCUS_27360 16165 15188 gene locus_tag LOCUS_27370 16165 15188 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_27370 17117 16227 gene locus_tag LOCUS_27380 17117 16227 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence092 2005 212 gene locus_tag LOCUS_27390 gene typA 2005 212 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_27390 2861 2157 gene locus_tag LOCUS_27400 2861 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2985 3644 gene locus_tag LOCUS_27410 2985 3644 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920805.1 protein_id gnl|my_center|LOCUS_27410 4485 3922 gene locus_tag LOCUS_27420 4485 3922 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_27420 5288 4986 gene locus_tag LOCUS_27430 5288 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 6151 5459 gene locus_tag LOCUS_27440 6151 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7384 6176 gene locus_tag LOCUS_27450 7384 6176 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_27450 7627 8991 gene locus_tag LOCUS_27460 7627 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 9475 9903 gene locus_tag LOCUS_27470 gene psb27 9475 9903 CDS product photosystem II protein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058295.1 protein_id gnl|my_center|LOCUS_27470 10079 12448 gene locus_tag LOCUS_27480 10079 12448 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143626.1 protein_id gnl|my_center|LOCUS_27480 16161 13057 gene locus_tag LOCUS_27490 16161 13057 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_27490 16969 16292 gene locus_tag LOCUS_27500 16969 16292 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence093 537 800 gene locus_tag LOCUS_27510 gene hypC 537 800 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816727.1 protein_id gnl|my_center|LOCUS_27510 942 2054 gene locus_tag LOCUS_27520 gene hypD 942 2054 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 protein_id gnl|my_center|LOCUS_27520 2038 2496 gene locus_tag LOCUS_27530 2038 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2990 2493 gene locus_tag LOCUS_27540 2990 2493 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_27540 3505 3326 gene locus_tag LOCUS_27550 3505 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 3720 3502 gene locus_tag LOCUS_27560 3720 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 4260 4060 gene locus_tag LOCUS_27570 4260 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 5077 4490 gene locus_tag LOCUS_27580 5077 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 6287 5481 gene locus_tag LOCUS_27590 6287 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 6657 6349 gene locus_tag LOCUS_27600 6657 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 6802 8061 gene locus_tag LOCUS_27610 6802 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 8238 9488 gene locus_tag LOCUS_27620 8238 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 9827 11725 gene locus_tag LOCUS_27630 9827 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 13254 11737 gene locus_tag LOCUS_27640 gene amt 13254 11737 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_27640 14136 13318 gene locus_tag LOCUS_27650 14136 13318 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_27650 14416 14129 gene locus_tag LOCUS_27660 gene clpS 14416 14129 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024123996.1 protein_id gnl|my_center|LOCUS_27660 14616 15116 gene locus_tag LOCUS_27670 14616 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 15273 15470 gene locus_tag LOCUS_27680 15273 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 15474 15740 gene locus_tag LOCUS_27690 15474 15740 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_27690 15813 16757 gene locus_tag LOCUS_27700 15813 16757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence094 2271 1345 gene locus_tag LOCUS_27710 2271 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 5605 2351 gene locus_tag LOCUS_27720 5605 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142960.1 protein_id gnl|my_center|LOCUS_27720 7121 5616 gene locus_tag LOCUS_27730 7121 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142959.1 protein_id gnl|my_center|LOCUS_27730 7633 7145 gene locus_tag LOCUS_27740 7633 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 9853 7655 gene locus_tag LOCUS_27750 9853 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 11607 12989 gene locus_tag LOCUS_27760 11607 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 13267 13073 gene locus_tag LOCUS_27770 13267 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 14145 13339 gene locus_tag LOCUS_27780 14145 13339 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_27780 14677 14589 gene locus_tag LOCUS_t00330 14677 14589 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 14875 16173 gene locus_tag LOCUS_27790 14875 16173 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_27790 16189 16527 gene locus_tag LOCUS_27800 16189 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence095 230 466 gene locus_tag LOCUS_27810 230 466 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_27810 907 1995 gene locus_tag LOCUS_27820 gene aksF 907 1995 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_27820 2156 2779 gene locus_tag LOCUS_27830 2156 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3840 3100 gene locus_tag LOCUS_27840 3840 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 4384 3875 gene locus_tag LOCUS_27850 4384 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 5509 5006 gene locus_tag LOCUS_27860 5509 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 5800 6114 gene locus_tag LOCUS_27870 5800 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058283.1 protein_id gnl|my_center|LOCUS_27870 6397 6792 gene locus_tag LOCUS_27880 6397 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 7274 7086 gene locus_tag LOCUS_27890 7274 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 8143 7898 gene locus_tag LOCUS_27900 8143 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 9372 9683 gene locus_tag LOCUS_27910 9372 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 10612 9680 gene locus_tag LOCUS_27920 10612 9680 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_27920 11034 10609 gene locus_tag LOCUS_27930 11034 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 12916 11105 gene locus_tag LOCUS_27940 gene ilvB 12916 11105 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_27940 13134 14321 gene locus_tag LOCUS_27950 13134 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 14353 15096 gene locus_tag LOCUS_27960 14353 15096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 15260 15757 gene locus_tag LOCUS_27970 15260 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 15807 16556 gene locus_tag LOCUS_27980 15807 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence096 1883 243 gene locus_tag LOCUS_27990 1883 243 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_27990 3161 2619 gene locus_tag LOCUS_28000 3161 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3539 3177 gene locus_tag LOCUS_28010 3539 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 4231 3536 gene locus_tag LOCUS_28020 4231 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 4519 5478 gene locus_tag LOCUS_28030 gene cysK 4519 5478 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_28030 6207 5548 gene locus_tag LOCUS_28040 6207 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 6681 7364 gene locus_tag LOCUS_28050 6681 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 7406 8437 gene locus_tag LOCUS_28060 7406 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 8497 10806 gene locus_tag LOCUS_28070 8497 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 11135 13357 gene locus_tag LOCUS_28080 11135 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 13428 15104 gene locus_tag LOCUS_28090 13428 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 15141 16118 gene locus_tag LOCUS_28100 15141 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 16288 16115 gene locus_tag LOCUS_28110 16288 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence097 1058 861 gene locus_tag LOCUS_28120 1058 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057514.1 protein_id gnl|my_center|LOCUS_28120 1665 1090 gene locus_tag LOCUS_28130 gene def 1665 1090 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057513.1 protein_id gnl|my_center|LOCUS_28130 3348 1951 gene locus_tag LOCUS_28140 3348 1951 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056941.1 protein_id gnl|my_center|LOCUS_28140 3703 4683 gene locus_tag LOCUS_28150 3703 4683 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_28150 4701 5153 gene locus_tag LOCUS_28160 4701 5153 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_28160 6067 6378 gene locus_tag LOCUS_28170 6067 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 6719 7342 gene locus_tag LOCUS_28180 6719 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 8503 7670 gene locus_tag LOCUS_28190 8503 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 9264 12014 gene locus_tag LOCUS_28200 9264 12014 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 protein_id gnl|my_center|LOCUS_28200 14851 12695 gene locus_tag LOCUS_28210 gene ppsA 14851 12695 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629687.1 protein_id gnl|my_center|LOCUS_28210 15128 15823 gene locus_tag LOCUS_28220 15128 15823 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence098 268 194 gene locus_tag LOCUS_t00340 268 194 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 399 950 gene locus_tag LOCUS_28230 399 950 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201440.1 protein_id gnl|my_center|LOCUS_28230 2002 1472 gene locus_tag LOCUS_28240 2002 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3390 2302 gene locus_tag LOCUS_28250 3390 2302 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_28250 3457 4092 gene locus_tag LOCUS_28260 gene trmB 3457 4092 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_28260 4190 4735 gene locus_tag LOCUS_28270 4190 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 4755 5555 gene locus_tag LOCUS_28280 gene trxA 4755 5555 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932886.1 protein_id gnl|my_center|LOCUS_28280 7171 5693 gene locus_tag LOCUS_28290 gene glgA 7171 5693 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_28290 8775 7384 gene locus_tag LOCUS_28300 gene dacB 8775 7384 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_28300 9121 10473 gene locus_tag LOCUS_28310 gene gor 9121 10473 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_28310 11645 10860 gene locus_tag LOCUS_28320 11645 10860 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_28320 11878 12363 gene locus_tag LOCUS_28330 11878 12363 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_28330 12692 13204 gene locus_tag LOCUS_28340 12692 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 13229 13738 gene locus_tag LOCUS_28350 13229 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 15374 14508 gene locus_tag LOCUS_28360 15374 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 15974 15699 gene locus_tag LOCUS_28370 15974 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence099 884 147 gene locus_tag LOCUS_28380 884 147 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_28380 1124 3436 gene locus_tag LOCUS_28390 1124 3436 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_28390 4005 3769 gene locus_tag LOCUS_28400 4005 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 4439 4170 gene locus_tag LOCUS_28410 4439 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 4725 4387 gene locus_tag LOCUS_28420 4725 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 4928 4731 gene locus_tag LOCUS_28430 4928 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 5253 5501 gene locus_tag LOCUS_28440 5253 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 5828 6292 gene locus_tag LOCUS_28450 5828 6292 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_28450 6569 6366 gene locus_tag LOCUS_28460 6569 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 6640 7155 gene locus_tag LOCUS_28470 6640 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 7420 7917 gene locus_tag LOCUS_28480 7420 7917 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_28480 8088 8969 gene locus_tag LOCUS_28490 8088 8969 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143417.1 protein_id gnl|my_center|LOCUS_28490 9570 9004 gene locus_tag LOCUS_28500 9570 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 9697 9936 gene locus_tag LOCUS_28510 9697 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125028.1 protein_id gnl|my_center|LOCUS_28510 12201 9901 gene locus_tag LOCUS_28520 12201 9901 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056167.1 protein_id gnl|my_center|LOCUS_28520 13510 12536 gene locus_tag LOCUS_28530 gene tilS 13510 12536 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057455.1 protein_id gnl|my_center|LOCUS_28530 14629 13682 gene locus_tag LOCUS_28540 gene hemF 14629 13682 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_28540 14934 15680 gene locus_tag LOCUS_28550 14934 15680 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence100 1039 320 gene locus_tag LOCUS_28560 1039 320 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_28560 2219 2416 gene locus_tag LOCUS_28570 2219 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 4335 3394 gene locus_tag LOCUS_28580 4335 3394 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_28580 5272 4337 gene locus_tag LOCUS_28590 5272 4337 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_28590 6796 5456 gene locus_tag LOCUS_28600 gene rfbH 6796 5456 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_28600 7989 6871 gene locus_tag LOCUS_28610 gene rfbG 7989 6871 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_28610 8804 7974 gene locus_tag LOCUS_28620 gene rfbF 8804 7974 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037178.1 protein_id gnl|my_center|LOCUS_28620 9165 9389 gene locus_tag LOCUS_28630 9165 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 9317 10417 gene locus_tag LOCUS_28640 9317 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 10430 10735 gene locus_tag LOCUS_28650 10430 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 11396 10944 gene locus_tag LOCUS_28660 11396 10944 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_28660 11501 11863 gene locus_tag LOCUS_28670 11501 11863 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_28670 11869 12708 gene locus_tag LOCUS_28680 11869 12708 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_28680 12785 13243 gene locus_tag LOCUS_28690 12785 13243 CDS product nitrate reductase associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_28690 13588 13397 gene locus_tag LOCUS_28700 13588 13397 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_28700 14221 15402 gene locus_tag LOCUS_28710 14221 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence101 299 1000 gene locus_tag LOCUS_28720 299 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1427 1948 gene locus_tag LOCUS_28730 1427 1948 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_28730 2090 2386 gene locus_tag LOCUS_28740 gene gatC 2090 2386 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143272.1 protein_id gnl|my_center|LOCUS_28740 2494 2895 gene locus_tag LOCUS_28750 2494 2895 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_28750 4107 4478 gene locus_tag LOCUS_28760 4107 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 4824 5639 gene locus_tag LOCUS_28770 4824 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 5713 6288 gene locus_tag LOCUS_28780 gene lepB 5713 6288 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056260.1 protein_id gnl|my_center|LOCUS_28780 6786 6298 gene locus_tag LOCUS_28790 6786 6298 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140692.1 protein_id gnl|my_center|LOCUS_28790 6805 7722 gene locus_tag LOCUS_28800 6805 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 7821 8675 gene locus_tag LOCUS_28810 gene pheA 7821 8675 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594784.1 protein_id gnl|my_center|LOCUS_28810 10642 8717 gene locus_tag LOCUS_28820 10642 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 10734 11414 gene locus_tag LOCUS_28830 10734 11414 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106289931.1 protein_id gnl|my_center|LOCUS_28830 11451 12641 gene locus_tag LOCUS_28840 11451 12641 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_28840 13254 12670 gene locus_tag LOCUS_28850 13254 12670 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_28850 13387 15519 gene locus_tag LOCUS_28860 gene glyS 13387 15519 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198128218.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence102 411 1142 gene locus_tag LOCUS_28870 411 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1602 1285 gene locus_tag LOCUS_28880 1602 1285 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_28880 1779 2336 gene locus_tag LOCUS_28890 gene efp 1779 2336 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057134.1 protein_id gnl|my_center|LOCUS_28890 2503 2997 gene locus_tag LOCUS_28900 gene accB 2503 2997 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892082.1 protein_id gnl|my_center|LOCUS_28900 3003 3989 gene locus_tag LOCUS_28910 3003 3989 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_28910 4129 4815 gene locus_tag LOCUS_28920 4129 4815 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125538.1 protein_id gnl|my_center|LOCUS_28920 4851 5450 gene locus_tag LOCUS_28930 4851 5450 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125539.1 protein_id gnl|my_center|LOCUS_28930 5557 5967 gene locus_tag LOCUS_28940 5557 5967 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706948.1 protein_id gnl|my_center|LOCUS_28940 6740 6060 gene locus_tag LOCUS_28950 6740 6060 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_28950 7501 7046 gene locus_tag LOCUS_28960 7501 7046 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_28960 7859 7557 gene locus_tag LOCUS_28970 7859 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 7975 8376 gene locus_tag LOCUS_28980 7975 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_28980 8547 10022 gene locus_tag LOCUS_28990 8547 10022 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057553.1 protein_id gnl|my_center|LOCUS_28990 10032 10271 gene locus_tag LOCUS_29000 10032 10271 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_29000 11026 11838 gene locus_tag LOCUS_29010 11026 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 14121 13417 gene locus_tag LOCUS_29020 14121 13417 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144068.1 protein_id gnl|my_center|LOCUS_29020 14167 14907 gene locus_tag LOCUS_29030 14167 14907 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550381.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence103 403 708 gene locus_tag LOCUS_29040 403 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 1106 705 gene locus_tag LOCUS_29050 1106 705 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_29050 2800 1673 gene locus_tag LOCUS_29060 2800 1673 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920975.1 protein_id gnl|my_center|LOCUS_29060 3656 3312 gene locus_tag LOCUS_29070 3656 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 4674 3670 gene locus_tag LOCUS_29080 gene pheS 4674 3670 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056537.1 protein_id gnl|my_center|LOCUS_29080 4916 5209 gene locus_tag LOCUS_29090 4916 5209 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_29090 5646 5810 gene locus_tag LOCUS_29100 5646 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 8725 6029 gene locus_tag LOCUS_29110 8725 6029 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 protein_id gnl|my_center|LOCUS_29110 8839 9288 gene locus_tag LOCUS_29120 8839 9288 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_29120 9658 9846 gene locus_tag LOCUS_29130 9658 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 9983 10528 gene locus_tag LOCUS_29140 gene ribH 9983 10528 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055922.1 protein_id gnl|my_center|LOCUS_29140 10584 10877 gene locus_tag LOCUS_29150 10584 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 10950 11021 gene locus_tag LOCUS_t00350 10950 11021 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11193 11600 gene locus_tag LOCUS_29160 11193 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057546.1 protein_id gnl|my_center|LOCUS_29160 11611 12858 gene locus_tag LOCUS_29170 11611 12858 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143911.1 protein_id gnl|my_center|LOCUS_29170 13028 13999 gene locus_tag LOCUS_29180 13028 13999 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_29180 14262 15323 gene locus_tag LOCUS_29190 14262 15323 CDS product anthranilate phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence104 196 1071 gene locus_tag LOCUS_29200 196 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 1538 1158 gene locus_tag LOCUS_29210 1538 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 3110 1578 gene locus_tag LOCUS_29220 3110 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 5404 3386 gene locus_tag LOCUS_29230 gene ligA 5404 3386 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056701.1 protein_id gnl|my_center|LOCUS_29230 5985 5419 gene locus_tag LOCUS_29240 5985 5419 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_29240 6572 6009 gene locus_tag LOCUS_29250 6572 6009 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_29250 8067 6745 gene locus_tag LOCUS_29260 8067 6745 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_29260 8129 8602 gene locus_tag LOCUS_29270 8129 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143336.1 protein_id gnl|my_center|LOCUS_29270 8897 9841 gene locus_tag LOCUS_29280 8897 9841 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967589.1 protein_id gnl|my_center|LOCUS_29280 10707 9937 gene locus_tag LOCUS_29290 10707 9937 CDS product AhpC/TSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_29290 11840 10704 gene locus_tag LOCUS_29300 11840 10704 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058228.1 protein_id gnl|my_center|LOCUS_29300 12083 11874 gene locus_tag LOCUS_29310 gene thiS 12083 11874 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_29310 13326 12310 gene locus_tag LOCUS_29320 13326 12310 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_29320 14218 13607 gene locus_tag LOCUS_29330 14218 13607 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496365.1 protein_id gnl|my_center|LOCUS_29330 14900 15637 gene locus_tag LOCUS_29340 14900 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence105 667 188 gene locus_tag LOCUS_29350 667 188 CDS product IS607-like element IS1602 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950774.1 protein_id gnl|my_center|LOCUS_29350 969 1271 gene locus_tag LOCUS_29360 969 1271 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 protein_id gnl|my_center|LOCUS_29360 2034 1375 gene locus_tag LOCUS_29370 2034 1375 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957597.1 protein_id gnl|my_center|LOCUS_29370 2233 2718 gene locus_tag LOCUS_29380 2233 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2907 3245 gene locus_tag LOCUS_29390 2907 3245 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_29390 3854 4492 gene locus_tag LOCUS_29400 gene rplC 3854 4492 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_29400 4513 5145 gene locus_tag LOCUS_29410 gene rplD 4513 5145 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_29410 5135 5440 gene locus_tag LOCUS_29420 5135 5440 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055938.1 protein_id gnl|my_center|LOCUS_29420 5474 6307 gene locus_tag LOCUS_29430 gene rplB 5474 6307 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055939.1 protein_id gnl|my_center|LOCUS_29430 6338 6619 gene locus_tag LOCUS_29440 gene rpsS 6338 6619 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055940.1 protein_id gnl|my_center|LOCUS_29440 6710 7069 gene locus_tag LOCUS_29450 gene rplV 6710 7069 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055941.1 protein_id gnl|my_center|LOCUS_29450 7092 7820 gene locus_tag LOCUS_29460 gene rpsC 7092 7820 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055942.1 protein_id gnl|my_center|LOCUS_29460 7851 8270 gene locus_tag LOCUS_29470 gene rplP 7851 8270 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_29470 8270 8488 gene locus_tag LOCUS_29480 gene rpmC 8270 8488 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143907.1 protein_id gnl|my_center|LOCUS_29480 8495 8737 gene locus_tag LOCUS_29490 gene rpsQ 8495 8737 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_29490 8758 9126 gene locus_tag LOCUS_29500 gene rplN 8758 9126 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_29500 9200 9553 gene locus_tag LOCUS_29510 gene rplX 9200 9553 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055947.1 protein_id gnl|my_center|LOCUS_29510 9608 10147 gene locus_tag LOCUS_29520 gene rplE 9608 10147 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055948.1 protein_id gnl|my_center|LOCUS_29520 10364 10765 gene locus_tag LOCUS_29530 gene rpsH 10364 10765 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_29530 10870 11439 gene locus_tag LOCUS_29540 gene rplF 10870 11439 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_29540 11443 11805 gene locus_tag LOCUS_29550 gene rplR 11443 11805 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143899.1 protein_id gnl|my_center|LOCUS_29550 11832 12353 gene locus_tag LOCUS_29560 gene rpsE 11832 12353 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055952.1 protein_id gnl|my_center|LOCUS_29560 12364 12807 gene locus_tag LOCUS_29570 gene rplO 12364 12807 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055953.1 protein_id gnl|my_center|LOCUS_29570 13104 14423 gene locus_tag LOCUS_29580 gene secY 13104 14423 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055954.1 protein_id gnl|my_center|LOCUS_29580 <15436 14536 gene locus_tag LOCUS_29590 <15436 14536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056261.1:RNA-guided endonuclease TnpB family protein >Feature sequence106 708 238 gene locus_tag LOCUS_29600 gene tsaE 708 238 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142985.1 protein_id gnl|my_center|LOCUS_29600 1047 2246 gene locus_tag LOCUS_29610 1047 2246 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_29610 3823 2243 gene locus_tag LOCUS_29620 3823 2243 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_29620 4295 3903 gene locus_tag LOCUS_29630 gene rbfA 4295 3903 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_29630 4534 4337 gene locus_tag LOCUS_29640 4534 4337 CDS product DUF751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 protein_id gnl|my_center|LOCUS_29640 5228 4632 gene locus_tag LOCUS_29650 5228 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 5537 5929 gene locus_tag LOCUS_29660 5537 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 6426 6025 gene locus_tag LOCUS_29670 6426 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 6654 6427 gene locus_tag LOCUS_29680 6654 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 6981 7403 gene locus_tag LOCUS_29690 6981 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7794 7429 gene locus_tag LOCUS_29700 7794 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531260.1 protein_id gnl|my_center|LOCUS_29700 8054 7791 gene locus_tag LOCUS_29710 8054 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 8093 8344 gene locus_tag LOCUS_29720 8093 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 8447 8635 gene locus_tag LOCUS_29730 8447 8635 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_29730 9129 12281 gene locus_tag LOCUS_29740 9129 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 12262 12549 gene locus_tag LOCUS_29750 12262 12549 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081705261.1 protein_id gnl|my_center|LOCUS_29750 12711 13001 gene locus_tag LOCUS_29760 12711 13001 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_29760 12991 13344 gene locus_tag LOCUS_29770 12991 13344 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_29770 13592 13798 gene locus_tag LOCUS_29780 13592 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 13788 14198 gene locus_tag LOCUS_29790 13788 14198 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_29790 14328 14666 gene locus_tag LOCUS_29800 14328 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 14659 15018 gene locus_tag LOCUS_29810 14659 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence107 1169 177 gene locus_tag LOCUS_29820 1169 177 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057700.1 protein_id gnl|my_center|LOCUS_29820 2417 1203 gene locus_tag LOCUS_29830 2417 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 2753 3550 gene locus_tag LOCUS_29840 2753 3550 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_29840 4379 3690 gene locus_tag LOCUS_29850 4379 3690 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 protein_id gnl|my_center|LOCUS_29850 4932 4450 gene locus_tag LOCUS_29860 4932 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 5156 6529 gene locus_tag LOCUS_29870 5156 6529 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929211.1 protein_id gnl|my_center|LOCUS_29870 7761 6745 gene locus_tag LOCUS_29880 gene hpnH 7761 6745 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_29880 8679 9689 gene locus_tag LOCUS_29890 8679 9689 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979245.1 protein_id gnl|my_center|LOCUS_29890 9691 10734 gene locus_tag LOCUS_29900 9691 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 10833 11432 gene locus_tag LOCUS_29910 10833 11432 CDS product DUF1517 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 protein_id gnl|my_center|LOCUS_29910 11449 12318 gene locus_tag LOCUS_29920 11449 12318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_29920 13113 12601 gene locus_tag LOCUS_29930 13113 12601 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920918.1 protein_id gnl|my_center|LOCUS_29930 13843 13175 gene locus_tag LOCUS_29940 13843 13175 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_29940 14990 14187 gene locus_tag LOCUS_29950 14990 14187 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence108 2030 495 gene locus_tag LOCUS_29960 gene purH 2030 495 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057387.1 protein_id gnl|my_center|LOCUS_29960 3038 2322 gene locus_tag LOCUS_29970 3038 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 4325 3249 gene locus_tag LOCUS_29980 4325 3249 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171974.1 protein_id gnl|my_center|LOCUS_29980 4782 5549 gene locus_tag LOCUS_29990 4782 5549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_29990 6079 5801 gene locus_tag LOCUS_30000 6079 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 6863 6636 gene locus_tag LOCUS_30010 6863 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 7170 6853 gene locus_tag LOCUS_30020 7170 6853 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_30020 7387 7172 gene locus_tag LOCUS_30030 7387 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 7853 7404 gene locus_tag LOCUS_30040 7853 7404 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_30040 8629 7946 gene locus_tag LOCUS_30050 8629 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 9721 9089 gene locus_tag LOCUS_30060 9721 9089 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027460.1 protein_id gnl|my_center|LOCUS_30060 9808 10626 gene locus_tag LOCUS_30070 9808 10626 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_30070 11226 11846 gene locus_tag LOCUS_30080 11226 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 12115 12576 gene locus_tag LOCUS_30090 12115 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 12595 12801 gene locus_tag LOCUS_30100 12595 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 12947 13028 gene locus_tag LOCUS_t00360 12947 13028 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13021 13102 gene locus_tag LOCUS_t00370 13021 13102 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 14448 13231 gene locus_tag LOCUS_30110 14448 13231 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_30110 14543 14791 gene locus_tag LOCUS_30120 14543 14791 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_30120 14902 15159 gene locus_tag LOCUS_30130 14902 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence109 915 274 gene locus_tag LOCUS_30140 915 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 protein_id gnl|my_center|LOCUS_30140 1203 2249 gene locus_tag LOCUS_30150 1203 2249 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_30150 2676 3644 gene locus_tag LOCUS_30160 2676 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 4037 4516 gene locus_tag LOCUS_30170 4037 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 4687 5064 gene locus_tag LOCUS_30180 4687 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 5101 7650 gene locus_tag LOCUS_30190 5101 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 7721 8929 gene locus_tag LOCUS_30200 7721 8929 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_30200 9157 9309 gene locus_tag LOCUS_30210 9157 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 9355 9804 gene locus_tag LOCUS_30220 9355 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30220 9867 10493 gene locus_tag LOCUS_30230 9867 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30230 11164 10883 gene locus_tag LOCUS_30240 11164 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 11429 11151 gene locus_tag LOCUS_30250 11429 11151 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_30250 11834 12640 gene locus_tag LOCUS_30260 11834 12640 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_30260 12870 12643 gene locus_tag LOCUS_30270 12870 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 13272 12931 gene locus_tag LOCUS_30280 13272 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 14137 13322 gene locus_tag LOCUS_30290 14137 13322 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_30290 14321 14845 gene locus_tag LOCUS_30300 14321 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence110 1177 929 gene locus_tag LOCUS_30310 1177 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 1376 1164 gene locus_tag LOCUS_30320 1376 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1570 1370 gene locus_tag LOCUS_30330 1570 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1938 1732 gene locus_tag LOCUS_30340 1938 1732 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_30340 2150 1938 gene locus_tag LOCUS_30350 2150 1938 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_30350 3595 2192 gene locus_tag LOCUS_30360 3595 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 4086 3679 gene locus_tag LOCUS_30370 4086 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 4350 5000 gene locus_tag LOCUS_30380 4350 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 6105 5110 gene locus_tag LOCUS_30390 6105 5110 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 protein_id gnl|my_center|LOCUS_30390 6400 6152 gene locus_tag LOCUS_30400 6400 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 6732 6403 gene locus_tag LOCUS_30410 6732 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 7019 6771 gene locus_tag LOCUS_30420 7019 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 7277 7056 gene locus_tag LOCUS_30430 7277 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 7583 7371 gene locus_tag LOCUS_30440 7583 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 8008 7580 gene locus_tag LOCUS_30450 8008 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 8578 8360 gene locus_tag LOCUS_30460 8578 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 9255 9097 gene locus_tag LOCUS_30470 9255 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 11219 9987 gene locus_tag LOCUS_30480 11219 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 14184 12073 gene locus_tag LOCUS_30490 14184 12073 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_30490 14819 14643 gene locus_tag LOCUS_30500 14819 14643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence111 <1 952 gene locus_tag LOCUS_30510 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022377.1:ISL3-like element ISMac21 family transposase 984 2195 gene locus_tag LOCUS_30520 984 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3301 4623 gene locus_tag LOCUS_30530 3301 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 4884 6716 gene locus_tag LOCUS_30540 4884 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 6713 12868 gene locus_tag LOCUS_30550 6713 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 13044 14723 gene locus_tag LOCUS_30560 13044 14723 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144228.1 protein_id gnl|my_center|LOCUS_30560 >Feature sequence112 153 419 gene locus_tag LOCUS_30570 153 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 654 998 gene locus_tag LOCUS_30580 654 998 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296467.1 protein_id gnl|my_center|LOCUS_30580 1001 1300 gene locus_tag LOCUS_30590 1001 1300 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838298.1 protein_id gnl|my_center|LOCUS_30590 1526 1335 gene locus_tag LOCUS_30600 1526 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 1799 2137 gene locus_tag LOCUS_30610 1799 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 2584 2808 gene locus_tag LOCUS_30620 2584 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 2826 3053 gene locus_tag LOCUS_30630 2826 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 5399 3102 gene locus_tag LOCUS_30640 5399 3102 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_30640 5963 6337 gene locus_tag LOCUS_30650 5963 6337 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057533.1 protein_id gnl|my_center|LOCUS_30650 6510 7436 gene locus_tag LOCUS_30660 6510 7436 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057532.1 protein_id gnl|my_center|LOCUS_30660 7515 7760 gene locus_tag LOCUS_30670 gene psbE 7515 7760 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_30670 7786 7920 gene locus_tag LOCUS_30680 gene psbF 7786 7920 CDS product cytochrome b559 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057382.1 protein_id gnl|my_center|LOCUS_30680 8093 8212 gene locus_tag LOCUS_30690 8093 8212 CDS product photosystem II reaction center protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071823295.1 protein_id gnl|my_center|LOCUS_30690 8630 8545 gene locus_tag LOCUS_t00380 8630 8545 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8803 9042 gene locus_tag LOCUS_30700 gene ndhL 8803 9042 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056553.1 protein_id gnl|my_center|LOCUS_30700 9064 9369 gene locus_tag LOCUS_30710 9064 9369 CDS product DUF3007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_30710 9374 9802 gene locus_tag LOCUS_30720 9374 9802 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_30720 10239 11162 gene locus_tag LOCUS_30730 10239 11162 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_30730 11238 11819 gene locus_tag LOCUS_30740 11238 11819 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141191.1 protein_id gnl|my_center|LOCUS_30740 12028 12780 gene locus_tag LOCUS_30750 12028 12780 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_30750 13928 12870 gene locus_tag LOCUS_30760 gene mnmA 13928 12870 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058089.1 protein_id gnl|my_center|LOCUS_30760 14031 14675 gene locus_tag LOCUS_30770 14031 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence113 648 250 gene locus_tag LOCUS_30780 648 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 931 632 gene locus_tag LOCUS_30790 931 632 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_30790 1430 1056 gene locus_tag LOCUS_30800 1430 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 1653 1432 gene locus_tag LOCUS_30810 1653 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 2116 1763 gene locus_tag LOCUS_30820 2116 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 2349 2113 gene locus_tag LOCUS_30830 2349 2113 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_30830 4698 2788 gene locus_tag LOCUS_30840 gene dxs 4698 2788 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056470.1 protein_id gnl|my_center|LOCUS_30840 5542 4772 gene locus_tag LOCUS_30850 gene larB 5542 4772 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_30850 7501 5753 gene locus_tag LOCUS_30860 7501 5753 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057062.1 protein_id gnl|my_center|LOCUS_30860 8637 7744 gene locus_tag LOCUS_30870 gene dapA 8637 7744 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057061.1 protein_id gnl|my_center|LOCUS_30870 9953 8916 gene locus_tag LOCUS_30880 9953 8916 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_30880 10278 11669 gene locus_tag LOCUS_30890 gene tig 10278 11669 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_30890 11933 12634 gene locus_tag LOCUS_30900 gene clpP 11933 12634 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_30900 12646 13980 gene locus_tag LOCUS_30910 gene clpX 12646 13980 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056361.1 protein_id gnl|my_center|LOCUS_30910 14002 14211 gene locus_tag LOCUS_30920 14002 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence114 364 107 gene locus_tag LOCUS_30930 364 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 976 512 gene locus_tag LOCUS_30940 976 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1029 1256 gene locus_tag LOCUS_30950 1029 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 1253 1666 gene locus_tag LOCUS_30960 1253 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 1964 2905 gene locus_tag LOCUS_30970 1964 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 2977 4776 gene locus_tag LOCUS_30980 2977 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 5685 5137 gene locus_tag LOCUS_30990 gene frr 5685 5137 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_30990 6349 5672 gene locus_tag LOCUS_31000 gene pyrH 6349 5672 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_31000 6600 7181 gene locus_tag LOCUS_31010 6600 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 7612 7779 gene locus_tag LOCUS_31020 7612 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 7988 9427 gene locus_tag LOCUS_31030 7988 9427 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_31030 10795 9419 gene locus_tag LOCUS_31040 10795 9419 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_31040 11379 11026 gene locus_tag LOCUS_31050 11379 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 11611 13251 gene locus_tag LOCUS_31060 11611 13251 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056613.1 protein_id gnl|my_center|LOCUS_31060 13651 13334 gene locus_tag LOCUS_31070 13651 13334 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_31070 13954 13781 gene locus_tag LOCUS_31080 13954 13781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 14310 14152 gene locus_tag LOCUS_31090 14310 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence115 2698 1634 gene locus_tag LOCUS_31100 2698 1634 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_31100 3997 2726 gene locus_tag LOCUS_31110 3997 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 5244 4177 gene locus_tag LOCUS_31120 5244 4177 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_31120 6094 5315 gene locus_tag LOCUS_31130 6094 5315 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142987.1 protein_id gnl|my_center|LOCUS_31130 6537 7814 gene locus_tag LOCUS_31140 6537 7814 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_31140 7818 9077 gene locus_tag LOCUS_31150 7818 9077 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_31150 9202 9129 gene locus_tag LOCUS_t00390 9202 9129 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9349 9822 gene locus_tag LOCUS_31160 9349 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 10185 10772 gene locus_tag LOCUS_31170 10185 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 11098 11346 gene locus_tag LOCUS_31180 11098 11346 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_31180 11351 11596 gene locus_tag LOCUS_31190 11351 11596 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392154.1 protein_id gnl|my_center|LOCUS_31190 11773 12000 gene locus_tag LOCUS_31200 11773 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 11997 12266 gene locus_tag LOCUS_31210 11997 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 12350 13285 gene locus_tag LOCUS_31220 12350 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 13533 13766 gene locus_tag LOCUS_31230 13533 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 13763 14104 gene locus_tag LOCUS_31240 13763 14104 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence116 2728 239 gene locus_tag LOCUS_31250 gene priA 2728 239 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920687.1 protein_id gnl|my_center|LOCUS_31250 3353 4486 gene locus_tag LOCUS_31260 3353 4486 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345474.1 protein_id gnl|my_center|LOCUS_31260 4826 5986 gene locus_tag LOCUS_31270 4826 5986 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 protein_id gnl|my_center|LOCUS_31270 6861 6085 gene locus_tag LOCUS_31280 6861 6085 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_31280 8410 7334 gene locus_tag LOCUS_31290 gene ruvB 8410 7334 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143112.1 protein_id gnl|my_center|LOCUS_31290 8434 9198 gene locus_tag LOCUS_31300 gene hisF 8434 9198 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799407.1 protein_id gnl|my_center|LOCUS_31300 9451 9651 gene locus_tag LOCUS_31310 9451 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 9770 9842 gene locus_tag LOCUS_t00400 9770 9842 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9904 11070 gene locus_tag LOCUS_31320 9904 11070 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_31320 12008 11169 gene locus_tag LOCUS_31330 12008 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 12231 12473 gene locus_tag LOCUS_31340 12231 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 12518 13093 gene locus_tag LOCUS_31350 12518 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 13215 14069 gene locus_tag LOCUS_31360 gene purU 13215 14069 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_31360 >Feature sequence117 329 1180 gene locus_tag LOCUS_31370 329 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1180 3051 gene locus_tag LOCUS_31380 1180 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3041 4147 gene locus_tag LOCUS_31390 3041 4147 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976356.1 protein_id gnl|my_center|LOCUS_31390 4156 6648 gene locus_tag LOCUS_31400 4156 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 7294 6878 gene locus_tag LOCUS_31410 7294 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 7412 7260 gene locus_tag LOCUS_31420 7412 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 7836 7441 gene locus_tag LOCUS_31430 7836 7441 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_31430 8059 7820 gene locus_tag LOCUS_31440 8059 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 9997 8135 gene locus_tag LOCUS_31450 9997 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 10371 10087 gene locus_tag LOCUS_31460 10371 10087 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920842.1 protein_id gnl|my_center|LOCUS_31460 10667 10374 gene locus_tag LOCUS_31470 gene clpS 10667 10374 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_31470 11856 10723 gene locus_tag LOCUS_31480 11856 10723 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_31480 12616 11954 gene locus_tag LOCUS_31490 12616 11954 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_31490 12727 13668 gene locus_tag LOCUS_31500 12727 13668 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence118 347 1285 gene locus_tag LOCUS_31510 347 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_31510 1371 2240 gene locus_tag LOCUS_31520 1371 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_31520 2517 4595 gene locus_tag LOCUS_31530 gene glgX 2517 4595 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_31530 4711 5472 gene locus_tag LOCUS_31540 4711 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 5519 6817 gene locus_tag LOCUS_31550 gene eno 5519 6817 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056505.1 protein_id gnl|my_center|LOCUS_31550 7147 7899 gene locus_tag LOCUS_31560 7147 7899 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124783.1 protein_id gnl|my_center|LOCUS_31560 8870 8481 gene locus_tag LOCUS_31570 8870 8481 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_31570 9171 9614 gene locus_tag LOCUS_31580 9171 9614 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_31580 9628 10035 gene locus_tag LOCUS_31590 9628 10035 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_31590 10038 11018 gene locus_tag LOCUS_31600 gene cbiB 10038 11018 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058209.1 protein_id gnl|my_center|LOCUS_31600 11333 10959 gene locus_tag LOCUS_31610 11333 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 12341 11697 gene locus_tag LOCUS_31620 12341 11697 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_31620 12625 12825 gene locus_tag LOCUS_31630 12625 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 <14099 12960 gene locus_tag LOCUS_31640 <14099 12960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613294.1:N-6 DNA methylase >Feature sequence119 585 310 gene locus_tag LOCUS_31650 585 310 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_31650 1996 692 gene locus_tag LOCUS_31660 gene thrC 1996 692 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_31660 3161 2616 gene locus_tag LOCUS_31670 gene rsmD 3161 2616 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_31670 3842 3165 gene locus_tag LOCUS_31680 3842 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 4996 4040 gene locus_tag LOCUS_31690 gene era 4996 4040 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055911.1 protein_id gnl|my_center|LOCUS_31690 5053 5799 gene locus_tag LOCUS_31700 5053 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929385.1 protein_id gnl|my_center|LOCUS_31700 6307 7587 gene locus_tag LOCUS_31710 6307 7587 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_31710 7735 7964 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atcgacaccccccttatcaagggggg 9717 8038 gene locus_tag LOCUS_31720 9717 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 10525 12381 gene locus_tag LOCUS_31730 gene ltrA 10525 12381 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_31730 12482 12676 gene locus_tag LOCUS_31740 12482 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 12679 13353 gene locus_tag LOCUS_31750 12679 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_31750 13891 13532 gene locus_tag LOCUS_31760 13891 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence120 295 1731 gene locus_tag LOCUS_31770 295 1731 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125901.1 protein_id gnl|my_center|LOCUS_31770 4566 1801 gene locus_tag LOCUS_31780 4566 1801 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057343.1 protein_id gnl|my_center|LOCUS_31780 4897 4553 gene locus_tag LOCUS_31790 4897 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 6059 5277 gene locus_tag LOCUS_31800 6059 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 6417 8204 gene locus_tag LOCUS_31810 gene aspS 6417 8204 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056986.1 protein_id gnl|my_center|LOCUS_31810 9629 8274 gene locus_tag LOCUS_31820 9629 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 10441 9785 gene locus_tag LOCUS_31830 10441 9785 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_31830 11102 10449 gene locus_tag LOCUS_31840 11102 10449 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_31840 12223 11168 gene locus_tag LOCUS_31850 gene aroF 12223 11168 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_31850 12746 12282 gene locus_tag LOCUS_31860 12746 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 13040 12771 gene locus_tag LOCUS_31870 gene rpsO 13040 12771 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144014.1 protein_id gnl|my_center|LOCUS_31870 13272 13601 gene locus_tag LOCUS_31880 13272 13601 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141521.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence121 1436 699 gene locus_tag LOCUS_31890 1436 699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_31890 1824 1573 gene locus_tag LOCUS_31900 1824 1573 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 protein_id gnl|my_center|LOCUS_31900 3578 1893 gene locus_tag LOCUS_31910 3578 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3775 4992 gene locus_tag LOCUS_31920 gene tyrS 3775 4992 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055905.1 protein_id gnl|my_center|LOCUS_31920 5245 5009 gene locus_tag LOCUS_31930 5245 5009 CDS product ferredoxin-thioredoxin reductase variable chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_31930 5468 8713 gene locus_tag LOCUS_31940 gene carB 5468 8713 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058165.1 protein_id gnl|my_center|LOCUS_31940 8975 10375 gene locus_tag LOCUS_31950 8975 10375 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_31950 10780 10604 gene locus_tag LOCUS_31960 gene tatA 10780 10604 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140713.1 protein_id gnl|my_center|LOCUS_31960 12309 10879 gene locus_tag LOCUS_31970 gene lpdA 12309 10879 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920772.1 protein_id gnl|my_center|LOCUS_31970 13548 12850 gene locus_tag LOCUS_31980 13548 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence122 286 113 gene locus_tag LOCUS_31990 286 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 869 375 gene locus_tag LOCUS_32000 869 375 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141055.1 protein_id gnl|my_center|LOCUS_32000 1171 854 gene locus_tag LOCUS_32010 gene grxC 1171 854 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_32010 1218 1299 gene locus_tag LOCUS_t00410 1218 1299 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1361 1921 gene locus_tag LOCUS_32020 1361 1921 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524131.1 protein_id gnl|my_center|LOCUS_32020 2284 2601 gene locus_tag LOCUS_32030 2284 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056366.1 protein_id gnl|my_center|LOCUS_32030 3015 4028 gene locus_tag LOCUS_32040 3015 4028 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_32040 4180 4623 gene locus_tag LOCUS_32050 4180 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 5637 4579 gene locus_tag LOCUS_32060 gene nagA 5637 4579 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057928.1 protein_id gnl|my_center|LOCUS_32060 6095 6889 gene locus_tag LOCUS_32070 6095 6889 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_32070 6968 7786 gene locus_tag LOCUS_32080 6968 7786 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_32080 7874 8338 gene locus_tag LOCUS_32090 7874 8338 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_32090 9102 8335 gene locus_tag LOCUS_32100 9102 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 9585 9106 gene locus_tag LOCUS_32110 gene fabZ 9585 9106 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057628.1 protein_id gnl|my_center|LOCUS_32110 10818 9679 gene locus_tag LOCUS_32120 10818 9679 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_32120 11848 11195 gene locus_tag LOCUS_32130 11848 11195 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_32130 12209 11919 gene locus_tag LOCUS_32140 12209 11919 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349694.1 protein_id gnl|my_center|LOCUS_32140 12369 13364 gene locus_tag LOCUS_32150 12369 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence123 1242 511 gene locus_tag LOCUS_32160 1242 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 2414 1518 gene locus_tag LOCUS_32170 2414 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3732 2434 gene locus_tag LOCUS_32180 3732 2434 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921083.1 protein_id gnl|my_center|LOCUS_32180 5229 3874 gene locus_tag LOCUS_32190 5229 3874 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_32190 6525 5239 gene locus_tag LOCUS_32200 6525 5239 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_32200 6917 8104 gene locus_tag LOCUS_32210 6917 8104 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_32210 8202 8933 gene locus_tag LOCUS_32220 gene radC 8202 8933 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920920.1 protein_id gnl|my_center|LOCUS_32220 9011 10063 gene locus_tag LOCUS_32230 gene purM 9011 10063 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_32230 11221 10085 gene locus_tag LOCUS_32240 gene cofH 11221 10085 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057436.1 protein_id gnl|my_center|LOCUS_32240 12060 11359 gene locus_tag LOCUS_32250 gene psb29 12060 11359 CDS product photosystem II biogenesis protein Psp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056976.1 protein_id gnl|my_center|LOCUS_32250 12287 12751 gene locus_tag LOCUS_32260 gene smpB 12287 12751 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_32260 12870 13418 gene locus_tag LOCUS_32270 12870 13418 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_32270 >Feature sequence124 168 1826 gene locus_tag LOCUS_32280 168 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3187 2030 gene locus_tag LOCUS_32290 gene corA 3187 2030 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_32290 3379 4395 gene locus_tag LOCUS_32300 gene pdxA 3379 4395 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057880.1 protein_id gnl|my_center|LOCUS_32300 4646 6010 gene locus_tag LOCUS_32310 4646 6010 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_32310 6119 9448 gene locus_tag LOCUS_32320 6119 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 9625 13044 gene locus_tag LOCUS_32330 9625 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence125 490 1917 gene locus_tag LOCUS_32340 gene glgA 490 1917 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056608.1 protein_id gnl|my_center|LOCUS_32340 2572 1967 gene locus_tag LOCUS_32350 2572 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2768 3100 gene locus_tag LOCUS_32360 2768 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3273 3548 gene locus_tag LOCUS_32370 3273 3548 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055881.1 protein_id gnl|my_center|LOCUS_32370 3949 5265 gene locus_tag LOCUS_32380 gene urtA 3949 5265 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_32380 5360 6520 gene locus_tag LOCUS_32390 5360 6520 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_32390 6524 7678 gene locus_tag LOCUS_32400 gene urtC 6524 7678 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_32400 7842 8588 gene locus_tag LOCUS_32410 gene urtD 7842 8588 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_32410 8627 9325 gene locus_tag LOCUS_32420 gene urtE 8627 9325 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_32420 9347 10570 gene locus_tag LOCUS_32430 9347 10570 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_32430 12383 10704 gene locus_tag LOCUS_32440 gene pckA 12383 10704 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_32440 >Feature sequence126 1098 139 gene locus_tag LOCUS_32450 gene hemC 1098 139 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057483.1 protein_id gnl|my_center|LOCUS_32450 1398 2000 gene locus_tag LOCUS_32460 1398 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2459 1956 gene locus_tag LOCUS_32470 2459 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32470 3394 4242 gene locus_tag LOCUS_32480 3394 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 4462 5337 gene locus_tag LOCUS_32490 gene glyQ 4462 5337 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920808.1 protein_id gnl|my_center|LOCUS_32490 5823 7475 gene locus_tag LOCUS_32500 5823 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 8132 7815 gene locus_tag LOCUS_32510 gene rpsJ 8132 7815 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_32510 9454 8225 gene locus_tag LOCUS_32520 gene tuf 9454 8225 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143916.1 protein_id gnl|my_center|LOCUS_32520 11683 9608 gene locus_tag LOCUS_32530 gene fusA 11683 9608 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_32530 12297 11827 gene locus_tag LOCUS_32540 gene rpsG 12297 11827 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_32540 12836 12453 gene locus_tag LOCUS_32550 gene rpsL 12836 12453 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143913.1 protein_id gnl|my_center|LOCUS_32550 >Feature sequence127 59 946 gene locus_tag LOCUS_32560 59 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1011 1868 gene locus_tag LOCUS_32570 1011 1868 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_32570 2762 1953 gene locus_tag LOCUS_32580 2762 1953 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 protein_id gnl|my_center|LOCUS_32580 3231 2878 gene locus_tag LOCUS_32590 3231 2878 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_32590 3479 3231 gene locus_tag LOCUS_32600 3479 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3801 3652 gene locus_tag LOCUS_32610 3801 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 4429 3854 gene locus_tag LOCUS_32620 4429 3854 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_32620 4858 4577 gene locus_tag LOCUS_32630 4858 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 5283 4855 gene locus_tag LOCUS_32640 5283 4855 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_32640 7375 5444 gene locus_tag LOCUS_32650 7375 5444 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_32650 8010 7525 gene locus_tag LOCUS_32660 8010 7525 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_32660 8395 9159 gene locus_tag LOCUS_32670 8395 9159 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056030.1 protein_id gnl|my_center|LOCUS_32670 10453 9272 gene locus_tag LOCUS_32680 10453 9272 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 protein_id gnl|my_center|LOCUS_32680 10921 12834 gene locus_tag LOCUS_32690 gene dnaK 10921 12834 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057570.1 protein_id gnl|my_center|LOCUS_32690 >Feature sequence128 481 41 gene locus_tag LOCUS_32700 481 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 1394 504 gene locus_tag LOCUS_32710 1394 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 1612 2172 gene locus_tag LOCUS_32720 1612 2172 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_32720 2549 2824 gene locus_tag LOCUS_32730 2549 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3101 4099 gene locus_tag LOCUS_32740 3101 4099 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928617.1 protein_id gnl|my_center|LOCUS_32740 5056 4106 gene locus_tag LOCUS_32750 5056 4106 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_32750 5920 5069 gene locus_tag LOCUS_32760 gene lgt 5920 5069 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_32760 5993 6077 gene locus_tag LOCUS_t00420 5993 6077 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6327 6485 gene locus_tag LOCUS_32770 6327 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 7824 9725 gene locus_tag LOCUS_32780 7824 9725 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929297.1 protein_id gnl|my_center|LOCUS_32780 10257 12875 gene locus_tag LOCUS_32790 gene clpB 10257 12875 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence129 1361 261 gene locus_tag LOCUS_32800 1361 261 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_32800 2285 3850 gene locus_tag LOCUS_32810 2285 3850 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193934126.1 protein_id gnl|my_center|LOCUS_32810 5807 3963 gene locus_tag LOCUS_32820 5807 3963 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530091.1 protein_id gnl|my_center|LOCUS_32820 7711 5891 gene locus_tag LOCUS_32830 gene arsA 7711 5891 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461627.1 protein_id gnl|my_center|LOCUS_32830 8488 7805 gene locus_tag LOCUS_32840 8488 7805 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928988.1 protein_id gnl|my_center|LOCUS_32840 8581 8919 gene locus_tag LOCUS_32850 8581 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 9330 9070 gene locus_tag LOCUS_32860 9330 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 10079 9345 gene locus_tag LOCUS_32870 10079 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 10568 10095 gene locus_tag LOCUS_32880 10568 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 11216 10944 gene locus_tag LOCUS_32890 11216 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 11631 11209 gene locus_tag LOCUS_32900 11631 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 12689 11649 gene locus_tag LOCUS_32910 12689 11649 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339432.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence130 285 133 gene locus_tag LOCUS_32920 285 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 943 776 gene locus_tag LOCUS_32930 943 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 1795 2553 gene locus_tag LOCUS_32940 1795 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 2570 4030 gene locus_tag LOCUS_32950 2570 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 5959 5699 gene locus_tag LOCUS_32960 5959 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 7669 6827 gene locus_tag LOCUS_32970 7669 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 8698 7682 gene locus_tag LOCUS_32980 gene dcm 8698 7682 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222381.1 protein_id gnl|my_center|LOCUS_32980 9945 8860 gene locus_tag LOCUS_32990 gene ald 9945 8860 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143957.1 protein_id gnl|my_center|LOCUS_32990 10471 10169 gene locus_tag LOCUS_33000 10471 10169 CDS product DUF3181 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920922.1 protein_id gnl|my_center|LOCUS_33000 10718 10464 gene locus_tag LOCUS_33010 10718 10464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_33010 <13010 10838 gene locus_tag LOCUS_33020 <13010 10838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057920.1:CHAT domain-containing protein >Feature sequence131 61 333 gene locus_tag LOCUS_33030 61 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 340 723 gene locus_tag LOCUS_33040 340 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 1067 1702 gene locus_tag LOCUS_33050 gene hisIE 1067 1702 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056088.1 protein_id gnl|my_center|LOCUS_33050 2227 3612 gene locus_tag LOCUS_33060 gene merA 2227 3612 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031938.1 protein_id gnl|my_center|LOCUS_33060 3638 4261 gene locus_tag LOCUS_33070 gene tmk 3638 4261 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_33070 4266 5759 gene locus_tag LOCUS_33080 4266 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 6468 6037 gene locus_tag LOCUS_33090 6468 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 7841 7086 gene locus_tag LOCUS_33100 7841 7086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143324.1 protein_id gnl|my_center|LOCUS_33100 8645 7842 gene locus_tag LOCUS_33110 8645 7842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143325.1 protein_id gnl|my_center|LOCUS_33110 9870 8995 gene locus_tag LOCUS_33120 9870 8995 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_33120 10035 10535 gene locus_tag LOCUS_33130 10035 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 10661 10915 gene locus_tag LOCUS_33140 10661 10915 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377382.1 protein_id gnl|my_center|LOCUS_33140 11069 12322 gene locus_tag LOCUS_33150 11069 12322 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_33150 12361 12825 gene locus_tag LOCUS_33160 12361 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 >Feature sequence132 1052 3868 gene locus_tag LOCUS_33170 1052 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 4463 3912 gene locus_tag LOCUS_33180 4463 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 5268 4519 gene locus_tag LOCUS_33190 5268 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 6034 5522 gene locus_tag LOCUS_33200 6034 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 7095 6205 gene locus_tag LOCUS_33210 7095 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 7670 7227 gene locus_tag LOCUS_33220 7670 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 8292 9326 gene locus_tag LOCUS_33230 8292 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 9414 10202 gene locus_tag LOCUS_33240 9414 10202 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928578.1 protein_id gnl|my_center|LOCUS_33240 11588 10518 gene locus_tag LOCUS_33250 11588 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 11705 12025 gene locus_tag LOCUS_33260 11705 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 12204 12818 gene locus_tag LOCUS_33270 12204 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 >Feature sequence133 178 3150 gene locus_tag LOCUS_33280 178 3150 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_33280 3262 4698 gene locus_tag LOCUS_33290 gene ffh 3262 4698 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057808.1 protein_id gnl|my_center|LOCUS_33290 5670 4702 gene locus_tag LOCUS_33300 gene thiL 5670 4702 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921033.1 protein_id gnl|my_center|LOCUS_33300 6638 5967 gene locus_tag LOCUS_33310 6638 5967 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_33310 6743 8227 gene locus_tag LOCUS_33320 6743 8227 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_33320 8384 9016 gene locus_tag LOCUS_33330 8384 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 9044 10132 gene locus_tag LOCUS_33340 gene cax 9044 10132 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_33340 10812 10135 gene locus_tag LOCUS_33350 gene rsmG 10812 10135 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140710.1 protein_id gnl|my_center|LOCUS_33350 11560 10913 gene locus_tag LOCUS_33360 11560 10913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920666.1 protein_id gnl|my_center|LOCUS_33360 11646 12560 gene locus_tag LOCUS_33370 11646 12560 CDS product Sll0314/Alr1548 family TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524124.1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence134 1515 142 gene locus_tag LOCUS_33380 1515 142 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 protein_id gnl|my_center|LOCUS_33380 2636 1827 gene locus_tag LOCUS_33390 2636 1827 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_33390 3751 2822 gene locus_tag LOCUS_33400 3751 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 4202 3744 gene locus_tag LOCUS_33410 4202 3744 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_33410 4669 4214 gene locus_tag LOCUS_33420 4669 4214 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_33420 5136 4681 gene locus_tag LOCUS_33430 5136 4681 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_33430 5603 5148 gene locus_tag LOCUS_33440 5603 5148 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_33440 6071 5616 gene locus_tag LOCUS_33450 6071 5616 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_33450 7808 6282 gene locus_tag LOCUS_33460 gene radA 7808 6282 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_33460 8042 8770 gene locus_tag LOCUS_33470 8042 8770 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_33470 8780 9421 gene locus_tag LOCUS_33480 8780 9421 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_33480 9681 9890 gene locus_tag LOCUS_33490 9681 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 11252 10065 gene locus_tag LOCUS_33500 11252 10065 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_33500 11746 11327 gene locus_tag LOCUS_33510 11746 11327 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789904.1 protein_id gnl|my_center|LOCUS_33510 11745 12611 gene locus_tag LOCUS_33520 11745 12611 CDS product DUF3598 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141575.1 protein_id gnl|my_center|LOCUS_33520 >Feature sequence135 499 663 gene locus_tag LOCUS_33530 499 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 1700 627 gene locus_tag LOCUS_33540 1700 627 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_33540 2028 3215 gene locus_tag LOCUS_33550 2028 3215 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_33550 3335 3907 gene locus_tag LOCUS_33560 3335 3907 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056726.1 protein_id gnl|my_center|LOCUS_33560 3907 4227 gene locus_tag LOCUS_33570 3907 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 5417 4245 gene locus_tag LOCUS_33580 gene hemW 5417 4245 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799709.1 protein_id gnl|my_center|LOCUS_33580 5686 6765 gene locus_tag LOCUS_33590 5686 6765 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_33590 7473 7084 gene locus_tag LOCUS_33600 7473 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 7606 8943 gene locus_tag LOCUS_33610 gene trmFO 7606 8943 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056303.1 protein_id gnl|my_center|LOCUS_33610 9004 9501 gene locus_tag LOCUS_33620 9004 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 12402 9754 gene locus_tag LOCUS_33630 gene mutS 12402 9754 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058073.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence136 279 2006 gene locus_tag LOCUS_33640 279 2006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142325.1 protein_id gnl|my_center|LOCUS_33640 3492 2545 gene locus_tag LOCUS_33650 3492 2545 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_33650 4976 3912 gene locus_tag LOCUS_33660 gene hemE 4976 3912 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_33660 7309 5057 gene locus_tag LOCUS_33670 7309 5057 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_33670 8632 7469 gene locus_tag LOCUS_33680 8632 7469 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_33680 9925 8702 gene locus_tag LOCUS_33690 9925 8702 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933906.1 protein_id gnl|my_center|LOCUS_33690 10300 11487 gene locus_tag LOCUS_33700 10300 11487 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012165757.1 protein_id gnl|my_center|LOCUS_33700 12168 12374 gene locus_tag LOCUS_33710 12168 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence137 470 246 gene locus_tag LOCUS_33720 470 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 528 824 gene locus_tag LOCUS_33730 528 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 895 2451 gene locus_tag LOCUS_33740 895 2451 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_33740 2525 2746 gene locus_tag LOCUS_33750 2525 2746 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_33750 2752 3084 gene locus_tag LOCUS_33760 2752 3084 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_33760 4250 3150 gene locus_tag LOCUS_33770 4250 3150 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_33770 5576 4293 gene locus_tag LOCUS_33780 5576 4293 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_33780 9364 6308 gene locus_tag LOCUS_33790 gene ppc 9364 6308 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057749.1 protein_id gnl|my_center|LOCUS_33790 9804 9616 gene locus_tag LOCUS_33800 9804 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 10088 9813 gene locus_tag LOCUS_33810 gene minE 10088 9813 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057853.1 protein_id gnl|my_center|LOCUS_33810 10918 10118 gene locus_tag LOCUS_33820 gene minD 10918 10118 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057852.1 protein_id gnl|my_center|LOCUS_33820 11939 11106 gene locus_tag LOCUS_33830 gene minC 11939 11106 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141990.1 protein_id gnl|my_center|LOCUS_33830 12296 11946 gene locus_tag LOCUS_33840 12296 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence138 409 1137 gene locus_tag LOCUS_33850 409 1137 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039062.1 protein_id gnl|my_center|LOCUS_33850 1733 1164 gene locus_tag LOCUS_33860 1733 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 5043 1984 gene locus_tag LOCUS_33870 gene infB 5043 1984 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056909.1 protein_id gnl|my_center|LOCUS_33870 5437 5156 gene locus_tag LOCUS_33880 5437 5156 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172451.1 protein_id gnl|my_center|LOCUS_33880 6630 5434 gene locus_tag LOCUS_33890 gene nusA 6630 5434 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057772.1 protein_id gnl|my_center|LOCUS_33890 7226 6756 gene locus_tag LOCUS_33900 gene rimP 7226 6756 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920953.1 protein_id gnl|my_center|LOCUS_33900 7441 9336 gene locus_tag LOCUS_33910 gene ftsH2 7441 9336 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_33910 10210 9422 gene locus_tag LOCUS_33920 10210 9422 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence139 238 1644 gene locus_tag LOCUS_33930 238 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 3417 2299 gene locus_tag LOCUS_33940 gene kdpDN 3417 2299 CDS product KdpD-like non-kinase potassium sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181481.1 protein_id gnl|my_center|LOCUS_33940 3895 4068 gene locus_tag LOCUS_33950 3895 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 5192 4131 gene locus_tag LOCUS_33960 gene corA 5192 4131 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_33960 6660 5383 gene locus_tag LOCUS_33970 6660 5383 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 protein_id gnl|my_center|LOCUS_33970 7340 7047 gene locus_tag LOCUS_33980 7340 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 7791 8027 gene locus_tag LOCUS_33990 7791 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 8045 8317 gene locus_tag LOCUS_34000 8045 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 10310 8685 gene locus_tag LOCUS_34010 gene groL 10310 8685 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056040.1 protein_id gnl|my_center|LOCUS_34010 10668 10357 gene locus_tag LOCUS_34020 gene groES 10668 10357 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125740.1 protein_id gnl|my_center|LOCUS_34020 11845 11417 gene locus_tag LOCUS_34030 11845 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence140 1269 631 gene locus_tag LOCUS_34040 1269 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 1926 1711 gene locus_tag LOCUS_34050 1926 1711 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_34050 2513 2298 gene locus_tag LOCUS_34060 2513 2298 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_34060 4375 4133 gene locus_tag LOCUS_34070 4375 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 5155 4868 gene locus_tag LOCUS_34080 5155 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 5518 6855 gene locus_tag LOCUS_34090 5518 6855 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha C-terminal partner DnaE-C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057904.1 protein_id gnl|my_center|LOCUS_34090 7017 6859 gene locus_tag LOCUS_34100 7017 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 6970 8004 gene locus_tag LOCUS_34110 6970 8004 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728943.1 protein_id gnl|my_center|LOCUS_34110 8492 8001 gene locus_tag LOCUS_34120 8492 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 8894 8646 gene locus_tag LOCUS_34130 8894 8646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 9282 9124 gene locus_tag LOCUS_34140 9282 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 9233 10657 gene locus_tag LOCUS_34150 9233 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 10724 10876 gene locus_tag LOCUS_34160 10724 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 11502 11107 gene locus_tag LOCUS_34170 11502 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34170 11733 11509 gene locus_tag LOCUS_34180 11733 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34180 >Feature sequence141 132 917 gene locus_tag LOCUS_34190 132 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 1047 2231 gene locus_tag LOCUS_34200 1047 2231 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_34200 3102 2197 gene locus_tag LOCUS_34210 3102 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 3346 3071 gene locus_tag LOCUS_34220 3346 3071 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_34220 5599 3449 gene locus_tag LOCUS_34230 5599 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 6630 5992 gene locus_tag LOCUS_34240 6630 5992 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948539.1 protein_id gnl|my_center|LOCUS_34240 7236 6661 gene locus_tag LOCUS_34250 7236 6661 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_34250 8069 7395 gene locus_tag LOCUS_34260 8069 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 8824 8288 gene locus_tag LOCUS_34270 8824 8288 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929789.1 protein_id gnl|my_center|LOCUS_34270 9998 9051 gene locus_tag LOCUS_34280 gene cysK 9998 9051 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_34280 10663 11184 gene locus_tag LOCUS_34290 10663 11184 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_34290 11240 11731 gene locus_tag LOCUS_34300 gene cpcA 11240 11731 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence142 743 279 gene locus_tag LOCUS_34310 743 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 1587 808 gene locus_tag LOCUS_34320 1587 808 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_34320 2427 1849 gene locus_tag LOCUS_34330 gene rimM 2427 1849 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125913.1 protein_id gnl|my_center|LOCUS_34330 2578 3375 gene locus_tag LOCUS_34340 2578 3375 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 protein_id gnl|my_center|LOCUS_34340 4152 3358 gene locus_tag LOCUS_34350 4152 3358 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928875.1 protein_id gnl|my_center|LOCUS_34350 4928 4542 gene locus_tag LOCUS_34360 4928 4542 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_34360 5452 6444 gene locus_tag LOCUS_34370 5452 6444 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_34370 6507 7508 gene locus_tag LOCUS_34380 6507 7508 CDS product curli production assembly/transport component CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869127.1 protein_id gnl|my_center|LOCUS_34380 7742 8704 gene locus_tag LOCUS_34390 7742 8704 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_34390 10339 9068 gene locus_tag LOCUS_34400 10339 9068 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_34400 10942 11142 gene locus_tag LOCUS_34410 10942 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 11222 11557 gene locus_tag LOCUS_34420 11222 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34420 >Feature sequence143 1218 121 gene locus_tag LOCUS_34430 1218 121 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407185.1 protein_id gnl|my_center|LOCUS_34430 2985 1372 gene locus_tag LOCUS_34440 2985 1372 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900326.1 protein_id gnl|my_center|LOCUS_34440 3112 3261 gene locus_tag LOCUS_34450 3112 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 3582 3310 gene locus_tag LOCUS_34460 3582 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 4093 4647 gene locus_tag LOCUS_34470 4093 4647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_34470 5946 4660 gene locus_tag LOCUS_34480 5946 4660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_34480 6371 7204 gene locus_tag LOCUS_34490 6371 7204 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_34490 7697 8869 gene locus_tag LOCUS_34500 gene dxr 7697 8869 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_34500 9352 10647 gene locus_tag LOCUS_34510 9352 10647 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_34510 10663 11334 gene locus_tag LOCUS_34520 10663 11334 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_34520 >Feature sequence144 466 1593 gene locus_tag LOCUS_34530 466 1593 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_34530 3165 1639 gene locus_tag LOCUS_34540 gene bchB 3165 1639 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058224.1 protein_id gnl|my_center|LOCUS_34540 3917 3321 gene locus_tag LOCUS_34550 3917 3321 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_34550 4650 4063 gene locus_tag LOCUS_34560 4650 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 5349 4876 gene locus_tag LOCUS_34570 5349 4876 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057630.1 protein_id gnl|my_center|LOCUS_34570 5999 5658 gene locus_tag LOCUS_34580 5999 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 protein_id gnl|my_center|LOCUS_34580 7313 6270 gene locus_tag LOCUS_34590 gene dcm 7313 6270 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_34590 8987 7470 gene locus_tag LOCUS_34600 8987 7470 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057656.1 protein_id gnl|my_center|LOCUS_34600 9957 9256 gene locus_tag LOCUS_34610 9957 9256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888749.1 protein_id gnl|my_center|LOCUS_34610 10996 10259 gene locus_tag LOCUS_34620 10996 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence145 851 213 gene locus_tag LOCUS_34630 gene purN 851 213 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_34630 1132 848 gene locus_tag LOCUS_34640 1132 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 2741 1248 gene locus_tag LOCUS_34650 gene pap 2741 1248 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_34650 2811 3809 gene locus_tag LOCUS_34660 gene galE 2811 3809 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920997.1 protein_id gnl|my_center|LOCUS_34660 3882 4307 gene locus_tag LOCUS_34670 3882 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 5383 4412 gene locus_tag LOCUS_34680 5383 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 5753 7006 gene locus_tag LOCUS_34690 5753 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 7006 7965 gene locus_tag LOCUS_34700 7006 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 7962 9194 gene locus_tag LOCUS_34710 7962 9194 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_34710 9210 10100 gene locus_tag LOCUS_34720 9210 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 10566 11516 gene locus_tag LOCUS_34730 10566 11516 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence146 327 764 gene locus_tag LOCUS_34740 gene cynS 327 764 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_34740 2915 1104 gene locus_tag LOCUS_34750 2915 1104 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_34750 3328 2960 gene locus_tag LOCUS_34760 3328 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 3482 3655 gene locus_tag LOCUS_34770 3482 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 4269 3667 gene locus_tag LOCUS_34780 4269 3667 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040689791.1 protein_id gnl|my_center|LOCUS_34780 5372 4347 gene locus_tag LOCUS_34790 5372 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 5593 6744 gene locus_tag LOCUS_34800 5593 6744 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_34800 8061 6940 gene locus_tag LOCUS_34810 8061 6940 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_34810 8233 8862 gene locus_tag LOCUS_34820 gene ruvA 8233 8862 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056382.1 protein_id gnl|my_center|LOCUS_34820 9418 9903 gene locus_tag LOCUS_34830 gene apcA 9418 9903 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_34830 9983 10468 gene locus_tag LOCUS_34840 gene apcB 9983 10468 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056800.1 protein_id gnl|my_center|LOCUS_34840 10659 10862 gene locus_tag LOCUS_34850 10659 10862 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056799.1 protein_id gnl|my_center|LOCUS_34850 11331 10915 gene locus_tag LOCUS_34860 gene msrB 11331 10915 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144007.1 protein_id gnl|my_center|LOCUS_34860 >Feature sequence147 346 768 gene locus_tag LOCUS_34870 346 768 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015159351.1 protein_id gnl|my_center|LOCUS_34870 1324 773 gene locus_tag LOCUS_34880 1324 773 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920633.1 protein_id gnl|my_center|LOCUS_34880 1430 2695 gene locus_tag LOCUS_34890 1430 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 3289 2648 gene locus_tag LOCUS_34900 3289 2648 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530085.1 protein_id gnl|my_center|LOCUS_34900 3442 4581 gene locus_tag LOCUS_34910 3442 4581 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_34910 4619 5524 gene locus_tag LOCUS_34920 gene crtB 4619 5524 CDS product cyanoexosortase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431335.1 protein_id gnl|my_center|LOCUS_34920 5517 6263 gene locus_tag LOCUS_34930 5517 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 6500 7726 gene locus_tag LOCUS_34940 6500 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 7844 10048 gene locus_tag LOCUS_34950 7844 10048 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142199.1 protein_id gnl|my_center|LOCUS_34950 11503 10055 gene locus_tag LOCUS_34960 11503 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592997.1 protein_id gnl|my_center|LOCUS_34960 >Feature sequence148 956 216 gene locus_tag LOCUS_34970 956 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 2204 987 gene locus_tag LOCUS_34980 2204 987 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765099.1 protein_id gnl|my_center|LOCUS_34980 3166 2207 gene locus_tag LOCUS_34990 gene gmd 3166 2207 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880676.1 protein_id gnl|my_center|LOCUS_34990 4101 3181 gene locus_tag LOCUS_35000 gene aglG 4101 3181 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_35000 4368 5351 gene locus_tag LOCUS_35010 4368 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 5576 5932 gene locus_tag LOCUS_35020 gene folB 5576 5932 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798382.1 protein_id gnl|my_center|LOCUS_35020 6461 5919 gene locus_tag LOCUS_35030 6461 5919 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_35030 6622 6948 gene locus_tag LOCUS_35040 6622 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 7553 6945 gene locus_tag LOCUS_35050 7553 6945 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_35050 8286 7630 gene locus_tag LOCUS_35060 gene nth 8286 7630 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_35060 9377 8286 gene locus_tag LOCUS_35070 gene rseP 9377 8286 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057479.1 protein_id gnl|my_center|LOCUS_35070 9669 10232 gene locus_tag LOCUS_35080 9669 10232 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_35080 10412 11002 gene locus_tag LOCUS_35090 10412 11002 CDS product PAP/fibrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence149 1082 219 gene locus_tag LOCUS_35100 1082 219 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 protein_id gnl|my_center|LOCUS_35100 1344 3347 gene locus_tag LOCUS_35110 1344 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3518 3937 gene locus_tag LOCUS_35120 3518 3937 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391723.1 protein_id gnl|my_center|LOCUS_35120 3979 4377 gene locus_tag LOCUS_35130 3979 4377 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876102.1 protein_id gnl|my_center|LOCUS_35130 4370 4828 gene locus_tag LOCUS_35140 4370 4828 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174492.1 protein_id gnl|my_center|LOCUS_35140 4914 5057 gene locus_tag LOCUS_35150 4914 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 5050 8493 gene locus_tag LOCUS_35160 5050 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 8511 9518 gene locus_tag LOCUS_35170 8511 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 9574 10248 gene locus_tag LOCUS_35180 9574 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 10258 10824 gene locus_tag LOCUS_35190 10258 10824 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_35190 10908 11474 gene locus_tag LOCUS_35200 10908 11474 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence150 2071 731 gene locus_tag LOCUS_35210 2071 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3055 2513 gene locus_tag LOCUS_35220 3055 2513 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_35220 3479 3261 gene locus_tag LOCUS_35230 3479 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 3596 4936 gene locus_tag LOCUS_35240 gene aroA 3596 4936 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_35240 5132 6847 gene locus_tag LOCUS_35250 5132 6847 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_35250 8539 7076 gene locus_tag LOCUS_35260 gene purF 8539 7076 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057521.1 protein_id gnl|my_center|LOCUS_35260 10947 8677 gene locus_tag LOCUS_35270 gene purL 10947 8677 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057520.1 protein_id gnl|my_center|LOCUS_35270 >Feature sequence151 141 2213 gene locus_tag LOCUS_35280 141 2213 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_35280 4480 2243 gene locus_tag LOCUS_35290 4480 2243 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036738.1 protein_id gnl|my_center|LOCUS_35290 6051 4606 gene locus_tag LOCUS_35300 6051 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_35300 7023 8309 gene locus_tag LOCUS_35310 7023 8309 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_35310 8601 8828 gene locus_tag LOCUS_35320 8601 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 9649 8858 gene locus_tag LOCUS_35330 9649 8858 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141905.1 protein_id gnl|my_center|LOCUS_35330 10383 9673 gene locus_tag LOCUS_35340 10383 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_35340 10585 11118 gene locus_tag LOCUS_35350 10585 11118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence152 498 1463 gene locus_tag LOCUS_35360 498 1463 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_35360 1439 2788 gene locus_tag LOCUS_35370 1439 2788 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920832.1 protein_id gnl|my_center|LOCUS_35370 3103 2792 gene locus_tag LOCUS_35380 3103 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 3424 4701 gene locus_tag LOCUS_35390 gene ahcY 3424 4701 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_35390 4944 5549 gene locus_tag LOCUS_35400 4944 5549 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_35400 5692 5991 gene locus_tag LOCUS_35410 5692 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 6033 6242 gene locus_tag LOCUS_35420 6033 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 6349 6546 gene locus_tag LOCUS_35430 6349 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 6543 6932 gene locus_tag LOCUS_35440 6543 6932 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_35440 8133 7948 gene locus_tag LOCUS_35450 8133 7948 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_35450 8414 8130 gene locus_tag LOCUS_35460 8414 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 9436 8543 gene locus_tag LOCUS_35470 9436 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 9948 9454 gene locus_tag LOCUS_35480 9948 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 10210 10452 gene locus_tag LOCUS_35490 10210 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence153 175 399 gene locus_tag LOCUS_35500 175 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 396 590 gene locus_tag LOCUS_35510 396 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 747 929 gene locus_tag LOCUS_35520 747 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 2074 1169 gene locus_tag LOCUS_35530 2074 1169 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_35530 2210 2728 gene locus_tag LOCUS_35540 2210 2728 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_35540 2736 3152 gene locus_tag LOCUS_35550 2736 3152 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_35550 3156 3794 gene locus_tag LOCUS_35560 3156 3794 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_35560 4267 3803 gene locus_tag LOCUS_35570 4267 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 5940 4348 gene locus_tag LOCUS_35580 5940 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 7626 6508 gene locus_tag LOCUS_35590 7626 6508 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_35590 7965 9125 gene locus_tag LOCUS_35600 gene mtnW 7965 9125 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_35600 10677 9394 gene locus_tag LOCUS_35610 gene serS 10677 9394 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057392.1 protein_id gnl|my_center|LOCUS_35610 >Feature sequence154 1262 138 gene locus_tag LOCUS_35620 1262 138 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928656.1 protein_id gnl|my_center|LOCUS_35620 2976 1351 gene locus_tag LOCUS_35630 gene guaA 2976 1351 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058250.1 protein_id gnl|my_center|LOCUS_35630 4244 3117 gene locus_tag LOCUS_35640 gene cbiD 4244 3117 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056612.1 protein_id gnl|my_center|LOCUS_35640 4523 4840 gene locus_tag LOCUS_35650 4523 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 4944 5150 gene locus_tag LOCUS_35660 4944 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 5369 6424 gene locus_tag LOCUS_35670 5369 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 6484 6753 gene locus_tag LOCUS_35680 6484 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 7369 6911 gene locus_tag LOCUS_35690 7369 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 7690 7370 gene locus_tag LOCUS_35700 7690 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 8130 7840 gene locus_tag LOCUS_35710 8130 7840 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_35710 9007 8207 gene locus_tag LOCUS_35720 9007 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 10656 9142 gene locus_tag LOCUS_35730 10656 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence155 281 6 gene locus_tag LOCUS_35740 281 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 628 1824 gene locus_tag LOCUS_35750 gene alr 628 1824 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056313.1 protein_id gnl|my_center|LOCUS_35750 2038 3342 gene locus_tag LOCUS_35760 2038 3342 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965184.1 protein_id gnl|my_center|LOCUS_35760 5424 3433 gene locus_tag LOCUS_35770 5424 3433 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_35770 6637 5546 gene locus_tag LOCUS_35780 6637 5546 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214433169.1 protein_id gnl|my_center|LOCUS_35780 7401 6712 gene locus_tag LOCUS_35790 7401 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 8822 7398 gene locus_tag LOCUS_35800 8822 7398 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106970097.1 protein_id gnl|my_center|LOCUS_35800 9967 8894 gene locus_tag LOCUS_35810 gene bchI 9967 8894 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920887.1 protein_id gnl|my_center|LOCUS_35810 10440 10051 gene locus_tag LOCUS_35820 10440 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045052736.1 protein_id gnl|my_center|LOCUS_35820 >Feature sequence156 276 1223 gene locus_tag LOCUS_35830 276 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 4282 1220 gene locus_tag LOCUS_35840 4282 1220 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_35840 4483 5271 gene locus_tag LOCUS_35850 4483 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 5702 5268 gene locus_tag LOCUS_35860 5702 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 6222 6866 gene locus_tag LOCUS_35870 6222 6866 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_35870 7526 6954 gene locus_tag LOCUS_35880 7526 6954 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142565.1 protein_id gnl|my_center|LOCUS_35880 7855 8982 gene locus_tag LOCUS_35890 gene recF 7855 8982 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_35890 9791 9081 gene locus_tag LOCUS_35900 gene rpiA 9791 9081 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_35900 10385 9864 gene locus_tag LOCUS_35910 10385 9864 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920888.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence157 1563 322 gene locus_tag LOCUS_35920 gene argJ 1563 322 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057748.1 protein_id gnl|my_center|LOCUS_35920 1744 2151 gene locus_tag LOCUS_35930 1744 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_35930 3813 2164 gene locus_tag LOCUS_35940 3813 2164 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_35940 5226 4165 gene locus_tag LOCUS_35950 5226 4165 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_35950 6379 5360 gene locus_tag LOCUS_35960 gene petA 6379 5360 CDS product apocytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056804.1 protein_id gnl|my_center|LOCUS_35960 6929 6390 gene locus_tag LOCUS_35970 6929 6390 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056803.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence158 205 969 gene locus_tag LOCUS_35980 205 969 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_35980 1601 2290 gene locus_tag LOCUS_35990 1601 2290 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_35990 2365 2976 gene locus_tag LOCUS_36000 2365 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 2979 3320 gene locus_tag LOCUS_36010 2979 3320 CDS product DUF565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_36010 3493 3792 gene locus_tag LOCUS_36020 3493 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 3799 5346 gene locus_tag LOCUS_36030 3799 5346 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_36030 5352 5513 gene locus_tag LOCUS_36040 5352 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 5908 5510 gene locus_tag LOCUS_36050 5908 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 6201 5905 gene locus_tag LOCUS_36060 6201 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 6562 6389 gene locus_tag LOCUS_36070 6562 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 6796 6593 gene locus_tag LOCUS_36080 6796 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 7777 6932 gene locus_tag LOCUS_36090 7777 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 8450 9865 gene locus_tag LOCUS_36100 8450 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence159 363 1712 gene locus_tag LOCUS_36110 363 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 1713 2405 gene locus_tag LOCUS_36120 1713 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 2684 3376 gene locus_tag LOCUS_36130 2684 3376 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_36130 3506 4930 gene locus_tag LOCUS_36140 3506 4930 CDS product deoxyribodipyrimidine photo-lyase, 8-HDF type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_36140 7810 5165 gene locus_tag LOCUS_36150 7810 5165 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141744.1 protein_id gnl|my_center|LOCUS_36150 8693 9721 gene locus_tag LOCUS_36160 8693 9721 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence160 1239 154 gene locus_tag LOCUS_36170 gene orr 1239 154 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_36170 2404 1244 gene locus_tag LOCUS_36180 2404 1244 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_36180 2636 2427 gene locus_tag LOCUS_36190 2636 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3197 2889 gene locus_tag LOCUS_36200 3197 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 4744 3371 gene locus_tag LOCUS_36210 4744 3371 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_36210 5522 5037 gene locus_tag LOCUS_36220 5522 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056916.1 protein_id gnl|my_center|LOCUS_36220 7252 5645 gene locus_tag LOCUS_36230 7252 5645 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_36230 7790 7281 gene locus_tag LOCUS_36240 gene hoxE 7790 7281 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_36240 8480 9502 gene locus_tag LOCUS_36250 8480 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 9697 9918 gene locus_tag LOCUS_36260 9697 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36260 >Feature sequence161 125 385 gene locus_tag LOCUS_36270 125 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 382 792 gene locus_tag LOCUS_36280 382 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 1350 1727 gene locus_tag LOCUS_36290 1350 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 1724 2116 gene locus_tag LOCUS_36300 1724 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 2481 2759 gene locus_tag LOCUS_36310 2481 2759 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_36310 2759 3046 gene locus_tag LOCUS_36320 2759 3046 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_36320 3348 3611 gene locus_tag LOCUS_36330 3348 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 3618 4064 gene locus_tag LOCUS_36340 3618 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 4094 4639 gene locus_tag LOCUS_36350 4094 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314297.1 protein_id gnl|my_center|LOCUS_36350 5704 4826 gene locus_tag LOCUS_36360 gene murB 5704 4826 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_36360 7286 5859 gene locus_tag LOCUS_36370 gene murC 7286 5859 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056226.1 protein_id gnl|my_center|LOCUS_36370 8409 7732 gene locus_tag LOCUS_36380 8409 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 8613 9917 gene locus_tag LOCUS_36390 gene hisD 8613 9917 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337274.1 protein_id gnl|my_center|LOCUS_36390 >Feature sequence162 <1 728 gene locus_tag LOCUS_36400 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201365204.1:IS1 family transposase 1387 725 gene locus_tag LOCUS_36410 1387 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 2036 1377 gene locus_tag LOCUS_36420 gene cas6 2036 1377 CDS product type I-MYXAN CRISPR-associated protein Cas6/Cmx6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026911.1 protein_id gnl|my_center|LOCUS_36420 3045 2050 gene locus_tag LOCUS_36430 3045 2050 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142883.1 protein_id gnl|my_center|LOCUS_36430 3395 4327 gene locus_tag LOCUS_36440 3395 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 4406 5032 gene locus_tag LOCUS_36450 4406 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 5807 5445 gene locus_tag LOCUS_36460 5807 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 6190 5894 gene locus_tag LOCUS_36470 6190 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 6673 7638 gene locus_tag LOCUS_36480 6673 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 7628 8722 gene locus_tag LOCUS_36490 7628 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence163 226 1422 gene locus_tag LOCUS_36500 226 1422 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_36500 1665 1411 gene locus_tag LOCUS_36510 1665 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 3189 1927 gene locus_tag LOCUS_36520 3189 1927 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166117.1 protein_id gnl|my_center|LOCUS_36520 3859 3191 gene locus_tag LOCUS_36530 gene lipB 3859 3191 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056676.1 protein_id gnl|my_center|LOCUS_36530 4333 4932 gene locus_tag LOCUS_36540 gene raiA 4333 4932 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_36540 5401 4991 gene locus_tag LOCUS_36550 5401 4991 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_36550 6278 5637 gene locus_tag LOCUS_36560 6278 5637 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_36560 6255 7511 gene locus_tag LOCUS_36570 gene larC 6255 7511 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058129.1 protein_id gnl|my_center|LOCUS_36570 8004 7552 gene locus_tag LOCUS_36580 8004 7552 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_36580 8426 8707 gene locus_tag LOCUS_36590 8426 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36590 >Feature sequence164 1443 2408 gene locus_tag LOCUS_36600 1443 2408 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330037.1 protein_id gnl|my_center|LOCUS_36600 2654 2920 gene locus_tag LOCUS_36610 2654 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141287.1 protein_id gnl|my_center|LOCUS_36610 3889 3002 gene locus_tag LOCUS_36620 3889 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 4200 5150 gene locus_tag LOCUS_36630 4200 5150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_36630 5831 5199 gene locus_tag LOCUS_36640 5831 5199 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_36640 6202 7395 gene locus_tag LOCUS_36650 6202 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 7438 8208 gene locus_tag LOCUS_36660 7438 8208 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_36660 8343 8930 gene locus_tag LOCUS_36670 8343 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 8902 9240 gene locus_tag LOCUS_36680 8902 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 >Feature sequence165 415 173 gene locus_tag LOCUS_36690 415 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 2002 476 gene locus_tag LOCUS_36700 gene lnt 2002 476 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057504.1 protein_id gnl|my_center|LOCUS_36700 2230 3000 gene locus_tag LOCUS_36710 2230 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 3468 3082 gene locus_tag LOCUS_36720 3468 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 protein_id gnl|my_center|LOCUS_36720 3548 4708 gene locus_tag LOCUS_36730 3548 4708 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162850918.1 protein_id gnl|my_center|LOCUS_36730 5346 5837 gene locus_tag LOCUS_36740 5346 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_36740 5886 6227 gene locus_tag LOCUS_36750 5886 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 6256 7590 gene locus_tag LOCUS_36760 6256 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 9068 7767 gene locus_tag LOCUS_36770 gene hemL 9068 7767 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797681.1 protein_id gnl|my_center|LOCUS_36770 >Feature sequence166 1535 120 gene locus_tag LOCUS_36780 gene argH 1535 120 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 protein_id gnl|my_center|LOCUS_36780 2626 2015 gene locus_tag LOCUS_36790 2626 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 2958 2623 gene locus_tag LOCUS_36800 2958 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 4462 3398 gene locus_tag LOCUS_36810 4462 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 5483 4626 gene locus_tag LOCUS_36820 5483 4626 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142304.1 protein_id gnl|my_center|LOCUS_36820 5644 5967 gene locus_tag LOCUS_36830 5644 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 6619 5987 gene locus_tag LOCUS_36840 6619 5987 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056571.1 protein_id gnl|my_center|LOCUS_36840 6938 9142 gene locus_tag LOCUS_36850 6938 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence167 1054 599 gene locus_tag LOCUS_36860 1054 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 1685 1083 gene locus_tag LOCUS_36870 1685 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 4973 2664 gene locus_tag LOCUS_36880 4973 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 6571 5003 gene locus_tag LOCUS_36890 6571 5003 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_36890 7477 7280 gene locus_tag LOCUS_36900 7477 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 8799 8479 gene locus_tag LOCUS_36910 8799 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 >Feature sequence168 427 161 gene locus_tag LOCUS_36920 427 161 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_36920 1205 591 gene locus_tag LOCUS_36930 gene lexA 1205 591 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125487.1 protein_id gnl|my_center|LOCUS_36930 2111 5665 gene locus_tag LOCUS_36940 gene nifJ 2111 5665 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_36940 5668 6693 gene locus_tag LOCUS_36950 5668 6693 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_36950 6843 8051 gene locus_tag LOCUS_36960 6843 8051 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057156.1 protein_id gnl|my_center|LOCUS_36960 8264 8094 gene locus_tag LOCUS_36970 8264 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 8486 8271 gene locus_tag LOCUS_36980 8486 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 8800 8489 gene locus_tag LOCUS_36990 8800 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 >Feature sequence169 1586 318 gene locus_tag LOCUS_37000 1586 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 1769 3040 gene locus_tag LOCUS_37010 1769 3040 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088243667.1 protein_id gnl|my_center|LOCUS_37010 3125 4285 gene locus_tag LOCUS_37020 3125 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 6969 4792 gene locus_tag LOCUS_37030 6969 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 7335 7937 gene locus_tag LOCUS_37040 gene lepB 7335 7937 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_37040 8950 7991 gene locus_tag LOCUS_37050 8950 7991 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_37050 >Feature sequence170 133 52 gene locus_tag LOCUS_t00430 133 52 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1107 268 gene locus_tag LOCUS_37060 1107 268 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920966.1 protein_id gnl|my_center|LOCUS_37060 3205 1187 gene locus_tag LOCUS_37070 3205 1187 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057837.1 protein_id gnl|my_center|LOCUS_37070 4106 3276 gene locus_tag LOCUS_37080 gene ntrB 4106 3276 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920965.1 protein_id gnl|my_center|LOCUS_37080 5577 4219 gene locus_tag LOCUS_37090 5577 4219 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057835.1 protein_id gnl|my_center|LOCUS_37090 5890 7116 gene locus_tag LOCUS_37100 5890 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 8345 7422 gene locus_tag LOCUS_37110 8345 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 8876 8421 gene locus_tag LOCUS_37120 8876 8421 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 protein_id gnl|my_center|LOCUS_37120 >Feature sequence171 1648 818 gene locus_tag LOCUS_37130 gene dapB 1648 818 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920961.1 protein_id gnl|my_center|LOCUS_37130 2915 2076 gene locus_tag LOCUS_37140 2915 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 3900 2938 gene locus_tag LOCUS_37150 3900 2938 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242748.1 protein_id gnl|my_center|LOCUS_37150 5442 4489 gene locus_tag LOCUS_37160 5442 4489 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550332.1 protein_id gnl|my_center|LOCUS_37160 5968 5465 gene locus_tag LOCUS_37170 5968 5465 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_37170 6378 5974 gene locus_tag LOCUS_37180 gene rsfS 6378 5974 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057064.1 protein_id gnl|my_center|LOCUS_37180 7030 6434 gene locus_tag LOCUS_37190 gene yqeK 7030 6434 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057165.1 protein_id gnl|my_center|LOCUS_37190 8679 7111 gene locus_tag LOCUS_37200 8679 7111 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence172 114 458 gene locus_tag LOCUS_37210 114 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 671 1447 gene locus_tag LOCUS_37220 671 1447 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_37220 1898 2320 gene locus_tag LOCUS_37230 1898 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 2349 2618 gene locus_tag LOCUS_37240 2349 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 2973 4121 gene locus_tag LOCUS_37250 2973 4121 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_37250 4297 4593 gene locus_tag LOCUS_37260 4297 4593 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_37260 4590 5999 gene locus_tag LOCUS_37270 4590 5999 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_37270 6298 6059 gene locus_tag LOCUS_37280 6298 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 6596 6868 gene locus_tag LOCUS_37290 6596 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 7990 6983 gene locus_tag LOCUS_37300 7990 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 8395 8742 gene locus_tag LOCUS_37310 8395 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence173 110 550 gene locus_tag LOCUS_37320 110 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 858 1526 gene locus_tag LOCUS_37330 gene fabG 858 1526 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771268.1 protein_id gnl|my_center|LOCUS_37330 1549 2661 gene locus_tag LOCUS_37340 1549 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 3344 3952 gene locus_tag LOCUS_37350 3344 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 5822 4020 gene locus_tag LOCUS_37360 gene ilvB 5822 4020 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182646.1 protein_id gnl|my_center|LOCUS_37360 7255 6050 gene locus_tag LOCUS_37370 7255 6050 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073147.1 protein_id gnl|my_center|LOCUS_37370 8306 7266 gene locus_tag LOCUS_37380 8306 7266 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_37380 <9046 8368 gene locus_tag LOCUS_37390 <9046 8368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143123.1:Uma2 family endonuclease >Feature sequence174 306 827 gene locus_tag LOCUS_37400 306 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 933 1196 gene locus_tag LOCUS_37410 933 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 1193 1630 gene locus_tag LOCUS_37420 1193 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 3041 1671 gene locus_tag LOCUS_37430 3041 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 3290 4090 gene locus_tag LOCUS_37440 3290 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204824.1 protein_id gnl|my_center|LOCUS_37440 4108 5733 gene locus_tag LOCUS_37450 4108 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 5730 7061 gene locus_tag LOCUS_37460 5730 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 7510 7088 gene locus_tag LOCUS_37470 7510 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 8491 7565 gene locus_tag LOCUS_37480 8491 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_37480 >Feature sequence175 486 1511 gene locus_tag LOCUS_37490 486 1511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_37490 2110 1691 gene locus_tag LOCUS_37500 2110 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37500 3282 2320 gene locus_tag LOCUS_37510 gene csaB 3282 2320 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057733.1 protein_id gnl|my_center|LOCUS_37510 4711 3632 gene locus_tag LOCUS_37520 4711 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_37520 4925 5725 gene locus_tag LOCUS_37530 4925 5725 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048869675.1 protein_id gnl|my_center|LOCUS_37530 6011 6562 gene locus_tag LOCUS_37540 6011 6562 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_37540 6889 7425 gene locus_tag LOCUS_37550 6889 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence176 197 2293 gene locus_tag LOCUS_37560 gene pta 197 2293 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_37560 4248 6116 gene locus_tag LOCUS_37570 4248 6116 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_37570 6997 6134 gene locus_tag LOCUS_37580 6997 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 7068 7601 gene locus_tag LOCUS_37590 7068 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 >Feature sequence177 2017 395 gene locus_tag LOCUS_37600 2017 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 2001 2450 gene locus_tag LOCUS_37610 2001 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 2988 3470 gene locus_tag LOCUS_37620 2988 3470 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 protein_id gnl|my_center|LOCUS_37620 4361 3645 gene locus_tag LOCUS_37630 4361 3645 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_37630 5589 4498 gene locus_tag LOCUS_37640 gene cax 5589 4498 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_37640 6459 5662 gene locus_tag LOCUS_37650 gene pstB 6459 5662 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_37650 7471 6581 gene locus_tag LOCUS_37660 gene pstA 7471 6581 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_37660 8418 7477 gene locus_tag LOCUS_37670 gene pstC 8418 7477 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_37670 >Feature sequence178 224 610 gene locus_tag LOCUS_37680 224 610 CDS product DUF2358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929025.1 protein_id gnl|my_center|LOCUS_37680 2032 620 gene locus_tag LOCUS_37690 2032 620 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_37690 2209 2403 gene locus_tag LOCUS_37700 gene rpmG 2209 2403 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057895.1 protein_id gnl|my_center|LOCUS_37700 2444 2659 gene locus_tag LOCUS_37710 gene rpsR 2444 2659 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057896.1 protein_id gnl|my_center|LOCUS_37710 3296 5524 gene locus_tag LOCUS_37720 3296 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 5601 5673 gene locus_tag LOCUS_t00440 5601 5673 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5915 6658 gene locus_tag LOCUS_37730 5915 6658 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_37730 6669 7259 gene locus_tag LOCUS_37740 6669 7259 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_37740 7642 8256 gene locus_tag LOCUS_37750 7642 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056873.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence179 646 335 gene locus_tag LOCUS_37760 646 335 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_37760 1890 2252 gene locus_tag LOCUS_37770 gene ndhC 1890 2252 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986108.1 protein_id gnl|my_center|LOCUS_37770 2300 3043 gene locus_tag LOCUS_37780 gene ndhK 2300 3043 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056552.1 protein_id gnl|my_center|LOCUS_37780 3044 3547 gene locus_tag LOCUS_37790 3044 3547 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057270.1 protein_id gnl|my_center|LOCUS_37790 4588 3719 gene locus_tag LOCUS_37800 4588 3719 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_37800 4867 5784 gene locus_tag LOCUS_37810 4867 5784 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_37810 5900 7093 gene locus_tag LOCUS_37820 5900 7093 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986860.1 protein_id gnl|my_center|LOCUS_37820 7733 7945 gene locus_tag LOCUS_37830 7733 7945 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546765.1 protein_id gnl|my_center|LOCUS_37830 7945 8169 gene locus_tag LOCUS_37840 7945 8169 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024016.1 protein_id gnl|my_center|LOCUS_37840 >Feature sequence180 1633 197 gene locus_tag LOCUS_37850 1633 197 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_37850 1901 3115 gene locus_tag LOCUS_37860 1901 3115 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_37860 7306 3134 gene locus_tag LOCUS_37870 7306 3134 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_37870 7828 7361 gene locus_tag LOCUS_37880 7828 7361 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_37880 >Feature sequence181 436 1392 gene locus_tag LOCUS_37890 436 1392 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_37890 1426 1935 gene locus_tag LOCUS_37900 1426 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928632.1 protein_id gnl|my_center|LOCUS_37900 2211 2140 gene locus_tag LOCUS_t00450 2211 2140 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2271 2525 gene locus_tag LOCUS_37910 2271 2525 CDS product DUF3493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057674.1 protein_id gnl|my_center|LOCUS_37910 2747 3049 gene locus_tag LOCUS_37920 2747 3049 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_37920 3249 5771 gene locus_tag LOCUS_37930 3249 5771 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_37930 6327 5920 gene locus_tag LOCUS_37940 6327 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 6733 6888 gene locus_tag LOCUS_37950 6733 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 7035 7331 gene locus_tag LOCUS_37960 7035 7331 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_37960 7312 7659 gene locus_tag LOCUS_37970 7312 7659 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941219.1 protein_id gnl|my_center|LOCUS_37970 7891 8172 gene locus_tag LOCUS_37980 7891 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 >Feature sequence182 3424 410 gene locus_tag LOCUS_37990 3424 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 3663 3588 gene locus_tag LOCUS_t00460 3663 3588 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3764 4639 gene locus_tag LOCUS_38000 gene lipA 3764 4639 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921111.1 protein_id gnl|my_center|LOCUS_38000 5195 4602 gene locus_tag LOCUS_38010 gene rdgB 5195 4602 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057634.1 protein_id gnl|my_center|LOCUS_38010 6283 5363 gene locus_tag LOCUS_38020 6283 5363 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142528.1 protein_id gnl|my_center|LOCUS_38020 6444 8087 gene locus_tag LOCUS_38030 gene hflX 6444 8087 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144128.1 protein_id gnl|my_center|LOCUS_38030 >Feature sequence183 <1 1140 gene locus_tag LOCUS_38040 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613294.1:N-6 DNA methylase 1395 2558 gene locus_tag LOCUS_38050 1395 2558 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_38050 3036 4088 gene locus_tag LOCUS_38060 3036 4088 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143724.1 protein_id gnl|my_center|LOCUS_38060 4481 4744 gene locus_tag LOCUS_38070 4481 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 4745 5212 gene locus_tag LOCUS_38080 4745 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 5494 5655 gene locus_tag LOCUS_38090 5494 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 5857 6054 gene locus_tag LOCUS_38100 5857 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 6636 6292 gene locus_tag LOCUS_38110 6636 6292 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_38110 6926 6633 gene locus_tag LOCUS_38120 6926 6633 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022117.1 protein_id gnl|my_center|LOCUS_38120 7722 7492 gene locus_tag LOCUS_38130 7722 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence184 1210 2259 gene locus_tag LOCUS_38140 1210 2259 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_38140 2333 2261 gene locus_tag LOCUS_t00470 2333 2261 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2609 2400 gene locus_tag LOCUS_38150 2609 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 2665 2850 gene locus_tag LOCUS_38160 2665 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141741.1 protein_id gnl|my_center|LOCUS_38160 4132 2840 gene locus_tag LOCUS_38170 4132 2840 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_38170 4378 5199 gene locus_tag LOCUS_38180 4378 5199 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920645.1 protein_id gnl|my_center|LOCUS_38180 5392 6639 gene locus_tag LOCUS_38190 gene ftsZ 5392 6639 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_38190 6646 7446 gene locus_tag LOCUS_38200 gene thiD 6646 7446 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_38200 7456 7941 gene locus_tag LOCUS_38210 7456 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence185 2660 339 gene locus_tag LOCUS_38220 gene pcrA 2660 339 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058290.1 protein_id gnl|my_center|LOCUS_38220 2986 4236 gene locus_tag LOCUS_38230 gene metK 2986 4236 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056822.1 protein_id gnl|my_center|LOCUS_38230 5379 4597 gene locus_tag LOCUS_38240 5379 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 6596 5376 gene locus_tag LOCUS_38250 6596 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 6994 6602 gene locus_tag LOCUS_38260 6994 6602 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974795.1 protein_id gnl|my_center|LOCUS_38260 7634 7080 gene locus_tag LOCUS_38270 7634 7080 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928657.1 protein_id gnl|my_center|LOCUS_38270 7883 7662 gene locus_tag LOCUS_38280 7883 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 >Feature sequence186 408 1895 gene locus_tag LOCUS_38290 408 1895 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_38290 1899 2222 gene locus_tag LOCUS_38300 1899 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 2519 3736 gene locus_tag LOCUS_38310 2519 3736 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073935.1 protein_id gnl|my_center|LOCUS_38310 4327 7773 gene locus_tag LOCUS_38320 4327 7773 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_38320 >Feature sequence187 454 1212 gene locus_tag LOCUS_38330 454 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 1205 2068 gene locus_tag LOCUS_38340 1205 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 2071 2964 gene locus_tag LOCUS_38350 2071 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 2972 5482 gene locus_tag LOCUS_38360 2972 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 5571 7070 gene locus_tag LOCUS_38370 5571 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 7212 7910 gene locus_tag LOCUS_38380 7212 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence188 451 678 gene locus_tag LOCUS_38390 451 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 2617 1061 gene locus_tag LOCUS_38400 2617 1061 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_38400 2979 4232 gene locus_tag LOCUS_38410 2979 4232 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_38410 4429 4560 gene locus_tag LOCUS_38420 4429 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 6239 4644 gene locus_tag LOCUS_38430 6239 4644 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_38430 6431 7030 gene locus_tag LOCUS_38440 6431 7030 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_38440 7130 7597 gene locus_tag LOCUS_38450 7130 7597 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_38450 >Feature sequence189 1136 135 gene locus_tag LOCUS_38460 gene dusB 1136 135 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056835.1 protein_id gnl|my_center|LOCUS_38460 1336 2910 gene locus_tag LOCUS_38470 1336 2910 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_38470 3070 4284 gene locus_tag LOCUS_38480 3070 4284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_38480 5546 4290 gene locus_tag LOCUS_38490 gene hisD 5546 4290 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058085.1 protein_id gnl|my_center|LOCUS_38490 6033 7379 gene locus_tag LOCUS_38500 gene accC 6033 7379 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_38500 >Feature sequence190 <1 1781 gene locus_tag LOCUS_38510 <1 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000601707.1:CRISPR-associated helicase/endonuclease Cas3 1778 3274 gene locus_tag LOCUS_38520 1778 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 3311 4195 gene locus_tag LOCUS_38530 gene cas7i 3311 4195 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052104.1 protein_id gnl|my_center|LOCUS_38530 4195 4890 gene locus_tag LOCUS_38540 4195 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 5281 5811 gene locus_tag LOCUS_38550 5281 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 5741 6040 gene locus_tag LOCUS_38560 gene cas2 5741 6040 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683530.1 protein_id gnl|my_center|LOCUS_38560 6293 7328 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtactaacctttgatgccgtaaggcgttgatcac >Feature sequence191 187 1419 gene locus_tag LOCUS_38570 187 1419 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 protein_id gnl|my_center|LOCUS_38570 2094 1525 gene locus_tag LOCUS_38580 2094 1525 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_38580 2663 2100 gene locus_tag LOCUS_38590 2663 2100 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_38590 2946 3542 gene locus_tag LOCUS_38600 2946 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 3614 3865 gene locus_tag LOCUS_38610 3614 3865 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_38610 4149 5444 gene locus_tag LOCUS_38620 4149 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 5727 5646 gene locus_tag LOCUS_t00480 5727 5646 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence192 229 1275 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccctagtagggtttaagattaattggaac 1349 4429 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccctagtagggtttaagattaattggaac 4935 4663 gene locus_tag LOCUS_38630 gene cas2 4935 4663 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256456.1 protein_id gnl|my_center|LOCUS_38630 5952 4948 gene locus_tag LOCUS_38640 gene cas1 5952 4948 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_38640 6551 5958 gene locus_tag LOCUS_38650 gene cas4 6551 5958 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_38650 7078 6554 gene locus_tag LOCUS_38660 7078 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 >Feature sequence193 1407 601 gene locus_tag LOCUS_38670 1407 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 1664 3241 gene locus_tag LOCUS_38680 gene serA 1664 3241 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_38680 3508 4404 gene locus_tag LOCUS_38690 gene prmA 3508 4404 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056181.1 protein_id gnl|my_center|LOCUS_38690 4705 5151 gene locus_tag LOCUS_38700 4705 5151 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_38700 6755 5193 gene locus_tag LOCUS_38710 6755 5193 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_38710 7032 7175 gene locus_tag LOCUS_38720 7032 7175 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_38720 >Feature sequence194 130 477 gene locus_tag LOCUS_38730 130 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 609 827 gene locus_tag LOCUS_38740 609 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 898 1479 gene locus_tag LOCUS_38750 898 1479 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 protein_id gnl|my_center|LOCUS_38750 1719 2198 gene locus_tag LOCUS_38760 1719 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 3488 2421 gene locus_tag LOCUS_38770 3488 2421 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_38770 6375 3493 gene locus_tag LOCUS_38780 6375 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 7329 7174 gene locus_tag LOCUS_38790 7329 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 >Feature sequence195 500 3160 gene locus_tag LOCUS_38800 gene clpB 500 3160 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058284.1 protein_id gnl|my_center|LOCUS_38800 4564 3854 gene locus_tag LOCUS_38810 4564 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 4995 5207 gene locus_tag LOCUS_38820 4995 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 5355 5993 gene locus_tag LOCUS_38830 5355 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38830 >Feature sequence196 2650 743 gene locus_tag LOCUS_38840 gene mnmG 2650 743 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056385.1 protein_id gnl|my_center|LOCUS_38840 2883 4310 gene locus_tag LOCUS_38850 2883 4310 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057441.1 protein_id gnl|my_center|LOCUS_38850 4319 5332 gene locus_tag LOCUS_38860 gene cydB 4319 5332 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057440.1 protein_id gnl|my_center|LOCUS_38860 5957 5415 gene locus_tag LOCUS_38870 5957 5415 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_38870 6270 5932 gene locus_tag LOCUS_38880 6270 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 6467 7156 gene locus_tag LOCUS_38890 6467 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 >Feature sequence197 1074 157 gene locus_tag LOCUS_38900 1074 157 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_38900 2600 1506 gene locus_tag LOCUS_38910 2600 1506 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582736.1 protein_id gnl|my_center|LOCUS_38910 2827 2636 gene locus_tag LOCUS_38920 2827 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 3031 3570 gene locus_tag LOCUS_38930 3031 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38930 4568 4032 gene locus_tag LOCUS_38940 4568 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058286.1 protein_id gnl|my_center|LOCUS_38940 5157 4669 gene locus_tag LOCUS_38950 5157 4669 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064951.1 protein_id gnl|my_center|LOCUS_38950 5406 5236 gene locus_tag LOCUS_38960 5406 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 6540 6136 gene locus_tag LOCUS_38970 6540 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence198 168 1178 gene locus_tag LOCUS_38980 168 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 1376 1738 gene locus_tag LOCUS_38990 1376 1738 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_38990 2165 2440 gene locus_tag LOCUS_39000 2165 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39000 2418 3590 gene locus_tag LOCUS_39010 2418 3590 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056261.1 protein_id gnl|my_center|LOCUS_39010 4449 6920 gene locus_tag LOCUS_39020 4449 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 >Feature sequence199 2616 619 gene locus_tag LOCUS_39030 gene bchD 2616 619 CDS product magnesium chelatase ATPase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057253.1 protein_id gnl|my_center|LOCUS_39030 2924 4606 gene locus_tag LOCUS_39040 2924 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 6245 4962 gene locus_tag LOCUS_39050 6245 4962 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_39050 >Feature sequence200 524 135 gene locus_tag LOCUS_39060 524 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 1401 745 gene locus_tag LOCUS_39070 1401 745 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_39070 1936 1502 gene locus_tag LOCUS_39080 1936 1502 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124912.1 protein_id gnl|my_center|LOCUS_39080 3501 1990 gene locus_tag LOCUS_39090 3501 1990 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_39090 3976 3581 gene locus_tag LOCUS_39100 3976 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 5026 4271 gene locus_tag LOCUS_39110 5026 4271 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246180.1 protein_id gnl|my_center|LOCUS_39110 5225 6736 gene locus_tag LOCUS_39120 5225 6736 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963438.1 protein_id gnl|my_center|LOCUS_39120 >Feature sequence201 952 236 gene locus_tag LOCUS_39130 952 236 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142237.1 protein_id gnl|my_center|LOCUS_39130 1108 2721 gene locus_tag LOCUS_39140 gene metG 1108 2721 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056597.1 protein_id gnl|my_center|LOCUS_39140 2822 3427 gene locus_tag LOCUS_39150 2822 3427 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_39150 4865 3669 gene locus_tag LOCUS_39160 4865 3669 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057505.1 protein_id gnl|my_center|LOCUS_39160 6137 4965 gene locus_tag LOCUS_39170 6137 4965 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_39170 6465 6130 gene locus_tag LOCUS_39180 6465 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence202 183 1577 gene locus_tag LOCUS_39190 183 1577 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_39190 1886 2269 gene locus_tag LOCUS_39200 1886 2269 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056206.1 protein_id gnl|my_center|LOCUS_39200 3285 2422 gene locus_tag LOCUS_39210 3285 2422 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_39210 3556 4065 gene locus_tag LOCUS_39220 3556 4065 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125313.1 protein_id gnl|my_center|LOCUS_39220 4062 5189 gene locus_tag LOCUS_39230 4062 5189 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057098.1 protein_id gnl|my_center|LOCUS_39230 6381 5443 gene locus_tag LOCUS_39240 6381 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 >Feature sequence203 156 656 gene locus_tag LOCUS_39250 156 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 653 985 gene locus_tag LOCUS_39260 653 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 1329 1565 gene locus_tag LOCUS_39270 gene rpmB 1329 1565 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_39270 1710 1976 gene locus_tag LOCUS_39280 gene psaK 1710 1976 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_39280 2259 3395 gene locus_tag LOCUS_39290 2259 3395 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_39290 3698 3453 gene locus_tag LOCUS_39300 3698 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 4932 3757 gene locus_tag LOCUS_39310 4932 3757 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 protein_id gnl|my_center|LOCUS_39310 4991 6253 gene locus_tag LOCUS_39320 4991 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 >Feature sequence204 1109 297 gene locus_tag LOCUS_39330 gene hypB 1109 297 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_39330 1444 1100 gene locus_tag LOCUS_39340 gene hypA 1444 1100 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_39340 2660 1590 gene locus_tag LOCUS_39350 gene hypE 2660 1590 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 protein_id gnl|my_center|LOCUS_39350 3010 3927 gene locus_tag LOCUS_39360 3010 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 3995 6463 gene locus_tag LOCUS_39370 gene recG 3995 6463 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_39370 >Feature sequence205 149 400 gene locus_tag LOCUS_39380 149 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 3267 598 gene locus_tag LOCUS_39390 3267 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 3959 3279 gene locus_tag LOCUS_39400 3959 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 <6491 4057 gene locus_tag LOCUS_39410 <6491 4057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275305.1:glycosyltransferase >Feature sequence206 836 288 gene locus_tag LOCUS_39420 836 288 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_39420 1376 915 gene locus_tag LOCUS_39430 1376 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 1774 1379 gene locus_tag LOCUS_39440 1774 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 2499 1783 gene locus_tag LOCUS_39450 gene hoxU 2499 1783 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_39450 4213 2585 gene locus_tag LOCUS_39460 gene hcp 4213 2585 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545464.1 protein_id gnl|my_center|LOCUS_39460 5651 5265 gene locus_tag LOCUS_39470 5651 5265 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_39470 5974 5648 gene locus_tag LOCUS_39480 5974 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258616.1 protein_id gnl|my_center|LOCUS_39480 >Feature sequence207 712 2067 gene locus_tag LOCUS_39490 gene ftsY 712 2067 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056772.1 protein_id gnl|my_center|LOCUS_39490 2162 2962 gene locus_tag LOCUS_39500 2162 2962 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_39500 3002 3418 gene locus_tag LOCUS_39510 3002 3418 CDS product DUF3119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 protein_id gnl|my_center|LOCUS_39510 3663 4946 gene locus_tag LOCUS_39520 3663 4946 CDS product DUF3086 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056951.1 protein_id gnl|my_center|LOCUS_39520 6219 5134 gene locus_tag LOCUS_39530 6219 5134 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_39530 >Feature sequence208 <1 616 gene locus_tag LOCUS_39540 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975001.1:calcium-binding protein 1669 890 gene locus_tag LOCUS_39550 1669 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 3956 1821 gene locus_tag LOCUS_39560 3956 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 4200 4030 gene locus_tag LOCUS_39570 4200 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 5881 4256 gene locus_tag LOCUS_39580 5881 4256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 protein_id gnl|my_center|LOCUS_39580 >Feature sequence209 <1 562 gene locus_tag LOCUS_39590 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056522.1:Rpn family recombination-promoting nuclease/putative transposase 552 872 gene locus_tag LOCUS_39600 552 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 1070 989 gene locus_tag LOCUS_t00490 1070 989 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1805 1125 gene locus_tag LOCUS_39610 1805 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056940.1 protein_id gnl|my_center|LOCUS_39610 1929 2984 gene locus_tag LOCUS_39620 1929 2984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799101.1 protein_id gnl|my_center|LOCUS_39620 4043 3138 gene locus_tag LOCUS_39630 gene rimK 4043 3138 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_39630 4387 5400 gene locus_tag LOCUS_39640 gene rlmN 4387 5400 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_39640 5682 5906 gene locus_tag LOCUS_39650 5682 5906 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057795.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence210 364 110 gene locus_tag LOCUS_39660 364 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 841 497 gene locus_tag LOCUS_39670 841 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 2495 1470 gene locus_tag LOCUS_39680 2495 1470 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199695.1 protein_id gnl|my_center|LOCUS_39680 2973 3647 gene locus_tag LOCUS_39690 2973 3647 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948539.1 protein_id gnl|my_center|LOCUS_39690 3899 4828 gene locus_tag LOCUS_39700 3899 4828 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_39700 4869 5864 gene locus_tag LOCUS_39710 4869 5864 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227811.1 protein_id gnl|my_center|LOCUS_39710 >Feature sequence211 1426 320 gene locus_tag LOCUS_39720 gene gcvT 1426 320 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143519.1 protein_id gnl|my_center|LOCUS_39720 3690 2002 gene locus_tag LOCUS_39730 3690 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 4966 3854 gene locus_tag LOCUS_39740 gene queA 4966 3854 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056766.1 protein_id gnl|my_center|LOCUS_39740 5113 5502 gene locus_tag LOCUS_39750 5113 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_39750 5776 5624 gene locus_tag LOCUS_39760 5776 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39760 >Feature sequence212 394 2265 gene locus_tag LOCUS_39770 394 2265 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_39770 2813 2705 gene locus_tag LOCUS_r00010 2813 2705 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence213 386 1483 gene locus_tag LOCUS_39780 386 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 1781 2068 gene locus_tag LOCUS_39790 1781 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 2409 2750 gene locus_tag LOCUS_39800 2409 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 2810 4216 gene locus_tag LOCUS_39810 2810 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 4266 5138 gene locus_tag LOCUS_39820 4266 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 5521 5375 gene locus_tag LOCUS_39830 5521 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 >Feature sequence214 156 1538 gene locus_tag LOCUS_39840 gene psbC 156 1538 CDS product photosystem II reaction center protein CP43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124637.1 protein_id gnl|my_center|LOCUS_39840 2649 1570 gene locus_tag LOCUS_39850 gene cobD 2649 1570 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_39850 2989 2705 gene locus_tag LOCUS_39860 2989 2705 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921010.1 protein_id gnl|my_center|LOCUS_39860 3539 4024 gene locus_tag LOCUS_39870 3539 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 4102 4578 gene locus_tag LOCUS_39880 gene ureE 4102 4578 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057206.1 protein_id gnl|my_center|LOCUS_39880 5362 5036 gene locus_tag LOCUS_39890 5362 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 >Feature sequence215 854 207 gene locus_tag LOCUS_39900 854 207 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_39900 1530 3257 gene locus_tag LOCUS_39910 1530 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 3426 3211 gene locus_tag LOCUS_39920 3426 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 3762 4115 gene locus_tag LOCUS_39930 3762 4115 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_39930 4137 4472 gene locus_tag LOCUS_39940 4137 4472 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_39940 4607 4867 gene locus_tag LOCUS_39950 4607 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 4870 5169 gene locus_tag LOCUS_39960 4870 5169 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 protein_id gnl|my_center|LOCUS_39960 >Feature sequence216 149 397 gene locus_tag LOCUS_39970 149 397 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393809.1 protein_id gnl|my_center|LOCUS_39970 394 603 gene locus_tag LOCUS_39980 394 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 638 919 gene locus_tag LOCUS_39990 638 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 1341 1478 gene locus_tag LOCUS_40000 1341 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 2324 3607 gene locus_tag LOCUS_40010 2324 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 4183 3650 gene locus_tag LOCUS_40020 gene dps 4183 3650 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_40020 4669 4442 gene locus_tag LOCUS_40030 4669 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 4878 4672 gene locus_tag LOCUS_40040 4878 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 5322 4972 gene locus_tag LOCUS_40050 5322 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 >Feature sequence217 343 95 gene locus_tag LOCUS_40060 343 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 501 1322 gene locus_tag LOCUS_40070 gene sppA 501 1322 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_40070 1391 1792 gene locus_tag LOCUS_40080 gene aroH 1391 1792 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057640.1 protein_id gnl|my_center|LOCUS_40080 2702 1809 gene locus_tag LOCUS_40090 2702 1809 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_40090 2794 3609 gene locus_tag LOCUS_40100 2794 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 4827 3652 gene locus_tag LOCUS_40110 4827 3652 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142934.1 protein_id gnl|my_center|LOCUS_40110 5329 4844 gene locus_tag LOCUS_40120 5329 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 >Feature sequence218 1392 52 gene locus_tag LOCUS_40130 1392 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 1903 1574 gene locus_tag LOCUS_40140 1903 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 2961 2104 gene locus_tag LOCUS_40150 2961 2104 CDS product IS4-like element ISGvi3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140874.1 protein_id gnl|my_center|LOCUS_40150 3259 4221 gene locus_tag LOCUS_40160 3259 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40160 4291 4950 gene locus_tag LOCUS_40170 4291 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40170 >Feature sequence219 295 2331 gene locus_tag LOCUS_40180 295 2331 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_40180 2334 2555 gene locus_tag LOCUS_40190 2334 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 2576 2821 gene locus_tag LOCUS_40200 2576 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 2913 3152 gene locus_tag LOCUS_40210 2913 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 3149 3556 gene locus_tag LOCUS_40220 3149 3556 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_40220 3578 4894 gene locus_tag LOCUS_40230 3578 4894 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554539.1 protein_id gnl|my_center|LOCUS_40230 >Feature sequence220 357 977 gene locus_tag LOCUS_40240 357 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 1199 1029 gene locus_tag LOCUS_40250 1199 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_40250 2016 1288 gene locus_tag LOCUS_40260 2016 1288 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920695.1 protein_id gnl|my_center|LOCUS_40260 3400 2420 gene locus_tag LOCUS_40270 gene chlG 3400 2420 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920891.1 protein_id gnl|my_center|LOCUS_40270 4483 3407 gene locus_tag LOCUS_40280 4483 3407 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_40280 4730 4506 gene locus_tag LOCUS_40290 4730 4506 CDS product DUF2862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_40290 5180 4848 gene locus_tag LOCUS_40300 5180 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 >Feature sequence221 2864 165 gene locus_tag LOCUS_40310 2864 165 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_40310 3871 3530 gene locus_tag LOCUS_40320 3871 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 4278 4012 gene locus_tag LOCUS_40330 4278 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 4641 4387 gene locus_tag LOCUS_40340 4641 4387 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_40340 4835 4638 gene locus_tag LOCUS_40350 4835 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 >Feature sequence222 1451 282 gene locus_tag LOCUS_40360 1451 282 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_40360 2488 1820 gene locus_tag LOCUS_40370 2488 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 2697 4820 gene locus_tag LOCUS_40380 2697 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 5096 4977 gene locus_tag LOCUS_40390 5096 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 >Feature sequence223 647 2005 gene locus_tag LOCUS_40400 gene trxB 647 2005 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057761.1 protein_id gnl|my_center|LOCUS_40400 2192 3022 gene locus_tag LOCUS_40410 2192 3022 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_40410 3850 3269 gene locus_tag LOCUS_40420 3850 3269 CDS product DUF3727 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_40420 4710 3898 gene locus_tag LOCUS_40430 gene surE 4710 3898 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_40430 4767 4841 gene locus_tag LOCUS_t00500 4767 4841 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence224 93 1577 gene locus_tag LOCUS_r00020 93 1577 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1711 1786 gene locus_tag LOCUS_t00510 1711 1786 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1938 4813 gene locus_tag LOCUS_r00030 1938 4813 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence225 257 1576 gene locus_tag LOCUS_40440 257 1576 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 protein_id gnl|my_center|LOCUS_40440 1667 2413 gene locus_tag LOCUS_40450 1667 2413 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920713.1 protein_id gnl|my_center|LOCUS_40450 2622 2410 gene locus_tag LOCUS_40460 2622 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 protein_id gnl|my_center|LOCUS_40460 2694 4355 gene locus_tag LOCUS_40470 2694 4355 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_40470 4817 4350 gene locus_tag LOCUS_40480 4817 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 >Feature sequence226 587 1870 gene locus_tag LOCUS_40490 587 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 2042 2419 gene locus_tag LOCUS_40500 2042 2419 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_40500 2468 3019 gene locus_tag LOCUS_40510 gene cobU 2468 3019 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_40510 3025 3819 gene locus_tag LOCUS_40520 3025 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 3829 4419 gene locus_tag LOCUS_40530 gene leuD 3829 4419 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_40530 4521 4697 gene locus_tag LOCUS_40540 4521 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 >Feature sequence227 328 1032 gene locus_tag LOCUS_40550 328 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 1175 2158 gene locus_tag LOCUS_40560 1175 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 2195 3292 gene locus_tag LOCUS_40570 2195 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 3314 4192 gene locus_tag LOCUS_40580 3314 4192 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_40580 >Feature sequence228 579 1562 gene locus_tag LOCUS_40590 579 1562 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_40590 1589 2995 gene locus_tag LOCUS_40600 gene secD 1589 2995 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056058.1 protein_id gnl|my_center|LOCUS_40600 3151 4083 gene locus_tag LOCUS_40610 gene secF 3151 4083 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056057.1 protein_id gnl|my_center|LOCUS_40610 4403 4080 gene locus_tag LOCUS_40620 4403 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 4744 4400 gene locus_tag LOCUS_40630 4744 4400 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_40630 >Feature sequence229 134 382 gene locus_tag LOCUS_40640 134 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 460 903 gene locus_tag LOCUS_40650 460 903 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_40650 1675 989 gene locus_tag LOCUS_40660 1675 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 1929 2606 gene locus_tag LOCUS_40670 1929 2606 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143627.1 protein_id gnl|my_center|LOCUS_40670 3002 2613 gene locus_tag LOCUS_40680 3002 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 2995 3930 gene locus_tag LOCUS_40690 2995 3930 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_40690 4619 3927 gene locus_tag LOCUS_40700 gene tpiA 4619 3927 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798681.1 protein_id gnl|my_center|LOCUS_40700 >Feature sequence230 268 104 gene locus_tag LOCUS_40710 268 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 720 1403 gene locus_tag LOCUS_40720 720 1403 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920655.1 protein_id gnl|my_center|LOCUS_40720 1619 3517 gene locus_tag LOCUS_40730 1619 3517 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_40730 3849 3920 gene locus_tag LOCUS_t00520 3849 3920 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence231 412 813 gene locus_tag LOCUS_40740 412 813 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_40740 2611 1094 gene locus_tag LOCUS_40750 gene cobA 2611 1094 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920993.1 protein_id gnl|my_center|LOCUS_40750 3582 2665 gene locus_tag LOCUS_40760 3582 2665 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_40760 4215 3625 gene locus_tag LOCUS_40770 gene cbiT 4215 3625 CDS product precorrin-6Y C5,15-methyltransferase subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_40770 >Feature sequence232 3458 231 gene locus_tag LOCUS_40780 3458 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 4591 3560 gene locus_tag LOCUS_40790 4591 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 >Feature sequence233 300 524 gene locus_tag LOCUS_40800 300 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 1132 713 gene locus_tag LOCUS_40810 gene vapC 1132 713 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331362.1 protein_id gnl|my_center|LOCUS_40810 1344 1129 gene locus_tag LOCUS_40820 1344 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 2779 2153 gene locus_tag LOCUS_40830 2779 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 4160 3432 gene locus_tag LOCUS_40840 4160 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 >Feature sequence234 1365 160 gene locus_tag LOCUS_40850 1365 160 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056559.1 protein_id gnl|my_center|LOCUS_40850 3525 1636 gene locus_tag LOCUS_40860 3525 1636 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_40860 4138 4004 gene locus_tag LOCUS_40870 4138 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 >Feature sequence235 300 629 gene locus_tag LOCUS_40880 300 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence236 1326 388 gene locus_tag LOCUS_40890 1326 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 1971 1342 gene locus_tag LOCUS_40900 1971 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529035.1 protein_id gnl|my_center|LOCUS_40900 3150 2014 gene locus_tag LOCUS_40910 3150 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 3925 3155 gene locus_tag LOCUS_40920 3925 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 3979 4470 gene locus_tag LOCUS_40930 3979 4470 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_40930 >Feature sequence237 1066 236 gene locus_tag LOCUS_40940 1066 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 3471 1303 gene locus_tag LOCUS_40950 3471 1303 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920783.1 protein_id gnl|my_center|LOCUS_40950 3724 4278 gene locus_tag LOCUS_40960 gene cysC 3724 4278 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_40960 >Feature sequence238 63 644 gene locus_tag LOCUS_40970 63 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 722 1792 gene locus_tag LOCUS_40980 722 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 2899 2567 gene locus_tag LOCUS_40990 2899 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 3206 2889 gene locus_tag LOCUS_41000 3206 2889 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_41000 3637 3840 gene locus_tag LOCUS_41010 3637 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 3815 4138 gene locus_tag LOCUS_41020 3815 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 4334 4179 gene locus_tag LOCUS_41030 4334 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 >Feature sequence239 <1 655 gene locus_tag LOCUS_41040 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056481.1:GDP-mannose 4,6-dehydratase 668 1606 gene locus_tag LOCUS_41050 668 1606 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_41050 2337 1660 gene locus_tag LOCUS_41060 2337 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 3095 4279 gene locus_tag LOCUS_41070 3095 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 >Feature sequence240 >Feature sequence241 >Feature sequence242 2436 1810 gene locus_tag LOCUS_41080 2436 1810 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929250.1 protein_id gnl|my_center|LOCUS_41080 2725 3201 gene locus_tag LOCUS_41090 2725 3201 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797565.1 protein_id gnl|my_center|LOCUS_41090 3164 3925 gene locus_tag LOCUS_41100 3164 3925 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797618.1 protein_id gnl|my_center|LOCUS_41100 >Feature sequence243 528 289 gene locus_tag LOCUS_41110 528 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 821 519 gene locus_tag LOCUS_41120 821 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 2779 878 gene locus_tag LOCUS_41130 gene glmS 2779 878 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921151.1 protein_id gnl|my_center|LOCUS_41130 3975 3409 gene locus_tag LOCUS_41140 3975 3409 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_41140 >Feature sequence244 914 195 gene locus_tag LOCUS_41150 914 195 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_41150 1425 2165 gene locus_tag LOCUS_41160 1425 2165 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058255.1 protein_id gnl|my_center|LOCUS_41160 4025 2541 gene locus_tag LOCUS_41170 4025 2541 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_41170 >Feature sequence245 169 2080 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaattaatcttaaaccctactagggattgaaac 2218 4258 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaattaatcttaaaccctattagggattgaaac >Feature sequence246 697 2355 gene locus_tag LOCUS_41180 697 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 2352 3317 gene locus_tag LOCUS_41190 2352 3317 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_41190 3727 3362 gene locus_tag LOCUS_41200 3727 3362 CDS product DUF1815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987665.1 protein_id gnl|my_center|LOCUS_41200 >Feature sequence247 500 1669 gene locus_tag LOCUS_41210 500 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 1694 2797 gene locus_tag LOCUS_41220 1694 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 3190 3417 gene locus_tag LOCUS_41230 3190 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 3976 3773 gene locus_tag LOCUS_41240 3976 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 >Feature sequence248 2740 737 gene locus_tag LOCUS_41250 2740 737 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_41250 <4090 2804 gene locus_tag LOCUS_41260 <4090 2804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147443659.1:non-ribosomal peptide synthetase >Feature sequence249 875 387 gene locus_tag LOCUS_41270 875 387 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920902.1 protein_id gnl|my_center|LOCUS_41270 1416 904 gene locus_tag LOCUS_41280 gene ybeY 1416 904 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928724.1 protein_id gnl|my_center|LOCUS_41280 1730 1428 gene locus_tag LOCUS_41290 1730 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 1923 3374 gene locus_tag LOCUS_41300 1923 3374 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_41300 >Feature sequence250 450 677 gene locus_tag LOCUS_41310 450 677 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258326.1 protein_id gnl|my_center|LOCUS_41310 680 799 gene locus_tag LOCUS_41320 680 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 1776 1051 gene locus_tag LOCUS_41330 1776 1051 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125174.1 protein_id gnl|my_center|LOCUS_41330 2002 2895 gene locus_tag LOCUS_41340 2002 2895 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986764.1 protein_id gnl|my_center|LOCUS_41340 3015 3323 gene locus_tag LOCUS_41350 3015 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 3346 3831 gene locus_tag LOCUS_41360 3346 3831 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_41360 >Feature sequence251 950 2869 gene locus_tag LOCUS_41370 950 2869 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_41370 2931 3380 gene locus_tag LOCUS_41380 2931 3380 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 protein_id gnl|my_center|LOCUS_41380 >Feature sequence252 <1 825 gene locus_tag LOCUS_41390 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142039.1:DUF4351 domain-containing protein >Feature sequence253 2239 134 gene locus_tag LOCUS_41400 gene recQ 2239 134 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_41400 2959 2348 gene locus_tag LOCUS_41410 2959 2348 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_41410 >Feature sequence254 1204 419 gene locus_tag LOCUS_41420 1204 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 1625 1323 gene locus_tag LOCUS_41430 1625 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 2500 1856 gene locus_tag LOCUS_41440 gene pdxH 2500 1856 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 protein_id gnl|my_center|LOCUS_41440 2552 3322 gene locus_tag LOCUS_41450 2552 3322 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920913.1 protein_id gnl|my_center|LOCUS_41450 >Feature sequence255 171 1901 gene locus_tag LOCUS_41460 171 1901 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_41460 2309 3619 gene locus_tag LOCUS_41470 2309 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 >Feature sequence256 753 1523 gene locus_tag LOCUS_41480 753 1523 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142610.1 protein_id gnl|my_center|LOCUS_41480 1769 1560 gene locus_tag LOCUS_41490 1769 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 2544 1879 gene locus_tag LOCUS_41500 2544 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 2910 3218 gene locus_tag LOCUS_41510 2910 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 >Feature sequence257 115 846 gene locus_tag LOCUS_41520 115 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 1448 1062 gene locus_tag LOCUS_41530 1448 1062 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_41530 1672 1445 gene locus_tag LOCUS_41540 1672 1445 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_41540 1900 2139 gene locus_tag LOCUS_41550 1900 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 2129 2551 gene locus_tag LOCUS_41560 2129 2551 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_41560 2630 2869 gene locus_tag LOCUS_41570 2630 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 2869 3297 gene locus_tag LOCUS_41580 2869 3297 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_41580 3366 3509 gene locus_tag LOCUS_41590 3366 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 >Feature sequence258 848 549 gene locus_tag LOCUS_41600 848 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 1364 1113 gene locus_tag LOCUS_41610 1364 1113 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_41610 1602 1357 gene locus_tag LOCUS_41620 1602 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 1943 2659 gene locus_tag LOCUS_41630 1943 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 2825 3079 gene locus_tag LOCUS_41640 2825 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 3080 3430 gene locus_tag LOCUS_41650 3080 3430 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_41650 >Feature sequence259 762 106 gene locus_tag LOCUS_41660 762 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 1166 1387 gene locus_tag LOCUS_41670 1166 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 1510 1737 gene locus_tag LOCUS_41680 1510 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 1740 2174 gene locus_tag LOCUS_41690 1740 2174 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_41690 2385 2756 gene locus_tag LOCUS_41700 2385 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 2756 3190 gene locus_tag LOCUS_41710 2756 3190 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_41710 >Feature sequence260 473 1477 gene locus_tag LOCUS_41720 473 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 2312 1659 gene locus_tag LOCUS_41730 2312 1659 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889576.1 protein_id gnl|my_center|LOCUS_41730 3253 2327 gene locus_tag LOCUS_41740 3253 2327 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_41740 >Feature sequence261 478 269 gene locus_tag LOCUS_41750 478 269 CDS product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921159.1 protein_id gnl|my_center|LOCUS_41750 2169 490 gene locus_tag LOCUS_41760 2169 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 2746 2171 gene locus_tag LOCUS_41770 2746 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 2983 3177 gene locus_tag LOCUS_41780 2983 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 >Feature sequence262 960 884 gene locus_tag LOCUS_t00530 960 884 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1040 965 gene locus_tag LOCUS_t00540 1040 965 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2783 1254 gene locus_tag LOCUS_r00040 2783 1254 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3150 3074 gene locus_tag LOCUS_t00550 3150 3074 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence263 500 39 gene locus_tag LOCUS_41790 500 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 <3387 677 gene locus_tag LOCUS_41800 <3387 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:CHAT domain-containing protein >Feature sequence264 <1 769 gene locus_tag LOCUS_41810 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267825.1:syringopeptin non-ribosomal peptide synthetase SypC note possible pseudo, internal stop codon, frameshifted >Feature sequence265 9 90 gene locus_tag LOCUS_t00560 9 90 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 247 720 gene locus_tag LOCUS_41820 247 720 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_41820 1369 887 gene locus_tag LOCUS_41830 1369 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 2887 1382 gene locus_tag LOCUS_41840 2887 1382 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_41840 >Feature sequence266 1148 165 gene locus_tag LOCUS_41850 gene holA 1148 165 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920898.1 protein_id gnl|my_center|LOCUS_41850 1668 2507 gene locus_tag LOCUS_41860 1668 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 2866 3000 gene locus_tag LOCUS_41870 2866 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 >Feature sequence267 271 2682 gene locus_tag LOCUS_41880 271 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 2719 2892 gene locus_tag LOCUS_41890 2719 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 >Feature sequence268 223 2703 gene locus_tag LOCUS_41900 223 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 >Feature sequence269 931 101 gene locus_tag LOCUS_41910 931 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 2607 1243 gene locus_tag LOCUS_41920 2607 1243 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_41920 >Feature sequence270 74 460 gene locus_tag LOCUS_41930 74 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 975 457 gene locus_tag LOCUS_41940 975 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 1689 1348 gene locus_tag LOCUS_41950 1689 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 2094 1798 gene locus_tag LOCUS_41960 2094 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 >Feature sequence271 287 415 gene locus_tag LOCUS_41970 287 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 >Feature sequence272 1787 366 gene locus_tag LOCUS_41980 gene glnA 1787 366 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057427.1 protein_id gnl|my_center|LOCUS_41980 >Feature sequence273 2163 967 gene locus_tag LOCUS_41990 2163 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 2668 2285 gene locus_tag LOCUS_42000 2668 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 >Feature sequence274 1046 315 gene locus_tag LOCUS_42010 1046 315 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_42010 1418 2368 gene locus_tag LOCUS_42020 1418 2368 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143271.1 protein_id gnl|my_center|LOCUS_42020 >Feature sequence275 364 1362 gene locus_tag LOCUS_42030 364 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480572.1 protein_id gnl|my_center|LOCUS_42030 1795 1992 gene locus_tag LOCUS_42040 1795 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 1989 2375 gene locus_tag LOCUS_42050 1989 2375 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_42050 2692 2573 gene locus_tag LOCUS_42060 2692 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 >Feature sequence276 1183 1317 gene locus_tag LOCUS_42070 1183 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 2023 2271 gene locus_tag LOCUS_42080 2023 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 2264 2578 gene locus_tag LOCUS_42090 2264 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 >Feature sequence277 62 997 gene locus_tag LOCUS_42100 62 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 1516 1091 gene locus_tag LOCUS_42110 1516 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 1752 1495 gene locus_tag LOCUS_42120 1752 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 2013 2501 gene locus_tag LOCUS_42130 2013 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 >Feature sequence278 689 1543 gene locus_tag LOCUS_42140 689 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_42140 1632 2051 gene locus_tag LOCUS_42150 1632 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 2035 2394 gene locus_tag LOCUS_42160 2035 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 >Feature sequence279 536 3 gene locus_tag LOCUS_42170 536 3 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_42170 >Feature sequence280 162 1757 gene locus_tag LOCUS_42180 162 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 1862 2311 gene locus_tag LOCUS_42190 1862 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 >Feature sequence281 37 327 gene locus_tag LOCUS_42200 37 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 463 299 gene locus_tag LOCUS_42210 463 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 852 1799 gene locus_tag LOCUS_42220 gene queG 852 1799 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_42220 1789 2427 gene locus_tag LOCUS_42230 1789 2427 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_42230 >Feature sequence282 611 1351 gene locus_tag LOCUS_42240 611 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 1816 1397 gene locus_tag LOCUS_42250 gene fitB 1816 1397 CDS product type II toxin-antitoxin system toxin FitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691083.1 protein_id gnl|my_center|LOCUS_42250 2247 1810 gene locus_tag LOCUS_42260 2247 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260