>Feature sequence001 6829 53 gene locus_tag LOCUS_00010 6829 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 14506 6830 gene locus_tag LOCUS_00020 14506 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 18897 14503 gene locus_tag LOCUS_00030 18897 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 25549 18905 gene locus_tag LOCUS_00040 25549 18905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 30134 25557 gene locus_tag LOCUS_00050 30134 25557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 30860 30135 gene locus_tag LOCUS_00060 30860 30135 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 protein_id gnl|my_center|LOCUS_00060 31558 32811 gene locus_tag LOCUS_00070 31558 32811 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122960.1 protein_id gnl|my_center|LOCUS_00070 34118 32904 gene locus_tag LOCUS_00080 34118 32904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 35128 36069 gene locus_tag LOCUS_00090 35128 36069 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_00090 37101 36070 gene locus_tag LOCUS_00100 37101 36070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 38345 37212 gene locus_tag LOCUS_00110 38345 37212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 39877 38423 gene locus_tag LOCUS_00120 39877 38423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 40727 39861 gene locus_tag LOCUS_00130 40727 39861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 42314 40728 gene locus_tag LOCUS_00140 42314 40728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 43025 42327 gene locus_tag LOCUS_00150 43025 42327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 43351 44511 gene locus_tag LOCUS_00160 43351 44511 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_00160 44939 44613 gene locus_tag LOCUS_00170 44939 44613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 45486 45638 gene locus_tag LOCUS_00180 45486 45638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 45657 46760 gene locus_tag LOCUS_00190 45657 46760 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_00190 46757 49069 gene locus_tag LOCUS_00200 46757 49069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 49066 50418 gene locus_tag LOCUS_00210 49066 50418 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_00210 50832 51071 gene locus_tag LOCUS_00220 50832 51071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 >Feature sequence002 489 1688 gene locus_tag LOCUS_00230 489 1688 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_00230 2936 1761 gene locus_tag LOCUS_00240 2936 1761 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089076.1 protein_id gnl|my_center|LOCUS_00240 3368 2940 gene locus_tag LOCUS_00250 3368 2940 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064825.1 protein_id gnl|my_center|LOCUS_00250 4508 3399 gene locus_tag LOCUS_00260 4508 3399 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 protein_id gnl|my_center|LOCUS_00260 4969 4547 gene locus_tag LOCUS_00270 4969 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 5911 5066 gene locus_tag LOCUS_00280 5911 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 6088 6486 gene locus_tag LOCUS_00290 6088 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 6536 7552 gene locus_tag LOCUS_00300 6536 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 7585 9381 gene locus_tag LOCUS_00310 7585 9381 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089025.1 protein_id gnl|my_center|LOCUS_00310 9864 9397 gene locus_tag LOCUS_00320 9864 9397 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_00320 10055 10474 gene locus_tag LOCUS_00330 10055 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 10511 11629 gene locus_tag LOCUS_00340 gene ribBA 10511 11629 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 protein_id gnl|my_center|LOCUS_00340 11746 12861 gene locus_tag LOCUS_00350 11746 12861 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_00350 12867 13727 gene locus_tag LOCUS_00360 12867 13727 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_00360 14079 13729 gene locus_tag LOCUS_00370 14079 13729 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_00370 15946 14105 gene locus_tag LOCUS_00380 gene sppA 15946 14105 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707123.1 protein_id gnl|my_center|LOCUS_00380 16319 15963 gene locus_tag LOCUS_00390 16319 15963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 16681 16328 gene locus_tag LOCUS_00400 gene arsC 16681 16328 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 protein_id gnl|my_center|LOCUS_00400 16824 18050 gene locus_tag LOCUS_00410 16824 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 18034 18501 gene locus_tag LOCUS_00420 18034 18501 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102387.1 protein_id gnl|my_center|LOCUS_00420 18504 18767 gene locus_tag LOCUS_00430 18504 18767 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300975.1 protein_id gnl|my_center|LOCUS_00430 19190 18795 gene locus_tag LOCUS_00440 19190 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 19883 19227 gene locus_tag LOCUS_00450 19883 19227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 20858 19902 gene locus_tag LOCUS_00460 gene meaB 20858 19902 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_00460 21274 20855 gene locus_tag LOCUS_00470 21274 20855 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_00470 23004 21277 gene locus_tag LOCUS_00480 23004 21277 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_00480 23808 23035 gene locus_tag LOCUS_00490 23808 23035 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326803.1 protein_id gnl|my_center|LOCUS_00490 24027 25166 gene locus_tag LOCUS_00500 24027 25166 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929834.1 protein_id gnl|my_center|LOCUS_00500 26654 25557 gene locus_tag LOCUS_00510 26654 25557 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398410.1 protein_id gnl|my_center|LOCUS_00510 28370 26661 gene locus_tag LOCUS_00520 28370 26661 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_00520 30394 28415 gene locus_tag LOCUS_00530 30394 28415 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_00530 31399 30416 gene locus_tag LOCUS_00540 31399 30416 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_00540 32455 31424 gene locus_tag LOCUS_00550 32455 31424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 32553 33299 gene locus_tag LOCUS_00560 32553 33299 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_00560 >Feature sequence003 512 48 gene locus_tag LOCUS_00570 512 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 664 1860 gene locus_tag LOCUS_00580 664 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112117.1 protein_id gnl|my_center|LOCUS_00580 2698 1886 gene locus_tag LOCUS_00590 gene hisN 2698 1886 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606663.1 protein_id gnl|my_center|LOCUS_00590 4280 2724 gene locus_tag LOCUS_00600 4280 2724 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105036.1 protein_id gnl|my_center|LOCUS_00600 4952 4386 gene locus_tag LOCUS_00610 4952 4386 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_00610 6529 4994 gene locus_tag LOCUS_00620 6529 4994 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_00620 6996 6625 gene locus_tag LOCUS_00630 6996 6625 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689264.1 protein_id gnl|my_center|LOCUS_00630 7628 7023 gene locus_tag LOCUS_00640 7628 7023 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037433.1 protein_id gnl|my_center|LOCUS_00640 7738 8592 gene locus_tag LOCUS_00650 7738 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 8589 10001 gene locus_tag LOCUS_00660 gene sthA 8589 10001 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135175071.1 protein_id gnl|my_center|LOCUS_00660 11118 10042 gene locus_tag LOCUS_00670 11118 10042 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398801.1 protein_id gnl|my_center|LOCUS_00670 12329 11124 gene locus_tag LOCUS_00680 12329 11124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_00680 12459 13118 gene locus_tag LOCUS_00690 12459 13118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 13551 13126 gene locus_tag LOCUS_00700 13551 13126 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660557.1 protein_id gnl|my_center|LOCUS_00700 13958 13602 gene locus_tag LOCUS_00710 13958 13602 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730423.1 protein_id gnl|my_center|LOCUS_00710 15350 14049 gene locus_tag LOCUS_00720 15350 14049 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_00720 16339 15368 gene locus_tag LOCUS_00730 gene cmoB 16339 15368 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114185.1 protein_id gnl|my_center|LOCUS_00730 17088 16336 gene locus_tag LOCUS_00740 gene cmoA 17088 16336 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096076.1 protein_id gnl|my_center|LOCUS_00740 17172 18551 gene locus_tag LOCUS_00750 17172 18551 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_00750 19412 18558 gene locus_tag LOCUS_00760 19412 18558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 20270 19497 gene locus_tag LOCUS_00770 20270 19497 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_00770 20851 20267 gene locus_tag LOCUS_00780 gene ppiA 20851 20267 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369397.1 protein_id gnl|my_center|LOCUS_00780 21553 20894 gene locus_tag LOCUS_00790 21553 20894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 21941 21639 gene locus_tag LOCUS_00800 21941 21639 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_00800 22559 21963 gene locus_tag LOCUS_00810 22559 21963 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_00810 22680 23510 gene locus_tag LOCUS_00820 gene rnm 22680 23510 CDS product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096361.1 protein_id gnl|my_center|LOCUS_00820 23571 24164 gene locus_tag LOCUS_00830 23571 24164 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_00830 24538 24197 gene locus_tag LOCUS_00840 24538 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 24606 25118 gene locus_tag LOCUS_00850 24606 25118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00850 25096 25755 gene locus_tag LOCUS_00860 25096 25755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 25748 26608 gene locus_tag LOCUS_00870 25748 26608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 27503 26610 gene locus_tag LOCUS_00880 27503 26610 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_00880 28468 27713 gene locus_tag LOCUS_00890 28468 27713 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 protein_id gnl|my_center|LOCUS_00890 29178 28465 gene locus_tag LOCUS_00900 gene mupP 29178 28465 CDS product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268565.1 protein_id gnl|my_center|LOCUS_00900 29891 29175 gene locus_tag LOCUS_00910 29891 29175 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_00910 <31291 29931 gene locus_tag LOCUS_00920 <31291 29931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113433.1:TRZ/ATZ family hydrolase >Feature sequence004 <1 2086 gene locus_tag LOCUS_00930 <1 2086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112602.1:alanine--tRNA ligase 2199 2384 gene locus_tag LOCUS_00940 2199 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 2427 2517 gene locus_tag LOCUS_t00010 2427 2517 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3920 2655 gene locus_tag LOCUS_00950 3920 2655 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032665702.1 protein_id gnl|my_center|LOCUS_00950 4347 3910 gene locus_tag LOCUS_00960 4347 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4690 4331 gene locus_tag LOCUS_00970 4690 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 5033 4701 gene locus_tag LOCUS_00980 5033 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 7276 5420 gene locus_tag LOCUS_00990 7276 5420 CDS product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948071.1 protein_id gnl|my_center|LOCUS_00990 8220 7273 gene locus_tag LOCUS_01000 8220 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 8539 8300 gene locus_tag LOCUS_01010 8539 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 8796 8536 gene locus_tag LOCUS_01020 8796 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 9367 9038 gene locus_tag LOCUS_01030 9367 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 9867 9364 gene locus_tag LOCUS_01040 9867 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 10127 9864 gene locus_tag LOCUS_01050 10127 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 10427 10741 gene locus_tag LOCUS_01060 10427 10741 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_01060 10745 11077 gene locus_tag LOCUS_01070 10745 11077 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202809.1 protein_id gnl|my_center|LOCUS_01070 11835 11179 gene locus_tag LOCUS_01080 11835 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 12533 11832 gene locus_tag LOCUS_01090 12533 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 13091 12633 gene locus_tag LOCUS_01100 13091 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 14491 13199 gene locus_tag LOCUS_01110 14491 13199 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_01110 17428 14960 gene locus_tag LOCUS_01120 17428 14960 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085486134.1 protein_id gnl|my_center|LOCUS_01120 17754 19802 gene locus_tag LOCUS_01130 17754 19802 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528125.1 protein_id gnl|my_center|LOCUS_01130 20171 20572 gene locus_tag LOCUS_01140 20171 20572 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210369.1 protein_id gnl|my_center|LOCUS_01140 20603 21628 gene locus_tag LOCUS_01150 20603 21628 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_01150 22280 21615 gene locus_tag LOCUS_01160 22280 21615 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_01160 22464 23231 gene locus_tag LOCUS_01170 22464 23231 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_01170 24627 23221 gene locus_tag LOCUS_01180 24627 23221 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_01180 25819 24659 gene locus_tag LOCUS_01190 25819 24659 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_01190 <27954 25860 gene locus_tag LOCUS_01200 <27954 25860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000966626.1:TonB-dependent receptor >Feature sequence005 526 2157 gene locus_tag LOCUS_01210 526 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 2216 2539 gene locus_tag LOCUS_01220 2216 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4495 2546 gene locus_tag LOCUS_01230 4495 2546 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_01230 5199 4531 gene locus_tag LOCUS_01240 5199 4531 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809046.1 protein_id gnl|my_center|LOCUS_01240 5409 6938 gene locus_tag LOCUS_01250 5409 6938 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 protein_id gnl|my_center|LOCUS_01250 7966 6986 gene locus_tag LOCUS_01260 7966 6986 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_01260 8086 9225 gene locus_tag LOCUS_01270 8086 9225 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704066.1 protein_id gnl|my_center|LOCUS_01270 9218 9913 gene locus_tag LOCUS_01280 9218 9913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140495.1 protein_id gnl|my_center|LOCUS_01280 9900 11108 gene locus_tag LOCUS_01290 9900 11108 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_01290 11112 12308 gene locus_tag LOCUS_01300 11112 12308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_01300 13418 12381 gene locus_tag LOCUS_01310 13418 12381 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975052.1 protein_id gnl|my_center|LOCUS_01310 14527 13415 gene locus_tag LOCUS_01320 14527 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 16404 14524 gene locus_tag LOCUS_01330 16404 14524 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_01330 17147 16410 gene locus_tag LOCUS_01340 17147 16410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_01340 18085 17144 gene locus_tag LOCUS_01350 18085 17144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_01350 19070 18195 gene locus_tag LOCUS_01360 19070 18195 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727553.1 protein_id gnl|my_center|LOCUS_01360 19287 20543 gene locus_tag LOCUS_01370 19287 20543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 20634 21764 gene locus_tag LOCUS_01380 20634 21764 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044382.1 protein_id gnl|my_center|LOCUS_01380 21778 24834 gene locus_tag LOCUS_01390 gene vexK 21778 24834 CDS product efflux RND transporter permease subunit VexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625968.1 protein_id gnl|my_center|LOCUS_01390 24838 25824 gene locus_tag LOCUS_01400 24838 25824 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_01400 26869 25838 gene locus_tag LOCUS_01410 26869 25838 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328363.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence006 380 1879 gene locus_tag LOCUS_01420 380 1879 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_01420 3015 1924 gene locus_tag LOCUS_01430 3015 1924 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_01430 3283 3065 gene locus_tag LOCUS_01440 3283 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3855 3391 gene locus_tag LOCUS_01450 gene bfrB 3855 3391 CDS product bacterioferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092078.1 protein_id gnl|my_center|LOCUS_01450 4343 3924 gene locus_tag LOCUS_01460 4343 3924 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_01460 5271 4426 gene locus_tag LOCUS_01470 5271 4426 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_01470 5391 5921 gene locus_tag LOCUS_01480 gene nrdR 5391 5921 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_01480 5918 7051 gene locus_tag LOCUS_01490 gene ribD 5918 7051 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103235.1 protein_id gnl|my_center|LOCUS_01490 7094 7756 gene locus_tag LOCUS_01500 7094 7756 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_01500 7753 8862 gene locus_tag LOCUS_01510 gene ribBA 7753 8862 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 protein_id gnl|my_center|LOCUS_01510 8948 9418 gene locus_tag LOCUS_01520 gene ribE 8948 9418 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_01520 9441 9905 gene locus_tag LOCUS_01530 gene nusB 9441 9905 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_01530 9917 10870 gene locus_tag LOCUS_01540 gene thiL 9917 10870 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752139.1 protein_id gnl|my_center|LOCUS_01540 10876 11541 gene locus_tag LOCUS_01550 10876 11541 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_01550 11644 12246 gene locus_tag LOCUS_01560 gene ribA 11644 12246 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412070.1 protein_id gnl|my_center|LOCUS_01560 14180 12261 gene locus_tag LOCUS_01570 gene dxs 14180 12261 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 protein_id gnl|my_center|LOCUS_01570 15194 14286 gene locus_tag LOCUS_01580 15194 14286 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245492.1 protein_id gnl|my_center|LOCUS_01580 15474 15187 gene locus_tag LOCUS_01590 15474 15187 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551852.1 protein_id gnl|my_center|LOCUS_01590 15620 16513 gene locus_tag LOCUS_01600 15620 16513 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081490.1 protein_id gnl|my_center|LOCUS_01600 16742 18892 gene locus_tag LOCUS_01610 16742 18892 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_01610 18894 19148 gene locus_tag LOCUS_01620 18894 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 19158 19805 gene locus_tag LOCUS_01630 gene pnuC 19158 19805 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_01630 19732 20628 gene locus_tag LOCUS_01640 19732 20628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 20635 21633 gene locus_tag LOCUS_01650 20635 21633 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_01650 21630 22403 gene locus_tag LOCUS_01660 21630 22403 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_01660 22676 23671 gene locus_tag LOCUS_01670 22676 23671 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_01670 24657 23722 gene locus_tag LOCUS_01680 24657 23722 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705598.1 protein_id gnl|my_center|LOCUS_01680 24960 25697 gene locus_tag LOCUS_01690 24960 25697 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 protein_id gnl|my_center|LOCUS_01690 >Feature sequence007 826 38 gene locus_tag LOCUS_01700 gene fliP 826 38 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244364.1 protein_id gnl|my_center|LOCUS_01700 1194 823 gene locus_tag LOCUS_01710 1194 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 2649 1291 gene locus_tag LOCUS_01720 2649 1291 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_01720 3431 3093 gene locus_tag LOCUS_01730 3431 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 4246 3545 gene locus_tag LOCUS_01740 4246 3545 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170044.1 protein_id gnl|my_center|LOCUS_01740 4745 4254 gene locus_tag LOCUS_01750 4745 4254 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948551.1 protein_id gnl|my_center|LOCUS_01750 5144 5755 gene locus_tag LOCUS_01760 5144 5755 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797816.1 protein_id gnl|my_center|LOCUS_01760 5762 6643 gene locus_tag LOCUS_01770 5762 6643 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104259.1 protein_id gnl|my_center|LOCUS_01770 6786 7769 gene locus_tag LOCUS_01780 6786 7769 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_01780 9317 7806 gene locus_tag LOCUS_01790 9317 7806 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_01790 10183 9317 gene locus_tag LOCUS_01800 10183 9317 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_01800 11442 10225 gene locus_tag LOCUS_01810 11442 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 11716 12471 gene locus_tag LOCUS_01820 11716 12471 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_01820 12475 13464 gene locus_tag LOCUS_01830 12475 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 13464 14903 gene locus_tag LOCUS_01840 gene pyk 13464 14903 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453949.1 protein_id gnl|my_center|LOCUS_01840 16418 15261 gene locus_tag LOCUS_01850 16418 15261 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897320.1 protein_id gnl|my_center|LOCUS_01850 17474 16422 gene locus_tag LOCUS_01860 17474 16422 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_01860 17941 17477 gene locus_tag LOCUS_01870 17941 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01870 18396 17938 gene locus_tag LOCUS_01880 18396 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01880 18769 21453 gene locus_tag LOCUS_01890 18769 21453 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 protein_id gnl|my_center|LOCUS_01890 22575 21481 gene locus_tag LOCUS_01900 22575 21481 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_01900 22698 23462 gene locus_tag LOCUS_01910 22698 23462 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence008 546 1 gene locus_tag LOCUS_01920 546 1 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399855.1 protein_id gnl|my_center|LOCUS_01920 755 1627 gene locus_tag LOCUS_01930 755 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 1642 2103 gene locus_tag LOCUS_01940 1642 2103 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_01940 2125 4458 gene locus_tag LOCUS_01950 2125 4458 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_01950 5643 4471 gene locus_tag LOCUS_01960 5643 4471 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_01960 6539 5640 gene locus_tag LOCUS_01970 6539 5640 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_01970 9117 6679 gene locus_tag LOCUS_01980 9117 6679 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 protein_id gnl|my_center|LOCUS_01980 10381 9314 gene locus_tag LOCUS_01990 10381 9314 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089456.1 protein_id gnl|my_center|LOCUS_01990 11616 10537 gene locus_tag LOCUS_02000 gene mer 11616 10537 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_02000 12873 11674 gene locus_tag LOCUS_02010 12873 11674 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 protein_id gnl|my_center|LOCUS_02010 13903 13028 gene locus_tag LOCUS_02020 13903 13028 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 protein_id gnl|my_center|LOCUS_02020 15227 13953 gene locus_tag LOCUS_02030 15227 13953 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_02030 16152 15247 gene locus_tag LOCUS_02040 16152 15247 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241727.1 protein_id gnl|my_center|LOCUS_02040 16394 17335 gene locus_tag LOCUS_02050 16394 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 17470 18441 gene locus_tag LOCUS_02060 17470 18441 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461191.1 protein_id gnl|my_center|LOCUS_02060 18477 19397 gene locus_tag LOCUS_02070 18477 19397 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461191.1 protein_id gnl|my_center|LOCUS_02070 19420 20583 gene locus_tag LOCUS_02080 19420 20583 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974705.1 protein_id gnl|my_center|LOCUS_02080 20704 21597 gene locus_tag LOCUS_02090 20704 21597 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_02090 21590 22078 gene locus_tag LOCUS_02100 gene cutC 21590 22078 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence009 1 375 gene locus_tag LOCUS_02110 1 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 966 559 gene locus_tag LOCUS_02120 966 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2349 979 gene locus_tag LOCUS_02130 2349 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 3770 2793 gene locus_tag LOCUS_02140 3770 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 4039 3770 gene locus_tag LOCUS_02150 4039 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 4123 4980 gene locus_tag LOCUS_02160 4123 4980 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728436.1 protein_id gnl|my_center|LOCUS_02160 4977 5534 gene locus_tag LOCUS_02170 4977 5534 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_02170 5601 9719 gene locus_tag LOCUS_02180 5601 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 10391 9750 gene locus_tag LOCUS_02190 gene queE 10391 9750 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810901.1 protein_id gnl|my_center|LOCUS_02190 11464 10388 gene locus_tag LOCUS_02200 11464 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 12162 11461 gene locus_tag LOCUS_02210 gene queC 12162 11461 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_02210 12327 12656 gene locus_tag LOCUS_02220 12327 12656 CDS product Rap1a/Tai family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192506.1 protein_id gnl|my_center|LOCUS_02220 14741 12660 gene locus_tag LOCUS_02230 14741 12660 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_02230 15313 14780 gene locus_tag LOCUS_02240 15313 14780 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_02240 16378 15353 gene locus_tag LOCUS_02250 16378 15353 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_02250 17583 16414 gene locus_tag LOCUS_02260 17583 16414 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922041.1 protein_id gnl|my_center|LOCUS_02260 17778 18590 gene locus_tag LOCUS_02270 17778 18590 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_02270 18587 19375 gene locus_tag LOCUS_02280 gene mlaE 18587 19375 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219882.1 protein_id gnl|my_center|LOCUS_02280 19388 19894 gene locus_tag LOCUS_02290 gene mlaD 19388 19894 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_02290 19899 20543 gene locus_tag LOCUS_02300 19899 20543 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_02300 20540 20821 gene locus_tag LOCUS_02310 20540 20821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 20882 21745 gene locus_tag LOCUS_02320 20882 21745 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731406.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence010 2764 608 gene locus_tag LOCUS_02330 2764 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 3438 2782 gene locus_tag LOCUS_02340 3438 2782 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 protein_id gnl|my_center|LOCUS_02340 3589 4893 gene locus_tag LOCUS_02350 3589 4893 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_02350 6526 4919 gene locus_tag LOCUS_02360 6526 4919 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_02360 6795 7442 gene locus_tag LOCUS_02370 6795 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 8040 7468 gene locus_tag LOCUS_02380 8040 7468 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_02380 8150 8494 gene locus_tag LOCUS_02390 8150 8494 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070442.1 protein_id gnl|my_center|LOCUS_02390 9079 8555 gene locus_tag LOCUS_02400 9079 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 9543 9076 gene locus_tag LOCUS_02410 9543 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 9736 10584 gene locus_tag LOCUS_02420 9736 10584 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267503.1 protein_id gnl|my_center|LOCUS_02420 10882 11841 gene locus_tag LOCUS_02430 10882 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 12306 11857 gene locus_tag LOCUS_02440 12306 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 15319 12365 gene locus_tag LOCUS_02450 15319 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 17509 15449 gene locus_tag LOCUS_02460 17509 15449 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038709.1 protein_id gnl|my_center|LOCUS_02460 17757 20006 gene locus_tag LOCUS_02470 gene plpD 17757 20006 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_02470 21321 20017 gene locus_tag LOCUS_02480 21321 20017 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_02480 22253 21384 gene locus_tag LOCUS_02490 22253 21384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 <22903 22250 gene locus_tag LOCUS_02500 <22903 22250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202248.1:preprotein translocase subunit SecA >Feature sequence011 3 422 gene locus_tag LOCUS_02510 3 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1680 817 gene locus_tag LOCUS_02520 1680 817 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 protein_id gnl|my_center|LOCUS_02520 2731 1871 gene locus_tag LOCUS_02530 2731 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2816 3031 gene locus_tag LOCUS_02540 2816 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3229 3432 gene locus_tag LOCUS_02550 3229 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3591 3502 gene locus_tag LOCUS_t00020 3591 3502 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4479 3718 gene locus_tag LOCUS_02560 4479 3718 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_02560 5618 4503 gene locus_tag LOCUS_02570 gene bamC 5618 4503 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 protein_id gnl|my_center|LOCUS_02570 6552 5632 gene locus_tag LOCUS_02580 gene dapA 6552 5632 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317384.1 protein_id gnl|my_center|LOCUS_02580 7381 6623 gene locus_tag LOCUS_02590 7381 6623 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_02590 8132 7413 gene locus_tag LOCUS_02600 8132 7413 CDS product EthD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729166.1 protein_id gnl|my_center|LOCUS_02600 8382 10208 gene locus_tag LOCUS_02610 gene ilvB 8382 10208 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470298.1 protein_id gnl|my_center|LOCUS_02610 10309 12489 gene locus_tag LOCUS_02620 10309 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 12512 13348 gene locus_tag LOCUS_02630 12512 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13345 14163 gene locus_tag LOCUS_02640 13345 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 14163 15116 gene locus_tag LOCUS_02650 14163 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 15138 19733 gene locus_tag LOCUS_02660 15138 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 21344 19917 gene locus_tag LOCUS_02670 21344 19917 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence012 674 1720 gene locus_tag LOCUS_02680 674 1720 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_02680 1808 4015 gene locus_tag LOCUS_02690 1808 4015 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 protein_id gnl|my_center|LOCUS_02690 5533 4052 gene locus_tag LOCUS_02700 5533 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 5772 7739 gene locus_tag LOCUS_02710 5772 7739 CDS product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 protein_id gnl|my_center|LOCUS_02710 7756 9525 gene locus_tag LOCUS_02720 7756 9525 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105560.1 protein_id gnl|my_center|LOCUS_02720 9543 10844 gene locus_tag LOCUS_02730 9543 10844 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192968.1 protein_id gnl|my_center|LOCUS_02730 10899 11837 gene locus_tag LOCUS_02740 10899 11837 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727013.1 protein_id gnl|my_center|LOCUS_02740 12518 11841 gene locus_tag LOCUS_02750 12518 11841 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256419.1 protein_id gnl|my_center|LOCUS_02750 13735 12602 gene locus_tag LOCUS_02760 13735 12602 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_02760 15830 13932 gene locus_tag LOCUS_02770 15830 13932 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02770 16207 15824 gene locus_tag LOCUS_02780 16207 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02780 17820 16339 gene locus_tag LOCUS_02790 17820 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 18560 17931 gene locus_tag LOCUS_02800 18560 17931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 21017 18768 gene locus_tag LOCUS_02810 21017 18768 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence013 906 136 gene locus_tag LOCUS_02820 906 136 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_02820 1993 938 gene locus_tag LOCUS_02830 1993 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2619 1990 gene locus_tag LOCUS_02840 2619 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4890 2695 gene locus_tag LOCUS_02850 4890 2695 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_02850 7087 4916 gene locus_tag LOCUS_02860 7087 4916 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_02860 7492 10458 gene locus_tag LOCUS_02870 7492 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 10455 11492 gene locus_tag LOCUS_02880 gene narH 10455 11492 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487116.1 protein_id gnl|my_center|LOCUS_02880 11513 12058 gene locus_tag LOCUS_02890 11513 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 12055 12540 gene locus_tag LOCUS_02900 12055 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12616 13629 gene locus_tag LOCUS_02910 12616 13629 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 protein_id gnl|my_center|LOCUS_02910 14763 13747 gene locus_tag LOCUS_02920 14763 13747 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_02920 15943 14879 gene locus_tag LOCUS_02930 15943 14879 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036508.1 protein_id gnl|my_center|LOCUS_02930 16641 16012 gene locus_tag LOCUS_02940 16641 16012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 17452 16655 gene locus_tag LOCUS_02950 17452 16655 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_02950 18367 17588 gene locus_tag LOCUS_02960 18367 17588 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_02960 19532 18864 gene locus_tag LOCUS_02970 19532 18864 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_02970 <20069 19526 gene locus_tag LOCUS_02980 <20069 19526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920181.1:NUDIX hydrolase >Feature sequence014 1410 283 gene locus_tag LOCUS_02990 1410 283 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036868.1 protein_id gnl|my_center|LOCUS_02990 2123 1491 gene locus_tag LOCUS_03000 2123 1491 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036867.1 protein_id gnl|my_center|LOCUS_03000 2739 2158 gene locus_tag LOCUS_03010 2739 2158 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037716.1 protein_id gnl|my_center|LOCUS_03010 3222 5717 gene locus_tag LOCUS_03020 3222 5717 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 protein_id gnl|my_center|LOCUS_03020 5863 7089 gene locus_tag LOCUS_03030 5863 7089 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_03030 7208 8491 gene locus_tag LOCUS_03040 7208 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 protein_id gnl|my_center|LOCUS_03040 8488 9372 gene locus_tag LOCUS_03050 8488 9372 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_03050 9406 10305 gene locus_tag LOCUS_03060 9406 10305 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_03060 10310 10594 gene locus_tag LOCUS_03070 10310 10594 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_03070 10605 13262 gene locus_tag LOCUS_03080 gene pepN 10605 13262 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_03080 15042 13309 gene locus_tag LOCUS_03090 15042 13309 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_03090 16988 15042 gene locus_tag LOCUS_03100 16988 15042 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_03100 17997 16978 gene locus_tag LOCUS_03110 17997 16978 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_03110 18467 17994 gene locus_tag LOCUS_03120 18467 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 19408 18464 gene locus_tag LOCUS_03130 19408 18464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence015 1222 266 gene locus_tag LOCUS_03140 gene miaA 1222 266 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280341.1 protein_id gnl|my_center|LOCUS_03140 3034 1238 gene locus_tag LOCUS_03150 gene mutL 3034 1238 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_03150 4604 3078 gene locus_tag LOCUS_03160 gene amiB 4604 3078 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_03160 5118 4639 gene locus_tag LOCUS_03170 gene tsaE 5118 4639 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815423.1 protein_id gnl|my_center|LOCUS_03170 6647 5136 gene locus_tag LOCUS_03180 6647 5136 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_03180 6755 7855 gene locus_tag LOCUS_03190 gene queG 6755 7855 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266491.1 protein_id gnl|my_center|LOCUS_03190 8587 8039 gene locus_tag LOCUS_03200 gene orn 8587 8039 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520890.1 protein_id gnl|my_center|LOCUS_03200 8659 9633 gene locus_tag LOCUS_03210 gene rsgA 8659 9633 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_03210 9630 10517 gene locus_tag LOCUS_03220 gene asd 9630 10517 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063853.1 protein_id gnl|my_center|LOCUS_03220 11561 10593 gene locus_tag LOCUS_03230 gene epmA 11561 10593 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 protein_id gnl|my_center|LOCUS_03230 12135 11566 gene locus_tag LOCUS_03240 gene efp 12135 11566 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_03240 12316 14364 gene locus_tag LOCUS_03250 gene fimX 12316 14364 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_03250 15587 14370 gene locus_tag LOCUS_03260 gene serB 15587 14370 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_03260 17848 15593 gene locus_tag LOCUS_03270 gene parC 17848 15593 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_03270 18496 17921 gene locus_tag LOCUS_03280 18496 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 19476 18496 gene locus_tag LOCUS_03290 19476 18496 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_03290 >Feature sequence016 <1 18701 gene locus_tag LOCUS_03300 <1 18701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence017 1954 794 gene locus_tag LOCUS_03310 1954 794 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_03310 2231 2019 gene locus_tag LOCUS_03320 2231 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2328 2337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3023 2499 gene locus_tag LOCUS_03330 3023 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4212 3052 gene locus_tag LOCUS_03340 4212 3052 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_03340 5410 4229 gene locus_tag LOCUS_03350 5410 4229 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_03350 7987 5534 gene locus_tag LOCUS_03360 7987 5534 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900424.1 protein_id gnl|my_center|LOCUS_03360 8591 8280 gene locus_tag LOCUS_03370 8591 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228958.1 protein_id gnl|my_center|LOCUS_03370 8924 9880 gene locus_tag LOCUS_03380 8924 9880 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259384.1 protein_id gnl|my_center|LOCUS_03380 9893 10333 gene locus_tag LOCUS_03390 9893 10333 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408058.1 protein_id gnl|my_center|LOCUS_03390 10335 11528 gene locus_tag LOCUS_03400 10335 11528 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057979.1 protein_id gnl|my_center|LOCUS_03400 11579 13552 gene locus_tag LOCUS_03410 11579 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 13590 14030 gene locus_tag LOCUS_03420 13590 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 14905 14276 gene locus_tag LOCUS_03430 14905 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 15223 14975 gene locus_tag LOCUS_03440 15223 14975 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920053.1 protein_id gnl|my_center|LOCUS_03440 16448 15300 gene locus_tag LOCUS_03450 16448 15300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 16525 17511 gene locus_tag LOCUS_03460 16525 17511 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence018 790 101 gene locus_tag LOCUS_03470 gene ung 790 101 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067035.1 protein_id gnl|my_center|LOCUS_03470 3299 831 gene locus_tag LOCUS_03480 3299 831 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406167.1 protein_id gnl|my_center|LOCUS_03480 4019 3324 gene locus_tag LOCUS_03490 gene cofC 4019 3324 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415094.1 protein_id gnl|my_center|LOCUS_03490 4963 4016 gene locus_tag LOCUS_03500 gene cofD 4963 4016 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_03500 5721 4960 gene locus_tag LOCUS_03510 gene cofE 5721 4960 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_03510 6406 5714 gene locus_tag LOCUS_03520 gene npdG 6406 5714 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_03520 6534 7307 gene locus_tag LOCUS_03530 6534 7307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_03530 8035 7361 gene locus_tag LOCUS_03540 8035 7361 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105337.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03540 8083 8751 gene locus_tag LOCUS_03550 8083 8751 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186606.1 protein_id gnl|my_center|LOCUS_03550 10315 8759 gene locus_tag LOCUS_03560 10315 8759 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266666.1 protein_id gnl|my_center|LOCUS_03560 10668 11864 gene locus_tag LOCUS_03570 10668 11864 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_03570 11899 13032 gene locus_tag LOCUS_03580 11899 13032 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_03580 13724 13008 gene locus_tag LOCUS_03590 13724 13008 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730633.1 protein_id gnl|my_center|LOCUS_03590 13916 13743 gene locus_tag LOCUS_03600 13916 13743 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098329.1 protein_id gnl|my_center|LOCUS_03600 15513 13951 gene locus_tag LOCUS_03610 15513 13951 CDS product DUF3336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_03610 15626 15904 gene locus_tag LOCUS_03620 15626 15904 CDS product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095874.1 protein_id gnl|my_center|LOCUS_03620 17404 15929 gene locus_tag LOCUS_03630 17404 15929 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence019 <1 637 gene locus_tag LOCUS_03640 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193564.1:U32 family peptidase 628 1092 gene locus_tag LOCUS_03650 628 1092 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_03650 1663 1064 gene locus_tag LOCUS_03660 1663 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1772 2203 gene locus_tag LOCUS_03670 1772 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 2200 3351 gene locus_tag LOCUS_03680 2200 3351 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_03680 3475 5037 gene locus_tag LOCUS_03690 3475 5037 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_03690 5840 5052 gene locus_tag LOCUS_03700 5840 5052 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_03700 6943 5873 gene locus_tag LOCUS_03710 6943 5873 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_03710 7162 8076 gene locus_tag LOCUS_03720 7162 8076 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730868.1 protein_id gnl|my_center|LOCUS_03720 8214 8552 gene locus_tag LOCUS_03730 8214 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 8588 9469 gene locus_tag LOCUS_03740 8588 9469 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_03740 9492 9863 gene locus_tag LOCUS_03750 9492 9863 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_03750 11647 9920 gene locus_tag LOCUS_03760 11647 9920 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113119.1 protein_id gnl|my_center|LOCUS_03760 12713 11826 gene locus_tag LOCUS_03770 12713 11826 CDS product TIGR03620 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_03770 12859 14061 gene locus_tag LOCUS_03780 12859 14061 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446656.1 protein_id gnl|my_center|LOCUS_03780 14126 15241 gene locus_tag LOCUS_03790 gene ald 14126 15241 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946659.1 protein_id gnl|my_center|LOCUS_03790 15360 16832 gene locus_tag LOCUS_03800 15360 16832 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275325.1 protein_id gnl|my_center|LOCUS_03800 17508 16849 gene locus_tag LOCUS_03810 17508 16849 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969269.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence020 2763 1213 gene locus_tag LOCUS_03820 2763 1213 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_03820 3248 2760 gene locus_tag LOCUS_03830 3248 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3378 3920 gene locus_tag LOCUS_03840 3378 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4797 3859 gene locus_tag LOCUS_03850 4797 3859 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267733.1 protein_id gnl|my_center|LOCUS_03850 6007 4799 gene locus_tag LOCUS_03860 6007 4799 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039173.1 protein_id gnl|my_center|LOCUS_03860 8391 6073 gene locus_tag LOCUS_03870 8391 6073 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_03870 8844 9599 gene locus_tag LOCUS_03880 8844 9599 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_03880 9599 11014 gene locus_tag LOCUS_03890 gene uxaC 9599 11014 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039186.1 protein_id gnl|my_center|LOCUS_03890 11011 12504 gene locus_tag LOCUS_03900 11011 12504 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456739.1 protein_id gnl|my_center|LOCUS_03900 12568 14568 gene locus_tag LOCUS_03910 gene uidA 12568 14568 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945913.1 protein_id gnl|my_center|LOCUS_03910 14565 15860 gene locus_tag LOCUS_03920 14565 15860 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_03920 16490 15912 gene locus_tag LOCUS_03930 16490 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 16634 17602 gene locus_tag LOCUS_03940 gene paoD 16634 17602 CDS product molybdenum cofactor insertion chaperone PaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121356.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence021 1122 310 gene locus_tag LOCUS_03950 1122 310 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_03950 1820 1140 gene locus_tag LOCUS_03960 1820 1140 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_03960 3280 1817 gene locus_tag LOCUS_03970 3280 1817 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_03970 4044 3334 gene locus_tag LOCUS_03980 4044 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4238 4756 gene locus_tag LOCUS_03990 4238 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4765 5706 gene locus_tag LOCUS_04000 4765 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 6048 5746 gene locus_tag LOCUS_04010 6048 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 9126 6058 gene locus_tag LOCUS_04020 9126 6058 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_04020 10229 9123 gene locus_tag LOCUS_04030 10229 9123 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494086.1 protein_id gnl|my_center|LOCUS_04030 11458 10226 gene locus_tag LOCUS_04040 11458 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 12515 11577 gene locus_tag LOCUS_04050 12515 11577 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 protein_id gnl|my_center|LOCUS_04050 14751 12523 gene locus_tag LOCUS_04060 14751 12523 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 protein_id gnl|my_center|LOCUS_04060 15306 14788 gene locus_tag LOCUS_04070 15306 14788 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 protein_id gnl|my_center|LOCUS_04070 15622 15278 gene locus_tag LOCUS_04080 15622 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 17144 15894 gene locus_tag LOCUS_04090 17144 15894 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence022 463 930 gene locus_tag LOCUS_04100 gene recX 463 930 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406202.1 protein_id gnl|my_center|LOCUS_04100 934 1692 gene locus_tag LOCUS_04110 934 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2008 1619 gene locus_tag LOCUS_04120 2008 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2056 2205 gene locus_tag LOCUS_04130 2056 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2351 2202 gene locus_tag LOCUS_04140 2351 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 2692 2435 gene locus_tag LOCUS_04150 2692 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3563 2781 gene locus_tag LOCUS_04160 3563 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5112 3838 gene locus_tag LOCUS_04170 5112 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 8205 5236 gene locus_tag LOCUS_04180 8205 5236 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_04180 8700 9989 gene locus_tag LOCUS_04190 8700 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 10869 9970 gene locus_tag LOCUS_04200 10869 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 10822 11130 gene locus_tag LOCUS_04210 10822 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 11123 11815 gene locus_tag LOCUS_04220 11123 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 12678 11845 gene locus_tag LOCUS_04230 12678 11845 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_04230 14702 12675 gene locus_tag LOCUS_04240 gene mnmC 14702 12675 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_04240 15542 14730 gene locus_tag LOCUS_04250 15542 14730 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268503.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence023 214 555 gene locus_tag LOCUS_04260 214 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2050 509 gene locus_tag LOCUS_04270 2050 509 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_04270 4643 2052 gene locus_tag LOCUS_04280 gene ndvB 4643 2052 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_04280 6003 4669 gene locus_tag LOCUS_04290 6003 4669 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_04290 6282 6848 gene locus_tag LOCUS_04300 gene ahpC 6282 6848 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705621.1 protein_id gnl|my_center|LOCUS_04300 6868 8442 gene locus_tag LOCUS_04310 gene ahpF 6868 8442 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246288.1 protein_id gnl|my_center|LOCUS_04310 9442 8636 gene locus_tag LOCUS_04320 9442 8636 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148770277.1 protein_id gnl|my_center|LOCUS_04320 9603 9770 gene locus_tag LOCUS_04330 9603 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 10009 12234 gene locus_tag LOCUS_04340 10009 12234 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_04340 12381 13178 gene locus_tag LOCUS_04350 12381 13178 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_04350 14213 13152 gene locus_tag LOCUS_04360 gene selD 14213 13152 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_04360 15264 14224 gene locus_tag LOCUS_04370 gene oruR 15264 14224 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_04370 15969 15343 gene locus_tag LOCUS_04380 15969 15343 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 protein_id gnl|my_center|LOCUS_04380 16471 16010 gene locus_tag LOCUS_04390 16471 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence024 <1 1373 gene locus_tag LOCUS_04400 <1 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000164216.1:colanic acid biosynthesis phosphomannomutase CpsG 1655 1395 gene locus_tag LOCUS_04410 1655 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 1820 3031 gene locus_tag LOCUS_04420 1820 3031 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_04420 3139 3993 gene locus_tag LOCUS_04430 gene yghU 3139 3993 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769036.1 protein_id gnl|my_center|LOCUS_04430 4170 4319 gene locus_tag LOCUS_04440 4170 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 4323 6533 gene locus_tag LOCUS_04450 4323 6533 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_04450 7050 6586 gene locus_tag LOCUS_04460 gene bfr 7050 6586 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675528.1 protein_id gnl|my_center|LOCUS_04460 8114 7062 gene locus_tag LOCUS_04470 8114 7062 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_04470 9140 8175 gene locus_tag LOCUS_04480 9140 8175 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_04480 10018 9143 gene locus_tag LOCUS_04490 10018 9143 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_04490 11204 10152 gene locus_tag LOCUS_04500 11204 10152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_04500 11891 11283 gene locus_tag LOCUS_04510 11891 11283 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947367.1 protein_id gnl|my_center|LOCUS_04510 13140 12073 gene locus_tag LOCUS_04520 13140 12073 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_04520 13570 15918 gene locus_tag LOCUS_04530 13570 15918 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268745.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence025 <1 726 gene locus_tag LOCUS_04540 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003380132.1:adenylosuccinate lyase 732 1223 gene locus_tag LOCUS_04550 732 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2039 1248 gene locus_tag LOCUS_04560 2039 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3744 2137 gene locus_tag LOCUS_04570 3744 2137 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929741.1 protein_id gnl|my_center|LOCUS_04570 4409 3852 gene locus_tag LOCUS_04580 4409 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 5020 4418 gene locus_tag LOCUS_04590 5020 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6492 5017 gene locus_tag LOCUS_04600 6492 5017 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_04600 6632 9142 gene locus_tag LOCUS_04610 6632 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 9302 10543 gene locus_tag LOCUS_04620 9302 10543 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_04620 10697 11734 gene locus_tag LOCUS_04630 10697 11734 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_04630 11749 12975 gene locus_tag LOCUS_04640 11749 12975 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_04640 12993 14618 gene locus_tag LOCUS_04650 12993 14618 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_04650 15333 14623 gene locus_tag LOCUS_04660 15333 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 16223 15420 gene locus_tag LOCUS_04670 16223 15420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence026 2031 1120 gene locus_tag LOCUS_04680 gene hslO 2031 1120 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070560.1 protein_id gnl|my_center|LOCUS_04680 2441 2049 gene locus_tag LOCUS_04690 2441 2049 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068915.1 protein_id gnl|my_center|LOCUS_04690 3105 2434 gene locus_tag LOCUS_04700 gene yrfG 3105 2434 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_04700 3215 3775 gene locus_tag LOCUS_04710 gene nudE 3215 3775 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_04710 3781 4560 gene locus_tag LOCUS_04720 gene cysQ 3781 4560 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114067.1 protein_id gnl|my_center|LOCUS_04720 4988 4746 gene locus_tag LOCUS_04730 4988 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 5371 8604 gene locus_tag LOCUS_04740 gene recC 5371 8604 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707658.1 protein_id gnl|my_center|LOCUS_04740 8601 12158 gene locus_tag LOCUS_04750 gene recB 8601 12158 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271602.1 protein_id gnl|my_center|LOCUS_04750 12148 14028 gene locus_tag LOCUS_04760 gene recD 12148 14028 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 protein_id gnl|my_center|LOCUS_04760 14106 14495 gene locus_tag LOCUS_04770 14106 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 14834 14631 gene locus_tag LOCUS_04780 14834 14631 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942197.1 protein_id gnl|my_center|LOCUS_04780 16112 14883 gene locus_tag LOCUS_04790 16112 14883 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence027 2182 1457 gene locus_tag LOCUS_04800 gene lptB 2182 1457 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_04800 2771 2169 gene locus_tag LOCUS_04810 gene lptA 2771 2169 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120916.1 protein_id gnl|my_center|LOCUS_04810 3419 2835 gene locus_tag LOCUS_04820 3419 2835 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_04820 4402 3419 gene locus_tag LOCUS_04830 gene kdsD 4402 3419 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_04830 4642 4887 gene locus_tag LOCUS_04840 gene ibaG 4642 4887 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501458.1 protein_id gnl|my_center|LOCUS_04840 4903 6165 gene locus_tag LOCUS_04850 gene murA 4903 6165 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_04850 6162 6830 gene locus_tag LOCUS_04860 gene hisG 6162 6830 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 protein_id gnl|my_center|LOCUS_04860 6827 8134 gene locus_tag LOCUS_04870 gene hisD 6827 8134 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 protein_id gnl|my_center|LOCUS_04870 8131 9225 gene locus_tag LOCUS_04880 gene hisC 8131 9225 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_04880 10280 9222 gene locus_tag LOCUS_04890 gene algW 10280 9222 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 protein_id gnl|my_center|LOCUS_04890 10791 10333 gene locus_tag LOCUS_04900 10791 10333 CDS product YhcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094304.1 protein_id gnl|my_center|LOCUS_04900 10955 12046 gene locus_tag LOCUS_04910 gene zapE 10955 12046 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_04910 12135 12563 gene locus_tag LOCUS_04920 gene rplM 12135 12563 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847599.1 protein_id gnl|my_center|LOCUS_04920 12577 12969 gene locus_tag LOCUS_04930 gene rpsI 12577 12969 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_04930 13175 14947 gene locus_tag LOCUS_04940 13175 14947 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079894.1 protein_id gnl|my_center|LOCUS_04940 15260 15862 gene locus_tag LOCUS_04950 gene petA 15260 15862 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence028 546 130 gene locus_tag LOCUS_04960 546 130 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106175.1 protein_id gnl|my_center|LOCUS_04960 1290 556 gene locus_tag LOCUS_04970 1290 556 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083979.1 protein_id gnl|my_center|LOCUS_04970 1650 1513 gene locus_tag LOCUS_04980 1650 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1847 1659 gene locus_tag LOCUS_04990 1847 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2302 1847 gene locus_tag LOCUS_05000 2302 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 3461 2322 gene locus_tag LOCUS_05010 3461 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 4679 3498 gene locus_tag LOCUS_05020 4679 3498 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_05020 5540 4695 gene locus_tag LOCUS_05030 5540 4695 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_05030 5833 6954 gene locus_tag LOCUS_05040 5833 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7104 9272 gene locus_tag LOCUS_05050 7104 9272 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_05050 9299 10165 gene locus_tag LOCUS_05060 9299 10165 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 protein_id gnl|my_center|LOCUS_05060 10197 11096 gene locus_tag LOCUS_05070 10197 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05070 11038 11220 gene locus_tag LOCUS_05080 11038 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 11227 12852 gene locus_tag LOCUS_05090 11227 12852 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896176.1 protein_id gnl|my_center|LOCUS_05090 12936 14204 gene locus_tag LOCUS_05100 12936 14204 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_05100 14849 14325 gene locus_tag LOCUS_05110 14849 14325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 15355 14846 gene locus_tag LOCUS_05120 15355 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 15737 15662 gene locus_tag LOCUS_t00030 15737 15662 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 <1 962 gene locus_tag LOCUS_05130 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967897.1:amidohydrolase family protein 965 1855 gene locus_tag LOCUS_05140 gene wapR 965 1855 CDS product alpha-1,3-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_05140 1863 2261 gene locus_tag LOCUS_05150 1863 2261 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_05150 2261 2725 gene locus_tag LOCUS_05160 2261 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2722 3825 gene locus_tag LOCUS_05170 2722 3825 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036848.1 protein_id gnl|my_center|LOCUS_05170 3865 4818 gene locus_tag LOCUS_05180 3865 4818 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928906.1 protein_id gnl|my_center|LOCUS_05180 5058 5960 gene locus_tag LOCUS_05190 gene prfB 5058 5960 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05190 5980 7473 gene locus_tag LOCUS_05200 gene lysS 5980 7473 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765916.1 protein_id gnl|my_center|LOCUS_05200 7477 8097 gene locus_tag LOCUS_05210 7477 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 10420 8078 gene locus_tag LOCUS_05220 10420 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10800 10417 gene locus_tag LOCUS_05230 10800 10417 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_05230 12305 10797 gene locus_tag LOCUS_05240 12305 10797 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975236.1 protein_id gnl|my_center|LOCUS_05240 15110 12414 gene locus_tag LOCUS_05250 15110 12414 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_05250 <15614 15115 gene locus_tag LOCUS_05260 <15614 15115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092395.1:type I methionyl aminopeptidase >Feature sequence030 2506 923 gene locus_tag LOCUS_05270 2506 923 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_05270 3318 2512 gene locus_tag LOCUS_05280 3318 2512 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083337.1 protein_id gnl|my_center|LOCUS_05280 4463 3315 gene locus_tag LOCUS_05290 4463 3315 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_05290 4589 5008 gene locus_tag LOCUS_05300 4589 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 5831 5109 gene locus_tag LOCUS_05310 5831 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 6132 5821 gene locus_tag LOCUS_05320 6132 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 6293 7336 gene locus_tag LOCUS_05330 6293 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7368 9749 gene locus_tag LOCUS_05340 7368 9749 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_05340 9766 10827 gene locus_tag LOCUS_05350 9766 10827 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_05350 10824 12566 gene locus_tag LOCUS_05360 10824 12566 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_05360 12689 13123 gene locus_tag LOCUS_05370 12689 13123 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_05370 14771 13341 gene locus_tag LOCUS_05380 gene nuoN 14771 13341 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090482.1 protein_id gnl|my_center|LOCUS_05380 <15603 14768 gene locus_tag LOCUS_05390 <15603 14768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097684.1:NADH-quinone oxidoreductase subunit M >Feature sequence031 <1 719 gene locus_tag LOCUS_05400 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404819.1:TIGR03619 family F420-dependent LLM class oxidoreductase 746 1495 gene locus_tag LOCUS_05410 746 1495 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_05410 1497 1886 gene locus_tag LOCUS_05420 1497 1886 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_05420 1890 2828 gene locus_tag LOCUS_05430 1890 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2878 3909 gene locus_tag LOCUS_05440 2878 3909 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898842.1 protein_id gnl|my_center|LOCUS_05440 3906 4811 gene locus_tag LOCUS_05450 3906 4811 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_05450 4852 5442 gene locus_tag LOCUS_05460 4852 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5554 6285 gene locus_tag LOCUS_05470 5554 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 6293 8242 gene locus_tag LOCUS_05480 6293 8242 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338380.1 protein_id gnl|my_center|LOCUS_05480 8239 8595 gene locus_tag LOCUS_05490 8239 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 8592 10766 gene locus_tag LOCUS_05500 8592 10766 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827278.1 protein_id gnl|my_center|LOCUS_05500 10821 11684 gene locus_tag LOCUS_05510 gene menB 10821 11684 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_05510 11712 13070 gene locus_tag LOCUS_05520 11712 13070 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_05520 13111 15159 gene locus_tag LOCUS_05530 13111 15159 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969299.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence032 1000 2787 gene locus_tag LOCUS_05540 1000 2787 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_05540 2902 4113 gene locus_tag LOCUS_05550 2902 4113 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072384.1 protein_id gnl|my_center|LOCUS_05550 4113 4667 gene locus_tag LOCUS_05560 4113 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 5218 4688 gene locus_tag LOCUS_05570 5218 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 5304 6143 gene locus_tag LOCUS_05580 5304 6143 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_05580 6220 6903 gene locus_tag LOCUS_05590 6220 6903 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_05590 8070 7165 gene locus_tag LOCUS_05600 gene rdgC 8070 7165 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_05600 8121 8834 gene locus_tag LOCUS_05610 8121 8834 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_05610 8831 9256 gene locus_tag LOCUS_05620 8831 9256 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_05620 9277 10296 gene locus_tag LOCUS_05630 gene lpxK 9277 10296 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091159.1 protein_id gnl|my_center|LOCUS_05630 10293 11057 gene locus_tag LOCUS_05640 gene kdsB 10293 11057 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_05640 11054 11527 gene locus_tag LOCUS_05650 11054 11527 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_05650 11533 12540 gene locus_tag LOCUS_05660 gene murB 11533 12540 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 protein_id gnl|my_center|LOCUS_05660 12701 13366 gene locus_tag LOCUS_05670 gene uvrY 12701 13366 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737926.1 protein_id gnl|my_center|LOCUS_05670 13363 15189 gene locus_tag LOCUS_05680 gene uvrC 13363 15189 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence033 552 1391 gene locus_tag LOCUS_05690 gene ttcA 552 1391 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925707.1 protein_id gnl|my_center|LOCUS_05690 1506 1895 gene locus_tag LOCUS_05700 gene fliE 1506 1895 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_05700 1930 3630 gene locus_tag LOCUS_05710 gene fliF 1930 3630 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109118.1 protein_id gnl|my_center|LOCUS_05710 3617 4636 gene locus_tag LOCUS_05720 gene fliG 3617 4636 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082212.1 protein_id gnl|my_center|LOCUS_05720 4659 5444 gene locus_tag LOCUS_05730 4659 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5441 6844 gene locus_tag LOCUS_05740 gene fliI 5441 6844 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_05740 6841 7296 gene locus_tag LOCUS_05750 6841 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 7446 9308 gene locus_tag LOCUS_05760 7446 9308 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204243.1 protein_id gnl|my_center|LOCUS_05760 9447 9953 gene locus_tag LOCUS_05770 9447 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 9992 10960 gene locus_tag LOCUS_05780 gene fliM 9992 10960 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083045.1 protein_id gnl|my_center|LOCUS_05780 10986 11339 gene locus_tag LOCUS_05790 10986 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 11348 12835 gene locus_tag LOCUS_05800 gene gltX 11348 12835 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_05800 <15035 12811 gene locus_tag LOCUS_05810 <15035 12811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244431.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence034 3275 1590 gene locus_tag LOCUS_05820 gene panP 3275 1590 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942351.1 protein_id gnl|my_center|LOCUS_05820 3479 5254 gene locus_tag LOCUS_05830 3479 5254 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_05830 5704 5327 gene locus_tag LOCUS_05840 5704 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5804 6706 gene locus_tag LOCUS_05850 5804 6706 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104227.1 protein_id gnl|my_center|LOCUS_05850 6750 7196 gene locus_tag LOCUS_05860 6750 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 10030 7163 gene locus_tag LOCUS_05870 10030 7163 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_05870 10124 10945 gene locus_tag LOCUS_05880 gene fabG 10124 10945 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_05880 11096 11962 gene locus_tag LOCUS_05890 11096 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 12810 11971 gene locus_tag LOCUS_05900 12810 11971 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966304.1 protein_id gnl|my_center|LOCUS_05900 13381 12926 gene locus_tag LOCUS_05910 13381 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 13528 14343 gene locus_tag LOCUS_05920 gene murI 13528 14343 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence035 <1 580 gene locus_tag LOCUS_05930 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212596.1:cytochrome-c oxidase, cbb3-type subunit II 577 771 gene locus_tag LOCUS_05940 577 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 768 1679 gene locus_tag LOCUS_05950 gene ccoP 768 1679 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268424.1 protein_id gnl|my_center|LOCUS_05950 2564 1881 gene locus_tag LOCUS_05960 gene rpiA 2564 1881 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_05960 2728 4263 gene locus_tag LOCUS_05970 gene ilvA 2728 4263 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_05970 4850 4242 gene locus_tag LOCUS_05980 4850 4242 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 protein_id gnl|my_center|LOCUS_05980 5443 5123 gene locus_tag LOCUS_05990 5443 5123 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_05990 5649 5440 gene locus_tag LOCUS_06000 5649 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5765 6301 gene locus_tag LOCUS_06010 5765 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 6312 7658 gene locus_tag LOCUS_06020 gene pepP 6312 7658 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_06020 7655 8896 gene locus_tag LOCUS_06030 gene ubiH 7655 8896 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_06030 8893 10122 gene locus_tag LOCUS_06040 8893 10122 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_06040 10228 10620 gene locus_tag LOCUS_06050 gene gcvH 10228 10620 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103095.1 protein_id gnl|my_center|LOCUS_06050 10651 11853 gene locus_tag LOCUS_06060 10651 11853 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 protein_id gnl|my_center|LOCUS_06060 11935 12426 gene locus_tag LOCUS_06070 11935 12426 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555745.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence036 415 1107 gene locus_tag LOCUS_06080 415 1107 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_06080 1107 1883 gene locus_tag LOCUS_06090 1107 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1880 3277 gene locus_tag LOCUS_06100 gene zwf 1880 3277 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_06100 3274 5667 gene locus_tag LOCUS_06110 3274 5667 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_06110 5952 5755 gene locus_tag LOCUS_06120 5952 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6208 6723 gene locus_tag LOCUS_06130 6208 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 7317 6775 gene locus_tag LOCUS_06140 7317 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 8063 7473 gene locus_tag LOCUS_06150 8063 7473 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337407.1 protein_id gnl|my_center|LOCUS_06150 8526 10541 gene locus_tag LOCUS_06160 8526 10541 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343703.1 protein_id gnl|my_center|LOCUS_06160 12218 10761 gene locus_tag LOCUS_06170 12218 10761 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_06170 13431 12235 gene locus_tag LOCUS_06180 13431 12235 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531489.1 protein_id gnl|my_center|LOCUS_06180 13904 13470 gene locus_tag LOCUS_06190 gene trxC 13904 13470 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence037 551 1510 gene locus_tag LOCUS_06200 551 1510 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402775.1 protein_id gnl|my_center|LOCUS_06200 1723 4311 gene locus_tag LOCUS_06210 1723 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4425 7289 gene locus_tag LOCUS_06220 4425 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 7370 8008 gene locus_tag LOCUS_06230 7370 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 8053 9099 gene locus_tag LOCUS_06240 8053 9099 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530708.1 protein_id gnl|my_center|LOCUS_06240 9092 10228 gene locus_tag LOCUS_06250 9092 10228 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 protein_id gnl|my_center|LOCUS_06250 10303 11481 gene locus_tag LOCUS_06260 10303 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896388.1 protein_id gnl|my_center|LOCUS_06260 11604 12497 gene locus_tag LOCUS_06270 11604 12497 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970319.1 protein_id gnl|my_center|LOCUS_06270 13837 12668 gene locus_tag LOCUS_06280 13837 12668 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_06280 14256 13840 gene locus_tag LOCUS_06290 14256 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence038 2141 669 gene locus_tag LOCUS_06300 2141 669 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_06300 2424 2167 gene locus_tag LOCUS_06310 2424 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2566 3528 gene locus_tag LOCUS_06320 2566 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4362 3547 gene locus_tag LOCUS_06330 4362 3547 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 protein_id gnl|my_center|LOCUS_06330 4612 5742 gene locus_tag LOCUS_06340 4612 5742 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_06340 6853 5726 gene locus_tag LOCUS_06350 6853 5726 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112987.1 protein_id gnl|my_center|LOCUS_06350 7047 7541 gene locus_tag LOCUS_06360 7047 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7558 7875 gene locus_tag LOCUS_06370 7558 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 8472 7909 gene locus_tag LOCUS_06380 8472 7909 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_06380 8632 9642 gene locus_tag LOCUS_06390 8632 9642 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_06390 10159 9707 gene locus_tag LOCUS_06400 10159 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 10346 10963 gene locus_tag LOCUS_06410 gene msrA 10346 10963 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_06410 11045 12511 gene locus_tag LOCUS_06420 gene guaB 11045 12511 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380633.1 protein_id gnl|my_center|LOCUS_06420 12633 14210 gene locus_tag LOCUS_06430 gene guaA 12633 14210 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771001.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence039 337 3033 gene locus_tag LOCUS_06440 337 3033 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_06440 3582 3046 gene locus_tag LOCUS_06450 3582 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3661 4050 gene locus_tag LOCUS_06460 3661 4050 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 protein_id gnl|my_center|LOCUS_06460 5146 4100 gene locus_tag LOCUS_06470 gene truD 5146 4100 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113870.1 protein_id gnl|my_center|LOCUS_06470 6727 5234 gene locus_tag LOCUS_06480 gene ppx 6727 5234 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_06480 6873 8975 gene locus_tag LOCUS_06490 gene ppk1 6873 8975 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460183.1 protein_id gnl|my_center|LOCUS_06490 9289 8972 gene locus_tag LOCUS_06500 gene bolA 9289 8972 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_06500 9393 10709 gene locus_tag LOCUS_06510 gene yegQ 9393 10709 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_06510 11632 10778 gene locus_tag LOCUS_06520 11632 10778 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167772.1 protein_id gnl|my_center|LOCUS_06520 11987 11775 gene locus_tag LOCUS_06530 11987 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 <14304 12223 gene locus_tag LOCUS_06540 <14304 12223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031141.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein >Feature sequence040 2016 814 gene locus_tag LOCUS_06550 gene cgtA 2016 814 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_06550 2323 2066 gene locus_tag LOCUS_06560 gene rpmA 2323 2066 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094760.1 protein_id gnl|my_center|LOCUS_06560 2656 2342 gene locus_tag LOCUS_06570 gene rplU 2656 2342 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381306.1 protein_id gnl|my_center|LOCUS_06570 2971 3933 gene locus_tag LOCUS_06580 gene ispB 2971 3933 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 protein_id gnl|my_center|LOCUS_06580 4002 6263 gene locus_tag LOCUS_06590 4002 6263 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266649.1 protein_id gnl|my_center|LOCUS_06590 7046 6303 gene locus_tag LOCUS_06600 7046 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8335 7070 gene locus_tag LOCUS_06610 8335 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 9304 8405 gene locus_tag LOCUS_06620 9304 8405 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132696218.1 protein_id gnl|my_center|LOCUS_06620 9518 10525 gene locus_tag LOCUS_06630 9518 10525 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_06630 11332 10565 gene locus_tag LOCUS_06640 11332 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 12093 11329 gene locus_tag LOCUS_06650 12093 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 12821 12339 gene locus_tag LOCUS_06660 12821 12339 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_06660 13648 12818 gene locus_tag LOCUS_06670 13648 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 <14303 13740 gene locus_tag LOCUS_06680 <14303 13740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390844.1:glycosyltransferase family 4 protein >Feature sequence041 1063 509 gene locus_tag LOCUS_06690 1063 509 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_06690 1275 2570 gene locus_tag LOCUS_06700 1275 2570 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_06700 3177 2974 gene locus_tag LOCUS_06710 3177 2974 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_06710 3307 4056 gene locus_tag LOCUS_06720 3307 4056 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283886.1 protein_id gnl|my_center|LOCUS_06720 7082 4104 gene locus_tag LOCUS_06730 7082 4104 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420345.1 protein_id gnl|my_center|LOCUS_06730 7477 9228 gene locus_tag LOCUS_06740 7477 9228 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071595.1 protein_id gnl|my_center|LOCUS_06740 9383 9994 gene locus_tag LOCUS_06750 9383 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10016 11911 gene locus_tag LOCUS_06760 10016 11911 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_06760 12033 13160 gene locus_tag LOCUS_06770 12033 13160 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 protein_id gnl|my_center|LOCUS_06770 13727 13239 gene locus_tag LOCUS_06780 gene dpsA 13727 13239 CDS product non-specific DNA-binding protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence042 <1 854 gene locus_tag LOCUS_06790 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803576.1:phosphoenolpyruvate synthase 1634 873 gene locus_tag LOCUS_06800 1634 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3435 1777 gene locus_tag LOCUS_06810 3435 1777 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120244.1 protein_id gnl|my_center|LOCUS_06810 4220 3432 gene locus_tag LOCUS_06820 gene gloB 4220 3432 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036190.1 protein_id gnl|my_center|LOCUS_06820 4515 4273 gene locus_tag LOCUS_06830 4515 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4396 5085 gene locus_tag LOCUS_06840 4396 5085 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 protein_id gnl|my_center|LOCUS_06840 5097 5549 gene locus_tag LOCUS_06850 gene rnhA 5097 5549 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241132.1 protein_id gnl|my_center|LOCUS_06850 5552 6265 gene locus_tag LOCUS_06860 gene dnaQ 5552 6265 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_06860 6360 8027 gene locus_tag LOCUS_06870 6360 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8055 9146 gene locus_tag LOCUS_06880 gene sohB 8055 9146 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_06880 9367 9152 gene locus_tag LOCUS_06890 9367 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 9508 10140 gene locus_tag LOCUS_06900 gene mobA 9508 10140 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_06900 10182 11324 gene locus_tag LOCUS_06910 10182 11324 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_06910 12202 11357 gene locus_tag LOCUS_06920 12202 11357 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_06920 12675 12235 gene locus_tag LOCUS_06930 12675 12235 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_06930 12764 13441 gene locus_tag LOCUS_06940 12764 13441 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence043 <1 524 gene locus_tag LOCUS_06950 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369346.1:glycogen synthase GlgA 570 3116 gene locus_tag LOCUS_06960 570 3116 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_06960 4762 3113 gene locus_tag LOCUS_06970 gene pgi 4762 3113 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266656.1 protein_id gnl|my_center|LOCUS_06970 4848 5399 gene locus_tag LOCUS_06980 gene thrB 4848 5399 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939791.1 protein_id gnl|my_center|LOCUS_06980 6456 5350 gene locus_tag LOCUS_06990 gene gcvT 6456 5350 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113083.1 protein_id gnl|my_center|LOCUS_06990 6605 7069 gene locus_tag LOCUS_07000 6605 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 7991 7137 gene locus_tag LOCUS_07010 7991 7137 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_07010 8101 9072 gene locus_tag LOCUS_07020 gene glk 8101 9072 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919917.1 protein_id gnl|my_center|LOCUS_07020 9069 9746 gene locus_tag LOCUS_07030 9069 9746 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_07030 10574 9777 gene locus_tag LOCUS_07040 10574 9777 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112858.1 protein_id gnl|my_center|LOCUS_07040 10655 11905 gene locus_tag LOCUS_07050 10655 11905 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_07050 11992 12531 gene locus_tag LOCUS_07060 11992 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 <13986 12563 gene locus_tag LOCUS_07070 <13986 12563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459240.1:IS1634 family transposase >Feature sequence044 46 492 gene locus_tag LOCUS_07080 46 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 562 2004 gene locus_tag LOCUS_07090 gene fliD 562 2004 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037105.1 protein_id gnl|my_center|LOCUS_07090 2001 2378 gene locus_tag LOCUS_07100 2001 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3634 2399 gene locus_tag LOCUS_07110 gene flgL 3634 2399 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 protein_id gnl|my_center|LOCUS_07110 5651 3648 gene locus_tag LOCUS_07120 gene flgK 5651 3648 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_07120 6620 5655 gene locus_tag LOCUS_07130 gene flgJ 6620 5655 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_07130 7783 6650 gene locus_tag LOCUS_07140 7783 6650 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_07140 8472 7780 gene locus_tag LOCUS_07150 gene flgH 8472 7780 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_07150 9269 8484 gene locus_tag LOCUS_07160 gene flgG 9269 8484 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082164.1 protein_id gnl|my_center|LOCUS_07160 10044 9301 gene locus_tag LOCUS_07170 10044 9301 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767027.1 protein_id gnl|my_center|LOCUS_07170 11454 10063 gene locus_tag LOCUS_07180 gene flgE 11454 10063 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082154.1 protein_id gnl|my_center|LOCUS_07180 12183 11503 gene locus_tag LOCUS_07190 gene flgD 12183 11503 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404333.1 protein_id gnl|my_center|LOCUS_07190 12638 12210 gene locus_tag LOCUS_07200 gene flgC 12638 12210 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082150.1 protein_id gnl|my_center|LOCUS_07200 13030 12635 gene locus_tag LOCUS_07210 gene flgB 13030 12635 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence045 729 1187 gene locus_tag LOCUS_07220 729 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2281 1760 gene locus_tag LOCUS_07230 2281 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3765 2308 gene locus_tag LOCUS_07240 3765 2308 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_07240 3940 4908 gene locus_tag LOCUS_07250 3940 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4905 5600 gene locus_tag LOCUS_07260 4905 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 6824 5922 gene locus_tag LOCUS_07270 6824 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 6983 7753 gene locus_tag LOCUS_07280 6983 7753 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228103.1 protein_id gnl|my_center|LOCUS_07280 8042 8956 gene locus_tag LOCUS_07290 8042 8956 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_07290 8976 9419 gene locus_tag LOCUS_07300 8976 9419 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 protein_id gnl|my_center|LOCUS_07300 9626 10627 gene locus_tag LOCUS_07310 9626 10627 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706768.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence046 <1 663 gene locus_tag LOCUS_07320 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919591.1:enoyl-CoA hydratase 660 1478 gene locus_tag LOCUS_07330 660 1478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160027.1 protein_id gnl|my_center|LOCUS_07330 1647 2627 gene locus_tag LOCUS_07340 1647 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 2767 4275 gene locus_tag LOCUS_07350 2767 4275 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 protein_id gnl|my_center|LOCUS_07350 4305 4895 gene locus_tag LOCUS_07360 4305 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 4919 5695 gene locus_tag LOCUS_07370 4919 5695 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_07370 5750 6664 gene locus_tag LOCUS_07380 5750 6664 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118774.1 protein_id gnl|my_center|LOCUS_07380 6687 7445 gene locus_tag LOCUS_07390 6687 7445 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084281.1 protein_id gnl|my_center|LOCUS_07390 7457 8935 gene locus_tag LOCUS_07400 7457 8935 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403919.1 protein_id gnl|my_center|LOCUS_07400 8940 9689 gene locus_tag LOCUS_07410 8940 9689 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898578.1 protein_id gnl|my_center|LOCUS_07410 9718 10089 gene locus_tag LOCUS_07420 9718 10089 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084283.1 protein_id gnl|my_center|LOCUS_07420 10133 10981 gene locus_tag LOCUS_07430 10133 10981 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730108.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence047 122 1234 gene locus_tag LOCUS_07440 122 1234 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 protein_id gnl|my_center|LOCUS_07440 3012 1228 gene locus_tag LOCUS_07450 3012 1228 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972722.1 protein_id gnl|my_center|LOCUS_07450 4064 3027 gene locus_tag LOCUS_07460 4064 3027 CDS product TIGR03857 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877342.1 protein_id gnl|my_center|LOCUS_07460 4468 5187 gene locus_tag LOCUS_07470 4468 5187 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087019.1 protein_id gnl|my_center|LOCUS_07470 5220 6029 gene locus_tag LOCUS_07480 5220 6029 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_07480 6218 7135 gene locus_tag LOCUS_07490 6218 7135 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089437.1 protein_id gnl|my_center|LOCUS_07490 7927 7205 gene locus_tag LOCUS_07500 7927 7205 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_07500 9091 7931 gene locus_tag LOCUS_07510 9091 7931 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_07510 9686 9102 gene locus_tag LOCUS_07520 9686 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 9821 10945 gene locus_tag LOCUS_07530 gene dinB 9821 10945 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191702.1 protein_id gnl|my_center|LOCUS_07530 10998 11501 gene locus_tag LOCUS_07540 10998 11501 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_07540 11522 11956 gene locus_tag LOCUS_07550 11522 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 12459 11965 gene locus_tag LOCUS_07560 12459 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 <13215 12617 gene locus_tag LOCUS_07570 <13215 12617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000127254.1:NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta >Feature sequence048 1138 2283 gene locus_tag LOCUS_07580 1138 2283 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838634.1 protein_id gnl|my_center|LOCUS_07580 2280 5432 gene locus_tag LOCUS_07590 2280 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 6760 5510 gene locus_tag LOCUS_07600 6760 5510 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941518.1 protein_id gnl|my_center|LOCUS_07600 6924 7580 gene locus_tag LOCUS_07610 gene elbB 6924 7580 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266301.1 protein_id gnl|my_center|LOCUS_07610 10968 7609 gene locus_tag LOCUS_07620 gene mscK 10968 7609 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208612.1 protein_id gnl|my_center|LOCUS_07620 11079 11657 gene locus_tag LOCUS_07630 11079 11657 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389806.1 protein_id gnl|my_center|LOCUS_07630 11762 12577 gene locus_tag LOCUS_07640 11762 12577 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_07640 12602 13174 gene locus_tag LOCUS_07650 12602 13174 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810329.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence049 923 1684 gene locus_tag LOCUS_07660 gene modA 923 1684 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195689.1 protein_id gnl|my_center|LOCUS_07660 1703 2374 gene locus_tag LOCUS_07670 gene modB 1703 2374 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_07670 2386 3084 gene locus_tag LOCUS_07680 2386 3084 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 protein_id gnl|my_center|LOCUS_07680 3166 5193 gene locus_tag LOCUS_07690 3166 5193 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 protein_id gnl|my_center|LOCUS_07690 5217 5759 gene locus_tag LOCUS_07700 5217 5759 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933413.1 protein_id gnl|my_center|LOCUS_07700 5794 6651 gene locus_tag LOCUS_07710 5794 6651 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190826.1 protein_id gnl|my_center|LOCUS_07710 9807 6745 gene locus_tag LOCUS_07720 gene mexW 9807 6745 CDS product multidrug efflux RND transporter permease subunit MexW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112762.1 protein_id gnl|my_center|LOCUS_07720 10904 9804 gene locus_tag LOCUS_07730 gene mexV 10904 9804 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115243.1 protein_id gnl|my_center|LOCUS_07730 11534 11061 gene locus_tag LOCUS_07740 gene bcp 11534 11061 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 protein_id gnl|my_center|LOCUS_07740 12964 11531 gene locus_tag LOCUS_07750 gene rmuC 12964 11531 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_07750 13098 13023 gene locus_tag LOCUS_t00040 13098 13023 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 939 751 gene locus_tag LOCUS_07760 939 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2239 1139 gene locus_tag LOCUS_07770 2239 1139 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038986.1 protein_id gnl|my_center|LOCUS_07770 3216 2278 gene locus_tag LOCUS_07780 3216 2278 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919042.1 protein_id gnl|my_center|LOCUS_07780 4319 3240 gene locus_tag LOCUS_07790 gene lptG 4319 3240 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 protein_id gnl|my_center|LOCUS_07790 5389 4316 gene locus_tag LOCUS_07800 gene lptF 5389 4316 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779635.1 protein_id gnl|my_center|LOCUS_07800 5727 5473 gene locus_tag LOCUS_07810 5727 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5979 7055 gene locus_tag LOCUS_07820 5979 7055 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_07820 7130 8020 gene locus_tag LOCUS_07830 7130 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 9582 8026 gene locus_tag LOCUS_07840 9582 8026 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930845.1 protein_id gnl|my_center|LOCUS_07840 10897 9653 gene locus_tag LOCUS_07850 10897 9653 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447276.1 protein_id gnl|my_center|LOCUS_07850 12208 10940 gene locus_tag LOCUS_07860 12208 10940 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191557.1 protein_id gnl|my_center|LOCUS_07860 12873 12394 gene locus_tag LOCUS_07870 12873 12394 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192835.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence051 124 1275 gene locus_tag LOCUS_07880 124 1275 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_07880 1263 2042 gene locus_tag LOCUS_07890 1263 2042 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_07890 2290 2679 gene locus_tag LOCUS_07900 2290 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3427 2666 gene locus_tag LOCUS_07910 3427 2666 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_07910 3522 4673 gene locus_tag LOCUS_07920 3522 4673 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 protein_id gnl|my_center|LOCUS_07920 5642 4692 gene locus_tag LOCUS_07930 5642 4692 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_07930 5718 7796 gene locus_tag LOCUS_07940 gene dinG 5718 7796 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 protein_id gnl|my_center|LOCUS_07940 7798 8118 gene locus_tag LOCUS_07950 7798 8118 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100152.1 protein_id gnl|my_center|LOCUS_07950 8447 9091 gene locus_tag LOCUS_07960 8447 9091 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_07960 9722 9294 gene locus_tag LOCUS_07970 9722 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 10753 9785 gene locus_tag LOCUS_07980 10753 9785 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261591.1 protein_id gnl|my_center|LOCUS_07980 12287 10755 gene locus_tag LOCUS_07990 12287 10755 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 protein_id gnl|my_center|LOCUS_07990 12760 12320 gene locus_tag LOCUS_08000 12760 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence052 <1 735 gene locus_tag LOCUS_08010 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113831.1:threonine synthase 732 2474 gene locus_tag LOCUS_08020 gene recJ 732 2474 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266941.1 protein_id gnl|my_center|LOCUS_08020 3192 2620 gene locus_tag LOCUS_08030 3192 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4027 3197 gene locus_tag LOCUS_08040 gene rhlP 4027 3197 CDS product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 protein_id gnl|my_center|LOCUS_08040 4190 7513 gene locus_tag LOCUS_08050 gene mscM 4190 7513 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706981.1 protein_id gnl|my_center|LOCUS_08050 7788 11309 gene locus_tag LOCUS_08060 7788 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 12336 11347 gene locus_tag LOCUS_08070 12336 11347 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence053 <1 1313 gene locus_tag LOCUS_08080 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:PilC/PilY family type IV pilus protein 1316 1777 gene locus_tag LOCUS_08090 gene pilE 1316 1777 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_08090 1812 2102 gene locus_tag LOCUS_08100 1812 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2253 2876 gene locus_tag LOCUS_08110 2253 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 3476 2886 gene locus_tag LOCUS_08120 3476 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 5153 3798 gene locus_tag LOCUS_08130 gene pilR 5153 3798 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_08130 6820 5150 gene locus_tag LOCUS_08140 gene pilS 6820 5150 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_08140 7071 6817 gene locus_tag LOCUS_08150 7071 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 7249 8883 gene locus_tag LOCUS_08160 7249 8883 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_08160 9949 9068 gene locus_tag LOCUS_08170 9949 9068 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102590.1 protein_id gnl|my_center|LOCUS_08170 10414 11331 gene locus_tag LOCUS_08180 gene rluD 10414 11331 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_08180 11324 12079 gene locus_tag LOCUS_08190 gene pgeF 11324 12079 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112833.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence054 135 995 gene locus_tag LOCUS_08200 135 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1199 2059 gene locus_tag LOCUS_08210 1199 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2078 2581 gene locus_tag LOCUS_08220 2078 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2586 3194 gene locus_tag LOCUS_08230 2586 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3205 3561 gene locus_tag LOCUS_08240 3205 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3563 5284 gene locus_tag LOCUS_08250 3563 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 5288 7300 gene locus_tag LOCUS_08260 5288 7300 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039462.1 protein_id gnl|my_center|LOCUS_08260 7300 7797 gene locus_tag LOCUS_08270 7300 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7794 9353 gene locus_tag LOCUS_08280 7794 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 9350 9700 gene locus_tag LOCUS_08290 9350 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9705 10070 gene locus_tag LOCUS_08300 9705 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10075 10395 gene locus_tag LOCUS_08310 10075 10395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 10392 11708 gene locus_tag LOCUS_08320 10392 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence055 2040 139 gene locus_tag LOCUS_08330 2040 139 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_08330 3262 2075 gene locus_tag LOCUS_08340 3262 2075 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057979.1 protein_id gnl|my_center|LOCUS_08340 3713 3279 gene locus_tag LOCUS_08350 3713 3279 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075834.1 protein_id gnl|my_center|LOCUS_08350 3963 5150 gene locus_tag LOCUS_08360 3963 5150 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_08360 5147 6316 gene locus_tag LOCUS_08370 5147 6316 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_08370 6464 6940 gene locus_tag LOCUS_08380 6464 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 6941 7564 gene locus_tag LOCUS_08390 6941 7564 CDS product lysophosphatidylcholine acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035483.1 protein_id gnl|my_center|LOCUS_08390 7597 8085 gene locus_tag LOCUS_08400 7597 8085 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_08400 8117 8602 gene locus_tag LOCUS_08410 8117 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 10212 8617 gene locus_tag LOCUS_08420 10212 8617 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_08420 11326 10199 gene locus_tag LOCUS_08430 11326 10199 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528495.1 protein_id gnl|my_center|LOCUS_08430 12306 11323 gene locus_tag LOCUS_08440 12306 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence056 <1 564 gene locus_tag LOCUS_08450 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106429.1:protease modulator HflC 654 839 gene locus_tag LOCUS_08460 654 839 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_08460 862 2058 gene locus_tag LOCUS_08470 862 2058 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402926.1 protein_id gnl|my_center|LOCUS_08470 2078 3376 gene locus_tag LOCUS_08480 2078 3376 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366319.1 protein_id gnl|my_center|LOCUS_08480 3553 3861 gene locus_tag LOCUS_08490 3553 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4951 4058 gene locus_tag LOCUS_08500 4951 4058 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 protein_id gnl|my_center|LOCUS_08500 5152 5066 gene locus_tag LOCUS_t00050 5152 5066 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5291 7594 gene locus_tag LOCUS_08510 gene rnr 5291 7594 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_08510 7609 8349 gene locus_tag LOCUS_08520 gene rlmB 7609 8349 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095638.1 protein_id gnl|my_center|LOCUS_08520 8744 9163 gene locus_tag LOCUS_08530 8744 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 9215 9442 gene locus_tag LOCUS_08540 gene rpsR 9215 9442 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874511.1 protein_id gnl|my_center|LOCUS_08540 9483 10343 gene locus_tag LOCUS_08550 9483 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_08550 10381 10827 gene locus_tag LOCUS_08560 gene rplI 10381 10827 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095627.1 protein_id gnl|my_center|LOCUS_08560 10919 12325 gene locus_tag LOCUS_08570 gene dnaB 10919 12325 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112283.1 protein_id gnl|my_center|LOCUS_08570 12433 12506 gene locus_tag LOCUS_t00060 12433 12506 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 <12568 11739 gene locus_tag LOCUS_08580 <12568 11739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918155.1:NAD(+) diphosphatase >Feature sequence058 920 18 gene locus_tag LOCUS_08590 920 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1392 976 gene locus_tag LOCUS_08600 1392 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1529 2815 gene locus_tag LOCUS_08610 1529 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2827 4068 gene locus_tag LOCUS_08620 2827 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 4065 5246 gene locus_tag LOCUS_08630 4065 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5284 6801 gene locus_tag LOCUS_08640 5284 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 6798 8864 gene locus_tag LOCUS_08650 6798 8864 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008292761.1 protein_id gnl|my_center|LOCUS_08650 8861 9121 gene locus_tag LOCUS_08660 8861 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 9142 9948 gene locus_tag LOCUS_08670 9142 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9951 11327 gene locus_tag LOCUS_08680 9951 11327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 11317 12405 gene locus_tag LOCUS_08690 11317 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence059 2425 2003 gene locus_tag LOCUS_08700 2425 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2681 2418 gene locus_tag LOCUS_08710 2681 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2966 3844 gene locus_tag LOCUS_08720 2966 3844 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896372.1 protein_id gnl|my_center|LOCUS_08720 4057 4668 gene locus_tag LOCUS_08730 gene gstA 4057 4668 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_08730 4719 6146 gene locus_tag LOCUS_08740 gene hemN 4719 6146 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535314.1 protein_id gnl|my_center|LOCUS_08740 6226 6729 gene locus_tag LOCUS_08750 6226 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 8528 6786 gene locus_tag LOCUS_08760 gene cysI 8528 6786 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_08760 10384 8537 gene locus_tag LOCUS_08770 10384 8537 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_08770 10665 11204 gene locus_tag LOCUS_08780 10665 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence060 829 23 gene locus_tag LOCUS_08790 829 23 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946385.1 protein_id gnl|my_center|LOCUS_08790 1936 893 gene locus_tag LOCUS_08800 1936 893 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113026.1 protein_id gnl|my_center|LOCUS_08800 2714 1962 gene locus_tag LOCUS_08810 2714 1962 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_08810 3491 2733 gene locus_tag LOCUS_08820 3491 2733 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_08820 4028 3543 gene locus_tag LOCUS_08830 4028 3543 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892969.1 protein_id gnl|my_center|LOCUS_08830 6288 4129 gene locus_tag LOCUS_08840 6288 4129 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135545767.1 protein_id gnl|my_center|LOCUS_08840 6716 6288 gene locus_tag LOCUS_08850 6716 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 6841 9261 gene locus_tag LOCUS_08860 6841 9261 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_08860 9335 9811 gene locus_tag LOCUS_08870 9335 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 11021 9885 gene locus_tag LOCUS_08880 11021 9885 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086644.1 protein_id gnl|my_center|LOCUS_08880 11221 11667 gene locus_tag LOCUS_08890 11221 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence061 2291 981 gene locus_tag LOCUS_08900 2291 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2867 2292 gene locus_tag LOCUS_08910 2867 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4149 3442 gene locus_tag LOCUS_08920 4149 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5848 5045 gene locus_tag LOCUS_08930 5848 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 6227 5841 gene locus_tag LOCUS_08940 6227 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 7224 6319 gene locus_tag LOCUS_08950 7224 6319 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132696218.1 protein_id gnl|my_center|LOCUS_08950 8199 7234 gene locus_tag LOCUS_08960 8199 7234 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176618.1 protein_id gnl|my_center|LOCUS_08960 9977 8199 gene locus_tag LOCUS_08970 9977 8199 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_08970 11146 9983 gene locus_tag LOCUS_08980 11146 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 11691 11146 gene locus_tag LOCUS_08990 11691 11146 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463089.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence062 295 1113 gene locus_tag LOCUS_09000 gene ccsA 295 1113 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765867.1 protein_id gnl|my_center|LOCUS_09000 1187 2446 gene locus_tag LOCUS_09010 1187 2446 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_09010 2995 2435 gene locus_tag LOCUS_09020 2995 2435 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337845.1 protein_id gnl|my_center|LOCUS_09020 3577 3008 gene locus_tag LOCUS_09030 3577 3008 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 protein_id gnl|my_center|LOCUS_09030 3906 3574 gene locus_tag LOCUS_09040 3906 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 5029 3908 gene locus_tag LOCUS_09050 gene tgt 5029 3908 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_09050 6108 5026 gene locus_tag LOCUS_09060 gene queA 6108 5026 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_09060 6227 6314 gene locus_tag LOCUS_t00070 6227 6314 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6483 6749 gene locus_tag LOCUS_09070 6483 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 7929 6985 gene locus_tag LOCUS_09080 7929 6985 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_09080 8467 8042 gene locus_tag LOCUS_09090 8467 8042 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224383.1 protein_id gnl|my_center|LOCUS_09090 9600 8464 gene locus_tag LOCUS_09100 9600 8464 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_09100 10150 9602 gene locus_tag LOCUS_09110 10150 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 10815 10147 gene locus_tag LOCUS_09120 10815 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence063 <1 517 gene locus_tag LOCUS_09130 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902861.1:acyl-CoA dehydrogenase family protein 527 967 gene locus_tag LOCUS_09140 527 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 978 1553 gene locus_tag LOCUS_09150 978 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1568 2719 gene locus_tag LOCUS_09160 1568 2719 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_09160 2726 3145 gene locus_tag LOCUS_09170 2726 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3687 3142 gene locus_tag LOCUS_09180 3687 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4112 3684 gene locus_tag LOCUS_09190 4112 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4708 4121 gene locus_tag LOCUS_09200 4708 4121 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180325543.1 protein_id gnl|my_center|LOCUS_09200 4863 6608 gene locus_tag LOCUS_09210 4863 6608 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706260.1 protein_id gnl|my_center|LOCUS_09210 6605 8356 gene locus_tag LOCUS_09220 6605 8356 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706258.1 protein_id gnl|my_center|LOCUS_09220 9262 8378 gene locus_tag LOCUS_09230 gene pbpG 9262 8378 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707427.1 protein_id gnl|my_center|LOCUS_09230 9982 9371 gene locus_tag LOCUS_09240 9982 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_09240 10147 11007 gene locus_tag LOCUS_09250 10147 11007 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence064 2086 1562 gene locus_tag LOCUS_09260 gene pilP 2086 1562 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_09260 2691 2083 gene locus_tag LOCUS_09270 gene pilO 2691 2083 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_09270 3277 2696 gene locus_tag LOCUS_09280 gene pilN 3277 2696 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_09280 4275 3277 gene locus_tag LOCUS_09290 4275 3277 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_09290 4572 6914 gene locus_tag LOCUS_09300 4572 6914 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114576.1 protein_id gnl|my_center|LOCUS_09300 7742 6915 gene locus_tag LOCUS_09310 7742 6915 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105331.1 protein_id gnl|my_center|LOCUS_09310 7972 7760 gene locus_tag LOCUS_09320 gene rpmE 7972 7760 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095846.1 protein_id gnl|my_center|LOCUS_09320 8102 10396 gene locus_tag LOCUS_09330 8102 10396 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266372.1 protein_id gnl|my_center|LOCUS_09330 10514 11248 gene locus_tag LOCUS_09340 10514 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence065 <1 2821 gene locus_tag LOCUS_09350 <1 2821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105494.1:ATP-dependent RNA helicase HrpA 2917 3795 gene locus_tag LOCUS_09360 2917 3795 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707407.1 protein_id gnl|my_center|LOCUS_09360 3866 4600 gene locus_tag LOCUS_09370 3866 4600 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_09370 5572 4607 gene locus_tag LOCUS_09380 gene dusA 5572 4607 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086515.1 protein_id gnl|my_center|LOCUS_09380 5747 7114 gene locus_tag LOCUS_09390 5747 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7114 8526 gene locus_tag LOCUS_09400 gene gndA 7114 8526 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529537.1 protein_id gnl|my_center|LOCUS_09400 8511 10052 gene locus_tag LOCUS_09410 gene zwf 8511 10052 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_09410 10055 10753 gene locus_tag LOCUS_09420 gene pgl 10055 10753 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence066 1411 557 gene locus_tag LOCUS_09430 gene panC 1411 557 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246105.1 protein_id gnl|my_center|LOCUS_09430 2230 1439 gene locus_tag LOCUS_09440 gene panB 2230 1439 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_09440 2916 2245 gene locus_tag LOCUS_09450 2916 2245 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_09450 3421 2909 gene locus_tag LOCUS_09460 gene folK 3421 2909 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209351.1 protein_id gnl|my_center|LOCUS_09460 4748 3411 gene locus_tag LOCUS_09470 4748 3411 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_09470 6487 5096 gene locus_tag LOCUS_09480 gene cbrB 6487 5096 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_09480 9493 6533 gene locus_tag LOCUS_09490 gene cbrA 9493 6533 CDS product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_09490 9659 9483 gene locus_tag LOCUS_09500 9659 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 10614 9733 gene locus_tag LOCUS_09510 gene gluQRS 10614 9733 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228220.1 protein_id gnl|my_center|LOCUS_09510 11110 10670 gene locus_tag LOCUS_09520 gene dksA 11110 10670 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence067 985 554 gene locus_tag LOCUS_09530 985 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2081 1071 gene locus_tag LOCUS_09540 gene trpS 2081 1071 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225097.1 protein_id gnl|my_center|LOCUS_09540 2225 3016 gene locus_tag LOCUS_09550 2225 3016 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_09550 4363 3065 gene locus_tag LOCUS_09560 4363 3065 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267127.1 protein_id gnl|my_center|LOCUS_09560 5244 4360 gene locus_tag LOCUS_09570 5244 4360 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_09570 5528 5253 gene locus_tag LOCUS_09580 5528 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 6348 5650 gene locus_tag LOCUS_09590 gene tsaB 6348 5650 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 protein_id gnl|my_center|LOCUS_09590 6881 6468 gene locus_tag LOCUS_09600 6881 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 8059 7010 gene locus_tag LOCUS_09610 gene hemH 8059 7010 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927663.1 protein_id gnl|my_center|LOCUS_09610 8725 8084 gene locus_tag LOCUS_09620 gene adk 8725 8084 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 protein_id gnl|my_center|LOCUS_09620 9681 8857 gene locus_tag LOCUS_09630 gene mazG 9681 8857 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 protein_id gnl|my_center|LOCUS_09630 <10948 9695 gene locus_tag LOCUS_09640 <10948 9695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086042.1:GTP diphosphokinase >Feature sequence068 <1 1884 gene locus_tag LOCUS_09650 <1 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100609.1:protein translocase subunit SecD 1900 2823 gene locus_tag LOCUS_09660 gene secF 1900 2823 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_09660 3672 2836 gene locus_tag LOCUS_09670 gene suhB 3672 2836 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380594.1 protein_id gnl|my_center|LOCUS_09670 3801 4586 gene locus_tag LOCUS_09680 gene trmJ 3801 4586 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113799.1 protein_id gnl|my_center|LOCUS_09680 4647 5141 gene locus_tag LOCUS_09690 gene iscR 4647 5141 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_09690 5156 6334 gene locus_tag LOCUS_09700 gene iscS 5156 6334 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 protein_id gnl|my_center|LOCUS_09700 6455 6883 gene locus_tag LOCUS_09710 gene ndk 6455 6883 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092811.1 protein_id gnl|my_center|LOCUS_09710 6900 8057 gene locus_tag LOCUS_09720 gene rlmN 6900 8057 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266908.1 protein_id gnl|my_center|LOCUS_09720 8054 8839 gene locus_tag LOCUS_09730 gene pilF 8054 8839 CDS product type 4a pilus biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_09730 8846 9352 gene locus_tag LOCUS_09740 8846 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 9354 10478 gene locus_tag LOCUS_09750 gene ispG 9354 10478 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence069 <1 1550 gene locus_tag LOCUS_09760 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003917711.1:type I polyketide synthase 1547 2434 gene locus_tag LOCUS_09770 1547 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 2526 6173 gene locus_tag LOCUS_09780 2526 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6166 10695 gene locus_tag LOCUS_09790 6166 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence070 535 65 gene locus_tag LOCUS_09800 535 65 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_09800 678 1511 gene locus_tag LOCUS_09810 678 1511 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_09810 3023 1596 gene locus_tag LOCUS_09820 3023 1596 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338379.1 protein_id gnl|my_center|LOCUS_09820 4285 3116 gene locus_tag LOCUS_09830 4285 3116 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039722.1 protein_id gnl|my_center|LOCUS_09830 5601 4282 gene locus_tag LOCUS_09840 5601 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_09840 5858 5598 gene locus_tag LOCUS_09850 5858 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 6301 5855 gene locus_tag LOCUS_09860 6301 5855 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_09860 6609 7277 gene locus_tag LOCUS_09870 6609 7277 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083342.1 protein_id gnl|my_center|LOCUS_09870 9254 7341 gene locus_tag LOCUS_09880 9254 7341 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_09880 7707 7731 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <10664 9333 gene locus_tag LOCUS_09890 <10664 9333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197535743.1:arylsulfatase >Feature sequence071 2894 1095 gene locus_tag LOCUS_09900 2894 1095 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_09900 2979 3917 gene locus_tag LOCUS_09910 2979 3917 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029966.1 protein_id gnl|my_center|LOCUS_09910 4024 5190 gene locus_tag LOCUS_09920 gene argE 4024 5190 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_09920 5187 6488 gene locus_tag LOCUS_09930 gene argA 5187 6488 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096265.1 protein_id gnl|my_center|LOCUS_09930 8667 6538 gene locus_tag LOCUS_09940 8667 6538 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_09940 10292 8859 gene locus_tag LOCUS_09950 10292 8859 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence072 993 388 gene locus_tag LOCUS_09960 993 388 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_09960 1348 1037 gene locus_tag LOCUS_09970 gene scyA 1348 1037 CDS product monoheme cytochrome c5 ScyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 protein_id gnl|my_center|LOCUS_09970 1490 2110 gene locus_tag LOCUS_09980 gene yihA 1490 2110 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 protein_id gnl|my_center|LOCUS_09980 4871 2133 gene locus_tag LOCUS_09990 gene polA 4871 2133 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 protein_id gnl|my_center|LOCUS_09990 5780 4878 gene locus_tag LOCUS_10000 gene znuA 5780 4878 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707443.1 protein_id gnl|my_center|LOCUS_10000 5971 6339 gene locus_tag LOCUS_10010 5971 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 6336 7088 gene locus_tag LOCUS_10020 gene znuC 6336 7088 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768460.1 protein_id gnl|my_center|LOCUS_10020 7081 7866 gene locus_tag LOCUS_10030 gene znuB 7081 7866 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247039.1 protein_id gnl|my_center|LOCUS_10030 8204 7977 gene locus_tag LOCUS_10040 8204 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 9517 8201 gene locus_tag LOCUS_10050 9517 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 <10443 9543 gene locus_tag LOCUS_10060 <10443 9543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097311.1:oxygen-dependent coproporphyrinogen oxidase >Feature sequence073 267 1160 gene locus_tag LOCUS_10070 267 1160 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_10070 1247 1795 gene locus_tag LOCUS_10080 1247 1795 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_10080 1796 2221 gene locus_tag LOCUS_10090 gene ruvX 1796 2221 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209978.1 protein_id gnl|my_center|LOCUS_10090 3400 2222 gene locus_tag LOCUS_10100 gene pilU 3400 2222 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_10100 4477 3443 gene locus_tag LOCUS_10110 gene pilT 4477 3443 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_10110 4623 5309 gene locus_tag LOCUS_10120 4623 5309 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_10120 5336 6166 gene locus_tag LOCUS_10130 gene proC 5336 6166 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_10130 6183 6770 gene locus_tag LOCUS_10140 6183 6770 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_10140 6770 7075 gene locus_tag LOCUS_10150 6770 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 7124 8305 gene locus_tag LOCUS_10160 7124 8305 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266425.1 protein_id gnl|my_center|LOCUS_10160 8295 8885 gene locus_tag LOCUS_10170 gene metW 8295 8885 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_10170 8885 9325 gene locus_tag LOCUS_10180 8885 9325 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461703.1 protein_id gnl|my_center|LOCUS_10180 9315 9926 gene locus_tag LOCUS_10190 9315 9926 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369727.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence074 1547 693 gene locus_tag LOCUS_10200 1547 693 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405474.1 protein_id gnl|my_center|LOCUS_10200 2947 1769 gene locus_tag LOCUS_10210 2947 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3169 4536 gene locus_tag LOCUS_10220 3169 4536 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_10220 5933 4569 gene locus_tag LOCUS_10230 5933 4569 CDS product aminoacyl-tRNA deacylase and HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769583.1 protein_id gnl|my_center|LOCUS_10230 8078 6024 gene locus_tag LOCUS_10240 gene recG 8078 6024 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_10240 8582 8193 gene locus_tag LOCUS_10250 8582 8193 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_10250 <10188 8614 gene locus_tag LOCUS_10260 <10188 8614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404001.1:bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase >Feature sequence075 1885 1199 gene locus_tag LOCUS_10270 1885 1199 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 protein_id gnl|my_center|LOCUS_10270 2600 1890 gene locus_tag LOCUS_10280 gene rpe 2600 1890 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 protein_id gnl|my_center|LOCUS_10280 2825 3544 gene locus_tag LOCUS_10290 2825 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4199 3477 gene locus_tag LOCUS_10300 gene murU 4199 3477 CDS product N-acetylmuramate alpha-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 protein_id gnl|my_center|LOCUS_10300 5212 4196 gene locus_tag LOCUS_10310 5212 4196 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_10310 5394 7949 gene locus_tag LOCUS_10320 5394 7949 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463957.1 protein_id gnl|my_center|LOCUS_10320 7963 9249 gene locus_tag LOCUS_10330 7963 9249 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence076 2451 724 gene locus_tag LOCUS_10340 2451 724 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943911.1 protein_id gnl|my_center|LOCUS_10340 2626 4083 gene locus_tag LOCUS_10350 gene pabB 2626 4083 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_10350 4708 4070 gene locus_tag LOCUS_10360 gene thrH 4708 4070 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765732.1 protein_id gnl|my_center|LOCUS_10360 5722 4763 gene locus_tag LOCUS_10370 gene cysB 5722 4763 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_10370 5943 6311 gene locus_tag LOCUS_10380 5943 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 6339 7169 gene locus_tag LOCUS_10390 6339 7169 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938457.1 protein_id gnl|my_center|LOCUS_10390 8099 7200 gene locus_tag LOCUS_10400 8099 7200 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_10400 8913 8101 gene locus_tag LOCUS_10410 8913 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 9948 8917 gene locus_tag LOCUS_10420 9948 8917 CDS product aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082912.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence077 226 1599 gene locus_tag LOCUS_10430 226 1599 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_10430 1730 2941 gene locus_tag LOCUS_10440 1730 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3760 2930 gene locus_tag LOCUS_10450 3760 2930 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_10450 5009 3816 gene locus_tag LOCUS_10460 5009 3816 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192836.1 protein_id gnl|my_center|LOCUS_10460 7962 5101 gene locus_tag LOCUS_10470 7962 5101 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_10470 8260 8033 gene locus_tag LOCUS_10480 8260 8033 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_10480 8347 9876 gene locus_tag LOCUS_10490 8347 9876 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409438.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence078 615 3332 gene locus_tag LOCUS_10500 615 3332 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114341.1 protein_id gnl|my_center|LOCUS_10500 3475 4740 gene locus_tag LOCUS_10510 gene lysA 3475 4740 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704446.1 protein_id gnl|my_center|LOCUS_10510 4740 5570 gene locus_tag LOCUS_10520 gene dapF 4740 5570 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_10520 5567 6295 gene locus_tag LOCUS_10530 5567 6295 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_10530 6302 7225 gene locus_tag LOCUS_10540 gene xerC 6302 7225 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_10540 7222 7953 gene locus_tag LOCUS_10550 7222 7953 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_10550 8258 7971 gene locus_tag LOCUS_10560 8258 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8760 8422 gene locus_tag LOCUS_10570 gene glnK 8760 8422 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_10570 9425 8949 gene locus_tag LOCUS_10580 9425 8949 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence079 237 836 gene locus_tag LOCUS_10590 237 836 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_10590 2900 912 gene locus_tag LOCUS_10600 2900 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3598 2981 gene locus_tag LOCUS_10610 3598 2981 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_10610 3685 5175 gene locus_tag LOCUS_10620 gene modF 3685 5175 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704776.1 protein_id gnl|my_center|LOCUS_10620 5906 5187 gene locus_tag LOCUS_10630 5906 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217636804.1 protein_id gnl|my_center|LOCUS_10630 7709 5982 gene locus_tag LOCUS_10640 7709 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10640 8316 7684 gene locus_tag LOCUS_10650 8316 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10650 9741 8701 gene locus_tag LOCUS_10660 9741 8701 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence080 206 1216 gene locus_tag LOCUS_10670 206 1216 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_10670 4343 1230 gene locus_tag LOCUS_10680 4343 1230 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_10680 5392 4340 gene locus_tag LOCUS_10690 5392 4340 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_10690 6325 5423 gene locus_tag LOCUS_10700 6325 5423 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815851.1 protein_id gnl|my_center|LOCUS_10700 6488 8056 gene locus_tag LOCUS_10710 gene gshA 6488 8056 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535409.1 protein_id gnl|my_center|LOCUS_10710 8064 8666 gene locus_tag LOCUS_10720 8064 8666 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768620.1 protein_id gnl|my_center|LOCUS_10720 9057 8650 gene locus_tag LOCUS_10730 9057 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 9169 9669 gene locus_tag LOCUS_10740 9169 9669 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence081 1468 428 gene locus_tag LOCUS_10750 1468 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1834 1628 gene locus_tag LOCUS_10760 1834 1628 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479953.1 protein_id gnl|my_center|LOCUS_10760 3046 1865 gene locus_tag LOCUS_10770 3046 1865 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480052.1 protein_id gnl|my_center|LOCUS_10770 3985 3068 gene locus_tag LOCUS_10780 3985 3068 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 protein_id gnl|my_center|LOCUS_10780 5190 4036 gene locus_tag LOCUS_10790 5190 4036 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_10790 6452 5187 gene locus_tag LOCUS_10800 6452 5187 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_10800 6500 7399 gene locus_tag LOCUS_10810 gene tesB 6500 7399 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528888.1 protein_id gnl|my_center|LOCUS_10810 7476 9041 gene locus_tag LOCUS_10820 7476 9041 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence082 <1 1218 gene locus_tag LOCUS_10830 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095854.1:ATP-dependent protease ATPase subunit HslU 1259 1651 gene locus_tag LOCUS_10840 1259 1651 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_10840 1676 2431 gene locus_tag LOCUS_10850 gene ubiE 1676 2431 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_10850 2428 3081 gene locus_tag LOCUS_10860 2428 3081 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403066.1 protein_id gnl|my_center|LOCUS_10860 3088 4704 gene locus_tag LOCUS_10870 gene ubiB 3088 4704 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_10870 4754 5161 gene locus_tag LOCUS_10880 gene hisI 4754 5161 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105339.1 protein_id gnl|my_center|LOCUS_10880 5154 5513 gene locus_tag LOCUS_10890 5154 5513 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_10890 5526 5762 gene locus_tag LOCUS_10900 gene tatA 5526 5762 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508972.1 protein_id gnl|my_center|LOCUS_10900 5773 6132 gene locus_tag LOCUS_10910 5773 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 6129 6911 gene locus_tag LOCUS_10920 gene tatC 6129 6911 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_10920 7326 6889 gene locus_tag LOCUS_10930 gene dtd 7326 6889 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_10930 8293 7337 gene locus_tag LOCUS_10940 gene pip 8293 7337 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_10940 9441 8476 gene locus_tag LOCUS_10950 9441 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence083 3 1025 gene locus_tag LOCUS_10960 3 1025 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_10960 1107 3314 gene locus_tag LOCUS_10970 1107 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 3469 4128 gene locus_tag LOCUS_10980 gene truA 3469 4128 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706494.1 protein_id gnl|my_center|LOCUS_10980 4237 4815 gene locus_tag LOCUS_10990 4237 4815 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_10990 4838 5764 gene locus_tag LOCUS_11000 gene accD 4838 5764 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_11000 5785 7059 gene locus_tag LOCUS_11010 gene folC 5785 7059 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_11010 7078 7719 gene locus_tag LOCUS_11020 gene dedD 7078 7719 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146989.1 protein_id gnl|my_center|LOCUS_11020 7777 8283 gene locus_tag LOCUS_11030 7777 8283 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence084 523 1785 gene locus_tag LOCUS_11040 523 1785 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_11040 2904 1807 gene locus_tag LOCUS_11050 2904 1807 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114484.1 protein_id gnl|my_center|LOCUS_11050 6326 2901 gene locus_tag LOCUS_11060 6326 2901 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210167.1 protein_id gnl|my_center|LOCUS_11060 7951 6323 gene locus_tag LOCUS_11070 7951 6323 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_11070 7859 8170 gene locus_tag LOCUS_11080 7859 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8236 9291 gene locus_tag LOCUS_11090 8236 9291 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence085 <1 1983 gene locus_tag LOCUS_11100 <1 1983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026080084.1:DEAD/DEAH box helicase 2163 2810 gene locus_tag LOCUS_11110 2163 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2830 3900 gene locus_tag LOCUS_11120 gene narH 2830 3900 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438317.1 protein_id gnl|my_center|LOCUS_11120 3923 6832 gene locus_tag LOCUS_11130 3923 6832 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_11130 6862 8061 gene locus_tag LOCUS_11140 6862 8061 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_11140 8097 9194 gene locus_tag LOCUS_11150 8097 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence086 305 30 gene locus_tag LOCUS_11160 305 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 844 437 gene locus_tag LOCUS_11170 844 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2203 902 gene locus_tag LOCUS_11180 2203 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2885 2205 gene locus_tag LOCUS_11190 gene carR 2885 2205 CDS product two-component system response regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090494.1 protein_id gnl|my_center|LOCUS_11190 3190 2885 gene locus_tag LOCUS_11200 3190 2885 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_11200 3504 3196 gene locus_tag LOCUS_11210 3504 3196 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090497.1 protein_id gnl|my_center|LOCUS_11210 4111 3602 gene locus_tag LOCUS_11220 gene rnk 4111 3602 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096424.1 protein_id gnl|my_center|LOCUS_11220 5343 4180 gene locus_tag LOCUS_11230 5343 4180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528655.1 protein_id gnl|my_center|LOCUS_11230 6260 5340 gene locus_tag LOCUS_11240 6260 5340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 protein_id gnl|my_center|LOCUS_11240 7204 6257 gene locus_tag LOCUS_11250 7204 6257 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528657.1 protein_id gnl|my_center|LOCUS_11250 7403 8428 gene locus_tag LOCUS_11260 gene pstS 7403 8428 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_11260 8438 9394 gene locus_tag LOCUS_11270 gene pstC 8438 9394 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence087 1508 213 gene locus_tag LOCUS_11280 1508 213 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_11280 2835 1483 gene locus_tag LOCUS_11290 2835 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3866 2886 gene locus_tag LOCUS_11300 3866 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4736 3951 gene locus_tag LOCUS_11310 4736 3951 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_11310 6255 4867 gene locus_tag LOCUS_11320 6255 4867 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640513.1 protein_id gnl|my_center|LOCUS_11320 7518 6331 gene locus_tag LOCUS_11330 7518 6331 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_11330 8675 7515 gene locus_tag LOCUS_11340 8675 7515 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_11340 <9341 8726 gene locus_tag LOCUS_11350 <9341 8726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730964.1:SDR family oxidoreductase >Feature sequence088 3021 733 gene locus_tag LOCUS_11360 gene atsD 3021 733 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_11360 4523 3219 gene locus_tag LOCUS_11370 4523 3219 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096809.1 protein_id gnl|my_center|LOCUS_11370 4773 5240 gene locus_tag LOCUS_11380 4773 5240 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890417.1 protein_id gnl|my_center|LOCUS_11380 5255 5686 gene locus_tag LOCUS_11390 5255 5686 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890418.1 protein_id gnl|my_center|LOCUS_11390 6937 5801 gene locus_tag LOCUS_11400 6937 5801 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_11400 7263 8945 gene locus_tag LOCUS_11410 gene ilvD 7263 8945 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence089 <1 1193 gene locus_tag LOCUS_11420 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003409207.1:FAD-binding protein 3256 1379 gene locus_tag LOCUS_11430 3256 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5668 3269 gene locus_tag LOCUS_11440 5668 3269 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_11440 5817 6470 gene locus_tag LOCUS_11450 5817 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8009 6528 gene locus_tag LOCUS_11460 8009 6528 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113127.1 protein_id gnl|my_center|LOCUS_11460 8296 8904 gene locus_tag LOCUS_11470 gene slmA 8296 8904 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence090 188 9097 gene locus_tag LOCUS_11480 188 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence091 <1 882 gene locus_tag LOCUS_11490 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918693.1:efflux RND transporter periplasmic adaptor subunit 882 3986 gene locus_tag LOCUS_11500 882 3986 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 protein_id gnl|my_center|LOCUS_11500 4722 4024 gene locus_tag LOCUS_11510 4722 4024 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731326.1 protein_id gnl|my_center|LOCUS_11510 5590 4775 gene locus_tag LOCUS_11520 5590 4775 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419179.1 protein_id gnl|my_center|LOCUS_11520 7271 5637 gene locus_tag LOCUS_11530 7271 5637 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_11530 8796 7390 gene locus_tag LOCUS_11540 gene der 8796 7390 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence092 120 695 gene locus_tag LOCUS_11550 120 695 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_11550 699 1613 gene locus_tag LOCUS_11560 699 1613 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_11560 2835 1654 gene locus_tag LOCUS_11570 gene yjiB 2835 1654 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_11570 4223 2832 gene locus_tag LOCUS_11580 4223 2832 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729626.1 protein_id gnl|my_center|LOCUS_11580 4353 5168 gene locus_tag LOCUS_11590 4353 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 5812 5177 gene locus_tag LOCUS_11600 5812 5177 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_11600 6441 6175 gene locus_tag LOCUS_11610 6441 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence093 293 2932 gene locus_tag LOCUS_11620 293 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2929 3939 gene locus_tag LOCUS_11630 2929 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 4014 5111 gene locus_tag LOCUS_11640 4014 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5176 6144 gene locus_tag LOCUS_11650 5176 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6227 8215 gene locus_tag LOCUS_11660 6227 8215 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224756.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence094 153 815 gene locus_tag LOCUS_11670 153 815 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_11670 818 1486 gene locus_tag LOCUS_11680 818 1486 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_11680 3357 1501 gene locus_tag LOCUS_11690 3357 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3785 3366 gene locus_tag LOCUS_11700 3785 3366 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_11700 5164 3782 gene locus_tag LOCUS_11710 5164 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5309 5923 gene locus_tag LOCUS_11720 5309 5923 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550955.1 protein_id gnl|my_center|LOCUS_11720 5927 6793 gene locus_tag LOCUS_11730 5927 6793 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189948.1 protein_id gnl|my_center|LOCUS_11730 6787 7284 gene locus_tag LOCUS_11740 6787 7284 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_11740 7378 8838 gene locus_tag LOCUS_11750 7378 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence095 1313 54 gene locus_tag LOCUS_11760 1313 54 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_11760 1684 1310 gene locus_tag LOCUS_11770 1684 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2347 1919 gene locus_tag LOCUS_11780 2347 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3365 2457 gene locus_tag LOCUS_11790 3365 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3694 4452 gene locus_tag LOCUS_11800 3694 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4642 5469 gene locus_tag LOCUS_11810 4642 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6377 5478 gene locus_tag LOCUS_11820 6377 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 7065 7442 gene locus_tag LOCUS_11830 7065 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 <8952 7572 gene locus_tag LOCUS_11840 <8952 7572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143596.1:sucrose synthase >Feature sequence096 997 782 gene locus_tag LOCUS_11850 997 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2109 1183 gene locus_tag LOCUS_11860 2109 1183 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206768431.1 protein_id gnl|my_center|LOCUS_11860 2799 2191 gene locus_tag LOCUS_11870 2799 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4127 3003 gene locus_tag LOCUS_11880 4127 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5010 4231 gene locus_tag LOCUS_11890 5010 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5519 5208 gene locus_tag LOCUS_11900 5519 5208 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545884.1 protein_id gnl|my_center|LOCUS_11900 5586 6473 gene locus_tag LOCUS_11910 5586 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6470 7438 gene locus_tag LOCUS_11920 6470 7438 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_11920 7435 8502 gene locus_tag LOCUS_11930 7435 8502 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128948541.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence097 1105 134 gene locus_tag LOCUS_11940 1105 134 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_11940 2352 1132 gene locus_tag LOCUS_11950 gene rfbH 2352 1132 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227240.1 protein_id gnl|my_center|LOCUS_11950 2511 3629 gene locus_tag LOCUS_11960 2511 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 5991 3580 gene locus_tag LOCUS_11970 5991 3580 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039380.1 protein_id gnl|my_center|LOCUS_11970 6122 7030 gene locus_tag LOCUS_11980 6122 7030 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_11980 8539 7271 gene locus_tag LOCUS_11990 8539 7271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence098 387 1838 gene locus_tag LOCUS_12000 387 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1851 2996 gene locus_tag LOCUS_12010 gene wecB 1851 2996 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_12010 2993 3862 gene locus_tag LOCUS_12020 2993 3862 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_12020 3871 4902 gene locus_tag LOCUS_12030 3871 4902 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_12030 4905 6134 gene locus_tag LOCUS_12040 4905 6134 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_12040 6135 7328 gene locus_tag LOCUS_12050 6135 7328 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_12050 7321 8646 gene locus_tag LOCUS_12060 7321 8646 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence099 1048 341 gene locus_tag LOCUS_12070 gene fliA 1048 341 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_12070 1907 1074 gene locus_tag LOCUS_12080 gene fleN 1907 1074 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083064.1 protein_id gnl|my_center|LOCUS_12080 3147 1930 gene locus_tag LOCUS_12090 gene flhF 3147 1930 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946725.1 protein_id gnl|my_center|LOCUS_12090 5272 3149 gene locus_tag LOCUS_12100 gene flhA 5272 3149 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_12100 6513 5374 gene locus_tag LOCUS_12110 gene flhB 6513 5374 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_12110 6700 7149 gene locus_tag LOCUS_12120 6700 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 7220 8620 gene locus_tag LOCUS_12130 gene sthA 7220 8620 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence100 <1 1450 gene locus_tag LOCUS_12140 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005073515.1:DUF3336 domain-containing protein 3960 1579 gene locus_tag LOCUS_12150 3960 1579 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 protein_id gnl|my_center|LOCUS_12150 4738 4061 gene locus_tag LOCUS_12160 4738 4061 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080706.1 protein_id gnl|my_center|LOCUS_12160 6319 4865 gene locus_tag LOCUS_12170 6319 4865 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_12170 6352 6567 gene locus_tag LOCUS_12180 6352 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8173 6554 gene locus_tag LOCUS_12190 8173 6554 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_12190 <8689 8190 gene locus_tag LOCUS_12200 <8689 8190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039902.1:thiolase family protein >Feature sequence101 168 1649 gene locus_tag LOCUS_12210 168 1649 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_12210 1725 3848 gene locus_tag LOCUS_12220 1725 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_12220 5960 4023 gene locus_tag LOCUS_12230 5960 4023 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_12230 6190 7341 gene locus_tag LOCUS_12240 6190 7341 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_12240 7382 8569 gene locus_tag LOCUS_12250 7382 8569 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269302.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence102 426 782 gene locus_tag LOCUS_12260 gene flgM 426 782 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098742.1 protein_id gnl|my_center|LOCUS_12260 818 1282 gene locus_tag LOCUS_12270 818 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1377 1451 gene locus_tag LOCUS_t00080 1377 1451 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1483 1842 gene locus_tag LOCUS_12280 1483 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1921 3207 gene locus_tag LOCUS_12290 1921 3207 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_12290 3207 4325 gene locus_tag LOCUS_12300 3207 4325 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_12300 4338 7424 gene locus_tag LOCUS_12310 4338 7424 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_12310 7746 7591 gene locus_tag LOCUS_12320 7746 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 7790 8026 gene locus_tag LOCUS_12330 7790 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8037 8222 gene locus_tag LOCUS_12340 8037 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence103 161 643 gene locus_tag LOCUS_12350 161 643 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284359.1 protein_id gnl|my_center|LOCUS_12350 1762 674 gene locus_tag LOCUS_12360 gene alr 1762 674 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114351.1 protein_id gnl|my_center|LOCUS_12360 3869 1770 gene locus_tag LOCUS_12370 3869 1770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_12370 4112 3909 gene locus_tag LOCUS_12380 4112 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 5663 4188 gene locus_tag LOCUS_12390 5663 4188 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 protein_id gnl|my_center|LOCUS_12390 5979 6200 gene locus_tag LOCUS_12400 5979 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 6140 6727 gene locus_tag LOCUS_12410 6140 6727 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 protein_id gnl|my_center|LOCUS_12410 6750 8033 gene locus_tag LOCUS_12420 6750 8033 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence104 252 2501 gene locus_tag LOCUS_12430 252 2501 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_12430 2695 5226 gene locus_tag LOCUS_12440 2695 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5380 5826 gene locus_tag LOCUS_12450 5380 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 5876 7045 gene locus_tag LOCUS_12460 5876 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence105 968 2203 gene locus_tag LOCUS_12470 968 2203 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_12470 2352 4151 gene locus_tag LOCUS_12480 2352 4151 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074243.1 protein_id gnl|my_center|LOCUS_12480 5531 4182 gene locus_tag LOCUS_12490 5531 4182 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_12490 6496 5531 gene locus_tag LOCUS_12500 6496 5531 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_12500 6740 7504 gene locus_tag LOCUS_12510 gene xth 6740 7504 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193531.1 protein_id gnl|my_center|LOCUS_12510 <8440 7526 gene locus_tag LOCUS_12520 <8440 7526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_059643243.1:GTP 3',8-cyclase MoaA >Feature sequence106 736 245 gene locus_tag LOCUS_12530 gene nuoJ 736 245 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090473.1 protein_id gnl|my_center|LOCUS_12530 1296 751 gene locus_tag LOCUS_12540 gene nuoI 1296 751 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405112.1 protein_id gnl|my_center|LOCUS_12540 2281 1301 gene locus_tag LOCUS_12550 gene nuoH 2281 1301 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365589.1 protein_id gnl|my_center|LOCUS_12550 4977 2278 gene locus_tag LOCUS_12560 gene nuoG 4977 2278 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518099.1 protein_id gnl|my_center|LOCUS_12560 6278 4977 gene locus_tag LOCUS_12570 gene nuoF 6278 4977 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 protein_id gnl|my_center|LOCUS_12570 6766 6275 gene locus_tag LOCUS_12580 gene nuoE 6766 6275 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705664.1 protein_id gnl|my_center|LOCUS_12580 <8396 6771 gene locus_tag LOCUS_12590 <8396 6771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090458.1:NADH-quinone oxidoreductase subunit C/D >Feature sequence107 432 88 gene locus_tag LOCUS_12600 432 88 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_12600 548 1405 gene locus_tag LOCUS_12610 548 1405 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895546.1 protein_id gnl|my_center|LOCUS_12610 2068 1604 gene locus_tag LOCUS_12620 gene htdZ 2068 1604 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_12620 2315 3493 gene locus_tag LOCUS_12630 2315 3493 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419307.1 protein_id gnl|my_center|LOCUS_12630 3508 4413 gene locus_tag LOCUS_12640 3508 4413 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224297.1 protein_id gnl|my_center|LOCUS_12640 5432 4563 gene locus_tag LOCUS_12650 5432 4563 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 protein_id gnl|my_center|LOCUS_12650 5427 5915 gene locus_tag LOCUS_12660 5427 5915 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689406.1 protein_id gnl|my_center|LOCUS_12660 7000 5978 gene locus_tag LOCUS_12670 7000 5978 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 protein_id gnl|my_center|LOCUS_12670 7238 7882 gene locus_tag LOCUS_12680 7238 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence108 865 1785 gene locus_tag LOCUS_12690 865 1785 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_12690 1849 3036 gene locus_tag LOCUS_12700 1849 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 4911 3139 gene locus_tag LOCUS_12710 4911 3139 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431977.1 protein_id gnl|my_center|LOCUS_12710 6248 4908 gene locus_tag LOCUS_12720 6248 4908 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_12720 7216 6242 gene locus_tag LOCUS_12730 gene waaC 7216 6242 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_12730 <8302 7249 gene locus_tag LOCUS_12740 <8302 7249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109905.1:lipopolysaccharide heptosyltransferase II >Feature sequence109 3528 2266 gene locus_tag LOCUS_12750 3528 2266 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119637.1 protein_id gnl|my_center|LOCUS_12750 5087 3567 gene locus_tag LOCUS_12760 5087 3567 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_12760 5588 6298 gene locus_tag LOCUS_12770 5588 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 <8242 6313 gene locus_tag LOCUS_12780 <8242 6313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971785.1:metallophosphoesterase >Feature sequence110 236 814 gene locus_tag LOCUS_12790 gene rsxA 236 814 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_12790 819 1451 gene locus_tag LOCUS_12800 gene rsxB 819 1451 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104488.1 protein_id gnl|my_center|LOCUS_12800 1448 3430 gene locus_tag LOCUS_12810 1448 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3498 4481 gene locus_tag LOCUS_12820 3498 4481 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 protein_id gnl|my_center|LOCUS_12820 4478 5119 gene locus_tag LOCUS_12830 gene rsxG 4478 5119 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_12830 5112 5828 gene locus_tag LOCUS_12840 5112 5828 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_12840 5825 6511 gene locus_tag LOCUS_12850 gene nth 5825 6511 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036717.1 protein_id gnl|my_center|LOCUS_12850 6576 6905 gene locus_tag LOCUS_12860 6576 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041065645.1 protein_id gnl|my_center|LOCUS_12860 6902 7687 gene locus_tag LOCUS_12870 gene yaaA 6902 7687 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186203.1 protein_id gnl|my_center|LOCUS_12870 8168 7776 gene locus_tag LOCUS_12880 8168 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence111 <1 1047 gene locus_tag LOCUS_12890 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097268.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 1263 2285 gene locus_tag LOCUS_12900 1263 2285 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_12900 3014 2292 gene locus_tag LOCUS_12910 3014 2292 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_12910 3564 3022 gene locus_tag LOCUS_12920 gene gmhB 3564 3022 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769732.1 protein_id gnl|my_center|LOCUS_12920 5642 3561 gene locus_tag LOCUS_12930 gene glyS 5642 3561 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291774.1 protein_id gnl|my_center|LOCUS_12930 6592 5639 gene locus_tag LOCUS_12940 gene glyQ 6592 5639 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_12940 6667 7584 gene locus_tag LOCUS_12950 6667 7584 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_12950 7952 8030 gene locus_tag LOCUS_t00090 7952 8030 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence112 1605 28 gene locus_tag LOCUS_12960 gene fadD8 1605 28 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191317023.1 protein_id gnl|my_center|LOCUS_12960 2447 1668 gene locus_tag LOCUS_12970 2447 1668 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256283.1 protein_id gnl|my_center|LOCUS_12970 2688 3092 gene locus_tag LOCUS_12980 2688 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3149 4222 gene locus_tag LOCUS_12990 3149 4222 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_12990 5858 4230 gene locus_tag LOCUS_13000 5858 4230 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 protein_id gnl|my_center|LOCUS_13000 6541 5963 gene locus_tag LOCUS_13010 gene nfuA 6541 5963 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence113 <1 941 gene locus_tag LOCUS_13020 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114068.1:beta-ketoacyl-ACP synthase FabY 945 1514 gene locus_tag LOCUS_13030 945 1514 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404145.1 protein_id gnl|my_center|LOCUS_13030 1511 1828 gene locus_tag LOCUS_13040 1511 1828 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_13040 3017 1785 gene locus_tag LOCUS_13050 3017 1785 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_13050 5062 3149 gene locus_tag LOCUS_13060 gene slt 5062 3149 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_13060 5577 5134 gene locus_tag LOCUS_13070 5577 5134 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378068.1 protein_id gnl|my_center|LOCUS_13070 5682 6143 gene locus_tag LOCUS_13080 5682 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence114 857 1207 gene locus_tag LOCUS_13090 857 1207 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809059.1 protein_id gnl|my_center|LOCUS_13090 1761 1228 gene locus_tag LOCUS_13100 1761 1228 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_13100 1835 2197 gene locus_tag LOCUS_13110 gene bprA 1835 2197 CDS product T3SS protein BprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187356.1 protein_id gnl|my_center|LOCUS_13110 2358 2741 gene locus_tag LOCUS_13120 2358 2741 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_13120 2760 4454 gene locus_tag LOCUS_13130 2760 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6105 4507 gene locus_tag LOCUS_13140 6105 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 6687 6178 gene locus_tag LOCUS_13150 6687 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 7676 6699 gene locus_tag LOCUS_13160 7676 6699 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence115 1145 2245 gene locus_tag LOCUS_13170 1145 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2157 2825 gene locus_tag LOCUS_13180 2157 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 3088 3654 gene locus_tag LOCUS_13190 3088 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3673 5319 gene locus_tag LOCUS_13200 3673 5319 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088410.1 protein_id gnl|my_center|LOCUS_13200 5516 5947 gene locus_tag LOCUS_13210 5516 5947 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532579.1 protein_id gnl|my_center|LOCUS_13210 6753 6016 gene locus_tag LOCUS_13220 gene narI 6753 6016 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528383.1 protein_id gnl|my_center|LOCUS_13220 7487 6750 gene locus_tag LOCUS_13230 gene narJ 7487 6750 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971854.1 protein_id gnl|my_center|LOCUS_13230 <8032 7499 gene locus_tag LOCUS_13240 <8032 7499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205549.1:nitrate reductase subunit beta >Feature sequence116 3 380 gene locus_tag LOCUS_13250 3 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 498 2915 gene locus_tag LOCUS_13260 gene lon 498 2915 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_13260 3060 3332 gene locus_tag LOCUS_13270 3060 3332 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688640.1 protein_id gnl|my_center|LOCUS_13270 3346 5208 gene locus_tag LOCUS_13280 3346 5208 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770757.1 protein_id gnl|my_center|LOCUS_13280 5217 6050 gene locus_tag LOCUS_13290 5217 6050 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 protein_id gnl|my_center|LOCUS_13290 6115 7299 gene locus_tag LOCUS_13300 6115 7299 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_13300 7342 7809 gene locus_tag LOCUS_13310 7342 7809 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence117 676 203 gene locus_tag LOCUS_13320 gene ccmE 676 203 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_13320 872 681 gene locus_tag LOCUS_13330 872 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1639 893 gene locus_tag LOCUS_13340 1639 893 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 protein_id gnl|my_center|LOCUS_13340 2397 1717 gene locus_tag LOCUS_13350 gene ccmB 2397 1717 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_13350 3048 2401 gene locus_tag LOCUS_13360 gene ccmA 3048 2401 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 protein_id gnl|my_center|LOCUS_13360 3221 4561 gene locus_tag LOCUS_13370 3221 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 4582 4893 gene locus_tag LOCUS_13380 4582 4893 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_13380 5217 4861 gene locus_tag LOCUS_13390 5217 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6098 5298 gene locus_tag LOCUS_13400 6098 5298 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766970.1 protein_id gnl|my_center|LOCUS_13400 7107 6130 gene locus_tag LOCUS_13410 gene motD 7107 6130 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_13410 7863 7123 gene locus_tag LOCUS_13420 7863 7123 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence118 <1 737 gene locus_tag LOCUS_13430 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269133.1:16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA 737 1543 gene locus_tag LOCUS_13440 737 1543 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_13440 1564 2865 gene locus_tag LOCUS_13450 1564 2865 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269138.1 protein_id gnl|my_center|LOCUS_13450 3319 2918 gene locus_tag LOCUS_13460 gene folB 3319 2918 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099587.1 protein_id gnl|my_center|LOCUS_13460 4429 3341 gene locus_tag LOCUS_13470 gene tsaD 4429 3341 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071502.1 protein_id gnl|my_center|LOCUS_13470 4543 4758 gene locus_tag LOCUS_13480 gene rpsU 4543 4758 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_13480 4789 5244 gene locus_tag LOCUS_13490 4789 5244 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085042.1 protein_id gnl|my_center|LOCUS_13490 5321 7117 gene locus_tag LOCUS_13500 gene dnaG 5321 7117 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703524.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence119 239 1435 gene locus_tag LOCUS_13510 239 1435 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_13510 1435 1662 gene locus_tag LOCUS_13520 1435 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2191 1667 gene locus_tag LOCUS_13530 2191 1667 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_13530 2311 3135 gene locus_tag LOCUS_13540 2311 3135 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_13540 3132 3386 gene locus_tag LOCUS_13550 3132 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3383 3610 gene locus_tag LOCUS_13560 gene tusA 3383 3610 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371482.1 protein_id gnl|my_center|LOCUS_13560 3644 4771 gene locus_tag LOCUS_13570 gene pdxB 3644 4771 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112396.1 protein_id gnl|my_center|LOCUS_13570 4768 5937 gene locus_tag LOCUS_13580 4768 5937 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_13580 7132 5915 gene locus_tag LOCUS_13590 7132 5915 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_13590 7265 7660 gene locus_tag LOCUS_13600 gene msrB 7265 7660 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence120 2429 273 gene locus_tag LOCUS_13610 2429 273 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_13610 3340 2426 gene locus_tag LOCUS_13620 3340 2426 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_13620 3605 4048 gene locus_tag LOCUS_13630 3605 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5835 4423 gene locus_tag LOCUS_13640 5835 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6608 5841 gene locus_tag LOCUS_13650 6608 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence121 595 1860 gene locus_tag LOCUS_13660 gene glgC 595 1860 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_13660 1853 3571 gene locus_tag LOCUS_13670 1853 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3568 5061 gene locus_tag LOCUS_13680 gene malQ 3568 5061 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_13680 5143 5475 gene locus_tag LOCUS_13690 5143 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5537 6082 gene locus_tag LOCUS_13700 5537 6082 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_13700 6140 7165 gene locus_tag LOCUS_13710 gene gap 6140 7165 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence122 29 1237 gene locus_tag LOCUS_13720 29 1237 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_13720 1234 2820 gene locus_tag LOCUS_13730 1234 2820 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776958.1 protein_id gnl|my_center|LOCUS_13730 3845 2829 gene locus_tag LOCUS_13740 3845 2829 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 protein_id gnl|my_center|LOCUS_13740 3956 4942 gene locus_tag LOCUS_13750 3956 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5032 6129 gene locus_tag LOCUS_13760 5032 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6129 7361 gene locus_tag LOCUS_13770 6129 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence123 1204 869 gene locus_tag LOCUS_13780 1204 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2567 1443 gene locus_tag LOCUS_13790 2567 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_13790 3082 2669 gene locus_tag LOCUS_13800 3082 2669 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_13800 4135 3095 gene locus_tag LOCUS_13810 4135 3095 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_13810 5457 4132 gene locus_tag LOCUS_13820 5457 4132 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_13820 5970 5566 gene locus_tag LOCUS_13830 5970 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 7194 5971 gene locus_tag LOCUS_13840 gene argJ 7194 5971 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence124 184 1113 gene locus_tag LOCUS_13850 184 1113 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_13850 2391 1219 gene locus_tag LOCUS_13860 gene nspC 2391 1219 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943174.1 protein_id gnl|my_center|LOCUS_13860 3586 2393 gene locus_tag LOCUS_13870 3586 2393 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_13870 5520 3604 gene locus_tag LOCUS_13880 gene speA 5520 3604 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_13880 6800 5631 gene locus_tag LOCUS_13890 6800 5631 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_13890 7349 6837 gene locus_tag LOCUS_13900 7349 6837 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762572.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence125 <1 622 gene locus_tag LOCUS_13910 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000081335.1:DEAD/DEAH box helicase family protein 761 1726 gene locus_tag LOCUS_13920 761 1726 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_13920 3504 1816 gene locus_tag LOCUS_13930 gene atsA 3504 1816 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_13930 4220 3537 gene locus_tag LOCUS_13940 4220 3537 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086682.1 protein_id gnl|my_center|LOCUS_13940 5339 4236 gene locus_tag LOCUS_13950 5339 4236 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_13950 <7598 5353 gene locus_tag LOCUS_13960 <7598 5353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_221892407.1:TonB-dependent receptor >Feature sequence126 379 792 gene locus_tag LOCUS_13970 379 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2036 825 gene locus_tag LOCUS_13980 2036 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3275 2115 gene locus_tag LOCUS_13990 gene mnmH 3275 2115 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070591.1 protein_id gnl|my_center|LOCUS_13990 3407 3649 gene locus_tag LOCUS_14000 3407 3649 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_14000 3646 5964 gene locus_tag LOCUS_14010 gene feoB 3646 5964 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_14010 7411 6002 gene locus_tag LOCUS_14020 gene cysS 7411 6002 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence127 216 452 gene locus_tag LOCUS_14030 216 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1128 439 gene locus_tag LOCUS_14040 1128 439 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405954.1 protein_id gnl|my_center|LOCUS_14040 1834 1136 gene locus_tag LOCUS_14050 1834 1136 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405955.1 protein_id gnl|my_center|LOCUS_14050 3177 1903 gene locus_tag LOCUS_14060 3177 1903 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_14060 3898 3164 gene locus_tag LOCUS_14070 3898 3164 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_14070 4131 6413 gene locus_tag LOCUS_14080 4131 6413 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_14080 6587 7315 gene locus_tag LOCUS_14090 6587 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence128 <1 520 gene locus_tag LOCUS_14100 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892661.1:DUF3375 domain-containing protein 557 1246 gene locus_tag LOCUS_14110 557 1246 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 protein_id gnl|my_center|LOCUS_14110 1239 4610 gene locus_tag LOCUS_14120 1239 4610 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_14120 4607 5806 gene locus_tag LOCUS_14130 4607 5806 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_14130 7376 6021 gene locus_tag LOCUS_14140 7376 6021 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218333.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence129 <1 740 gene locus_tag LOCUS_14150 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091442.1:30S ribosomal protein S1 845 1192 gene locus_tag LOCUS_14160 gene ihfB 845 1192 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167341.1 protein_id gnl|my_center|LOCUS_14160 1198 1455 gene locus_tag LOCUS_14170 1198 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1452 2186 gene locus_tag LOCUS_14180 gene pyrF 1452 2186 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999562.1 protein_id gnl|my_center|LOCUS_14180 2260 2571 gene locus_tag LOCUS_14190 2260 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2858 3832 gene locus_tag LOCUS_14200 2858 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_14200 3904 4881 gene locus_tag LOCUS_14210 3904 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5016 6290 gene locus_tag LOCUS_14220 5016 6290 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence130 <1 747 gene locus_tag LOCUS_14230 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104814.1:aspartate--tRNA ligase 750 1307 gene locus_tag LOCUS_14240 gene ruvC 750 1307 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111361.1 protein_id gnl|my_center|LOCUS_14240 1329 1955 gene locus_tag LOCUS_14250 gene ruvA 1329 1955 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 protein_id gnl|my_center|LOCUS_14250 1965 3008 gene locus_tag LOCUS_14260 gene ruvB 1965 3008 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_14260 3005 3475 gene locus_tag LOCUS_14270 gene ybgC 3005 3475 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_14270 3472 4170 gene locus_tag LOCUS_14280 gene tolQ 3472 4170 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_14280 4187 4600 gene locus_tag LOCUS_14290 gene tolR 4187 4600 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_14290 4604 5365 gene locus_tag LOCUS_14300 4604 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5362 6660 gene locus_tag LOCUS_14310 gene tolB 5362 6660 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339472.1 protein_id gnl|my_center|LOCUS_14310 6698 7234 gene locus_tag LOCUS_14320 gene pal 6698 7234 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314369.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence131 <1 547 gene locus_tag LOCUS_14330 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094386.1:ribonuclease G 554 4570 gene locus_tag LOCUS_14340 554 4570 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 protein_id gnl|my_center|LOCUS_14340 4567 5430 gene locus_tag LOCUS_14350 4567 5430 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766488.1 protein_id gnl|my_center|LOCUS_14350 5902 5402 gene locus_tag LOCUS_14360 5902 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 6168 5899 gene locus_tag LOCUS_14370 6168 5899 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 protein_id gnl|my_center|LOCUS_14370 7124 6165 gene locus_tag LOCUS_14380 gene rapZ 7124 6165 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence132 1669 518 gene locus_tag LOCUS_14390 1669 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1720 2925 gene locus_tag LOCUS_14400 1720 2925 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_14400 2945 4153 gene locus_tag LOCUS_14410 2945 4153 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893442.1 protein_id gnl|my_center|LOCUS_14410 4201 5109 gene locus_tag LOCUS_14420 gene menB 4201 5109 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_14420 5135 6301 gene locus_tag LOCUS_14430 5135 6301 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_14430 6326 6754 gene locus_tag LOCUS_14440 6326 6754 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence133 1346 114 gene locus_tag LOCUS_14450 gene nepI 1346 114 CDS product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094817.1 protein_id gnl|my_center|LOCUS_14450 1629 2315 gene locus_tag LOCUS_14460 1629 2315 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084101.1 protein_id gnl|my_center|LOCUS_14460 2692 2294 gene locus_tag LOCUS_14470 2692 2294 CDS product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975039.1 protein_id gnl|my_center|LOCUS_14470 3451 2708 gene locus_tag LOCUS_14480 3451 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3957 3466 gene locus_tag LOCUS_14490 3957 3466 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298503.1 protein_id gnl|my_center|LOCUS_14490 5128 4061 gene locus_tag LOCUS_14500 5128 4061 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777086.1 protein_id gnl|my_center|LOCUS_14500 6233 5325 gene locus_tag LOCUS_14510 6233 5325 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705386.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence134 2119 155 gene locus_tag LOCUS_14520 2119 155 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_14520 3621 2821 gene locus_tag LOCUS_14530 3621 2821 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_14530 4550 3618 gene locus_tag LOCUS_14540 4550 3618 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103683318.1 protein_id gnl|my_center|LOCUS_14540 4623 5105 gene locus_tag LOCUS_14550 4623 5105 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106526.1 protein_id gnl|my_center|LOCUS_14550 5098 6447 gene locus_tag LOCUS_14560 5098 6447 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence135 929 2989 gene locus_tag LOCUS_14570 gene prsK 929 2989 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_14570 3011 4375 gene locus_tag LOCUS_14580 gene prsR 3011 4375 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_14580 5807 4413 gene locus_tag LOCUS_14590 5807 4413 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_14590 6785 5901 gene locus_tag LOCUS_14600 6785 5901 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence136 <1 2541 gene locus_tag LOCUS_14610 <1 2541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920256.1:TonB-dependent receptor 2568 3608 gene locus_tag LOCUS_14620 2568 3608 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_14620 3622 4521 gene locus_tag LOCUS_14630 gene lipA 3622 4521 CDS product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_14630 4566 5759 gene locus_tag LOCUS_14640 4566 5759 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_14640 6264 5764 gene locus_tag LOCUS_14650 6264 5764 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_14650 <6972 6272 gene locus_tag LOCUS_14660 <6972 6272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528369.1:NADH-quinone oxidoreductase subunit C >Feature sequence137 <1 700 gene locus_tag LOCUS_14670 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228959.1:acyl-CoA synthetase 719 1492 gene locus_tag LOCUS_14680 719 1492 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041937280.1 protein_id gnl|my_center|LOCUS_14680 2764 1502 gene locus_tag LOCUS_14690 2764 1502 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_14690 4065 2797 gene locus_tag LOCUS_14700 4065 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900087.1 protein_id gnl|my_center|LOCUS_14700 4295 6364 gene locus_tag LOCUS_14710 4295 6364 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence138 <1 862 gene locus_tag LOCUS_14720 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000437792.1:tyrosine-protein phosphatase 2579 1029 gene locus_tag LOCUS_14730 2579 1029 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224348.1 protein_id gnl|my_center|LOCUS_14730 2938 2693 gene locus_tag LOCUS_14740 2938 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3632 2985 gene locus_tag LOCUS_14750 3632 2985 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000352.1 protein_id gnl|my_center|LOCUS_14750 3700 4629 gene locus_tag LOCUS_14760 3700 4629 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_14760 5577 4681 gene locus_tag LOCUS_14770 5577 4681 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038965.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence139 <1 1355 gene locus_tag LOCUS_14780 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272219.1:carboxylesterase/lipase family protein 1486 2886 gene locus_tag LOCUS_14790 1486 2886 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407366.1 protein_id gnl|my_center|LOCUS_14790 4789 3107 gene locus_tag LOCUS_14800 4789 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5772 4786 gene locus_tag LOCUS_14810 5772 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 6044 5769 gene locus_tag LOCUS_14820 6044 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6164 6568 gene locus_tag LOCUS_14830 6164 6568 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193832.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence140 172 828 gene locus_tag LOCUS_14840 172 828 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706488.1 protein_id gnl|my_center|LOCUS_14840 887 1279 gene locus_tag LOCUS_14850 gene tusD 887 1279 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209680.1 protein_id gnl|my_center|LOCUS_14850 1276 1647 gene locus_tag LOCUS_14860 gene tusC 1276 1647 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099034.1 protein_id gnl|my_center|LOCUS_14860 1655 1954 gene locus_tag LOCUS_14870 gene tusB 1655 1954 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_14870 1956 2270 gene locus_tag LOCUS_14880 1956 2270 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 protein_id gnl|my_center|LOCUS_14880 2267 3358 gene locus_tag LOCUS_14890 gene trmA 2267 3358 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268939.1 protein_id gnl|my_center|LOCUS_14890 4251 3352 gene locus_tag LOCUS_14900 4251 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464929.1 protein_id gnl|my_center|LOCUS_14900 5134 4502 gene locus_tag LOCUS_14910 gene dut 5134 4502 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_14910 5181 5909 gene locus_tag LOCUS_14920 5181 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence141 90 725 gene locus_tag LOCUS_14930 90 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1560 760 gene locus_tag LOCUS_14940 1560 760 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_14940 3300 1591 gene locus_tag LOCUS_14950 gene kstD 3300 1591 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419253.1 protein_id gnl|my_center|LOCUS_14950 4595 3369 gene locus_tag LOCUS_14960 4595 3369 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_14960 5715 4714 gene locus_tag LOCUS_14970 5715 4714 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123657.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence142 2355 739 gene locus_tag LOCUS_14980 2355 739 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965356.1 protein_id gnl|my_center|LOCUS_14980 2570 4042 gene locus_tag LOCUS_14990 gene pap 2570 4042 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_14990 5792 4242 gene locus_tag LOCUS_15000 5792 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 5874 6482 gene locus_tag LOCUS_15010 5874 6482 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence143 <1 653 gene locus_tag LOCUS_15020 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176634.1:EpsI family protein 661 2274 gene locus_tag LOCUS_15030 661 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2384 3052 gene locus_tag LOCUS_15040 2384 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3237 5621 gene locus_tag LOCUS_15050 3237 5621 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence144 724 392 gene locus_tag LOCUS_15060 724 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 967 779 gene locus_tag LOCUS_15070 967 779 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072131.1 protein_id gnl|my_center|LOCUS_15070 3312 1009 gene locus_tag LOCUS_15080 3312 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3434 6055 gene locus_tag LOCUS_15090 gene barA 3434 6055 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704764.1 protein_id gnl|my_center|LOCUS_15090 <6608 6085 gene locus_tag LOCUS_15100 <6608 6085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010928130.1:DNA polymerase Y family protein >Feature sequence145 2891 1638 gene locus_tag LOCUS_15110 2891 1638 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336759.1 protein_id gnl|my_center|LOCUS_15110 4113 2902 gene locus_tag LOCUS_15120 4113 2902 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040635.1 protein_id gnl|my_center|LOCUS_15120 4719 4246 gene locus_tag LOCUS_15130 4719 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence146 424 5877 gene locus_tag LOCUS_15140 424 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 5874 6350 gene locus_tag LOCUS_15150 5874 6350 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence147 487 1560 gene locus_tag LOCUS_15160 487 1560 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 protein_id gnl|my_center|LOCUS_15160 1632 3782 gene locus_tag LOCUS_15170 gene fadB 1632 3782 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104595.1 protein_id gnl|my_center|LOCUS_15170 3805 4980 gene locus_tag LOCUS_15180 gene fadA 3805 4980 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245350.1 protein_id gnl|my_center|LOCUS_15180 5003 5944 gene locus_tag LOCUS_15190 5003 5944 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074103.1 protein_id gnl|my_center|LOCUS_15190 6122 6206 gene locus_tag LOCUS_t00100 6122 6206 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence148 3567 1588 gene locus_tag LOCUS_15200 3567 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 4174 3659 gene locus_tag LOCUS_15210 4174 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5316 4531 gene locus_tag LOCUS_15220 5316 4531 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_15220 5432 6241 gene locus_tag LOCUS_15230 gene lgt 5432 6241 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence149 1063 539 gene locus_tag LOCUS_15240 gene lolA 1063 539 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405079.1 protein_id gnl|my_center|LOCUS_15240 986 1159 gene locus_tag LOCUS_15250 986 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3579 1183 gene locus_tag LOCUS_15260 gene ftsK 3579 1183 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895627.1 protein_id gnl|my_center|LOCUS_15260 3834 4784 gene locus_tag LOCUS_15270 gene trxB 3834 4784 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946716.1 protein_id gnl|my_center|LOCUS_15270 4790 5515 gene locus_tag LOCUS_15280 gene aat 4790 5515 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_15280 5500 6219 gene locus_tag LOCUS_15290 5500 6219 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence150 1147 125 gene locus_tag LOCUS_15300 1147 125 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706425.1 protein_id gnl|my_center|LOCUS_15300 1566 2036 gene locus_tag LOCUS_15310 gene ssb 1566 2036 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_15310 2088 2936 gene locus_tag LOCUS_15320 2088 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3017 3538 gene locus_tag LOCUS_15330 gene moaB 3017 3538 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509705.1 protein_id gnl|my_center|LOCUS_15330 3547 4761 gene locus_tag LOCUS_15340 3547 4761 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_15340 4775 6241 gene locus_tag LOCUS_15350 4775 6241 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence151 2517 1654 gene locus_tag LOCUS_15360 gene zipA 2517 1654 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083352.1 protein_id gnl|my_center|LOCUS_15360 6140 2637 gene locus_tag LOCUS_15370 gene smc 6140 2637 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence152 1797 595 gene locus_tag LOCUS_15380 1797 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3070 1811 gene locus_tag LOCUS_15390 3070 1811 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence153 1986 25 gene locus_tag LOCUS_15400 1986 25 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_15400 2096 2683 gene locus_tag LOCUS_15410 2096 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3957 2635 gene locus_tag LOCUS_15420 3957 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 5899 4064 gene locus_tag LOCUS_15430 gene glmS 5899 4064 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817475.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence154 3511 1025 gene locus_tag LOCUS_15440 3511 1025 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242997.1 protein_id gnl|my_center|LOCUS_15440 4024 3536 gene locus_tag LOCUS_15450 4024 3536 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807630.1 protein_id gnl|my_center|LOCUS_15450 4936 4058 gene locus_tag LOCUS_15460 4936 4058 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence155 2067 778 gene locus_tag LOCUS_15470 gene hemA 2067 778 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_15470 2241 3992 gene locus_tag LOCUS_15480 2241 3992 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 protein_id gnl|my_center|LOCUS_15480 3989 4585 gene locus_tag LOCUS_15490 gene lolB 3989 4585 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_15490 4582 5424 gene locus_tag LOCUS_15500 gene ispE 4582 5424 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_15500 5431 5506 gene locus_tag LOCUS_t00110 5431 5506 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5641 6030 gene locus_tag LOCUS_15510 5641 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence156 1238 690 gene locus_tag LOCUS_15520 gene fabA 1238 690 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_15520 1406 2767 gene locus_tag LOCUS_15530 1406 2767 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_15530 2771 4189 gene locus_tag LOCUS_15540 2771 4189 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055873.1 protein_id gnl|my_center|LOCUS_15540 4325 5566 gene locus_tag LOCUS_15550 4325 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence157 1019 159 gene locus_tag LOCUS_15560 gene purU 1019 159 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_15560 2510 1089 gene locus_tag LOCUS_15570 2510 1089 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 protein_id gnl|my_center|LOCUS_15570 3841 2507 gene locus_tag LOCUS_15580 3841 2507 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901847.1 protein_id gnl|my_center|LOCUS_15580 <6009 3984 gene locus_tag LOCUS_15590 <6009 3984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206773.1:TonB-dependent receptor >Feature sequence158 2057 192 gene locus_tag LOCUS_15600 2057 192 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_15600 3869 2088 gene locus_tag LOCUS_15610 3869 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5132 3927 gene locus_tag LOCUS_15620 5132 3927 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence159 1836 829 gene locus_tag LOCUS_15630 gene oruR 1836 829 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_15630 2096 3376 gene locus_tag LOCUS_15640 2096 3376 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557408.1 protein_id gnl|my_center|LOCUS_15640 3400 4896 gene locus_tag LOCUS_15650 3400 4896 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389417.1 protein_id gnl|my_center|LOCUS_15650 4928 5344 gene locus_tag LOCUS_15660 4928 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 <5945 5346 gene locus_tag LOCUS_15670 <5945 5346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919198.1:class I adenylate-forming enzyme family protein >Feature sequence160 9 497 gene locus_tag LOCUS_15680 9 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2631 604 gene locus_tag LOCUS_15690 gene tgpA 2631 604 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_15690 3620 2628 gene locus_tag LOCUS_15700 3620 2628 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_15700 4537 3620 gene locus_tag LOCUS_15710 4537 3620 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_15710 5833 4610 gene locus_tag LOCUS_15720 5833 4610 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence161 986 135 gene locus_tag LOCUS_15730 gene motA 986 135 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_15730 1765 1205 gene locus_tag LOCUS_15740 gene folE 1765 1205 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_15740 3279 1816 gene locus_tag LOCUS_15750 3279 1816 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113119.1 protein_id gnl|my_center|LOCUS_15750 3405 3854 gene locus_tag LOCUS_15760 3405 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5212 3902 gene locus_tag LOCUS_15770 gene bioA 5212 3902 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_15770 <5894 5217 gene locus_tag LOCUS_15780 <5894 5217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103924.1:arylesterase >Feature sequence162 140 895 gene locus_tag LOCUS_15790 140 895 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_15790 1577 909 gene locus_tag LOCUS_15800 1577 909 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932180.1 protein_id gnl|my_center|LOCUS_15800 2656 1574 gene locus_tag LOCUS_15810 2656 1574 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_15810 3303 2653 gene locus_tag LOCUS_15820 3303 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3410 4180 gene locus_tag LOCUS_15830 3410 4180 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence163 111 2165 gene locus_tag LOCUS_15840 111 2165 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_15840 2274 2729 gene locus_tag LOCUS_15850 2274 2729 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729021.1 protein_id gnl|my_center|LOCUS_15850 2746 3228 gene locus_tag LOCUS_15860 2746 3228 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 protein_id gnl|my_center|LOCUS_15860 5008 3311 gene locus_tag LOCUS_15870 gene kefB 5008 3311 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112454.1 protein_id gnl|my_center|LOCUS_15870 <5878 5037 gene locus_tag LOCUS_15880 <5878 5037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113487.1:GNAT family N-acetyltransferase/peptidase C39 family protein >Feature sequence164 265 14 gene locus_tag LOCUS_15890 265 14 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_15890 442 867 gene locus_tag LOCUS_15900 442 867 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467525.1 protein_id gnl|my_center|LOCUS_15900 1617 907 gene locus_tag LOCUS_15910 1617 907 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925340.1 protein_id gnl|my_center|LOCUS_15910 2840 1614 gene locus_tag LOCUS_15920 2840 1614 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_15920 3988 2837 gene locus_tag LOCUS_15930 3988 2837 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085850.1 protein_id gnl|my_center|LOCUS_15930 4034 4450 gene locus_tag LOCUS_15940 4034 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence165 97 1545 gene locus_tag LOCUS_15950 gene gorA 97 1545 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 protein_id gnl|my_center|LOCUS_15950 3744 1564 gene locus_tag LOCUS_15960 3744 1564 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 protein_id gnl|my_center|LOCUS_15960 3955 5622 gene locus_tag LOCUS_15970 gene gpmI 3955 5622 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence166 377 559 gene locus_tag LOCUS_15980 377 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1096 587 gene locus_tag LOCUS_15990 1096 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2390 1098 gene locus_tag LOCUS_16000 2390 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2659 2375 gene locus_tag LOCUS_16010 2659 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3421 2681 gene locus_tag LOCUS_16020 3421 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4459 3575 gene locus_tag LOCUS_16030 gene cyoE 4459 3575 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 protein_id gnl|my_center|LOCUS_16030 <5748 4521 gene locus_tag LOCUS_16040 <5748 4521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903627.1:b(o/a)3-type cytochrome-c oxidase subunit 1 >Feature sequence167 <1 919 gene locus_tag LOCUS_16050 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023936.1:Zn-ribbon domain-containing OB-fold protein 945 1388 gene locus_tag LOCUS_16060 945 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1399 3048 gene locus_tag LOCUS_16070 1399 3048 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225796.1 protein_id gnl|my_center|LOCUS_16070 3053 4222 gene locus_tag LOCUS_16080 3053 4222 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_16080 4240 5355 gene locus_tag LOCUS_16090 4240 5355 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence168 1591 980 gene locus_tag LOCUS_16100 gene caiE 1591 980 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 protein_id gnl|my_center|LOCUS_16100 1753 5223 gene locus_tag LOCUS_16110 1753 5223 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence169 1590 661 gene locus_tag LOCUS_16120 gene prmB 1590 661 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_16120 2407 1577 gene locus_tag LOCUS_16130 2407 1577 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_16130 4413 2503 gene locus_tag LOCUS_16140 gene htpG 4413 2503 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_16140 5353 4547 gene locus_tag LOCUS_16150 5353 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence170 2505 3527 gene locus_tag LOCUS_16160 gene cobS 2505 3527 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_16160 3524 5401 gene locus_tag LOCUS_16170 gene cobT 3524 5401 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388602.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence171 146 1279 gene locus_tag LOCUS_16180 146 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896388.1 protein_id gnl|my_center|LOCUS_16180 1329 1961 gene locus_tag LOCUS_16190 1329 1961 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731397.1 protein_id gnl|my_center|LOCUS_16190 2067 3248 gene locus_tag LOCUS_16200 2067 3248 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_16200 3269 4285 gene locus_tag LOCUS_16210 3269 4285 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_16210 4307 5494 gene locus_tag LOCUS_16220 4307 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence172 563 2116 gene locus_tag LOCUS_16230 563 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2118 3581 gene locus_tag LOCUS_16240 2118 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence173 697 368 gene locus_tag LOCUS_16250 697 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1145 687 gene locus_tag LOCUS_16260 gene holC 1145 687 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_16260 2662 1142 gene locus_tag LOCUS_16270 2662 1142 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266820.1 protein_id gnl|my_center|LOCUS_16270 3350 2874 gene locus_tag LOCUS_16280 3350 2874 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_16280 3504 4241 gene locus_tag LOCUS_16290 3504 4241 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence174 <1 599 gene locus_tag LOCUS_16300 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931292.1:phospholipase D family protein 907 2121 gene locus_tag LOCUS_16310 907 2121 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 protein_id gnl|my_center|LOCUS_16310 2141 3916 gene locus_tag LOCUS_16320 2141 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16320 3816 5381 gene locus_tag LOCUS_16330 3816 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence175 1072 107 gene locus_tag LOCUS_16340 1072 107 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_16340 2505 1069 gene locus_tag LOCUS_16350 gene murC 2505 1069 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_16350 3587 2502 gene locus_tag LOCUS_16360 gene murG 3587 2502 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_16360 4758 3580 gene locus_tag LOCUS_16370 gene ftsW 4758 3580 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406017.1 protein_id gnl|my_center|LOCUS_16370 <5450 4760 gene locus_tag LOCUS_16380 <5450 4760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103104.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence176 845 126 gene locus_tag LOCUS_16390 845 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1548 862 gene locus_tag LOCUS_16400 1548 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1994 3124 gene locus_tag LOCUS_16410 1994 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3128 4354 gene locus_tag LOCUS_16420 3128 4354 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252726.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence177 <1 1133 gene locus_tag LOCUS_16430 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403128.1:ATP-binding protein 1607 1326 gene locus_tag LOCUS_16440 1607 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2446 1607 gene locus_tag LOCUS_16450 gene nadC 2446 1607 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_16450 2984 2541 gene locus_tag LOCUS_16460 2984 2541 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085221.1 protein_id gnl|my_center|LOCUS_16460 3247 2990 gene locus_tag LOCUS_16470 3247 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3419 5440 gene locus_tag LOCUS_16480 3419 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence178 126 515 gene locus_tag LOCUS_16490 126 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 512 967 gene locus_tag LOCUS_16500 512 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 998 1606 gene locus_tag LOCUS_16510 998 1606 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064691.1 protein_id gnl|my_center|LOCUS_16510 2533 1625 gene locus_tag LOCUS_16520 2533 1625 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_16520 2639 4063 gene locus_tag LOCUS_16530 gene leuC 2639 4063 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_16530 4075 4725 gene locus_tag LOCUS_16540 gene leuD 4075 4725 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114814.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence179 1697 291 gene locus_tag LOCUS_16550 gene mucD 1697 291 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_16550 2184 1732 gene locus_tag LOCUS_16560 2184 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3125 2184 gene locus_tag LOCUS_16570 3125 2184 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 protein_id gnl|my_center|LOCUS_16570 3783 3154 gene locus_tag LOCUS_16580 3783 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4419 3835 gene locus_tag LOCUS_16590 gene rpoE 4419 3835 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence180 832 1602 gene locus_tag LOCUS_16600 832 1602 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011945636.1 protein_id gnl|my_center|LOCUS_16600 4030 1577 gene locus_tag LOCUS_16610 4030 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 <5393 4139 gene locus_tag LOCUS_16620 <5393 4139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895514.1:error-prone DNA polymerase >Feature sequence181 595 371 gene locus_tag LOCUS_16630 595 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 837 592 gene locus_tag LOCUS_16640 837 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1334 948 gene locus_tag LOCUS_16650 1334 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1587 1324 gene locus_tag LOCUS_16660 1587 1324 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 protein_id gnl|my_center|LOCUS_16660 2196 1774 gene locus_tag LOCUS_16670 2196 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3119 2448 gene locus_tag LOCUS_16680 3119 2448 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192421.1 protein_id gnl|my_center|LOCUS_16680 5110 3116 gene locus_tag LOCUS_16690 5110 3116 CDS product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence182 904 446 gene locus_tag LOCUS_16700 904 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1841 972 gene locus_tag LOCUS_16710 1841 972 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_16710 2056 3960 gene locus_tag LOCUS_16720 2056 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3975 4832 gene locus_tag LOCUS_16730 3975 4832 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079434.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence183 353 2818 gene locus_tag LOCUS_16740 353 2818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_16740 3574 2819 gene locus_tag LOCUS_16750 3574 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 3709 4494 gene locus_tag LOCUS_16760 3709 4494 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_16760 4496 5368 gene locus_tag LOCUS_16770 4496 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence184 2231 1458 gene locus_tag LOCUS_16780 2231 1458 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_16780 4640 2316 gene locus_tag LOCUS_16790 4640 2316 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence185 580 1170 gene locus_tag LOCUS_16800 580 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2520 1171 gene locus_tag LOCUS_16810 gene tilS 2520 1171 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113867.1 protein_id gnl|my_center|LOCUS_16810 3483 2533 gene locus_tag LOCUS_16820 gene accA 3483 2533 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_16820 <5363 3587 gene locus_tag LOCUS_16830 <5363 3587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098578.1:DNA polymerase III subunit alpha >Feature sequence186 681 175 gene locus_tag LOCUS_16840 gene purE 681 175 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942943.1 protein_id gnl|my_center|LOCUS_16840 1635 733 gene locus_tag LOCUS_16850 1635 733 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_16850 1856 3085 gene locus_tag LOCUS_16860 1856 3085 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040465.1 protein_id gnl|my_center|LOCUS_16860 3091 3858 gene locus_tag LOCUS_16870 3091 3858 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence187 160 1053 gene locus_tag LOCUS_16880 gene prmC 160 1053 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266734.1 protein_id gnl|my_center|LOCUS_16880 1050 1793 gene locus_tag LOCUS_16890 gene moeB 1050 1793 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_16890 4595 1794 gene locus_tag LOCUS_16900 4595 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence188 102 302 gene locus_tag LOCUS_16910 102 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1813 1043 gene locus_tag LOCUS_16920 1813 1043 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 protein_id gnl|my_center|LOCUS_16920 3568 2507 gene locus_tag LOCUS_16930 3568 2507 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263515.1 protein_id gnl|my_center|LOCUS_16930 4575 3565 gene locus_tag LOCUS_16940 4575 3565 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_16940 <5253 4572 gene locus_tag LOCUS_16950 <5253 4572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962314.1:DUF58 domain-containing protein >Feature sequence189 3692 1404 gene locus_tag LOCUS_16960 3692 1404 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence190 987 142 gene locus_tag LOCUS_16970 gene rsmI 987 142 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_16970 1052 3013 gene locus_tag LOCUS_16980 1052 3013 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 protein_id gnl|my_center|LOCUS_16980 3061 3363 gene locus_tag LOCUS_16990 3061 3363 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_16990 3381 3974 gene locus_tag LOCUS_17000 3381 3974 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 protein_id gnl|my_center|LOCUS_17000 4361 3978 gene locus_tag LOCUS_17010 4361 3978 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_17010 <5240 4516 gene locus_tag LOCUS_17020 <5240 4516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000758871.1:cytochrome c1 >Feature sequence191 156 1376 gene locus_tag LOCUS_17030 156 1376 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965460.1 protein_id gnl|my_center|LOCUS_17030 2823 1450 gene locus_tag LOCUS_17040 gene nhaD 2823 1450 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_17040 3011 4477 gene locus_tag LOCUS_17050 gene mgtE 3011 4477 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767763.1 protein_id gnl|my_center|LOCUS_17050 4551 5024 gene locus_tag LOCUS_17060 4551 5024 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523768.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence192 <1 1580 gene locus_tag LOCUS_17070 <1 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103491.1:NAD-glutamate dehydrogenase GdhB 1647 2702 gene locus_tag LOCUS_17080 1647 2702 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_17080 2699 4939 gene locus_tag LOCUS_17090 gene rlmKL 2699 4939 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence193 3071 1338 gene locus_tag LOCUS_17100 gene ftsI 3071 1338 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_17100 3376 3068 gene locus_tag LOCUS_17110 3376 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4305 3376 gene locus_tag LOCUS_17120 gene rsmH 4305 3376 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_17120 4784 4329 gene locus_tag LOCUS_17130 gene mraZ 4784 4329 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence194 <1 728 gene locus_tag LOCUS_17140 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639997.1:gamma-glutamyltransferase 1809 730 gene locus_tag LOCUS_17150 1809 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2979 1846 gene locus_tag LOCUS_17160 2979 1846 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_17160 3345 3022 gene locus_tag LOCUS_17170 3345 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 4529 3393 gene locus_tag LOCUS_17180 4529 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 <5083 4526 gene locus_tag LOCUS_17190 <5083 4526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892316.1:aldehyde dehydrogenase family protein >Feature sequence195 62 2212 gene locus_tag LOCUS_17200 62 2212 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135545767.1 protein_id gnl|my_center|LOCUS_17200 3629 2280 gene locus_tag LOCUS_17210 gene aceF 3629 2280 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_17210 <5060 3641 gene locus_tag LOCUS_17220 <5060 3641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199569.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type >Feature sequence196 174 1142 gene locus_tag LOCUS_17230 174 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1848 1207 gene locus_tag LOCUS_17240 1848 1207 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932940.1 protein_id gnl|my_center|LOCUS_17240 3443 1845 gene locus_tag LOCUS_17250 gene nirN 3443 1845 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_17250 3349 3651 gene locus_tag LOCUS_17260 3349 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence197 386 823 gene locus_tag LOCUS_17270 386 823 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620437.1 protein_id gnl|my_center|LOCUS_17270 825 1127 gene locus_tag LOCUS_17280 825 1127 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095218.1 protein_id gnl|my_center|LOCUS_17280 1509 1135 gene locus_tag LOCUS_17290 1509 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1624 2034 gene locus_tag LOCUS_17300 gene fur 1624 2034 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095216.1 protein_id gnl|my_center|LOCUS_17300 3757 2087 gene locus_tag LOCUS_17310 gene recN 3757 2087 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105025.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence198 351 2402 gene locus_tag LOCUS_17320 351 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence199 438 947 gene locus_tag LOCUS_17330 438 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1097 4219 gene locus_tag LOCUS_17340 1097 4219 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_17340 4820 4254 gene locus_tag LOCUS_17350 4820 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence200 1927 1097 gene locus_tag LOCUS_17360 1927 1097 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_17360 2871 1948 gene locus_tag LOCUS_17370 2871 1948 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876826.1 protein_id gnl|my_center|LOCUS_17370 4166 2946 gene locus_tag LOCUS_17380 4166 2946 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390303.1 protein_id gnl|my_center|LOCUS_17380 <4771 4213 gene locus_tag LOCUS_17390 <4771 4213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226411.1:formyl-CoA transferase >Feature sequence201 176 478 gene locus_tag LOCUS_17400 176 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 508 2343 gene locus_tag LOCUS_17410 508 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2347 4494 gene locus_tag LOCUS_17420 2347 4494 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence202 2277 1663 gene locus_tag LOCUS_17430 gene rnhB 2277 1663 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_17430 3437 2274 gene locus_tag LOCUS_17440 gene lpxB 3437 2274 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_17440 4222 3452 gene locus_tag LOCUS_17450 gene lpxA 4222 3452 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 protein_id gnl|my_center|LOCUS_17450 <4746 4219 gene locus_tag LOCUS_17460 <4746 4219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092375.1:3-hydroxyacyl-ACP dehydratase FabZ >Feature sequence203 1292 441 gene locus_tag LOCUS_17470 gene oppC 1292 441 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 protein_id gnl|my_center|LOCUS_17470 2215 1289 gene locus_tag LOCUS_17480 gene oppB 2215 1289 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_17480 3894 2215 gene locus_tag LOCUS_17490 3894 2215 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706430.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence204 <1 558 gene locus_tag LOCUS_17500 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878395.1:SDR family oxidoreductase 586 1053 gene locus_tag LOCUS_17510 586 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1374 2618 gene locus_tag LOCUS_17520 1374 2618 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_17520 2615 3940 gene locus_tag LOCUS_17530 2615 3940 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence205 3420 685 gene locus_tag LOCUS_17540 gene ppc 3420 685 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035990.1 protein_id gnl|my_center|LOCUS_17540 <4641 3500 gene locus_tag LOCUS_17550 <4641 3500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265529.1:TonB-dependent receptor >Feature sequence206 193 1590 gene locus_tag LOCUS_17560 193 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_17560 1620 2477 gene locus_tag LOCUS_17570 1620 2477 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_17570 2530 3477 gene locus_tag LOCUS_17580 2530 3477 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081156.1 protein_id gnl|my_center|LOCUS_17580 3530 4351 gene locus_tag LOCUS_17590 3530 4351 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730868.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence207 1334 126 gene locus_tag LOCUS_17600 1334 126 CDS product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899557.1 protein_id gnl|my_center|LOCUS_17600 2222 1407 gene locus_tag LOCUS_17610 2222 1407 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 protein_id gnl|my_center|LOCUS_17610 2422 3654 gene locus_tag LOCUS_17620 2422 3654 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517213.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence208 3 866 gene locus_tag LOCUS_17630 3 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 929 1273 gene locus_tag LOCUS_17640 929 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1633 4185 gene locus_tag LOCUS_17650 1633 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence209 <1 505 gene locus_tag LOCUS_17660 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727787.1:glucose 1-dehydrogenase 565 1578 gene locus_tag LOCUS_17670 565 1578 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_17670 2029 1589 gene locus_tag LOCUS_17680 2029 1589 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_17680 2807 2076 gene locus_tag LOCUS_17690 2807 2076 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811686.1 protein_id gnl|my_center|LOCUS_17690 4061 2817 gene locus_tag LOCUS_17700 4061 2817 CDS product metabolite/H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529121.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence210 <1 665 gene locus_tag LOCUS_17710 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057937.1:LL-diaminopimelate aminotransferase 695 2830 gene locus_tag LOCUS_17720 695 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2827 3669 gene locus_tag LOCUS_17730 gene dapF 2827 3669 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_17730 <4513 3866 gene locus_tag LOCUS_17740 <4513 3866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039961.1:type I glutamate--ammonia ligase >Feature sequence211 <1 520 gene locus_tag LOCUS_17750 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002219226.1:heavy metal translocating P-type ATPase 513 710 gene locus_tag LOCUS_17760 513 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 715 1413 gene locus_tag LOCUS_17770 715 1413 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_17770 1545 2945 gene locus_tag LOCUS_17780 gene hemN 1545 2945 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_17780 3006 3854 gene locus_tag LOCUS_17790 gene anr 3006 3854 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_17790 <4481 3865 gene locus_tag LOCUS_17800 <4481 3865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268444.1:sigma-54 dependent transcriptional regulator >Feature sequence212 <1 1092 gene locus_tag LOCUS_17810 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809310.1:formate dehydrogenase subunit alpha 1123 1347 gene locus_tag LOCUS_17820 1123 1347 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965706.1 protein_id gnl|my_center|LOCUS_17820 1400 3364 gene locus_tag LOCUS_17830 1400 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3386 4087 gene locus_tag LOCUS_17840 3386 4087 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523228.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence213 758 1345 gene locus_tag LOCUS_17850 gene smrA 758 1345 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704977.1 protein_id gnl|my_center|LOCUS_17850 2057 1362 gene locus_tag LOCUS_17860 gene hda 2057 1362 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369632.1 protein_id gnl|my_center|LOCUS_17860 3226 2057 gene locus_tag LOCUS_17870 3226 2057 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_17870 4303 3233 gene locus_tag LOCUS_17880 4303 3233 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042598094.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence214 1511 444 gene locus_tag LOCUS_17890 1511 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1935 1540 gene locus_tag LOCUS_17900 1935 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17900 2702 1968 gene locus_tag LOCUS_17910 2702 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17910 3814 2699 gene locus_tag LOCUS_17920 gene epd 3814 2699 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084958.1 protein_id gnl|my_center|LOCUS_17920 <4413 3811 gene locus_tag LOCUS_17930 <4413 3811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003110216.1:transketolase >Feature sequence215 506 354 gene locus_tag LOCUS_17940 506 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 644 568 gene locus_tag LOCUS_t00120 644 568 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1508 705 gene locus_tag LOCUS_17950 1508 705 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057847.1 protein_id gnl|my_center|LOCUS_17950 1665 2939 gene locus_tag LOCUS_17960 1665 2939 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809350.1 protein_id gnl|my_center|LOCUS_17960 3731 3048 gene locus_tag LOCUS_17970 3731 3048 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_17970 4220 3738 gene locus_tag LOCUS_17980 4220 3738 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723432.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence216 2059 3267 gene locus_tag LOCUS_17990 2059 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence217 988 2241 gene locus_tag LOCUS_18000 988 2241 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 protein_id gnl|my_center|LOCUS_18000 2254 3366 gene locus_tag LOCUS_18010 2254 3366 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111493.1 protein_id gnl|my_center|LOCUS_18010 3886 3497 gene locus_tag LOCUS_18020 3886 3497 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535286.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence218 <1 2152 gene locus_tag LOCUS_18030 <1 2152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_101589575.1:CoA transferase 2233 3285 gene locus_tag LOCUS_18040 2233 3285 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence219 <1 1748 gene locus_tag LOCUS_18050 <1 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268725.1:molybdopterin oxidoreductase family protein 1864 3150 gene locus_tag LOCUS_18060 1864 3150 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_18060 3183 4307 gene locus_tag LOCUS_18070 3183 4307 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085850.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence220 128 595 gene locus_tag LOCUS_18080 128 595 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_18080 631 2361 gene locus_tag LOCUS_18090 631 2361 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence221 210 809 gene locus_tag LOCUS_18100 210 809 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105196.1 protein_id gnl|my_center|LOCUS_18100 806 1126 gene locus_tag LOCUS_18110 806 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1128 2243 gene locus_tag LOCUS_18120 gene aroF 1128 2243 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_18120 2237 2986 gene locus_tag LOCUS_18130 2237 2986 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113986.1 protein_id gnl|my_center|LOCUS_18130 3216 2971 gene locus_tag LOCUS_18140 3216 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4151 3213 gene locus_tag LOCUS_18150 4151 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18150 >Feature sequence222 <1 892 gene locus_tag LOCUS_18160 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943912.1:biotin carboxylase N-terminal domain-containing protein 889 1299 gene locus_tag LOCUS_18170 gene mce 889 1299 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_18170 1392 3653 gene locus_tag LOCUS_18180 1392 3653 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence223 1 684 gene locus_tag LOCUS_18190 1 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 681 1628 gene locus_tag LOCUS_18200 681 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2220 1645 gene locus_tag LOCUS_18210 2220 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2493 3053 gene locus_tag LOCUS_18220 2493 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence224 <1 1705 gene locus_tag LOCUS_18230 <1 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775897.1:nitrate reductase subunit alpha 1705 2343 gene locus_tag LOCUS_18240 1705 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 <4197 2571 gene locus_tag LOCUS_18250 <4197 2571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971773.1:NADP-dependent malic enzyme >Feature sequence225 <1 591 gene locus_tag LOCUS_18260 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000367640.1:cytochrome c5 family protein 759 2501 gene locus_tag LOCUS_18270 759 2501 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266168.1 protein_id gnl|my_center|LOCUS_18270 4020 2488 gene locus_tag LOCUS_18280 4020 2488 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence226 400 1614 gene locus_tag LOCUS_18290 400 1614 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896596.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence227 <1 754 gene locus_tag LOCUS_18300 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334456.1:formylmethanofuran--tetrahydromethanopterin N-formyltransferase 751 1569 gene locus_tag LOCUS_18310 751 1569 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 protein_id gnl|my_center|LOCUS_18310 1653 1820 gene locus_tag LOCUS_18320 1653 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1839 2099 gene locus_tag LOCUS_18330 1839 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2682 2149 gene locus_tag LOCUS_18340 2682 2149 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338439.1 protein_id gnl|my_center|LOCUS_18340 <4159 2675 gene locus_tag LOCUS_18350 <4159 2675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001211849.1:di-heme enzyme >Feature sequence228 338 1177 gene locus_tag LOCUS_18360 gene lepB 338 1177 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101969.1 protein_id gnl|my_center|LOCUS_18360 1230 1643 gene locus_tag LOCUS_18370 1230 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1633 2331 gene locus_tag LOCUS_18380 gene rnc 1633 2331 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704749.1 protein_id gnl|my_center|LOCUS_18380 2331 3227 gene locus_tag LOCUS_18390 gene era 2331 3227 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_18390 3253 3981 gene locus_tag LOCUS_18400 gene recO 3253 3981 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524618.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence229 752 1060 gene locus_tag LOCUS_18410 gene yhbY 752 1060 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 protein_id gnl|my_center|LOCUS_18410 2022 1324 gene locus_tag LOCUS_18420 2022 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 <4114 2076 gene locus_tag LOCUS_18430 <4114 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003314654.1:DNA gyrase subunit A >Feature sequence230 558 3041 gene locus_tag LOCUS_18440 558 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3900 3046 gene locus_tag LOCUS_18450 3900 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence231 1910 1245 gene locus_tag LOCUS_18460 1910 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_18460 2866 1916 gene locus_tag LOCUS_18470 2866 1916 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_18470 <4094 2863 gene locus_tag LOCUS_18480 <4094 2863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532947.1:hydrogenase 4 subunit B >Feature sequence232 61 924 gene locus_tag LOCUS_18490 gene ubiA 61 924 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035644.1 protein_id gnl|my_center|LOCUS_18490 933 2204 gene locus_tag LOCUS_18500 933 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2257 2676 gene locus_tag LOCUS_18510 2257 2676 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316086.1 protein_id gnl|my_center|LOCUS_18510 <4091 2681 gene locus_tag LOCUS_18520 <4091 2681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096872.1:DNA helicase II >Feature sequence233 1832 2146 gene locus_tag LOCUS_18530 1832 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2140 2475 gene locus_tag LOCUS_18540 gene tnpB 2140 2475 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210315586.1 protein_id gnl|my_center|LOCUS_18540 2494 4065 gene locus_tag LOCUS_18550 2494 4065 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence234 1021 14 gene locus_tag LOCUS_18560 gene mltG 1021 14 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_18560 1862 1029 gene locus_tag LOCUS_18570 gene pabC 1862 1029 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_18570 3120 1885 gene locus_tag LOCUS_18580 gene fabF 3120 1885 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_18580 3503 3267 gene locus_tag LOCUS_18590 gene acpP 3503 3267 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 protein_id gnl|my_center|LOCUS_18590 4068 3667 gene locus_tag LOCUS_18600 4068 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence235 685 1512 gene locus_tag LOCUS_18610 685 1512 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705376.1 protein_id gnl|my_center|LOCUS_18610 1509 2321 gene locus_tag LOCUS_18620 gene cysE 1509 2321 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806519.1 protein_id gnl|my_center|LOCUS_18620 2995 2333 gene locus_tag LOCUS_18630 gene ppa 2995 2333 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210169.1 protein_id gnl|my_center|LOCUS_18630 3122 3379 gene locus_tag LOCUS_18640 3122 3379 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 protein_id gnl|my_center|LOCUS_18640 <4052 3400 gene locus_tag LOCUS_18650 <4052 3400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958118.1:6-phosphofructokinase >Feature sequence236 732 34 gene locus_tag LOCUS_18660 gene cmk 732 34 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554563.1 protein_id gnl|my_center|LOCUS_18660 2112 754 gene locus_tag LOCUS_18670 2112 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18670 2999 2109 gene locus_tag LOCUS_18680 2999 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 <4028 3068 gene locus_tag LOCUS_18690 <4028 3068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404232.1:prephenate dehydratase >Feature sequence237 <1 909 gene locus_tag LOCUS_18700 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095402.1:tRNA dihydrouridine synthase DusB 906 1211 gene locus_tag LOCUS_18710 906 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1270 2847 gene locus_tag LOCUS_18720 gene purH 1270 2847 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105151.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence238 <1 1478 gene locus_tag LOCUS_18730 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532900.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 1475 2596 gene locus_tag LOCUS_18740 1475 2596 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_18740 3754 2615 gene locus_tag LOCUS_18750 3754 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence239 <1 610 gene locus_tag LOCUS_18760 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096572.1:acetylglutamate kinase 607 1248 gene locus_tag LOCUS_18770 gene slmA 607 1248 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 protein_id gnl|my_center|LOCUS_18770 1875 1273 gene locus_tag LOCUS_18780 1875 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769563.1 protein_id gnl|my_center|LOCUS_18780 2676 2011 gene locus_tag LOCUS_18790 gene pyrE 2676 2011 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_18790 2824 3600 gene locus_tag LOCUS_18800 2824 3600 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence240 1393 548 gene locus_tag LOCUS_18810 1393 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2666 1458 gene locus_tag LOCUS_18820 2666 1458 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_18820 3339 2728 gene locus_tag LOCUS_18830 3339 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence241 1179 922 gene locus_tag LOCUS_18840 1179 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2311 1184 gene locus_tag LOCUS_18850 2311 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_18850 3369 2737 gene locus_tag LOCUS_18860 3369 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence242 905 123 gene locus_tag LOCUS_18870 905 123 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224716.1 protein_id gnl|my_center|LOCUS_18870 997 1560 gene locus_tag LOCUS_18880 gene ampD 997 1560 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_18880 1594 2457 gene locus_tag LOCUS_18890 gene ampE 1594 2457 CDS product regulatory signaling modulator protein AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112845.1 protein_id gnl|my_center|LOCUS_18890 2474 3388 gene locus_tag LOCUS_18900 2474 3388 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_18900 3916 3368 gene locus_tag LOCUS_18910 3916 3368 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence243 <1 1403 gene locus_tag LOCUS_18920 <1 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114997.1:TonB-dependent receptor 1559 3082 gene locus_tag LOCUS_18930 1559 3082 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225412.1 protein_id gnl|my_center|LOCUS_18930 3102 3431 gene locus_tag LOCUS_18940 3102 3431 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459471.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence244 1239 412 gene locus_tag LOCUS_18950 1239 412 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_18950 2182 1526 gene locus_tag LOCUS_18960 2182 1526 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_18960 2670 2179 gene locus_tag LOCUS_18970 gene ispF 2670 2179 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_18970 3401 2667 gene locus_tag LOCUS_18980 gene ispD 3401 2667 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406223.1 protein_id gnl|my_center|LOCUS_18980 3698 3417 gene locus_tag LOCUS_18990 gene ftsB 3698 3417 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377835.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence245 <1 585 gene locus_tag LOCUS_19000 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097632.1:replication-associated recombination protein A 582 977 gene locus_tag LOCUS_19010 gene crcB 582 977 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_19010 988 2283 gene locus_tag LOCUS_19020 gene serS 988 2283 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886697.1 protein_id gnl|my_center|LOCUS_19020 2292 3740 gene locus_tag LOCUS_19030 gene cysG 2292 3740 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence246 207 1055 gene locus_tag LOCUS_19040 gene folD 207 1055 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 protein_id gnl|my_center|LOCUS_19040 1118 1372 gene locus_tag LOCUS_19050 1118 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1665 2084 gene locus_tag LOCUS_19060 1665 2084 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 protein_id gnl|my_center|LOCUS_19060 2610 2107 gene locus_tag LOCUS_19070 2610 2107 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_19070 2951 2613 gene locus_tag LOCUS_19080 2951 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 <3944 2948 gene locus_tag LOCUS_19090 <3944 2948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_214185119.1:excinuclease ABC subunit UvrA >Feature sequence247 >Feature sequence248 83 496 gene locus_tag LOCUS_19100 gene rplP 83 496 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_19100 493 687 gene locus_tag LOCUS_19110 gene rpmC 493 687 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093720.1 protein_id gnl|my_center|LOCUS_19110 690 965 gene locus_tag LOCUS_19120 gene rpsQ 690 965 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_19120 1011 1379 gene locus_tag LOCUS_19130 gene rplN 1011 1379 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 protein_id gnl|my_center|LOCUS_19130 1424 1741 gene locus_tag LOCUS_19140 gene rplX 1424 1741 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571669.1 protein_id gnl|my_center|LOCUS_19140 1747 2286 gene locus_tag LOCUS_19150 gene rplE 1747 2286 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093703.1 protein_id gnl|my_center|LOCUS_19150 2293 2598 gene locus_tag LOCUS_19160 gene rpsN 2293 2598 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555476.1 protein_id gnl|my_center|LOCUS_19160 2621 3016 gene locus_tag LOCUS_19170 gene rpsH 2621 3016 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555475.1 protein_id gnl|my_center|LOCUS_19170 3094 3579 gene locus_tag LOCUS_19180 gene rplF 3094 3579 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence249 2012 513 gene locus_tag LOCUS_19190 2012 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3124 2027 gene locus_tag LOCUS_19200 gene aroB 3124 2027 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_19200 3766 3242 gene locus_tag LOCUS_19210 gene aroK 3766 3242 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266378.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence250 1159 158 gene locus_tag LOCUS_19220 gene rpoA 1159 158 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_19220 1814 1194 gene locus_tag LOCUS_19230 gene rpsD 1814 1194 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_19230 2234 1839 gene locus_tag LOCUS_19240 gene rpsK 2234 1839 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 protein_id gnl|my_center|LOCUS_19240 2645 2289 gene locus_tag LOCUS_19250 gene rpsM 2645 2289 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555467.1 protein_id gnl|my_center|LOCUS_19250 <3810 2900 gene locus_tag LOCUS_19260 <3810 2900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093694.1:preprotein translocase subunit SecY >Feature sequence251 935 339 gene locus_tag LOCUS_19270 gene lexA 935 339 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704040.1 protein_id gnl|my_center|LOCUS_19270 1383 1060 gene locus_tag LOCUS_19280 1383 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1492 2250 gene locus_tag LOCUS_19290 1492 2250 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_19290 3165 2230 gene locus_tag LOCUS_19300 3165 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 <3758 3162 gene locus_tag LOCUS_19310 <3758 3162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113980.1:transcription-repair coupling factor >Feature sequence252 874 122 gene locus_tag LOCUS_19320 874 122 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085480.1 protein_id gnl|my_center|LOCUS_19320 2065 1007 gene locus_tag LOCUS_19330 2065 1007 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 protein_id gnl|my_center|LOCUS_19330 2887 2084 gene locus_tag LOCUS_19340 2887 2084 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_19340 <3752 2904 gene locus_tag LOCUS_19350 <3752 2904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225236.1:CoA transferase subunit A >Feature sequence253 <1 545 gene locus_tag LOCUS_19360 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269187.1:serine hydroxymethyltransferase 1526 564 gene locus_tag LOCUS_19370 1526 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1613 3598 gene locus_tag LOCUS_19380 1613 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence254 209 1108 gene locus_tag LOCUS_19390 gene xerD 209 1108 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 protein_id gnl|my_center|LOCUS_19390 1175 1930 gene locus_tag LOCUS_19400 1175 1930 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_19400 1963 3270 gene locus_tag LOCUS_19410 1963 3270 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence255 862 83 gene locus_tag LOCUS_19420 gene uppS 862 83 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113863.1 protein_id gnl|my_center|LOCUS_19420 1424 867 gene locus_tag LOCUS_19430 gene frr 1424 867 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 protein_id gnl|my_center|LOCUS_19430 2163 1441 gene locus_tag LOCUS_19440 gene pyrH 2163 1441 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554728.1 protein_id gnl|my_center|LOCUS_19440 3135 2272 gene locus_tag LOCUS_19450 gene tsf 3135 2272 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence256 <1 1758 gene locus_tag LOCUS_19460 <1 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267288.1:LTA synthase family protein 1811 3547 gene locus_tag LOCUS_19470 1811 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence257 61 654 gene locus_tag LOCUS_19480 61 654 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507786.1 protein_id gnl|my_center|LOCUS_19480 674 2014 gene locus_tag LOCUS_19490 674 2014 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597555.1 protein_id gnl|my_center|LOCUS_19490 3654 2083 gene locus_tag LOCUS_19500 3654 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence258 3 79 gene locus_tag LOCUS_t00130 3 79 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 195 476 gene locus_tag LOCUS_19510 195 476 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142851.1 protein_id gnl|my_center|LOCUS_19510 775 539 gene locus_tag LOCUS_19520 775 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 862 2352 gene locus_tag LOCUS_19530 862 2352 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970485.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence259 688 134 gene locus_tag LOCUS_19540 688 134 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_19540 1751 723 gene locus_tag LOCUS_19550 1751 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 <3619 1778 gene locus_tag LOCUS_19560 <3619 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403397.1:arylsulfatase AtsD >Feature sequence260 1663 842 gene locus_tag LOCUS_19570 1663 842 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_19570 2456 1752 gene locus_tag LOCUS_19580 2456 1752 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367829.1 protein_id gnl|my_center|LOCUS_19580 <3608 3009 gene locus_tag LOCUS_19590 <3608 3009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090915.1:protease HtpX >Feature sequence261 878 1189 gene locus_tag LOCUS_19600 878 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1193 2359 gene locus_tag LOCUS_19610 1193 2359 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878493.1 protein_id gnl|my_center|LOCUS_19610 2400 3419 gene locus_tag LOCUS_19620 2400 3419 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence262 2001 1210 gene locus_tag LOCUS_19630 gene gloB 2001 1210 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence263 38 679 gene locus_tag LOCUS_19640 gene coq7 38 679 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269103.1 protein_id gnl|my_center|LOCUS_19640 1104 691 gene locus_tag LOCUS_19650 1104 691 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_19650 1191 1925 gene locus_tag LOCUS_19660 gene crp 1191 1925 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_19660 2730 1927 gene locus_tag LOCUS_19670 gene trpC 2730 1927 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_19670 <3529 2727 gene locus_tag LOCUS_19680 <3529 2727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003316297.1:anthranilate phosphoribosyltransferase >Feature sequence264 2735 102 gene locus_tag LOCUS_19690 2735 102 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931042.1 protein_id gnl|my_center|LOCUS_19690 <3521 2732 gene locus_tag LOCUS_19700 <3521 2732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063891.1:DNA repair exonuclease >Feature sequence265 969 1409 gene locus_tag LOCUS_19710 969 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence266 157 2 gene locus_tag LOCUS_19720 gene rpmG 157 2 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551515.1 protein_id gnl|my_center|LOCUS_19720 419 183 gene locus_tag LOCUS_19730 gene rpmB 419 183 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048256.1 protein_id gnl|my_center|LOCUS_19730 1228 554 gene locus_tag LOCUS_19740 gene radC 1228 554 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_19740 1342 2559 gene locus_tag LOCUS_19750 gene coaBC 1342 2559 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence267 <1 1480 gene locus_tag LOCUS_19760 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158908668.1:HsdR family type I site-specific deoxyribonuclease 1633 1839 gene locus_tag LOCUS_19770 1633 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1985 1791 gene locus_tag LOCUS_19780 1985 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2111 3118 gene locus_tag LOCUS_19790 2111 3118 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence268 6 197 gene locus_tag LOCUS_19800 6 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 163 1332 gene locus_tag LOCUS_19810 gene rodA 163 1332 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114090.1 protein_id gnl|my_center|LOCUS_19810 1359 2357 gene locus_tag LOCUS_19820 gene mltB 1359 2357 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_19820 2354 3250 gene locus_tag LOCUS_19830 2354 3250 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence269 1127 489 gene locus_tag LOCUS_19840 gene pdxH 1127 489 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365910.1 protein_id gnl|my_center|LOCUS_19840 1870 1187 gene locus_tag LOCUS_19850 1870 1187 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404657.1 protein_id gnl|my_center|LOCUS_19850 2355 1945 gene locus_tag LOCUS_19860 2355 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2494 2769 gene locus_tag LOCUS_19870 2494 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2903 2694 gene locus_tag LOCUS_19880 2903 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence270 787 59 gene locus_tag LOCUS_19890 gene cysE 787 59 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 protein_id gnl|my_center|LOCUS_19890 1416 2138 gene locus_tag LOCUS_19900 1416 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2834 2145 gene locus_tag LOCUS_19910 2834 2145 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence271 >Feature sequence272 >Feature sequence273 2163 1099 gene locus_tag LOCUS_19920 2163 1099 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_19920 2409 2191 gene locus_tag LOCUS_19930 2409 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2341 2847 gene locus_tag LOCUS_19940 gene def 2341 2847 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence274 1542 904 gene locus_tag LOCUS_19950 1542 904 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_19950 2052 1552 gene locus_tag LOCUS_19960 gene mreD 2052 1552 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_19960 2927 2049 gene locus_tag LOCUS_19970 gene mreC 2927 2049 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence275 <1 767 gene locus_tag LOCUS_19980 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870273.1:type I restriction endonuclease subunit R 911 1687 gene locus_tag LOCUS_19990 911 1687 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038823.1 protein_id gnl|my_center|LOCUS_19990 2717 1734 gene locus_tag LOCUS_20000 2717 1734 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 protein_id gnl|my_center|LOCUS_20000 <3248 2714 gene locus_tag LOCUS_20010 <3248 2714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085654.1:ABC transporter ATP-binding protein >Feature sequence276 <1 1128 gene locus_tag LOCUS_20020 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268402.1:heme lyase CcmF/NrfE family subunit 1132 1665 gene locus_tag LOCUS_20030 gene dsbE 1132 1665 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083138.1 protein_id gnl|my_center|LOCUS_20030 1662 2132 gene locus_tag LOCUS_20040 1662 2132 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268400.1 protein_id gnl|my_center|LOCUS_20040 2129 2824 gene locus_tag LOCUS_20050 2129 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence277 286 516 gene locus_tag LOCUS_20060 286 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2977 569 gene locus_tag LOCUS_20070 2977 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence278 1802 231 gene locus_tag LOCUS_20080 1802 231 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113161.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence279 231 620 gene locus_tag LOCUS_20090 gene pilG 231 620 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_20090 630 1004 gene locus_tag LOCUS_20100 gene pilH 630 1004 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_20100 1001 1549 gene locus_tag LOCUS_20110 1001 1549 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105281.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence280 650 2284 gene locus_tag LOCUS_20120 650 2284 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036317.1 protein_id gnl|my_center|LOCUS_20120 2355 3062 gene locus_tag LOCUS_20130 2355 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence281 980 252 gene locus_tag LOCUS_20140 gene algR 980 252 CDS product alginate biosynthesis regulator AlgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096397.1 protein_id gnl|my_center|LOCUS_20140 2023 977 gene locus_tag LOCUS_20150 gene algZ 2023 977 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence282 133 714 gene locus_tag LOCUS_20160 133 714 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551457.1 protein_id gnl|my_center|LOCUS_20160 1997 753 gene locus_tag LOCUS_20170 1997 753 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 protein_id gnl|my_center|LOCUS_20170 2406 2092 gene locus_tag LOCUS_20180 2406 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2713 2399 gene locus_tag LOCUS_20190 2713 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3135 2710 gene locus_tag LOCUS_20200 3135 2710 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence283 <1 604 gene locus_tag LOCUS_20210 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186957.1:2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG 617 1489 gene locus_tag LOCUS_20220 617 1489 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_20220 1486 2352 gene locus_tag LOCUS_20230 1486 2352 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence284 641 132 gene locus_tag LOCUS_20240 641 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1950 643 gene locus_tag LOCUS_20250 1950 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2395 2931 gene locus_tag LOCUS_20260 2395 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence285 368 2170 gene locus_tag LOCUS_20270 gene ggt 368 2170 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_20270 2659 2174 gene locus_tag LOCUS_20280 gene rraA 2659 2174 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence286 1020 97 gene locus_tag LOCUS_20290 1020 97 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_20290 1118 1993 gene locus_tag LOCUS_20300 1118 1993 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159137.1 protein_id gnl|my_center|LOCUS_20300 2039 2620 gene locus_tag LOCUS_20310 2039 2620 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence287 109 1416 gene locus_tag LOCUS_20320 gene sufD 109 1416 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_20320 1413 2657 gene locus_tag LOCUS_20330 1413 2657 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence288 <1 1720 gene locus_tag LOCUS_20340 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919198.1:class I adenylate-forming enzyme family protein >Feature sequence289 <1 975 gene locus_tag LOCUS_20350 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087741.1:circularly permuted type 2 ATP-grasp protein 978 1928 gene locus_tag LOCUS_20360 978 1928 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378609.1 protein_id gnl|my_center|LOCUS_20360 1950 2807 gene locus_tag LOCUS_20370 1950 2807 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence290 266 1423 gene locus_tag LOCUS_20380 266 1423 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence291 931 287 gene locus_tag LOCUS_20390 931 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1863 928 gene locus_tag LOCUS_20400 1863 928 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064730.1 protein_id gnl|my_center|LOCUS_20400 2659 1853 gene locus_tag LOCUS_20410 2659 1853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence292 448 876 gene locus_tag LOCUS_20420 448 876 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971252.1 protein_id gnl|my_center|LOCUS_20420 907 1818 gene locus_tag LOCUS_20430 907 1818 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115256.1 protein_id gnl|my_center|LOCUS_20430 1878 2654 gene locus_tag LOCUS_20440 1878 2654 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence293 1233 598 gene locus_tag LOCUS_20450 gene hflD 1233 598 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090440.1 protein_id gnl|my_center|LOCUS_20450 2321 1230 gene locus_tag LOCUS_20460 gene mnmA 2321 1230 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 protein_id gnl|my_center|LOCUS_20460 2782 2318 gene locus_tag LOCUS_20470 2782 2318 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence294 2804 282 gene locus_tag LOCUS_20480 gene copA1 2804 282 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence295 1518 745 gene locus_tag LOCUS_20490 gene lpxH 1518 745 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 protein_id gnl|my_center|LOCUS_20490 2006 1515 gene locus_tag LOCUS_20500 2006 1515 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence296 162 1373 gene locus_tag LOCUS_20510 162 1373 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence297 <1 731 gene locus_tag LOCUS_20520 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054993407.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 728 1393 gene locus_tag LOCUS_20530 gene rsmG 728 1393 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367844.1 protein_id gnl|my_center|LOCUS_20530 1390 2229 gene locus_tag LOCUS_20540 gene soj 1390 2229 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence298 1550 3 gene locus_tag LOCUS_20550 1550 3 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_20550 1660 2535 gene locus_tag LOCUS_20560 1660 2535 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence299 913 1123 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgggtcggcattcatgccgac 2370 1135 gene locus_tag LOCUS_20570 2370 1135 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_20570 <2879 2373 gene locus_tag LOCUS_20580 <2879 2373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112841.1:type IV-A pilus assembly ATPase PilB >Feature sequence300 <1 560 gene locus_tag LOCUS_20590 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390984.1:MacB family efflux pump subunit 557 1972 gene locus_tag LOCUS_20600 gene ompQ 557 1972 CDS product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_20600 2098 2463 gene locus_tag LOCUS_20610 2098 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20610 2520 2726 gene locus_tag LOCUS_20620 2520 2726 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence301 439 675 gene locus_tag LOCUS_20630 gene cspD 439 675 CDS product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 protein_id gnl|my_center|LOCUS_20630 2464 767 gene locus_tag LOCUS_20640 2464 767 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence302 963 4 gene locus_tag LOCUS_20650 963 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1694 963 gene locus_tag LOCUS_20660 1694 963 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 protein_id gnl|my_center|LOCUS_20660 2686 1691 gene locus_tag LOCUS_20670 gene birA 2686 1691 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence303 <1 771 gene locus_tag LOCUS_20680 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158908668.1:HsdR family type I site-specific deoxyribonuclease 701 1495 gene locus_tag LOCUS_20690 701 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 <2790 1777 gene locus_tag LOCUS_20700 <2790 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269445.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence304 <1 607 gene locus_tag LOCUS_20710 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707199.1:DUF3450 domain-containing protein 604 1983 gene locus_tag LOCUS_20720 604 1983 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence305 <1 792 gene locus_tag LOCUS_20730 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_154223677.1:leucine--tRNA ligase 798 1310 gene locus_tag LOCUS_20740 gene lptE 798 1310 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659127.1 protein_id gnl|my_center|LOCUS_20740 1326 2327 gene locus_tag LOCUS_20750 gene holA 1326 2327 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence306 2538 1348 gene locus_tag LOCUS_20760 gene odhB 2538 1348 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence307 442 612 gene locus_tag LOCUS_20770 442 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 666 1865 gene locus_tag LOCUS_20780 666 1865 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_20780 1862 2155 gene locus_tag LOCUS_20790 1862 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2318 2142 gene locus_tag LOCUS_20800 2318 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20800 2608 2315 gene locus_tag LOCUS_20810 2608 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20810 >Feature sequence308 740 102 gene locus_tag LOCUS_20820 gene pnuC 740 102 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_20820 999 751 gene locus_tag LOCUS_20830 999 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2698 1010 gene locus_tag LOCUS_20840 2698 1010 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence309 448 44 gene locus_tag LOCUS_20850 448 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 991 515 gene locus_tag LOCUS_20860 991 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 <2683 1364 gene locus_tag LOCUS_20870 <2683 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114544.1:lipid A export permease/ATP-binding protein MsbA >Feature sequence310 569 120 gene locus_tag LOCUS_20880 569 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1270 569 gene locus_tag LOCUS_20890 gene tpiA 1270 569 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 protein_id gnl|my_center|LOCUS_20890 <2676 1412 gene locus_tag LOCUS_20900 <2676 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707078.1:phosphoglucosamine mutase >Feature sequence311 1349 561 gene locus_tag LOCUS_20910 1349 561 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_20910 1720 2124 gene locus_tag LOCUS_20920 1720 2124 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071286.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence312 1652 2359 gene locus_tag LOCUS_20930 1652 2359 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528645.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence313 1844 105 gene locus_tag LOCUS_20940 1844 105 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066137.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence314 2461 383 gene locus_tag LOCUS_20950 2461 383 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence315 2392 1886 gene locus_tag LOCUS_20960 2392 1886 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706148.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence316 1063 602 gene locus_tag LOCUS_20970 gene rlmH 1063 602 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313894.1 protein_id gnl|my_center|LOCUS_20970 1407 1063 gene locus_tag LOCUS_20980 gene rsfS 1407 1063 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098046.1 protein_id gnl|my_center|LOCUS_20980 2072 1404 gene locus_tag LOCUS_20990 gene nadD 2072 1404 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence317 1147 599 gene locus_tag LOCUS_21000 1147 599 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092999.1 protein_id gnl|my_center|LOCUS_21000 2264 1275 gene locus_tag LOCUS_21010 2264 1275 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence318 <1 823 gene locus_tag LOCUS_21020 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093161.1:HlyC/CorC family transporter 820 2325 gene locus_tag LOCUS_21030 gene lnt 820 2325 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence319 1739 1470 gene locus_tag LOCUS_21040 gene rpsO 1739 1470 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555121.1 protein_id gnl|my_center|LOCUS_21040 <2558 1888 gene locus_tag LOCUS_21050 <2558 1888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100522.1:tRNA pseudouridine(55) synthase TruB >Feature sequence320 364 1161 gene locus_tag LOCUS_21060 364 1161 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_21060 1972 1166 gene locus_tag LOCUS_21070 1972 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence321 901 221 gene locus_tag LOCUS_21080 901 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1549 917 gene locus_tag LOCUS_21090 1549 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 1669 2475 gene locus_tag LOCUS_21100 1669 2475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827758.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence322 371 910 gene locus_tag LOCUS_21110 gene folA 371 910 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_21110 987 1742 gene locus_tag LOCUS_21120 987 1742 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence323 1569 520 gene locus_tag LOCUS_21130 1569 520 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730974.1 protein_id gnl|my_center|LOCUS_21130 <2513 1580 gene locus_tag LOCUS_21140 <2513 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225245.1:acyl-CoA dehydrogenase family protein >Feature sequence324 358 1641 gene locus_tag LOCUS_21150 gene hemL 358 1641 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_21150 <2503 1678 gene locus_tag LOCUS_21160 <2503 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707291.1:UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase >Feature sequence325 <1 2102 gene locus_tag LOCUS_21170 <1 2102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000233452.1:DEAD/DEAH box helicase family protein >Feature sequence326 >Feature sequence327 84 1103 gene locus_tag LOCUS_21180 84 1103 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_21180 1109 1717 gene locus_tag LOCUS_21190 1109 1717 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_21190 1708 2265 gene locus_tag LOCUS_21200 1708 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence328 >Feature sequence329 803 180 gene locus_tag LOCUS_21210 gene coaE 803 180 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770017.1 protein_id gnl|my_center|LOCUS_21210 2248 836 gene locus_tag LOCUS_21220 2248 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence330 <1 723 gene locus_tag LOCUS_21230 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085445.1:tetratricopeptide repeat protein 2066 744 gene locus_tag LOCUS_21240 2066 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence331 1697 765 gene locus_tag LOCUS_21250 1697 765 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133037023.1 protein_id gnl|my_center|LOCUS_21250 <2404 1681 gene locus_tag LOCUS_21260 <2404 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210326921.1:type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein >Feature sequence332 2185 827 gene locus_tag LOCUS_21270 2185 827 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence333 <2390 771 gene locus_tag LOCUS_21280 <2390 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539668.1:3-(methylthio)propionyl-CoA ligase >Feature sequence334 566 1303 gene locus_tag LOCUS_21290 566 1303 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence335 2 961 gene locus_tag LOCUS_21300 gene meaB 2 961 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_21300 1804 992 gene locus_tag LOCUS_21310 1804 992 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382474.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence336 101 1471 gene locus_tag LOCUS_21320 gene rseP 101 1471 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence337 1442 372 gene locus_tag LOCUS_21330 1442 372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626382.1 protein_id gnl|my_center|LOCUS_21330 <2347 1508 gene locus_tag LOCUS_21340 <2347 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102062.1:DNA topoisomerase IV subunit B >Feature sequence338 2 1477 gene locus_tag LOCUS_21350 2 1477 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_21350 1483 2064 gene locus_tag LOCUS_21360 1483 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence339 1613 612 gene locus_tag LOCUS_21370 gene ribF 1613 612 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769259.1 protein_id gnl|my_center|LOCUS_21370 2039 1626 gene locus_tag LOCUS_21380 2039 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence340 143 376 gene locus_tag LOCUS_21390 143 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 384 1376 gene locus_tag LOCUS_21400 gene aitP 384 1376 CDS product CDF family iron/cobalt efflux transporter AitP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112362.1 protein_id gnl|my_center|LOCUS_21400 1854 1699 gene locus_tag LOCUS_21410 1854 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2183 1851 gene locus_tag LOCUS_21420 2183 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence341 2074 554 gene locus_tag LOCUS_21430 2074 554 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence342 <1 1447 gene locus_tag LOCUS_21440 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092366.1:CTP synthase >Feature sequence343 332 1219 gene locus_tag LOCUS_21450 332 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1766 1374 gene locus_tag LOCUS_21460 1766 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence344 122 643 gene locus_tag LOCUS_21470 122 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 697 1227 gene locus_tag LOCUS_21480 697 1227 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859521.1 protein_id gnl|my_center|LOCUS_21480 2204 1209 gene locus_tag LOCUS_21490 2204 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence345 681 214 gene locus_tag LOCUS_21500 681 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 919 641 gene locus_tag LOCUS_21510 919 641 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085532.1 protein_id gnl|my_center|LOCUS_21510 999 1955 gene locus_tag LOCUS_21520 999 1955 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622187.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence346 939 169 gene locus_tag LOCUS_21530 gene fabG 939 169 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770626.1 protein_id gnl|my_center|LOCUS_21530 1870 923 gene locus_tag LOCUS_21540 gene fabD 1870 923 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191346.1 protein_id gnl|my_center|LOCUS_21540 2143 1964 gene locus_tag LOCUS_21550 gene rpmF 2143 1964 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300935.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence347 2154 1114 gene locus_tag LOCUS_21560 2154 1114 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence348 316 2040 gene locus_tag LOCUS_21570 316 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence349 <1 582 gene locus_tag LOCUS_21580 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094113.1:cell division protein FtsZ 698 1603 gene locus_tag LOCUS_21590 gene lpxC 698 1603 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377651.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence350 576 103 gene locus_tag LOCUS_21600 576 103 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence351 <2131 1405 gene locus_tag LOCUS_21610 <2131 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958613.1:methionine adenosyltransferase >Feature sequence352 268 711 gene locus_tag LOCUS_21620 gene aroQ 268 711 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_21620 732 1199 gene locus_tag LOCUS_21630 gene accB 732 1199 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence353 <1 626 gene locus_tag LOCUS_21640 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029883606.1:16S rRNA (guanine(966)-N(2))-methyltransferase 751 1236 gene locus_tag LOCUS_21650 gene coaD 751 1236 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 protein_id gnl|my_center|LOCUS_21650 1596 1276 gene locus_tag LOCUS_21660 1596 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence354 >Feature sequence355 977 48 gene locus_tag LOCUS_21670 gene ilvE 977 48 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_21670 <2092 974 gene locus_tag LOCUS_21680 <2092 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114555.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase >Feature sequence356 61 1140 gene locus_tag LOCUS_21690 61 1140 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence357 1154 609 gene locus_tag LOCUS_21700 gene rimM 1154 609 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_21700 1421 1164 gene locus_tag LOCUS_21710 gene rpsP 1421 1164 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence358 1393 518 gene locus_tag LOCUS_21720 gene ccoP 1393 518 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 protein_id gnl|my_center|LOCUS_21720 1556 1386 gene locus_tag LOCUS_21730 1556 1386 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087298.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence359 998 297 gene locus_tag LOCUS_21740 gene purN 998 297 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_21740 2037 988 gene locus_tag LOCUS_21750 gene purM 2037 988 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706623.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence360 786 1565 gene locus_tag LOCUS_21760 786 1565 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence361 1699 1118 gene locus_tag LOCUS_21770 1699 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence362 219 1217 gene locus_tag LOCUS_21780 219 1217 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence363 344 619 gene locus_tag LOCUS_21790 344 619 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705994.1 protein_id gnl|my_center|LOCUS_21790 613 978 gene locus_tag LOCUS_21800 613 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1945 971 gene locus_tag LOCUS_21810 gene cysK 1945 971 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072812.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence364 1611 163 gene locus_tag LOCUS_21820 gene gatB 1611 163 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence365 192 968 gene locus_tag LOCUS_21830 192 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1062 1541 gene locus_tag LOCUS_21840 1062 1541 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074234.1 protein_id gnl|my_center|LOCUS_21840 1558 1797 gene locus_tag LOCUS_21850 1558 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence366 910 278 gene locus_tag LOCUS_21860 910 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 <1938 1082 gene locus_tag LOCUS_21870 <1938 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057028.1:phosphoketolase family protein >Feature sequence367 656 258 gene locus_tag LOCUS_21880 gene rbfA 656 258 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_21880 <1933 678 gene locus_tag LOCUS_21890 <1933 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003377503.1:translation initiation factor IF-2 >Feature sequence368 1230 148 gene locus_tag LOCUS_21900 gene mraY 1230 148 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_21900 <1933 1230 gene locus_tag LOCUS_21910 <1933 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268847.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence369 1670 351 gene locus_tag LOCUS_21920 1670 351 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence370 >Feature sequence371 301 377 gene locus_tag LOCUS_t00140 301 377 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence372 >Feature sequence373 116 763 gene locus_tag LOCUS_21930 116 763 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_21930 885 1625 gene locus_tag LOCUS_21940 885 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence374 1209 139 gene locus_tag LOCUS_21950 gene corA 1209 139 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence375 1065 322 gene locus_tag LOCUS_21960 1065 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 <1800 1088 gene locus_tag LOCUS_21970 <1800 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980887.1:2-isopropylmalate synthase >Feature sequence376 <1790 816 gene locus_tag LOCUS_21980 <1790 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113983.1:Na(+)-translocating NADH-quinone reductase subunit A >Feature sequence377 746 111 gene locus_tag LOCUS_21990 746 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1647 799 gene locus_tag LOCUS_22000 1647 799 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706839.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence378 244 1725 gene locus_tag LOCUS_22010 gene sbcB 244 1725 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence379 132 1037 gene locus_tag LOCUS_22020 gene argF 132 1037 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412919.1 protein_id gnl|my_center|LOCUS_22020 <1762 1156 gene locus_tag LOCUS_22030 <1762 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003101982.1:endopeptidase La >Feature sequence380 <1 536 gene locus_tag LOCUS_22040 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104143.1:23S rRNA pseudouridine(955/2504/2580) synthase RluC 533 1210 gene locus_tag LOCUS_22050 533 1210 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_22050 <1760 1226 gene locus_tag LOCUS_22060 <1760 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206817289.1:nucleoside triphosphate pyrophosphatase >Feature sequence381 338 754 gene locus_tag LOCUS_22070 338 754 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_22070 759 1028 gene locus_tag LOCUS_22080 gene grxC 759 1028 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096057.1 protein_id gnl|my_center|LOCUS_22080 1077 1544 gene locus_tag LOCUS_22090 gene secB 1077 1544 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372189.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence382 <1742 515 gene locus_tag LOCUS_22100 <1742 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103493.1:valine--tRNA ligase >Feature sequence383 1028 1516 gene locus_tag LOCUS_22110 1028 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence384 <1731 936 gene locus_tag LOCUS_22120 <1731 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005093260.1:wax ester/triacylglycerol synthase family O-acyltransferase >Feature sequence385 <1 957 gene locus_tag LOCUS_22130 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522103.1:FMN-binding glutamate synthase family protein >Feature sequence386 1635 145 gene locus_tag LOCUS_22140 1635 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence387 1305 877 gene locus_tag LOCUS_22150 1305 877 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence388 118 1329 gene locus_tag LOCUS_22160 118 1329 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771340.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence389 1524 88 gene locus_tag LOCUS_22170 1524 88 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819824.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence390 40 840 gene locus_tag LOCUS_22180 40 840 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103549.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence391 >Feature sequence392 1496 1017 gene locus_tag LOCUS_22190 gene phnB 1496 1017 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence393 234 310 gene locus_tag LOCUS_t00150 234 310 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 380 859 gene locus_tag LOCUS_22200 gene bsaA 380 859 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219440.1 protein_id gnl|my_center|LOCUS_22200 <1605 948 gene locus_tag LOCUS_22210 <1605 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003396266.1:peptide chain release factor 3 >Feature sequence394 484 146 gene locus_tag LOCUS_22220 gene glnK 484 146 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_22220 1255 536 gene locus_tag LOCUS_22230 1255 536 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920508.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence395 1037 408 gene locus_tag LOCUS_22240 1037 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence396 >Feature sequence397 <1 1281 gene locus_tag LOCUS_22250 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_194931144.1:methionine synthase >Feature sequence398 <1527 359 gene locus_tag LOCUS_22260 <1527 359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007244213.1:lipoprotein-releasing ABC transporter permease subunit >Feature sequence399 <1524 444 gene locus_tag LOCUS_22270 <1524 444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097681.1:NADH-quinone oxidoreductase subunit L >Feature sequence400 609 379 gene locus_tag LOCUS_22280 609 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence401 <1 662 gene locus_tag LOCUS_22290 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005079346.1:FAD-binding protein >Feature sequence402 161 1024 gene locus_tag LOCUS_22300 gene atpG 161 1024 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence403 <1502 449 gene locus_tag LOCUS_22310 <1502 449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086450.1:sensor histidine kinase FleS >Feature sequence404 <1 510 gene locus_tag LOCUS_22320 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391312.1:rhomboid family intramembrane serine protease >Feature sequence405 265 47 gene locus_tag LOCUS_22330 265 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 600 1193 gene locus_tag LOCUS_22340 600 1193 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence406 201 632 gene locus_tag LOCUS_22350 201 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence407 824 279 gene locus_tag LOCUS_22360 gene rfbC 824 279 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185665.1 protein_id gnl|my_center|LOCUS_22360 <1413 824 gene locus_tag LOCUS_22370 <1413 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002364387.1:glucose-1-phosphate thymidylyltransferase RfbA >Feature sequence408 <1 631 gene locus_tag LOCUS_22380 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770616.1:dTMP kinase >Feature sequence409 >Feature sequence410 >Feature sequence411 766 245 gene locus_tag LOCUS_22390 766 245 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_22390 <1354 759 gene locus_tag LOCUS_22400 <1354 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459330.1:MotA/TolQ/ExbB proton channel family protein >Feature sequence412 2 334 gene locus_tag LOCUS_22410 2 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 485 1078 gene locus_tag LOCUS_22420 gene gmhA 485 1078 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194315.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence413 >Feature sequence414 >Feature sequence415 584 96 gene locus_tag LOCUS_22430 584 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 <1312 626 gene locus_tag LOCUS_22440 <1312 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804205.1:SDR family oxidoreductase >Feature sequence416 >Feature sequence417 >Feature sequence418 >Feature sequence419 >Feature sequence420 <1 814 gene locus_tag LOCUS_22450 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011787323.1:tetratricopeptide repeat protein >Feature sequence421 <1 864 gene locus_tag LOCUS_22460 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000628943.1:preprotein translocase subunit SecA >Feature sequence422 >Feature sequence423 >Feature sequence424 >Feature sequence425 1 510 gene locus_tag LOCUS_22470 1 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence426 >Feature sequence427 >Feature sequence428 <803 191 gene locus_tag LOCUS_22480 <803 191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243259.1:assimilatory sulfite reductase (NADPH) flavoprotein subunit >Feature sequence429 >Feature sequence430 >Feature sequence431 346 421 gene locus_tag LOCUS_t00160 346 421 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence432 >Feature sequence433 >Feature sequence434 >Feature sequence435 >Feature sequence436 >Feature sequence437 >Feature sequence438 >Feature sequence439 >Feature sequence440 676 527 gene locus_tag LOCUS_22490 676 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence441 >Feature sequence442 <1 583 gene locus_tag LOCUS_22500 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962729.1:cytochrome c peroxidase >Feature sequence443 >Feature sequence444 >Feature sequence445 >Feature sequence446 >Feature sequence447 <656 136 gene locus_tag LOCUS_22510 <656 136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815636.1:thiolase family protein >Feature sequence448 >Feature sequence449 >Feature sequence450 3 605 gene locus_tag LOCUS_22520 3 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence451 >Feature sequence452 >Feature sequence453 >Feature sequence454 >Feature sequence455 >Feature sequence456 >Feature sequence457 >Feature sequence458 <1 527 gene locus_tag LOCUS_22530 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727561.1:DUF4194 domain-containing protein >Feature sequence459 <634 15 gene locus_tag LOCUS_22540 <634 15 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207642.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase >Feature sequence460 >Feature sequence461 >Feature sequence462 >Feature sequence463 >Feature sequence464 >Feature sequence465 >Feature sequence466 >Feature sequence467 >Feature sequence468 286 360 gene locus_tag LOCUS_t00170 286 360 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence469 >Feature sequence470 >Feature sequence471 >Feature sequence472 82 603 gene locus_tag LOCUS_22550 82 603 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888135.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence473 158 565 gene locus_tag LOCUS_22560 158 565 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066815.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence474 >Feature sequence475 87 174 gene locus_tag LOCUS_t00180 87 174 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 182 259 gene locus_tag LOCUS_t00190 182 259 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 267 342 gene locus_tag LOCUS_t00200 267 342 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 403 478 gene locus_tag LOCUS_t00210 403 478 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence476 >Feature sequence477 >Feature sequence478 <607 24 gene locus_tag LOCUS_22570 <607 24 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230190.1:ABC transporter permease >Feature sequence479 355 280 gene locus_tag LOCUS_t00220 355 280 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence480 >Feature sequence481 >Feature sequence482 2 583 gene locus_tag LOCUS_22580 2 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence483 >Feature sequence484 >Feature sequence485 >Feature sequence486 >Feature sequence487 >Feature sequence488 >Feature sequence489 44 295 gene locus_tag LOCUS_22590 44 295 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163544.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence490 >Feature sequence491 >Feature sequence492 >Feature sequence493 >Feature sequence494 >Feature sequence495 >Feature sequence496 >Feature sequence497 >Feature sequence498 >Feature sequence499 >Feature sequence500 >Feature sequence501 >Feature sequence502 <1 517 gene locus_tag LOCUS_22600 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947367.1:TMEM165/GDT1 family protein >Feature sequence503 >Feature sequence504 >Feature sequence505 >Feature sequence506 >Feature sequence507 >Feature sequence508 >Feature sequence509 >Feature sequence510 >Feature sequence511 >Feature sequence512 >Feature sequence513 >Feature sequence514 555 94 gene locus_tag LOCUS_22610 555 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence515 >Feature sequence516 >Feature sequence517 >Feature sequence518 >Feature sequence519 >Feature sequence520 >Feature sequence521 166 242 gene locus_tag LOCUS_t00230 166 242 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence522 >Feature sequence523 >Feature sequence524 >Feature sequence525 >Feature sequence526 >Feature sequence527 >Feature sequence528 >Feature sequence529 >Feature sequence530 >Feature sequence531 >Feature sequence532 >Feature sequence533 518 195 gene locus_tag LOCUS_22620 518 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence534 1 231 gene locus_tag LOCUS_22630 1 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence535 >Feature sequence536 >Feature sequence537 >Feature sequence538 >Feature sequence539 >Feature sequence540 >Feature sequence541